Mercurial > repos > drosofff > msp_sr_readmap_and_size_histograms
annotate readmap.xml @ 3:f6dc63230483 draft
planemo upload for repository https://bitbucket.org/drosofff/gedtools/
author | mvdbeek |
---|---|
date | Sun, 21 Jun 2015 16:50:56 -0400 |
parents | 4895f7c6ae4d |
children | dffa22efc6a8 |
rev | line source |
---|---|
3
f6dc63230483
planemo upload for repository https://bitbucket.org/drosofff/gedtools/
mvdbeek
parents:
2
diff
changeset
|
1 <tool id="Readmap" name="Generate readmap and histograms from alignment files" version="1.0.2"> |
0 | 2 <description>from sRbowtie aligment</description> |
3 <requirements> | |
4 <requirement type="package" version="0.12.7">bowtie</requirement> | |
5 <requirement type="package" version="0.1.18">samtools</requirement> | |
6 <requirement type="package" version="0.7.7">pysam</requirement> | |
7 <requirement type="package" version="2.14">biocbasics</requirement> | |
1 | 8 <requirement type="package" version="1.9">numpy</requirement> |
0 | 9 </requirements> |
10 <command interpreter="python"> | |
11 readmap.py | |
12 #if $refGenomeSource.genomeSource == "history": | |
13 --reference_fasta ## sys.argv[2] | |
14 $refGenomeSource.ownFile ## index source | |
15 #else: | |
16 #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] | |
17 --reference_bowtie_index | |
18 $reference | |
19 #end if | |
20 --rcode | |
21 $plotCode | |
22 --output_readmap | |
23 $readmap_dataframe | |
24 --output_size_distribution | |
25 $size_distribution_dataframe | |
26 --minquery | |
27 $minquery | |
28 --maxquery | |
29 $maxquery | |
30 --input | |
31 #for $i in $refGenomeSource.series | |
32 $i.input | |
33 #end for | |
34 --ext | |
35 #for $i in $refGenomeSource.series | |
36 $i.input.ext | |
37 #end for | |
38 --label | |
39 #for $i in $refGenomeSource.series | |
40 "$i.input.name" | |
41 #end for | |
42 --normalization_factor | |
43 #for $i in $refGenomeSource.series | |
44 $i.norm | |
45 #end for | |
46 #if $gff: | |
47 --gff | |
48 $gff | |
49 #end if | |
50 | |
51 </command> | |
52 <inputs> | |
53 <conditional name="refGenomeSource"> | |
54 <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> | |
55 <option value="indexed">Use a built-in index</option> | |
56 <option value="history">Use one from the history</option> | |
57 </param> | |
58 <when value="indexed"> | |
59 <repeat name="series" title="Add alignment files"> | |
60 <param name="input" type="data" label="Select multiple alignments to parse"> | |
61 <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> | |
62 </param> | |
63 <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> | |
64 </repeat> | |
65 </when> | |
66 <when value="history"> | |
67 <param name="ownFile" type="data" format="fasta" label="Select a fasta file, that served as the reference index for the alignments" /> | |
68 <repeat name="series" title="Add alignment files"> | |
69 <param name="input" type="data" label="Select multiple alignments to parse"/> | |
70 <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> | |
71 </repeat> | |
72 </when> | |
73 </conditional> | |
74 <param name="gff" type="data" format="gff3" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> | |
75 <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> | |
76 <param name="minquery" type="integer" size="3" value="18" label="Min size of query small RNAs" help="'18' = 18 nucleotides"/> | |
77 <param name="maxquery" type="integer" size="3" value="28" label="Max size of query small RNAs" help="'28' = 28 nucleotides"/> | |
78 <param name="title" type="text" size="15" value= "Readmaps and size distributions" label="Main Titles"/> | |
79 <param name="xlabel" type="text" size="15" value="Coordinates/read size" label="x axis label"/> | |
80 <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> | |
81 <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> | |
82 <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> | |
83 </param> | |
84 </inputs> | |
85 <configfiles> | |
86 <configfile name="plotCode"> | |
87 ## Setup R error handling to go to stderr | |
88 options( show.error.messages=F, | |
89 error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) | |
90 library(RColorBrewer) | |
91 library(lattice) | |
92 library(latticeExtra) | |
93 library(grid) | |
94 library(gridExtra) | |
95 | |
96 ## data frames implementation | |
97 | |
98 rm=read.delim("${readmap_dataframe}", header=T, row.names=NULL) | |
99 n_samples=length(unique(rm\$sample)) | |
100 genes=unique(levels(rm\$gene)) | |
101 per_gene_readmap=lapply(genes, function(x) subset(rm, gene==x)) ####### ? | |
102 n_genes=length(per_gene_readmap) | |
103 | |
104 size=read.delim("${size_distribution_dataframe}", header=T, row.names=NULL) | |
105 per_gene_size=lapply(genes, function(x) subset(size, gene==x)) ###### ? | |
106 | |
107 ## end of data frames implementation | |
108 | |
109 ## functions | |
110 | |
111 plot_readmap=function(df, ...) { | |
112 combineLimits(xyplot(count~coord|factor(sample, levels=unique(sample))+reorder(gene, count, function(x) -sum(abs(x))), | |
113 data=df, | |
114 type='h', | |
115 scales= list(relation="free", x=list(rot=0, cex=0.7, axs="i", tck=0.5), y=list(tick.number=4, rot=90, cex=0.7)), | |
116 xlab=NULL, main=NULL, ylab=NULL, | |
117 as.table=T, | |
118 origin = 0, | |
119 horizontal=FALSE, | |
120 group=polarity, | |
121 col=c("red","blue"), | |
122 par.strip.text = list(cex=0.7), | |
123 ...)) | |
124 } | |
125 | |
126 plot_size_distribution= function(df, ...) { | |
127 smR.prepanel=function(x,y,...){; yscale=c(-max(abs(y)), max(abs(y)));list(ylim=yscale);} | |
128 bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample))+gene, data = df, origin = 0, | |
129 horizontal=FALSE, | |
130 group=polarity, | |
131 stack=TRUE, | |
132 col=c('red', 'blue'), | |
133 cex=0.75, | |
134 scales=list(y=list(tick.number=4, rot=90, relation="free", cex=0.7), x=list(cex=0.7) ), | |
135 prepanel=smR.prepanel, | |
136 xlab = NULL, | |
137 ylab = NULL, | |
138 main = NULL, | |
139 as.table=TRUE, | |
140 newpage = T, | |
141 par.strip.text = list(cex=0.7), | |
142 ...) | |
143 combineLimits(bc) | |
144 } | |
145 | |
146 ## end of functions | |
147 | |
148 ## function parameters' | |
149 | |
150 par.settings.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-2.5), strip.background = list(col=c("lightblue","lightgreen")) ) | |
151 par.settings.size=list(layout.heights=list(top.padding=-1, bottom.padding=-2.5), strip.background = list(col=c("lightblue","lightgreen")) ) | |
152 par.settings.combination.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-3), strip.background=list(col=c("lightblue","lightgreen")) ) | |
153 par.settings.combination.size=list(layout.heights=list(top.padding=-2, bottom.padding=-0.5), strip.background=list(col=c("lightblue", "lightgreen")) ) | |
154 | |
155 ## end of function parameters' | |
156 | |
157 ## GRAPHS | |
158 | |
159 if (n_genes > 7) {page_height_simple = 11.69; page_height_combi=11.69; rows_per_page=${rows_per_page}; extrarow=0 } else { | |
160 rows_per_page= n_genes; page_height_simple = 11.69/n_genes/4; page_height_combi=11.69/(n_genes*2); extrarow=1 } | |
161 if (n_samples > 4) {page_width = 8.2677*n_samples/4} else {page_width = 8.2677*n_samples/3} # to test | |
162 | |
163 pdf(file="${readmap_PDF}", paper="special", height=page_height_simple, width=page_width) | |
164 for (i in seq(1,n_genes,rows_per_page)) { | |
165 start=i | |
166 end=i+rows_per_page-1 | |
167 if (end>n_genes) {end=n_genes} | |
168 readmap_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.readmap)) | |
169 args.list=c(readmap_plot.list, list(nrow=rows_per_page, ncol=1, | |
170 main=textGrob("Read Maps (nucleotide coordinates)", gp=gpar(cex=1), just="top"), | |
171 left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90) | |
172 #sub=textGrob("readmap coordinates", gp=gpar(cex=.75), just="bottom") | |
173 ) | |
174 ) | |
175 do.call(grid.arrange, args.list) | |
176 } | |
177 devname=dev.off() | |
178 | |
179 | |
180 pdf(file="${size_PDF}", paper="special", height=page_height_simple, width=page_width) | |
181 for (i in seq(1,n_genes,rows_per_page)) { | |
182 start=i | |
183 end=i+rows_per_page-1 | |
184 if (end>n_genes) {end=n_genes} | |
185 plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, par.settings=par.settings.size) ) | |
186 args.list=c(plot.list, list(nrow=rows_per_page, ncol=1, | |
187 main=textGrob("Size distributions (in nucleotides)", gp=gpar(cex=1), just="top"), | |
188 left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90) | |
189 #sub="readsize in nucleotides" | |
190 ) | |
191 ) | |
192 do.call(grid.arrange, args.list) | |
193 } | |
194 devname=dev.off() | |
195 | |
196 pdf(file="${combi_PDF}", paper="special", height=page_height_combi, width=page_width) | |
197 for (i in seq(1,n_genes,rows_per_page/2)) { | |
198 start=i | |
199 end=i+rows_per_page/2-1 | |
200 if (end>n_genes) {end=n_genes} | |
201 read_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.combination.readmap)) | |
202 size_plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, strip=FALSE, par.settings=par.settings.combination.size)) | |
203 plot.list=rbind(read_plot.list, size_plot.list ) | |
204 args.list=c(plot.list, list(nrow=rows_per_page + extrarow, ncol=1, | |
205 main=textGrob("${title}", gp=gpar(cex=1), just="top"), | |
206 left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90), | |
207 sub=textGrob("${xlabel}", gp=gpar(cex=1), just="bottom") | |
208 ) | |
209 ) | |
210 do.call(grid.arrange, args.list) | |
211 } | |
212 devname=dev.off() | |
213 | |
214 | |
215 </configfile> | |
216 </configfiles> | |
217 | |
218 <outputs> | |
219 <data format="tabular" name="readmap_dataframe" label="Readmap dataframe"/> | |
220 <data format="tabular" name="size_distribution_dataframe" label="Size distribution dataframe"/> | |
221 <data format="pdf" name="readmap_PDF" label="Readmaps"/> | |
222 <data format="pdf" name="size_PDF" label="Size distribution"/> | |
223 <data format="pdf" name="combi_PDF" label="Size distribution and Readmaps"/> | |
224 </outputs> | |
225 <help> | |
226 | |
227 **What it does** | |
228 | |
229 Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a "Readmap", | |
230 where by default for each "chromosome" the position of the read is recorded on the x-axis, and the y-axis indicates | |
231 the number of reads per position. Reads that map in sense are on the top, reads that map antisense are on the bottom. | |
232 | |
233 | |
234 .. class:: warningmark | |
235 | |
236 '''TIP''' The input data can be produced using the sRbowtie tool. | |
237 | |
238 ---- | |
239 | |
240 '''Example''' | |
241 | |
242 Query sequence:: | |
243 For a SAM file as the following: | |
244 | |
245 5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 | |
246 | |
247 11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 | |
248 | |
249 2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 | |
250 | |
251 produce a plot like this: | |
252 | |
253 ---- | |
254 | |
255 .. image:: static/images/readmap.png | |
256 :height: 800 | |
257 :width: 500 | |
258 | |
259 </help> | |
1 | 260 <tests> |
0 | 261 <test> |
262 <param name="genomeSource" value="history" /> | |
263 <param name="ownFile" value ="transposons.fasta" ftype="fasta" /> | |
1 | 264 <param name="series_0|input" value="sample1.srbowtie_out" ftype="tabular"/> |
265 <param name="series_0|norm" value="1" /> | |
266 <param name="series_1|input" value="sample2.srbowtie_out" ftype="tabular"/> | |
267 <param name="series_1|norm" value="1" /> | |
268 <param name="series_2|input" value="sample3.srbowtie_out" ftype="tabular"/> | |
269 <param name="series_2|norm" value="1" /> | |
0 | 270 <param name="minquery" value="20" /> |
271 <param name="maxquery" value="30" /> | |
272 <param name="title" value="Readmaps and size distributions" /> | |
273 <param name="xlabel" value="Coordinates/read size" /> | |
274 <param name="ylabel" value="Number of reads" /> | |
275 <param name="rows_per_page" value="8" /> | |
1 | 276 <output name="readmap_dataframe" ftype="tabular" file="Readmap_dataframe.tab" /> |
277 <output name="size_distribution_dataframe" ftype="tabular" file="Size_distribution_dataframe.tab" /> | |
278 <output name="readmap_PDF" ftype="pdf" file="Readmaps.pdf" /> | |
279 <output name="size_PDF" ftype="pdf" file="Size_distribution.pdf" /> | |
280 <output name="combi_PDF" ftype="pdf" file="Size_distribution_and_Readmaps.pdf" /> | |
0 | 281 </test> |
1 | 282 </tests> |
0 | 283 </tool> |