|
0
|
1 import re
|
|
|
2 import argparse
|
|
|
3
|
|
|
4
|
|
|
5 parser = argparse.ArgumentParser()
|
|
|
6 parser.add_argument("--input", help="The 1_Summary file from an IMGT zip file")
|
|
|
7 parser.add_argument("--outdir", help="Output directory, 7 output files will be written here")
|
|
|
8
|
|
|
9 args = parser.parse_args()
|
|
|
10
|
|
|
11 infile = args.input
|
|
|
12 #infile = "test_VH-Ca_Cg_25nt/1_Summary_test_VH-Ca_Cg_25nt_241013.txt"
|
|
|
13 outdir = args.outdir
|
|
|
14 #outfile = "identified.txt"
|
|
|
15
|
|
|
16 dic = dict()
|
|
|
17 total = 0
|
|
|
18
|
|
|
19 first = True
|
|
|
20 with open(infile, 'r') as f: #read all sequences into a dictionary as key = ID, value = sequence
|
|
|
21 for line in f:
|
|
|
22 total += 1
|
|
|
23 if first:
|
|
|
24 first = False
|
|
|
25 continue
|
|
|
26 linesplt = line.split("\t")
|
|
|
27 if linesplt[2] == "No results":
|
|
|
28 continue
|
|
|
29 ID = linesplt[1]
|
|
|
30 seq = linesplt[28]
|
|
|
31 dic[ID] = seq
|
|
|
32
|
|
|
33 #lambda/kappa reference sequence
|
|
|
34 searchstrings = {"ca": "catccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccagatgggaacgtggtcatcgcctgcctggtccagggcttcttcccccaggagccactcagtgtgacctggagcgaaag",
|
|
|
35 "cg": "ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcc",
|
|
|
36 "cm": "gggagtgcatccgccccaacccttttccccctcgtctcctgtgagaattccc"}
|
|
|
37
|
|
|
38 compiledregex = {"ca": [],
|
|
|
39 "cg": [],
|
|
|
40 "cm": []}
|
|
|
41
|
|
|
42 #lambda/kappa reference sequence variable nucleotides
|
|
|
43 ca1 = {38: 't', 39: 'g', 48: 'a', 49: 'g', 51: 'c', 68: 'a', 73: 'c'}
|
|
|
44 ca2 = {38: 'g', 39: 'a', 48: 'c', 49: 'c', 51: 'a', 68: 'g', 73: 'a'}
|
|
|
45 cg1 = {0: 'c', 33: 'a', 38: 'c', 44: 'a', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'}
|
|
|
46 cg2 = {0: 'c', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'g', 132: 't'}
|
|
|
47 cg3 = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'}
|
|
|
48 cg4 = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'c', 132: 'c'}
|
|
|
49
|
|
|
50 #reference sequences are cut into smaller parts of 'chunklength' length, and with 'chunklength' / 2 overlap
|
|
|
51 chunklength = 8
|
|
|
52
|
|
|
53 #create the chunks of the reference sequence with regular expressions for the variable nucleotides
|
|
|
54 for i in range(0, len(searchstrings["ca"]) - chunklength, chunklength / 2):
|
|
|
55 pos = i
|
|
|
56 chunk = searchstrings["ca"][i:i+chunklength]
|
|
|
57 result = ""
|
|
|
58 varsInResult = 0
|
|
|
59 for c in chunk:
|
|
|
60 if pos in ca1.keys():
|
|
|
61 varsInResult += 1
|
|
|
62 result += "[" + ca1[pos] + ca2[pos] + "]"
|
|
|
63 else:
|
|
|
64 result += c
|
|
|
65 pos += 1
|
|
|
66 compiledregex["ca"].append((re.compile(result), varsInResult))
|
|
|
67
|
|
|
68 for i in range(0, len(searchstrings["cg"]) - chunklength, chunklength / 2):
|
|
|
69 pos = i
|
|
|
70 chunk = searchstrings["cg"][i:i+chunklength]
|
|
|
71 result = ""
|
|
|
72 varsInResult = 0
|
|
|
73 for c in chunk:
|
|
|
74 if pos in cg1.keys():
|
|
|
75 varsInResult += 1
|
|
|
76 result += "[" + "".join(set([cg1[pos], cg2[pos], cg3[pos], cg4[pos]])) + "]"
|
|
|
77 else:
|
|
|
78 result += c
|
|
|
79 pos += 1
|
|
|
80 compiledregex["cg"].append((re.compile(result), varsInResult))
|
|
|
81
|
|
|
82 for i in range(0, len(searchstrings["cm"]) - chunklength, chunklength / 2):
|
|
|
83 compiledregex["cm"].append((re.compile(searchstrings["cm"][i:i+chunklength]), False))
|
|
|
84
|
|
|
85
|
|
|
86
|
|
|
87 def removeAndReturnMaxIndex(x): #simplifies a list comprehension
|
|
|
88 m = max(x)
|
|
|
89 index = x.index(m)
|
|
|
90 x[index] = 0
|
|
|
91 return index
|
|
|
92
|
|
|
93
|
|
|
94 start_location = dict()
|
|
|
95 hits = dict()
|
|
|
96 alltotal = 0
|
|
|
97 for key in compiledregex.keys(): #for ca/cg/cm
|
|
|
98 regularexpressions = compiledregex[key] #get the compiled regular expressions
|
|
|
99 for ID in dic.keys()[0:]: #for every ID
|
|
|
100 if ID not in hits.keys(): #ensure that the dictionairy that keeps track of the hits for every gene exists
|
|
|
101 hits[ID] = {"ca_hits": 0, "cg_hits": 0, "cm_hits": 0, "ca1": 0, "ca2": 0, "cg1": 0, "cg2": 0, "cg3": 0, "cg4": 0}
|
|
|
102 currentIDHits = hits[ID]
|
|
|
103 seq = dic[ID]
|
|
|
104 lastindex = 0
|
|
|
105 start = [0] * len(seq)
|
|
|
106 for i, regexp in enumerate(regularexpressions): #for every regular expression
|
|
|
107 regex, hasVar = regexp
|
|
|
108 matches = regex.finditer(seq[lastindex:])
|
|
|
109 for match in matches: #for every match with the current regex, only uses the first hit
|
|
|
110 lastindex += match.start()
|
|
|
111 start[lastindex - chunklength / 2 * i] += 1
|
|
|
112 if hasVar: #if the regex has a variable nt in it
|
|
|
113 chunkstart = chunklength / 2 * i #where in the reference does this chunk start
|
|
|
114 chunkend = chunklength / 2 * i + chunklength #where in the reference does this chunk end
|
|
|
115 if key == "ca": #just calculate the variable nt score for 'ca', cheaper
|
|
|
116 currentIDHits["ca1"] += len([1 for x in ca1 if chunkstart <= x < chunkend and ca1[x] == seq[lastindex + x - chunkstart]])
|
|
|
117 currentIDHits["ca2"] += len([1 for x in ca2 if chunkstart <= x < chunkend and ca2[x] == seq[lastindex + x - chunkstart]])
|
|
|
118 elif key == "cg": #just calculate the variable nt score for 'cg', cheaper
|
|
|
119 currentIDHits["cg1"] += len([1 for x in cg1 if chunkstart <= x < chunkend and cg1[x] == seq[lastindex + x - chunkstart]])
|
|
|
120 currentIDHits["cg2"] += len([1 for x in cg2 if chunkstart <= x < chunkend and cg2[x] == seq[lastindex + x - chunkstart]])
|
|
|
121 currentIDHits["cg3"] += len([1 for x in cg3 if chunkstart <= x < chunkend and cg3[x] == seq[lastindex + x - chunkstart]])
|
|
|
122 currentIDHits["cg4"] += len([1 for x in cg4 if chunkstart <= x < chunkend and cg4[x] == seq[lastindex + x - chunkstart]])
|
|
|
123 else: #key == "cm" #no variable regions in 'cm'
|
|
|
124 pass
|
|
|
125 break #this only breaks when there was a match with the regex, breaking means the 'else:' clause is skipped
|
|
|
126 else: #only runs if there were no hits
|
|
|
127 continue
|
|
|
128 #print "found ", regex.pattern , "at", lastindex, "adding one to", (lastindex - chunklength / 2 * i), "to the start array of", ID, "gene", key, "it's now:", start[lastindex - chunklength / 2 * i]
|
|
|
129 currentIDHits[key + "_hits"] += 1
|
|
|
130 start_location[ID + "_" + key] = str([(removeAndReturnMaxIndex(start) + 1) for x in range(5) if max(start) > 1])
|
|
|
131 #start_location[ID + "_" + key] = str(start.index(max(start)))
|
|
|
132
|
|
|
133
|
|
|
134 chunksInCA = len(compiledregex["ca"])
|
|
|
135 chunksInCG = len(compiledregex["cg"])
|
|
|
136 chunksInCM = len(compiledregex["cm"])
|
|
|
137 requiredChunkPercentage = 0.7
|
|
|
138 varsInCA = float(len(ca1.keys()) * 2)
|
|
|
139 varsInCG = float(len(cg1.keys()) * 2) + 1
|
|
|
140 varsInCM = 0
|
|
|
141 requiredVarPercentage = 0.7
|
|
|
142
|
|
|
143 ca = 0
|
|
|
144 ca1 = 0
|
|
|
145 ca2 = 0
|
|
|
146 cg = 0
|
|
|
147 cg1 = 0
|
|
|
148 cg2 = 0
|
|
|
149 cg3 = 0
|
|
|
150 cg4 = 0
|
|
|
151 cm = 0
|
|
|
152 try:
|
|
|
153 cafile = open(outdir + "/ca.txt", 'w')
|
|
|
154 ca1file = open(outdir + "/ca1.txt", 'w')
|
|
|
155 ca2file = open(outdir + "/ca2.txt", 'w')
|
|
|
156 cgfile = open(outdir + "/cg.txt", 'w')
|
|
|
157 cg1file = open(outdir + "/cg1.txt", 'w')
|
|
|
158 cg2file = open(outdir + "/cg2.txt", 'w')
|
|
|
159 cg3file = open(outdir + "/cg3.txt", 'w')
|
|
|
160 cg4file = open(outdir + "/cg4.txt", 'w')
|
|
|
161 cmfile = open(outdir + "/cm.txt", 'w')
|
|
|
162 unmatchedfile = open(outdir + "/unmatched.txt", 'w')
|
|
|
163 cafile.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
|
|
|
164 ca1file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
|
|
|
165 ca2file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
|
|
|
166 cgfile.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
|
|
|
167 cg1file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
|
|
|
168 cg2file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
|
|
|
169 cg3file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
|
|
|
170 cg4file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
|
|
|
171 cmfile.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
|
|
|
172 unmatchedfile.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\tbest_match\n")
|
|
|
173 for ID in hits.keys():
|
|
|
174 currentIDHits = hits[ID]
|
|
|
175 possibleca = float(len(compiledregex["ca"]))
|
|
|
176 possiblecg = float(len(compiledregex["cg"]))
|
|
|
177 possiblecm = float(len(compiledregex["cm"]))
|
|
|
178 cahits = currentIDHits["ca_hits"]
|
|
|
179 cghits = currentIDHits["cg_hits"]
|
|
|
180 cmhits = currentIDHits["cm_hits"]
|
|
|
181 if cahits > cghits and cahits > cmhits: #its a ca gene
|
|
|
182 if cahits <= int(chunksInCA * requiredChunkPercentage):
|
|
|
183 unmatchedfile.write(ID + "\tNA\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\tca\n")
|
|
|
184 continue
|
|
|
185 ca += 1
|
|
|
186 ca1hits = currentIDHits["ca1"]
|
|
|
187 ca2hits = currentIDHits["ca2"]
|
|
|
188 cafile.write(ID + "\tNA\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n")
|
|
|
189 if ca1hits > ca2hits:
|
|
|
190 #print ID, "is ca1 with", (ca1hits / 2), "hits for ca1 and", (ca2hits / 2), "hits for ca2", (int((ca1hits / varsInCA) * 100)), "percent hit"
|
|
|
191 if ca1hits <= int(varsInCA * requiredVarPercentage):
|
|
|
192 unmatchedfile.write(ID + "\t" + str(int(ca1hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\tca1\n")
|
|
|
193 continue
|
|
|
194 ca1 += 1
|
|
|
195 ca1file.write(ID + "\t" + str(int(ca1hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n")
|
|
|
196 else:
|
|
|
197 #print ID, "is ca2 with", (ca1hits / 2), "hits for ca1 and", (ca2hits / 2), "hits for ca2", (int((ca2hits / varsInCA) * 100)), "percent hit"
|
|
|
198 if ca2hits <= int(varsInCA * requiredVarPercentage):
|
|
|
199 unmatchedfile.write(ID + "\t" + str(int(ca2hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\tca1\n")
|
|
|
200 continue
|
|
|
201 ca2 += 1
|
|
|
202 ca2file.write(ID + "\t" + str(int(ca2hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n")
|
|
|
203 elif cghits > cahits and cghits > cmhits: #its a cg gene
|
|
|
204 if cghits <= int(chunksInCG * requiredChunkPercentage):
|
|
|
205 unmatchedfile.write(ID + "\tNA\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_ca"] + "\tcg\n")
|
|
|
206 continue
|
|
|
207 cg += 1
|
|
|
208 cg1hits = currentIDHits["cg1"]
|
|
|
209 cg2hits = currentIDHits["cg2"]
|
|
|
210 cg3hits = currentIDHits["cg3"]
|
|
|
211 cg4hits = currentIDHits["cg4"]
|
|
|
212 cgfile.write(ID + "\tNA\t" + str(int(cghits / possibleca * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
|
|
|
213 if cg1hits > cg2hits and cg1hits > cg3hits and cg1hits > cg4hits: #cg1 gene
|
|
|
214 if cg1hits <= int(varsInCG * requiredVarPercentage):
|
|
|
215 unmatchedfile.write(ID + "\t" + str(int(cg1hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\tcg1\n")
|
|
|
216 continue
|
|
|
217 cg1 += 1
|
|
|
218 cg1file.write(ID + "\t" + str(int(cg1hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
|
|
|
219 elif cg2hits > cg1hits and cg2hits > cg3hits and cg2hits > cg4hits: #cg2 gene
|
|
|
220 if cg2hits <= int(varsInCG * requiredVarPercentage):
|
|
|
221 unmatchedfile.write(ID + "\t" + str(int(cg2hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\tcg2\n")
|
|
|
222 continue
|
|
|
223 cg2 += 1
|
|
|
224 cg2file.write(ID + "\t" + str(int(cg2hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
|
|
|
225 elif cg3hits > cg1hits and cg3hits > cg2hits and cg3hits > cg4hits: #cg3 gene
|
|
|
226 if cg3hits <= int(varsInCG * requiredVarPercentage):
|
|
|
227 unmatchedfile.write(ID + "\t" + str(int(cg3hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\tcg3\n")
|
|
|
228 continue
|
|
|
229 cg3 += 1
|
|
|
230 cg3file.write(ID + "\t" + str(int(cg3hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
|
|
|
231 else: #cg4 gene
|
|
|
232 if cg4hits <= int(varsInCG * requiredVarPercentage):
|
|
|
233 unmatchedfile.write(ID + "\t" + str(int(cg4hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\tcg4\n")
|
|
|
234 continue
|
|
|
235 cg4 += 1
|
|
|
236 cg4file.write(ID + "\t" + str(int(cg4hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
|
|
|
237 else: #its a cm gene
|
|
|
238 if cmhits <= int(chunksInCM * requiredChunkPercentage):
|
|
|
239 unmatchedfile.write(ID + "\tNA\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_ca"] + "\tcm\n")
|
|
|
240 continue
|
|
|
241 cm += 1
|
|
|
242 cmfile.write(ID + "\tNA\t" + str(int(cmhits / possiblecm * 100)) + "\t" + start_location[ID + "_cm"] + "\n")
|
|
|
243 finally:
|
|
|
244 cafile.close()
|
|
|
245 ca1file.close()
|
|
|
246 ca2file.close()
|
|
|
247 cgfile.close()
|
|
|
248 cg1file.close()
|
|
|
249 cg2file.close()
|
|
|
250 cg3file.close()
|
|
|
251 cg4file.close()
|
|
|
252 cmfile.close()
|
|
|
253 unmatchedfile.close()
|
|
|
254
|
|
|
255
|
|
|
256 #print ca,cg,cm,(ca+cg+cm)
|
|
|
257
|
|
|
258
|
|
|
259
|
|
|
260
|
|
|
261
|
|
|
262
|
|
|
263
|
|
|
264
|
|
|
265
|
