Mercurial > repos > rnateam > mea
changeset 0:9ab890b4d814 draft
planemo upload commit 9099c0a9ff5f7f3d9407e2ec3598957e02850d88-dirty
author | rnateam |
---|---|
date | Wed, 01 Jul 2015 09:56:14 -0400 |
parents | |
children | a041bcbb77fc |
files | mea.xml test-data/test_compare.out test-data/test_dp.ps test-data/test_predict.out test-data/test_reference.txt test-data/test_structure.txt tool_dependencies.xml |
diffstat | 7 files changed, 1081 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/mea.xml Wed Jul 01 09:56:14 2015 -0400 @@ -0,0 +1,189 @@ +<tool id="mea" name="MEA" version="0.6.4"> + <description>Predict maximum expected accuracy secondary structures + of RNAs and compare RNA secondary structures</description> + + <requirements> + + </requirements> + <stdio> + <exit_code range="1:" /> + </stdio> + + <command><![CDATA[ + mea + #if str($mode.mode_selector) == "predict" + $mode.dotplot + #else + --structure `cat $mode.structure` + #end if + #if str($reference) != "" + --reference `cat $reference` + #end if + --alpha $mode.alpha + --beta $mode.beta + --gamma $mode.gamma + --delta $mode.delta + $slide_rule + $conflict_rule + > $stdout + ]]></command> + + <inputs> + <conditional name="mode"> + <param name="mode_selector" type="select" label="Working Mode"> + <option value="predict">Predict</option> + <option value="compare">Compare</option> + </param> + <when value="predict"> + <param name="dotplot" type="data" format="rna_eps" label="Dotplot" + optional="false" help="Dotplot file (RNA base pair probabilities)"/> + <param name="alpha" label="Alpha" type="float" + optional="false" value="0.012" + help="Slope of base pair distance penalty"/> + <param name="beta" label="Beta" type="float" + optional="false" value="315" + help="Turning point of base pair distance penalty" /> + <param name="gamma" label="Gamma" type="float" + optional="false" value="0.5" + help="Base pair weight factor" /> + <param name="delta" label="Delta" type="float" + optional="false" value="0.003" + help="Minimum penalty factor for base pairs" /> + </when> + <when value="compare"> + <param name="structure" format="txt" type="data" label="Structure" + optional="false" help="(Predicted) RNA secondary structure" /> + </when> + </conditional> + + <param name="reference" format="txt" type="data" label="Reference" /> + + <param name="slide_rule" label="Slide Rule" type="boolean" + optional="false" + checked="yes" + falsevalue="--no-slide-rule" truevalue="" + help="Use slide rule" /> + <param name="conflict_rule" label="Conflict Rule" type="boolean" + optional="false" + checked="yes" + falsevalue="--no-conflict-rule" truevalue="" + help="Use onflict rule"/> + </inputs> + + <outputs> + <data format="txt" name="stdout" label="${tool.name} on ${on_string}" /> + </outputs> + + <tests> + <test> + <param name="alpha" + value="0.012" /> + <param name="beta" + value="315" /> + <param name="gamma" + value="0.5" /> + <param name="delta" + value="0.003" /> + <param name="slide-rule" checked="yes" /> + <param name="conflict-rule" checked="yes" /> + + <param name="mode_selector" value="predict" /> + <param name="reference" value="test_reference.txt" /> + + <param name="dotplot" value="test_dp.ps" /> + + <output name="stdout" file="test_predict.out" /> + </test> + + <test> + <param name="mode_selector" value="compare" /> + <param name="structure" value="test_structure.txt" /> + <param name="reference" value="test_reference.txt" /> + <param name="slide-rule" checked="yes" /> + <param name="conflict-rule" checked="yes" /> + + <output name="stdout" file="test_compare.out" /> + </test> + </tests> + + + <help><![CDATA[ +=== +MEA +=== + +MEA predicts RNA maximum expected accuracy structures from RNA base +pair probabilities and optionally compares them to a reference +structure. In a special mode it skips the prediction and compares a +given structure to the reference. For the prediction, MEA allows to +penalize long base pairs, using parameters alpha, beta, gamma, and +delta. For the comparison of secondary structures, several measures +are computed from the confusion matrix of the RNA base pairs. + +------ +Inputs +------ + +The tool accepts dot plot files as generated by RNAfold -p. + +For (predicted) structure and reference, the tool accepts +dot-bracket structures with pseudoknots (supporting bracket pairs +(),{},[],<>,Aa,Bb,...) + +------- +Outputs +------- + +If predicting a structure, the tool outputs the sequence and the +predicted dot bracket strucuture with computed score in parenthesis +following the structure. This mimicks the output of the Vienna +tools. + +The result of structure comparison is reported as a line of numbers + + TP FP FN TN SENS PPV F1 MCC + +where + + * TP = # true positives + + * FP = # false positives + + * FN = # false negatives + + * TN = # true negatives + + * SENS = TP/(TP+FN) 'Sensitivity' + + * PPV = TP/(TP+FP) 'Positive Predictive Value' + + * F1 = PPV*SENS / (PPV+SENS), if PPV+SENS!=0; 0, otherwise 'F1-score' + + * MCC = (TP*TN - FP*FN) / sqrt( (TP+FP)*(TP+FN)*(TN+FP)*(TN+FN) ) 'Mathews correlation coefficient' + + +Special rules for prediction evaluation: +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +* Slide rule: tolerate shift of one base pair end by one base. This + rule directly affects the number of true positives. + +* Conflict rule: predicted base pairs are false only if they + conflict with the reference; two base pair conflict if and only if + they share one end This rule directly affects the number of false + positives. + +-------- +Download +-------- + +The command line tool MEA is free software available for download and +local installation at +.. __: http://www.bioinf.uni-leipzig.de/Software/mea/ + +]]></help> + <citations> + <citation type="doi">10.1007/978-3-319-02624-4_1</citation> + </citations> + +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_compare.out Wed Jul 01 09:56:14 2015 -0400 @@ -0,0 +1,1 @@ +22 0 6 4067 0.785714 1 0.88 0.885752
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_dp.ps Wed Jul 01 09:56:14 2015 -0400 @@ -0,0 +1,854 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: PS_dot.c,v 1.38 2007/02/02 15:18:13 ivo Exp $, ViennaRNA-2.1.8 +%%CreationDate: Tue Jun 30 15:53:02 2015 +%%BoundingBox: 66 211 518 662 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: -d2 +% +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (dot.ps) show + +/sequence { (\ +ACGUAGCGGCGAUCGUAGCUAGCGCGCGAGUCGAUCGGCGCGGAUGCAUGCGGCGCGAGCGGUAGCGCGUAGGAGAUAUUAGCGGCGCGAUGCG\ +) } def +/len { sequence length } bind def + +72 216 translate +72 6 mul len 1 add div dup scale +/Helvetica findfont 0.95 scalefont setfont + +drawseq +0.5 dup translate +% draw diagonal +0.04 setlinewidth +0 len moveto len 0 lineto stroke + +/min { 2 copy gt { exch } if pop } bind def + +/utri{ % i j prob utri + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.33 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def + +%data starts here + +%start of quadruplex data + +%draw the grid +drawgrid + +%start of base pair probability data +1 45 0.037521086 ubox +1 63 0.014295566 ubox +1 91 0.020645728 ubox +2 6 0.004367449 ubox +2 8 0.021705446 ubox +2 11 0.013667321 ubox +2 15 0.003271257 ubox +2 22 0.035590809 ubox +2 24 0.012104068 ubox +2 26 0.004697631 ubox +2 40 0.008961167 ubox +2 42 0.099828325 ubox +2 43 0.149022299 ubox +2 46 0.130891127 ubox +2 52 0.005379135 ubox +2 57 0.039834753 ubox +2 59 0.013489281 ubox +2 61 0.240340024 ubox +2 62 0.014748017 ubox +2 65 0.012986509 ubox +2 87 0.018454189 ubox +2 89 0.198685971 ubox +2 92 0.258042883 ubox +2 94 0.239140657 ubox +3 7 0.020435524 ubox +3 10 0.013735849 ubox +3 14 0.003249549 ubox +3 19 0.012487128 ubox +3 23 0.012668579 ubox +3 25 0.004730655 ubox +3 39 0.008994103 ubox +3 41 0.076982114 ubox +3 45 0.190948035 ubox +3 47 0.015810575 ubox +3 51 0.005415168 ubox +3 56 0.039802053 ubox +3 60 0.241563115 ubox +3 63 0.003875608 ubox +3 86 0.018481981 ubox +3 88 0.199541373 ubox +3 91 0.257491606 ubox +3 93 0.249218165 ubox +4 9 0.013378812 ubox +4 18 0.012395370 ubox +4 21 0.107585739 ubox +4 22 0.009274398 ubox +4 24 0.004418681 ubox +4 38 0.008727279 ubox +4 40 0.070572076 ubox +4 42 0.061372098 ubox +4 43 0.104490298 ubox +4 44 0.200010223 ubox +4 46 0.015931964 ubox +4 50 0.005390376 ubox +4 55 0.037202525 ubox +4 57 0.004029813 ubox +4 58 0.014866920 ubox +4 59 0.237954189 ubox +4 61 0.009749317 ubox +4 62 0.005199825 ubox +4 64 0.013142870 ubox +4 85 0.017574854 ubox +4 87 0.186788879 ubox +4 89 0.003663857 ubox +4 90 0.247333055 ubox +4 92 0.247345722 ubox +5 20 0.110571280 ubox +5 45 0.018536568 ubox +5 49 0.005281456 ubox +5 63 0.013431643 ubox +5 91 0.217923792 ubox +6 16 0.013892313 ubox +6 19 0.111340434 ubox +6 23 0.006732127 ubox +6 39 0.025916162 ubox +6 41 0.844447131 ubox +6 54 0.040029951 ubox +6 56 0.181842067 ubox +6 60 0.149620792 ubox +6 83 0.018806564 ubox +6 86 0.204827846 ubox +6 88 0.350799591 ubox +6 93 0.023085094 ubox +7 15 0.014531894 ubox +7 18 0.111297143 ubox +7 22 0.007515494 ubox +7 33 0.004585087 ubox +7 37 0.064515784 ubox +7 38 0.023622021 ubox +7 40 0.847088320 ubox +7 42 0.007244682 ubox +7 53 0.040045383 ubox +7 55 0.181902420 ubox +7 57 0.112607527 ubox +7 59 0.150083377 ubox +7 61 0.020101947 ubox +7 82 0.018805245 ubox +7 84 0.018804944 ubox +7 85 0.204883438 ubox +7 87 0.351777128 ubox +7 89 0.043066339 ubox +7 92 0.023134223 ubox +7 94 0.003907637 ubox +8 14 0.014827477 ubox +8 16 0.003209920 ubox +8 20 0.011969025 ubox +8 32 0.004614874 ubox +8 36 0.065392120 ubox +8 39 0.847188337 ubox +8 41 0.007178023 ubox +8 54 0.181306532 ubox +8 56 0.080337419 ubox +8 60 0.020086236 ubox +8 83 0.018124772 ubox +8 86 0.351634124 ubox +8 88 0.033522271 ubox +8 91 0.018551778 ubox +9 13 0.009610222 ubox +9 16 0.101290090 ubox +9 19 0.013854560 ubox +9 31 0.004612511 ubox +9 35 0.064869077 ubox +9 36 0.009174145 ubox +9 39 0.009762960 ubox +9 51 0.040238572 ubox +9 54 0.017892412 ubox +9 56 0.224659359 ubox +9 83 0.207194705 ubox +9 86 0.017267611 ubox +9 88 0.064192694 ubox +9 93 0.024125686 ubox +10 15 0.106267019 ubox +10 18 0.013868465 ubox +10 30 0.004596046 ubox +10 33 0.066712846 ubox +10 37 0.847381407 ubox +10 38 0.008186006 ubox +10 50 0.040244507 ubox +10 52 0.178117235 ubox +10 53 0.022350185 ubox +10 55 0.238410141 ubox +10 57 0.003546542 ubox +10 82 0.207212728 ubox +10 84 0.349993064 ubox +10 85 0.016510985 ubox +10 87 0.069764212 ubox +10 89 0.015095559 ubox +10 92 0.024298069 ubox +10 94 0.003668690 ubox +11 32 0.066778179 ubox +11 36 0.847577632 ubox +11 49 0.034418944 ubox +11 51 0.176357702 ubox +11 54 0.238356297 ubox +11 56 0.003552368 ubox +11 79 0.009009634 ubox +11 80 0.085658080 ubox +11 83 0.348590635 ubox +11 86 0.069697953 ubox +11 88 0.014830844 ubox +11 91 0.014586538 ubox +11 93 0.003880719 ubox +12 31 0.065069649 ubox +12 35 0.847389109 ubox +12 49 0.071664533 ubox +12 70 0.005852706 ubox +12 77 0.095653881 ubox +12 79 0.103294789 ubox +12 80 0.086537203 ubox +12 91 0.020714973 ubox +13 29 0.060139119 ubox +13 30 0.034396159 ubox +13 34 0.847175040 ubox +13 48 0.072572200 ubox +13 50 0.012455906 ubox +13 53 0.239385252 ubox +13 71 0.005947257 ubox +13 74 0.010883135 ubox +13 76 0.099046684 ubox +13 78 0.101455563 ubox +13 81 0.099504308 ubox +13 82 0.027687917 ubox +13 85 0.067876723 ubox +13 90 0.025283938 ubox +14 28 0.069953762 ubox +14 30 0.003635706 ubox +14 33 0.847289081 ubox +14 46 0.015512422 ubox +14 50 0.094202845 ubox +14 52 0.246327244 ubox +14 69 0.057875825 ubox +14 73 0.011307529 ubox +14 75 0.099304185 ubox +14 82 0.015780741 ubox +14 84 0.068556444 ubox +14 87 0.017719285 ubox +14 89 0.025309144 ubox +14 94 0.003775421 ubox +15 27 0.071514866 ubox +15 31 0.010847351 ubox +15 32 0.843968222 ubox +15 45 0.015472831 ubox +15 47 0.149926609 ubox +15 49 0.097360282 ubox +15 51 0.246797690 ubox +15 68 0.058270453 ubox +15 77 0.262987322 ubox +15 79 0.222099445 ubox +15 80 0.009088416 ubox +15 83 0.067701853 ubox +15 86 0.018263026 ubox +15 88 0.025217470 ubox +15 93 0.003991467 ubox +16 26 0.067491075 ubox +16 28 0.031008167 ubox +16 29 0.072594599 ubox +16 30 0.201983675 ubox +16 44 0.015076160 ubox +16 46 0.149962565 ubox +16 48 0.097145888 ubox +16 50 0.246761891 ubox +16 67 0.054519211 ubox +16 71 0.010400114 ubox +16 73 0.022474058 ubox +16 74 0.016616876 ubox +16 75 0.040604294 ubox +16 76 0.270624115 ubox +16 78 0.228368573 ubox +16 81 0.019277755 ubox +16 82 0.062560990 ubox +16 85 0.017470895 ubox +16 87 0.024343783 ubox +16 92 0.003984466 ubox +17 31 0.067807624 ubox +17 45 0.135192933 ubox +17 49 0.243922602 ubox +17 70 0.009806352 ubox +17 77 0.210876465 ubox +17 79 0.005721920 ubox +17 80 0.026405295 ubox +17 91 0.003890715 ubox +18 23 0.007566048 ubox +18 25 0.202387424 ubox +18 27 0.766629747 ubox +18 31 0.261859827 ubox +18 32 0.004157726 ubox +18 45 0.004658670 ubox +18 47 0.266002961 ubox +18 66 0.061518302 ubox +18 77 0.010308519 ubox +18 79 0.026034275 ubox +18 80 0.017320703 ubox +18 83 0.033674072 ubox +18 86 0.006370458 ubox +19 24 0.202161595 ubox +19 26 0.766002718 ubox +19 28 0.098227020 ubox +19 30 0.276214409 ubox +19 42 0.007255022 ubox +19 43 0.115466385 ubox +19 46 0.266190796 ubox +19 65 0.061621321 ubox +19 72 0.132433308 ubox +19 73 0.335075981 ubox +19 75 0.174097688 ubox +19 82 0.034009440 ubox +19 85 0.006337894 ubox +20 24 0.041288952 ubox +20 26 0.011266781 ubox +20 28 0.009527024 ubox +20 29 0.269100135 ubox +20 42 0.102651357 ubox +20 43 0.017791755 ubox +20 44 0.029567081 ubox +20 46 0.006913403 ubox +20 64 0.061609346 ubox +20 71 0.132343080 ubox +20 72 0.327064446 ubox +20 73 0.024744916 ubox +20 74 0.172172078 ubox +20 78 0.008616522 ubox +20 81 0.034044897 ubox +20 84 0.005349261 ubox +21 45 0.019901701 ubox +21 63 0.061450239 ubox +21 70 0.094630320 ubox +21 77 0.008770697 ubox +21 80 0.033712127 ubox +22 27 0.144503043 ubox +22 31 0.050422832 ubox +22 41 0.207166987 ubox +22 68 0.019255477 ubox +22 70 0.389118283 ubox +22 79 0.011286016 ubox +22 88 0.007249638 ubox +23 28 0.037382685 ubox +23 30 0.050805185 ubox +23 40 0.207341852 ubox +23 42 0.252666381 ubox +23 43 0.004602337 ubox +23 61 0.061616082 ubox +23 67 0.019277203 ubox +23 69 0.406334190 ubox +23 72 0.004682256 ubox +23 87 0.007270739 ubox +24 31 0.033760458 ubox +24 39 0.207344295 ubox +24 41 0.253201902 ubox +24 60 0.061639786 ubox +24 66 0.019274829 ubox +24 68 0.406511149 ubox +24 70 0.016029681 ubox +24 86 0.007260326 ubox +25 30 0.034038814 ubox +25 38 0.207189392 ubox +25 40 0.253223146 ubox +25 42 0.007561329 ubox +25 59 0.061515545 ubox +25 65 0.019254142 ubox +25 67 0.406511369 ubox +25 69 0.016372634 ubox +25 84 0.005456586 ubox +25 85 0.005217208 ubox +25 94 0.007850186 ubox +26 39 0.252885748 ubox +26 41 0.007602875 ubox +26 63 0.015134489 ubox +26 66 0.406506091 ubox +26 68 0.016378544 ubox +26 83 0.007440764 ubox +26 93 0.008310063 ubox +27 37 0.262262676 ubox +27 38 0.194749775 ubox +27 40 0.007591399 ubox +27 42 0.004178327 ubox +27 57 0.060646786 ubox +27 61 0.006856647 ubox +27 62 0.016172056 ubox +27 65 0.406287833 ubox +27 67 0.016378075 ubox +27 82 0.007447105 ubox +27 92 0.008301162 ubox +27 94 0.004246028 ubox +28 36 0.308389500 ubox +28 39 0.006526280 ubox +28 41 0.004312139 ubox +28 56 0.060646316 ubox +28 60 0.010855479 ubox +28 63 0.019268097 ubox +28 66 0.016299714 ubox +28 91 0.004460063 ubox +28 93 0.004475462 ubox +29 35 0.305668438 ubox +29 63 0.111713816 ubox +30 35 0.021217944 ubox +30 36 0.040438679 ubox +30 39 0.006684463 ubox +30 54 0.060335569 ubox +30 60 0.093092305 ubox +30 63 0.145671356 ubox +30 77 0.006982399 ubox +30 91 0.008049747 ubox +31 38 0.007121915 ubox +31 53 0.060405807 ubox +31 58 0.102211146 ubox +31 59 0.054262976 ubox +31 61 0.020926780 ubox +31 62 0.355366954 ubox +31 76 0.007343760 ubox +31 90 0.009770487 ubox +32 37 0.008976508 ubox +32 52 0.060411444 ubox +32 57 0.112171720 ubox +32 59 0.022765395 ubox +32 61 0.386545258 ubox +32 62 0.019149553 ubox +32 75 0.007376470 ubox +32 89 0.009853263 ubox +33 51 0.060202424 ubox +33 56 0.109875526 ubox +33 60 0.383724314 ubox +33 88 0.009645443 ubox +34 45 0.006544156 ubox +34 49 0.009212129 ubox +34 63 0.003712235 ubox +35 44 0.006721756 ubox +35 48 0.008368024 ubox +35 50 0.013009869 ubox +35 55 0.007498445 ubox +35 57 0.010422186 ubox +35 58 0.331608099 ubox +35 59 0.049103805 ubox +35 62 0.004164222 ubox +35 73 0.005746522 ubox +35 74 0.003269593 ubox +36 43 0.006735926 ubox +36 50 0.014173462 ubox +36 53 0.010751776 ubox +36 55 0.150088918 ubox +36 57 0.360797410 ubox +36 59 0.009049701 ubox +36 61 0.004285642 ubox +36 72 0.005907132 ubox +36 73 0.003296694 ubox +36 87 0.010138181 ubox +37 47 0.003475085 ubox +37 49 0.013285354 ubox +37 54 0.155023410 ubox +37 56 0.303554581 ubox +37 60 0.004274899 ubox +37 86 0.010372872 ubox +38 47 0.059155232 ubox +38 51 0.011959125 ubox +38 54 0.230460425 ubox +38 56 0.221561602 ubox +38 68 0.004180892 ubox +38 70 0.006935648 ubox +39 46 0.059208724 ubox +39 50 0.012018649 ubox +39 52 0.216700833 ubox +39 53 0.180049832 ubox +39 55 0.293106797 ubox +39 57 0.006672659 ubox +39 67 0.004253543 ubox +39 69 0.007186705 ubox +39 84 0.010677991 ubox +40 45 0.038354313 ubox +40 47 0.012692859 ubox +40 49 0.010960050 ubox +40 51 0.260362642 ubox +40 54 0.293413841 ubox +40 56 0.006787752 ubox +40 66 0.004255686 ubox +40 68 0.007188595 ubox +40 83 0.010722221 ubox +41 46 0.012738676 ubox +41 50 0.260610340 ubox +41 52 0.137141405 ubox +41 53 0.280814164 ubox +41 55 0.006805474 ubox +41 65 0.004265493 ubox +41 67 0.007181400 ubox +41 82 0.010720009 ubox +42 47 0.024020779 ubox +42 49 0.237558669 ubox +42 51 0.161383013 ubox +42 54 0.006732983 ubox +42 66 0.006752797 ubox +42 93 0.007784487 ubox +43 47 0.030029679 ubox +43 49 0.005096988 ubox +43 51 0.242156365 ubox +43 80 0.009174223 ubox +43 93 0.004326096 ubox +44 49 0.084853186 ubox +44 70 0.005622445 ubox +44 79 0.010555236 ubox +44 91 0.007563281 ubox +45 50 0.050375260 ubox +45 52 0.014395383 ubox +45 61 0.012956084 ubox +45 64 0.004541817 ubox +45 67 0.004306230 ubox +45 69 0.005968153 ubox +45 78 0.010540639 ubox +45 90 0.007481616 ubox +45 94 0.611990670 ubox +46 51 0.014743705 ubox +46 54 0.003633148 ubox +46 60 0.014157606 ubox +46 63 0.004701867 ubox +46 66 0.008725838 ubox +46 68 0.006115946 ubox +46 77 0.010205016 ubox +46 93 0.844929365 ubox +47 52 0.004893440 ubox +47 53 0.003691975 ubox +47 59 0.014208084 ubox +47 62 0.004727591 ubox +47 65 0.011355058 ubox +47 67 0.006112402 ubox +47 72 0.004387523 ubox +47 73 0.004823292 ubox +47 75 0.005117092 ubox +47 89 0.004439383 ubox +47 92 0.854884327 ubox +48 70 0.003287385 ubox +48 91 0.852545355 ubox +49 57 0.014240061 ubox +49 61 0.005541667 ubox +49 64 0.027074876 ubox +49 69 0.003494650 ubox +49 71 0.013545611 ubox +49 74 0.008745336 ubox +49 87 0.003392678 ubox +49 89 0.500638881 ubox +49 90 0.687224962 ubox +49 94 0.019600277 ubox +50 56 0.014446566 ubox +50 60 0.006234868 ubox +50 63 0.029074204 ubox +50 68 0.003595231 ubox +50 70 0.014187673 ubox +50 86 0.004894875 ubox +50 88 0.854957079 ubox +50 93 0.026690703 ubox +51 55 0.014342853 ubox +51 59 0.006236231 ubox +51 62 0.029401438 ubox +51 67 0.003597607 ubox +51 69 0.014373151 ubox +51 72 0.009478243 ubox +51 85 0.004895816 ubox +51 87 0.855765444 ubox +51 89 0.031333967 ubox +51 92 0.026729787 ubox +52 66 0.003540774 ubox +52 68 0.010239428 ubox +52 86 0.855579282 ubox +52 88 0.022788657 ubox +52 91 0.020615027 ubox +53 60 0.030128010 ubox +53 68 0.042295935 ubox +53 70 0.021470856 ubox +53 83 0.006687683 ubox +53 86 0.009821488 ubox +53 88 0.031592782 ubox +54 59 0.030161365 ubox +54 67 0.044305764 ubox +54 69 0.027833176 ubox +54 72 0.006003260 ubox +54 73 0.004584043 ubox +54 82 0.006699170 ubox +54 84 0.855415726 ubox +54 85 0.009198290 ubox +54 87 0.038349419 ubox +54 89 0.024683668 ubox +54 94 0.007743693 ubox +55 63 0.004177347 ubox +55 66 0.044356410 ubox +55 68 0.027971222 ubox +55 70 0.019603111 ubox +55 83 0.855475752 ubox +55 86 0.038394491 ubox +55 88 0.024771550 ubox +55 93 0.008613265 ubox +56 62 0.004553975 ubox +56 65 0.044360134 ubox +56 67 0.027981546 ubox +56 69 0.034383459 ubox +56 72 0.016469331 ubox +56 73 0.014742567 ubox +56 75 0.003417972 ubox +56 82 0.854226870 ubox +56 84 0.004284036 ubox +56 85 0.038306499 ubox +56 87 0.024772209 ubox +56 92 0.008626194 ubox +57 66 0.025306963 ubox +57 68 0.065891741 ubox +57 70 0.230571481 ubox +57 77 0.005164467 ubox +57 79 0.009166416 ubox +57 80 0.102921631 ubox +57 83 0.004543159 ubox +57 86 0.024594341 ubox +57 91 0.008356748 ubox +58 63 0.006090708 ubox +58 70 0.026598818 ubox +58 77 0.008004488 ubox +58 79 0.113644146 ubox +58 80 0.112782577 ubox +59 66 0.128669116 ubox +59 68 0.801896747 ubox +59 70 0.124445033 ubox +59 77 0.004642866 ubox +59 79 0.081824095 ubox +59 80 0.018016421 ubox +59 83 0.041658916 ubox +59 88 0.010840428 ubox +59 93 0.091998057 ubox +60 65 0.129083699 ubox +60 67 0.802618719 ubox +60 69 0.128700330 ubox +60 72 0.004269792 ubox +60 73 0.004251557 ubox +60 75 0.013383322 ubox +60 82 0.041685356 ubox +60 84 0.012512459 ubox +60 87 0.010967331 ubox +60 92 0.092308158 ubox +60 94 0.010509920 ubox +61 66 0.799006510 ubox +61 68 0.128296443 ubox +61 77 0.027527913 ubox +61 79 0.012802671 ubox +61 80 0.058425842 ubox +61 83 0.012517462 ubox +61 86 0.010550821 ubox +61 91 0.089635301 ubox +61 93 0.016515255 ubox +62 66 0.016092620 ubox +62 68 0.008939286 ubox +62 77 0.184365063 ubox +62 79 0.098074869 ubox +62 80 0.003783512 ubox +62 86 0.004120089 ubox +62 88 0.013646910 ubox +62 91 0.024352420 ubox +62 93 0.278387764 ubox +63 67 0.009731503 ubox +63 71 0.010836445 ubox +63 72 0.004005127 ubox +63 74 0.009262094 ubox +63 75 0.044289773 ubox +63 76 0.186008241 ubox +63 78 0.100799889 ubox +63 81 0.012702778 ubox +63 84 0.006377925 ubox +63 85 0.004693129 ubox +63 87 0.013530602 ubox +63 89 0.007178144 ubox +63 90 0.027351004 ubox +63 92 0.278426675 ubox +64 70 0.010922997 ubox +64 77 0.093995775 ubox +64 79 0.003756619 ubox +64 80 0.012545301 ubox +64 91 0.232970816 ubox +65 77 0.003856379 ubox +65 79 0.010283574 ubox +65 83 0.010452049 ubox +65 86 0.010405874 ubox +65 88 0.119955935 ubox +65 91 0.007155932 ubox +65 93 0.007298737 ubox +66 72 0.083401356 ubox +66 73 0.190878754 ubox +66 75 0.083919306 ubox +66 82 0.010468713 ubox +66 84 0.019553940 ubox +66 85 0.009603068 ubox +66 87 0.120137686 ubox +66 89 0.276151499 ubox +66 92 0.006803754 ubox +67 77 0.006659374 ubox +67 83 0.021320354 ubox +67 86 0.120043445 ubox +67 88 0.278633972 ubox +68 72 0.021773601 ubox +68 73 0.093874610 ubox +68 75 0.035898725 ubox +68 82 0.021525030 ubox +68 84 0.067109636 ubox +68 85 0.100654537 ubox +68 87 0.278647007 ubox +69 77 0.035753327 ubox +69 79 0.188994541 ubox +69 80 0.012025776 ubox +69 83 0.094055814 ubox +69 86 0.278570056 ubox +70 74 0.010727916 ubox +70 75 0.011552397 ubox +70 76 0.037676632 ubox +70 78 0.201236372 ubox +70 81 0.175792959 ubox +70 82 0.087904386 ubox +70 84 0.008008457 ubox +70 85 0.269224462 ubox +71 77 0.200786870 ubox +71 79 0.023407691 ubox +71 80 0.183844324 ubox +72 77 0.018375803 ubox +72 79 0.175344507 ubox +72 80 0.026989439 ubox +72 83 0.217675516 ubox +73 77 0.009943918 ubox +73 79 0.023475545 ubox +73 80 0.162325910 ubox +73 83 0.065050489 ubox +74 79 0.163619801 ubox +74 80 0.054426892 ubox +75 79 0.039481991 ubox +75 80 0.096270277 ubox +75 83 0.011150614 ubox +76 80 0.038209845 ubox +77 81 0.012538807 ubox +77 82 0.007217726 ubox +77 84 0.003386513 ubox +82 93 0.005527246 ubox +83 92 0.005542929 ubox +84 91 0.005065037 ubox +85 93 0.007029342 ubox +86 92 0.007053740 ubox +86 94 0.005293461 ubox +87 91 0.004357089 ubox +87 93 0.011645051 ubox +88 92 0.011626182 ubox +89 93 0.003620304 ubox +6 41 0.9500000 lbox +7 40 0.9500000 lbox +8 39 0.9500000 lbox +10 37 0.9500000 lbox +11 36 0.9500000 lbox +12 35 0.9500000 lbox +13 34 0.9500000 lbox +14 33 0.9500000 lbox +15 32 0.9500000 lbox +18 27 0.9500000 lbox +19 26 0.9500000 lbox +45 94 0.9500000 lbox +46 93 0.9500000 lbox +47 92 0.9500000 lbox +48 91 0.9500000 lbox +49 90 0.9500000 lbox +50 88 0.9500000 lbox +51 87 0.9500000 lbox +52 86 0.9500000 lbox +54 84 0.9500000 lbox +55 83 0.9500000 lbox +56 82 0.9500000 lbox +59 68 0.9500000 lbox +60 67 0.9500000 lbox +61 66 0.9500000 lbox +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_predict.out Wed Jul 01 09:56:14 2015 -0400 @@ -0,0 +1,3 @@ +ACGUAGCGGCGAUCGUAGCUAGCGCGCGAGUCGAUCGGCGCGGAUGCAUGCGGCGCGAGCGGUAGCGCGUAGGAGAUAUUAGCGGCGCGAUGCG +.....(((.((((((..((......))....)))))).)))....(((.(((.(((..(((....))).............))).)))..))). (53.4375) +23 0 2 4070 0.92 1 0.958333 0.958931
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_reference.txt Wed Jul 01 09:56:14 2015 -0400 @@ -0,0 +1,1 @@ +.....(((.((((((..((......))....)))))).)))...((((((((.(((..(((....))).............))).))).)))))
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_structure.txt Wed Jul 01 09:56:14 2015 -0400 @@ -0,0 +1,2 @@ +.....(((.((((((..((......))....)))))).)))......(((((.(((.....(((....))).........).)).))).))... +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Wed Jul 01 09:56:14 2015 -0400 @@ -0,0 +1,31 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="gengetopt" version="2.22.6"> + <repository changeset_revision="9d2ed370989c" name="package_gengetopt_2_22_6" owner="iuc" prior_installation_required="True" toolshed="https://testtoolshed.g2.bx.psu.edu" /> + </package> + <package name="mea" version="0.6.4"> + <install version="1.0"> + <actions> + <action type="download_by_url"> + http://www.bioinf.uni-leipzig.de/Software/mea/mea-0.6.4.tar.gz + </action> + + <action type="set_environment_for_install"> + <repository changeset_revision="9d2ed370989c" name="package_gengetopt_2_22_6" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu"> + <package name="gengetopt" version="2.22.6" /> + </repository> + </action> + + <action type="autoconf" /> + + <action type="set_environment"> + <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR/bin + </environment_variable> + <environment_variable action="set" name="MEA_ROOT_PATH">$INSTALL_DIR + </environment_variable> + </action> + </actions> + </install> + <readme>Compiling MEA requires a C++ compiler (usually g++)</readme> + </package> +</tool_dependency>