diff readmap.xml @ 0:9af9983dcd02 draft

Imported from capsule None
author drosofff
date Mon, 03 Nov 2014 10:28:40 -0500
parents
children eee9701a7491
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/readmap.xml	Mon Nov 03 10:28:40 2014 -0500
@@ -0,0 +1,280 @@
+<tool id="Readmap" name="Generate readmap and histograms from alignment files" version="1.0.0">
+  <description>from sRbowtie aligment</description>
+  <requirements>
+        <requirement type="package" version="0.12.7">bowtie</requirement>
+        <requirement type="package" version="0.1.18">samtools</requirement>
+        <requirement type="package" version="0.7.7">pysam</requirement>
+        <requirement type="package" version="2.14">biocbasics</requirement>
+        <requirement type="package" version="3.0.3">R</requirement>
+  </requirements>
+  <parallelism method="basic"></parallelism>
+<command interpreter="python">
+        readmap.py 
+	          #if $refGenomeSource.genomeSource == "history":
+         	    --reference_fasta  ## sys.argv[2]
+                    $refGenomeSource.ownFile ## index source
+          	  #else:
+                    #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1]
+		    --reference_bowtie_index
+                    $reference
+          	  #end if
+		  --rcode
+		  $plotCode
+		  --output_readmap
+		  $readmap_dataframe
+		  --output_size_distribution
+		  $size_distribution_dataframe
+		  --minquery
+		  $minquery
+		  --maxquery
+		  $maxquery
+		  --input
+		  #for $i in $refGenomeSource.series
+    		    $i.input 
+		  #end for
+		  --ext
+		  #for $i in $refGenomeSource.series
+    		    $i.input.ext 
+		  #end for
+		  --label
+		  #for $i in $refGenomeSource.series
+    		    "$i.input.name" 
+		  #end for
+		  --normalization_factor
+		  #for $i in $refGenomeSource.series
+    		    $i.norm
+		  #end for
+		  #if $gff:
+		    --gff
+                    $gff
+                  #end if
+
+</command>
+  <inputs>
+       <conditional name="refGenomeSource">
+           <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+               <option value="indexed">Use a built-in index</option>
+               <option value="history">Use one from the history</option>
+           </param>
+           <when value="indexed">
+	     <repeat name="series" title="Add alignment files">
+	       <param name="input" type="data" label="Select multiple alignments to parse">
+                  <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/>
+               </param>
+	       <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/>
+	     </repeat>
+           </when>
+           <when value="history">
+             <param name="ownFile" type="data" format="fasta" label="Select a fasta file, that served as the reference index for the alignments" />
+	     <repeat name="series" title="Add alignment files">
+	       <param name="input" type="data" label="Select multiple alignments to parse"/>
+	       <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/>
+	     </repeat>
+	   </when>
+       </conditional>
+                <param name="gff" type="data" format="gff3" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/>
+                 <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> -->
+                <param name="minquery" type="integer" size="3" value="18" label="Min size of query small RNAs" help="'18' = 18 nucleotides"/>
+                <param name="maxquery" type="integer" size="3" value="28" label="Max size of query small RNAs" help="'28' = 28 nucleotides"/>
+                <param name="title" type="text" size="15" value= "Readmaps and size distributions" label="Main Titles"/>
+                <param name="xlabel" type="text" size="15" value="Coordinates/read size" label="x axis label"/>
+                <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/>
+                <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?">
+		  <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/>
+                </param>
+  </inputs>
+   <configfiles>
+     <configfile name="plotCode">
+      ## Setup R error handling to go to stderr
+      options( show.error.messages=F,
+               error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } )
+      library(RColorBrewer)
+      library(lattice)
+      library(latticeExtra)
+      library(grid)
+      library(gridExtra)
+      
+      ## data frames implementation
+
+      rm=read.delim("${readmap_dataframe}", header=T, row.names=NULL)
+      n_samples=length(unique(rm\$sample))
+      genes=unique(levels(rm\$gene))
+      per_gene_readmap=lapply(genes, function(x) subset(rm, gene==x)) ####### ?
+      n_genes=length(per_gene_readmap)
+      
+      size=read.delim("${size_distribution_dataframe}", header=T, row.names=NULL)
+      per_gene_size=lapply(genes, function(x) subset(size, gene==x)) ###### ?
+
+      ## end of data frames implementation
+      
+      ## functions
+      
+      plot_readmap=function(df, ...) {
+      combineLimits(xyplot(count~coord|factor(sample, levels=unique(sample))+reorder(gene, count, function(x) -sum(abs(x))), 
+      data=df, 
+      type='h', 
+      scales= list(relation="free", x=list(rot=0, cex=0.7, axs="i", tck=0.5), y=list(tick.number=4, rot=90, cex=0.7)),
+      xlab=NULL, main=NULL, ylab=NULL, 
+      as.table=T, 
+      origin = 0, 
+      horizontal=FALSE, 
+      group=polarity,
+      col=c("red","blue"),
+      par.strip.text = list(cex=0.7),
+      ...))
+      }
+
+      plot_size_distribution= function(df, ...) {
+          smR.prepanel=function(x,y,...){; yscale=c(-max(abs(y)), max(abs(y)));list(ylim=yscale);}
+          bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample))+gene, data = df, origin = 0,
+            horizontal=FALSE,
+	    group=polarity,
+	    stack=TRUE,
+            col=c('red', 'blue'),
+            cex=0.75,
+            scales=list(y=list(tick.number=4, rot=90, relation="free", cex=0.7), x=list(cex=0.7) ),
+            prepanel=smR.prepanel,
+            xlab = NULL,
+            ylab = NULL,
+            main = NULL,
+            as.table=TRUE,
+            newpage = T,
+            par.strip.text = list(cex=0.7),
+            ...)
+          combineLimits(bc)
+          }
+          
+      ## end of functions
+      
+      ## function parameters'
+      
+      par.settings.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-2.5), strip.background = list(col=c("lightblue","lightgreen")) )
+      par.settings.size=list(layout.heights=list(top.padding=-1, bottom.padding=-2.5), strip.background = list(col=c("lightblue","lightgreen")) )
+      par.settings.combination.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-3), strip.background=list(col=c("lightblue","lightgreen")) )
+      par.settings.combination.size=list(layout.heights=list(top.padding=-2, bottom.padding=-0.5), strip.background=list(col=c("lightblue", "lightgreen")) )
+
+      ## end of function parameters'
+      
+      ## GRAPHS
+
+      if (n_genes > 7) {page_height_simple = 11.69; page_height_combi=11.69; rows_per_page=${rows_per_page}; extrarow=0 } else {
+                         rows_per_page= n_genes; page_height_simple = 11.69/n_genes/4; page_height_combi=11.69/(n_genes*2); extrarow=1 }
+      if (n_samples > 4) {page_width = 8.2677*n_samples/4} else {page_width = 8.2677*n_samples/3} # to test
+
+      pdf(file="${readmap_PDF}", paper="special", height=page_height_simple, width=page_width)
+      for (i in seq(1,n_genes,rows_per_page)) {
+        start=i
+        end=i+rows_per_page-1
+        if (end>n_genes) {end=n_genes}
+        readmap_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.readmap))
+        args.list=c(readmap_plot.list, list(nrow=rows_per_page, ncol=1,
+                                            main=textGrob("Read Maps (nucleotide coordinates)", gp=gpar(cex=1), just="top"),
+                                            left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90)
+                                            #sub=textGrob("readmap coordinates", gp=gpar(cex=.75), just="bottom")
+                                            )
+                   )
+        do.call(grid.arrange, args.list)
+      }
+      devname=dev.off()
+
+
+      pdf(file="${size_PDF}", paper="special", height=page_height_simple, width=page_width)
+      for (i in seq(1,n_genes,rows_per_page)) {
+        start=i
+        end=i+rows_per_page-1
+        if (end>n_genes) {end=n_genes}
+        plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, par.settings=par.settings.size) )
+        args.list=c(plot.list, list(nrow=rows_per_page, ncol=1,
+                                    main=textGrob("Size distributions (in nucleotides)", gp=gpar(cex=1), just="top"),
+                                    left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90)
+                                    #sub="readsize in nucleotides"
+                                    )
+                    )
+        do.call(grid.arrange, args.list)
+      }
+      devname=dev.off()
+
+      pdf(file="${combi_PDF}", paper="special", height=page_height_combi, width=page_width)
+      for (i in seq(1,n_genes,rows_per_page/2)) {
+        start=i
+        end=i+rows_per_page/2-1
+        if (end>n_genes) {end=n_genes}
+	read_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.combination.readmap))
+        size_plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, strip=FALSE, par.settings=par.settings.combination.size))
+	plot.list=rbind(read_plot.list, size_plot.list )
+        args.list=c(plot.list, list(nrow=rows_per_page + extrarow, ncol=1,
+                                    main=textGrob("${title}", gp=gpar(cex=1), just="top"),
+                                    left=textGrob("${ylabel}", gp=gpar(cex=1), vjust=1, rot=90),
+                                    sub=textGrob("${xlabel}", gp=gpar(cex=1), just="bottom")
+                                    )
+                    )
+        do.call(grid.arrange, args.list)
+      }
+      devname=dev.off()
+
+
+     </configfile>
+   </configfiles>
+
+   <outputs>
+   <data format="tabular" name="readmap_dataframe" label="Readmap dataframe"/>
+   <data format="tabular" name="size_distribution_dataframe" label="Size distribution dataframe"/>
+   <data format="pdf" name="readmap_PDF" label="Readmaps"/>
+   <data format="pdf" name="size_PDF" label="Size distribution"/>
+   <data format="pdf" name="combi_PDF" label="Size distribution and Readmaps"/>
+   </outputs>
+<help>
+
+**What it does**
+
+Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a "Readmap", 
+where by default for each "chromosome" the position of the read is recorded on the x-axis, and the y-axis indicates 
+the number of reads per position. Reads that map in sense are on the top, reads that map antisense are on the bottom.
+
+
+.. class:: warningmark
+
+'''TIP''' The input data can be produced using the sRbowtie tool.
+
+----
+
+'''Example'''
+
+Query sequence::
+For a SAM file as the following:
+
+  5	16	2L_79	24393	255	17M	*	0	0	CCTTCATCTTTTTTTTT	IIIIIIIIIIIIIIIII	XA:i:0	MD:Z:17	NM:i:0
+
+  11	0	2R_1	12675	255	21M	*	0	0	AAAAAAAACGCGTCCTTGTGC	IIIIIIIIIIIIIIIIIIIII	XA:i:0	MD:Z:21	NM:i:0
+
+  2	16	2L_5	669	255	23M	*	0	0	TGTTGCTGCATTTCTTTTTTTTT	IIIIIIIIIIIIIIIIIIIIIII	XA:i:0	MD:Z:23	NM:i:0
+
+produce a plot like this:
+
+----
+
+.. image:: static/images/readmap.png 
+    :height: 800 
+    :width: 500
+
+</help>
+
+  <test>
+      <param name="genomeSource" value="history" />
+      <param name="ownFile" value ="transposons.fasta" ftype="fasta" />
+      <param name="input" value="sample1.srbowtie_out, sample2.srbowtie_out, sample3.srbowtie_out" ftype="tabular" />
+      <param name="norm" value="1,1,1" />
+      <param name="minquery" value="20" />
+      <param name="maxquery" value="30" />
+      <param name="title" value="Readmaps and size distributions" />
+      <param name="xlabel" value="Coordinates/read size" />
+      <param name="ylabel" value="Number of reads" />
+      <param name="rows_per_page" value="8" />
+      <output name="readmap_dataframe" ftype="tabular" value="Readmap_dataframe.tab" />
+      <output name="size_distribution_dataframe" ftype="tabular" value="Size_distribution_dataframe.tab" />
+      <output name="readmap_PDF" ftype="pdf" value="Readmaps.pdf" />
+      <output name="size_PDF" ftype="pdf" value="Size_distribution.pdf" />
+      <output name="combi_PDF" ftype="pdf" value="Size_distribution_and_Readmaps.pdf" />
+  </test>
+
+</tool>