comparison test-data/TEST_4/TEST_4.tsv @ 2:ca9e2125c5de draft

"planemo upload for repository https://github.com/mesocentre-clermont-auvergne/galaxy-tools/tree/master/tools/bakta commit fe1cdf884df206d842be4f0768acb06b0bbcf56f"
author pimarin
date Wed, 17 Aug 2022 10:29:37 +0000
parents 4d315de96666
children eea334d9988b
comparison
equal deleted inserted replaced
1:728e602cd3f7 2:ca9e2125c5de
1 #Annotated with Bakta (v1.4.0): https://github.com/oschwengers/bakta 1 #Annotated with Bakta (v1.4.2): https://github.com/oschwengers/bakta
2 #Database (v3.0): https://doi.org/10.5281/zenodo.4247252 2 #Database (v3.0): https://doi.org/10.5281/zenodo.4247252
3 #Sequence Id Type Start Stop Strand Locus Tag Gene Product DbXrefs 3 #Sequence Id Type Start Stop Strand Locus Tag Gene Product DbXrefs
4 c1 cds 3 98 + BALIOE_00005 hypothetical protein 4 p2 cds 2 736 + DOGAIA_00005 hypothetical protein
5 c1 ncRNA-region 215 328 + Threonine operon leader RFAM:RF00506, SO:0000140 5 p2 cds 971 1351 - DOGAIA_00010 hypothetical protein
6 c1 cds 354 2816 + BALIOE_00010 hypothetical protein 6 p2 cds 1348 2388 - DOGAIA_00015 mock1 mock hypothetical user protein 1 EC:0.0.0.0, USERDB:MOCK1
7 c1 cds 2818 3750 + BALIOE_00015 hypothetical protein
8 c1 cds 3751 5037 + BALIOE_00020 hypothetical protein
9 c1 cds 5251 5547 + BALIOE_00025 hypothetical protein
10 c1 cds 5700 6476 - BALIOE_00030 hypothetical protein
11 c1 cds 6546 7976 - BALIOE_00035 hypothetical protein
12 c1 cds 8255 9208 + BALIOE_00040 hypothetical protein
13 c1 cds 9323 9910 + BALIOE_00045 hypothetical protein
14 c1 cds 9945 10511 - BALIOE_00050 hypothetical protein
15 c1 cds 10660 11373 - BALIOE_00055 hypothetical protein
16 c1 cds 11399 11803 - BALIOE_00060 hypothetical protein
17 c1 cds 12180 14096 + BALIOE_00065 hypothetical protein
18 c1 cds 14185 15315 + BALIOE_00070 hypothetical protein
19 c1 cds 15419 15628 - BALIOE_00075 hypothetical protein
20 c1 cds 16157 17323 + BALIOE_00080 hypothetical protein
21 c1 cds 17389 18288 + BALIOE_00085 hypothetical protein
22 c1 cds 18326 18751 - BALIOE_00090 hypothetical protein
23 c1 cds 18960 19286 - BALIOE_00095 hypothetical protein
24 c1 cds 19299 21749 - BALIOE_00100 hypothetical protein
25 c1 cds 21762 22445 - BALIOE_00105 hypothetical protein
26 c1 cds 22495 23028 - BALIOE_00110 hypothetical protein
27 c1 cds 23330 24751 - BALIOE_00115 hypothetical protein
28 c1 cds 25221 25484 - BALIOE_00120 hypothetical protein
29 c1 cds 25819 26760 + BALIOE_00125 hypothetical protein
30 c1 cds 26803 29619 + BALIOE_00130 hypothetical protein
31 c1 cds 29619 30113 + BALIOE_00135 hypothetical protein
32 c1 cds 30201 30650 + BALIOE_00140 hypothetical protein
33 c1 cds 30652 31602 + BALIOE_00145 hypothetical protein
34 c1 cds 31668 32582 + BALIOE_00150 hypothetical protein
35 c1 cds 32749 33570 + BALIOE_00155 hypothetical protein
36 c1 cds 34026 35174 + BALIOE_00160 hypothetical protein
37 c1 cds 35192 38413 + BALIOE_00165 hypothetical protein
38 c1 cds 38421 38639 - BALIOE_00170 hypothetical protein
39 c1 cds 38674 39069 + BALIOE_00175 hypothetical protein
40 c1 cds 39188 39778 - BALIOE_00180 hypothetical protein
41 c1 cds 39784 40569 - BALIOE_00185 hypothetical protein
42 c1 cds 40678 42231 - BALIOE_00190 hypothetical protein
43 c1 cds 42305 43522 - BALIOE_00195 hypothetical protein
44 c1 cds 43651 44793 - BALIOE_00200 hypothetical protein
45 c1 cds 44824 46338 - BALIOE_00205 hypothetical protein
46 c1 crispr 46595 46726 ? CRISPR array with 3 repeats of length 17, consensus sequence TTTTCAATATTGGTGAT and spacer length 41 SO:0001459
47 c1 cds 46817 47587 + BALIOE_00210 hypothetical protein
48 c1 cds 47602 48543 + BALIOE_00215 hypothetical protein
49 c1 cds 48594 49880 + BALIOE_00220 hypothetical protein
50 c1 cds 49877 50164 + BALIOE_00225 hypothetical protein
51 c1 cds 50222 51553 + BALIOE_00230 hypothetical protein
52 c1 cds 51661 52191 + BALIOE_00235 hypothetical protein
53 c1 cds 52184 54046 + BALIOE_00240 hypothetical protein
54 c1 cds 54127 54717 + BALIOE_00245 hypothetical protein
55 c1 cds 54803 55036 + BALIOE_00250 hypothetical protein
56 c1 cds 55039 55353 + BALIOE_00255 hypothetical protein
57 c1 cds 55350 56198 - BALIOE_00260 hypothetical protein
58 c1 cds 56205 56582 - BALIOE_00265 hypothetical protein
59 c1 cds 56585 57406 - BALIOE_00270 hypothetical protein
60 c1 cds 57403 58392 - BALIOE_00275 hypothetical protein
61 c1 cds 58392 59678 - BALIOE_00280 hypothetical protein
62 c1 cds 59731 62085 - BALIOE_00285 hypothetical protein
63 c1 cds 62340 63155 + BALIOE_00290 hypothetical protein
64 c1 cds 63450 64202 + BALIOE_00295 hypothetical protein
65 c1 cds 64620 65279 - BALIOE_00300 hypothetical protein
66 c1 cds 65291 68197 - BALIOE_00305 hypothetical protein
67 c1 cds 68361 70712 - BALIOE_00310 hypothetical protein
68 c1 cds 70787 71482 - BALIOE_00315 hypothetical protein
69 c1 cds 71682 73184 - BALIOE_00320 hypothetical protein
70 c1 cds 73195 74895 - BALIOE_00325 hypothetical protein
71 c1 cds 75234 76112 + BALIOE_00330 hypothetical protein
72 c1 cds 76198 76962 + BALIOE_00335 hypothetical protein
73 c1 cds 77049 77747 - BALIOE_00340 hypothetical protein
74 c1 cds 77731 79341 - BALIOE_00345 hypothetical protein
75 c1 cds 79317 80300 - BALIOE_00350 hypothetical protein
76 c1 cds 80672 81241 + BALIOE_00355 hypothetical protein
77 c1 cds 81207 81314 + BALIOE_00360 hypothetical protein
78 c1 cds 81470 83128 - BALIOE_00365 hypothetical protein
79 c1 cds 83456 84061 - BALIOE_00370 hypothetical protein
80 c1 cds 84072 85472 - BALIOE_00375 hypothetical protein
81 c1 cds 85475 86566 - BALIOE_00380 hypothetical protein
82 c1 cds 86566 88137 - BALIOE_00385 hypothetical protein
83 c1 cds 88974 89918 + BALIOE_00390 hypothetical protein
84 c1 cds 90236 91960 + BALIOE_00395 hypothetical protein
85 c1 cds 91963 92454 + BALIOE_00400 hypothetical protein
86 c1 cds 92634 93638 + BALIOE_00405 hypothetical protein
87 c1 cds 94240 94698 + BALIOE_00410 hypothetical protein
88 c1 cds 94700 95641 + BALIOE_00415 hypothetical protein
89 c1 cds 95638 96003 + BALIOE_00420 hypothetical protein
90 c1 cds 96019 97785 + BALIOE_00425 hypothetical protein
91 c1 cds 97772 99259 + BALIOE_00430 hypothetical protein
92 c1 cds 99256 100614 + BALIOE_00435 hypothetical protein
93 c1 cds 100608 101690 + BALIOE_00440 hypothetical protein
94 c1 cds 101693 103009 + BALIOE_00445 hypothetical protein
95 c1 cds 103009 104253 + BALIOE_00450 hypothetical protein
96 c1 cds 104250 105317 + BALIOE_00455 hypothetical protein
97 c1 cds 105371 106846 + BALIOE_00460 hypothetical protein
98 c1 cds 106839 107759 + BALIOE_00465 hypothetical protein
99 c1 cds 107761 108591 + BALIOE_00470 hypothetical protein
100 c1 cds 108588 109850 + BALIOE_00475 hypothetical protein
101 c1 cds 109911 111062 + BALIOE_00480 hypothetical protein
102 c1 cds 111163 112080 + BALIOE_00485 hypothetical protein
103 c1 cds 112236 112823 + BALIOE_00490 hypothetical protein
104 c1 cds 112885 115590 + BALIOE_00495 hypothetical protein
105 c1 cds 115650 116048 + BALIOE_00500 hypothetical protein
106 c1 ncRNA 116039 116116 + BALIOE_00505 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
107 c1 cds 116139 116336 - BALIOE_00510 hypothetical protein
108 c1 cds 116346 117089 - BALIOE_00515 hypothetical protein
109 c1 cds 117089 117709 - BALIOE_00520 hypothetical protein
110 c1 cds 117934 118977 + BALIOE_00525 hypothetical protein
111 c1 cds 119012 120214 - BALIOE_00530 hypothetical protein
112 c1 cds 120204 121589 - BALIOE_00535 hypothetical protein
113 c1 cds 121599 122039 - BALIOE_00540 hypothetical protein
114 c1 cds 122242 123135 - BALIOE_00545 hypothetical protein
115 c1 cds 123223 123774 + BALIOE_00550 hypothetical protein
116 c1 cds 123771 124625 + BALIOE_00555 hypothetical protein
117 c1 cds 124668 126038 - BALIOE_00560 hypothetical protein
118 c1 cds 126582 127346 + BALIOE_00565 hypothetical protein
119 c1 cds 127507 130170 + BALIOE_00570 hypothetical protein
120 c1 cds 130185 132077 + BALIOE_00575 hypothetical protein
121 c1 cds 132285 133709 + BALIOE_00580 hypothetical protein
122 c1 cds 133780 135633 - BALIOE_00585 hypothetical protein
123 c1 cds 135988 138585 + BALIOE_00590 hypothetical protein
124 c1 cds 138761 139123 + BALIOE_00595 hypothetical protein
125 c1 cds 139161 139955 - BALIOE_00600 hypothetical protein
126 c1 cds 139971 140837 - BALIOE_00605 hypothetical protein
127 c1 cds 140943 141251 - BALIOE_00610 hypothetical protein
128 c1 cds 141456 143006 + BALIOE_00615 hypothetical protein
129 c1 cds 143208 145598 - BALIOE_00620 hypothetical protein
130 c1 cds 145804 146340 + BALIOE_00625 hypothetical protein
131 c1 cds 146381 147043 - BALIOE_00630 hypothetical protein
132 c1 cds 147152 148078 + BALIOE_00635 hypothetical protein
133 c1 cds 148078 148845 + BALIOE_00640 hypothetical protein
134 c1 cds 148950 149390 + BALIOE_00645 hypothetical protein
135 c1 cds 149454 150683 + BALIOE_00650 hypothetical protein
136 c1 cds 150687 151067 - BALIOE_00655 hypothetical protein
137 c1 cds 151341 152237 + BALIOE_00660 hypothetical protein
138 c1 cds 152536 153387 - BALIOE_00665 hypothetical protein
139 c1 cds 153399 154193 - BALIOE_00670 hypothetical protein
140 c1 cds 154328 155437 - BALIOE_00675 hypothetical protein
141 c1 cds 155449 156039 - BALIOE_00680 hypothetical protein
142 c1 cds 156060 156665 - BALIOE_00685 hypothetical protein
143 c1 cds 156680 157228 - BALIOE_00690 hypothetical protein
144 c1 cds 157242 159842 - BALIOE_00695 hypothetical protein
145 c1 cds 159884 160609 - BALIOE_00700 hypothetical protein
146 c1 cds 160696 161292 - BALIOE_00705 hypothetical protein
147 c1 cds 161573 162055 - BALIOE_00710 hypothetical protein
148 c1 cds 162052 163416 - BALIOE_00715 hypothetical protein
149 c1 cds 163509 164435 - BALIOE_00720 hypothetical protein
150 c1 cds 164472 164927 - BALIOE_00725 hypothetical protein
151 c1 cds 165105 165809 - BALIOE_00730 hypothetical protein
152 c1 cds 165824 166354 - BALIOE_00735 hypothetical protein
153 c1 cds 166428 168857 + BALIOE_00740 hypothetical protein
154 c1 cds 169053 171587 + BALIOE_00745 hypothetical protein
155 c1 cds 171807 174050 + BALIOE_00750 hypothetical protein
156 c1 cds 174101 174898 + BALIOE_00755 hypothetical protein
157 c1 cds 174898 175788 + BALIOE_00760 hypothetical protein
158 c1 cds 175785 177767 + BALIOE_00765 hypothetical protein
159 c1 cds 177802 179082 - BALIOE_00770 hypothetical protein
160 c1 cds 179307 180728 + BALIOE_00775 hypothetical protein
161 c1 cds 180810 181154 + BALIOE_00780 hypothetical protein
162 c1 cds 181201 181824 - BALIOE_00785 hypothetical protein
163 c1 cds 181862 182662 - BALIOE_00790 hypothetical protein
164 c1 cds 182655 183353 - BALIOE_00795 hypothetical protein
165 c1 cds 183437 184954 + BALIOE_00800 hypothetical protein
166 c1 cds 185084 186508 + BALIOE_00805 hypothetical protein
167 c1 cds 186663 187820 + BALIOE_00810 hypothetical protein
168 c1 cds 187909 188295 - BALIOE_00815 hypothetical protein
169 c1 cds 188610 189434 - BALIOE_00820 hypothetical protein
170 c1 cds 189465 192137 - BALIOE_00825 hypothetical protein
171 c1 cds 192199 192993 - BALIOE_00830 hypothetical protein
172 c1 cds 193361 194086 + BALIOE_00835 hypothetical protein
173 c1 cds 194344 195195 + BALIOE_00840 hypothetical protein
174 c1 cds 195342 196067 + BALIOE_00845 hypothetical protein
175 c1 cds 196217 196774 + BALIOE_00850 hypothetical protein
176 c1 cds 196866 198062 + BALIOE_00855 hypothetical protein
177 c1 cds 198251 199009 + BALIOE_00860 hypothetical protein
178 c1 cds 199009 199161 + BALIOE_00865 hypothetical protein
179 c1 cds 199130 199879 + BALIOE_00870 hypothetical protein
180 c1 cds 199891 201243 + BALIOE_00875 hypothetical protein
181 c1 cds 201273 203705 + BALIOE_00880 hypothetical protein
182 c1 cds 203826 204311 + BALIOE_00885 hypothetical protein
183 c1 cds 204315 205340 + BALIOE_00890 hypothetical protein
184 c1 cds 205445 205900 + BALIOE_00895 hypothetical protein
185 c1 cds 205904 206692 + BALIOE_00900 hypothetical protein
186 c1 cds 206692 207840 + BALIOE_00905 hypothetical protein
187 c1 cds 207837 208433 + BALIOE_00910 hypothetical protein
188 c1 cds 208470 211952 + BALIOE_00915 hypothetical protein
189 c1 cds 211965 212924 + BALIOE_00920 hypothetical protein
190 c1 cds 213023 215164 + BALIOE_00925 hypothetical protein
191 c1 cds 215221 215610 + BALIOE_00930 hypothetical protein
192 c1 cds 215675 216970 + BALIOE_00935 hypothetical protein
193 c1 cds 217023 217283 - BALIOE_00940 hypothetical protein
194 c1 cds 217270 217470 - BALIOE_00945 hypothetical protein
195 c1 cds 217636 218094 + BALIOE_00950 hypothetical protein
196 c1 cds 218178 218588 + BALIOE_00955 hypothetical protein
197 c1 cds 218602 219312 + BALIOE_00960 hypothetical protein
198 c1 ncRNA 219391 219467 + BALIOE_00965 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
199 c1 cds 219512 220336 - BALIOE_00970 hypothetical protein
200 c1 cds 220389 222107 - BALIOE_00975 hypothetical protein
201 c1 cds 222218 222925 - BALIOE_00980 hypothetical protein
202 c1 cds 222922 223326 - BALIOE_00985 hypothetical protein
203 c1 cds 223444 224259 - BALIOE_00990 hypothetical protein
204 c1 cds 224299 224952 - BALIOE_00995 hypothetical protein
205 c1 cds 224945 225976 - BALIOE_01000 hypothetical protein
206 c1 cds 226164 226739 + BALIOE_01005 hypothetical protein
207 c1 rRNA 227103 228644 + BALIOE_01010 16S_rrna 16S ribosomal RNA GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
208 c1 tRNA 228713 228789 + BALIOE_01015 Ile_trna tRNA-Ile SO:0000263
209 c1 tRNA 228832 228907 + BALIOE_01020 Ala_trna tRNA-Ala SO:0000254
210 c1 tRNA 232258 232334 + BALIOE_01025 Asp_trna tRNA-Asp SO:0000256
211 c1 cds 232497 233300 + BALIOE_01030 hypothetical protein
212 c1 cds 233297 234211 - BALIOE_01035 hypothetical protein
213 c1 cds 234473 235252 + BALIOE_01040 hypothetical protein
214 c1 cds 235330 236100 + BALIOE_01045 hypothetical protein
215 c1 cds 236148 237368 - BALIOE_01050 hypothetical protein
216 c1 cds 237578 238333 - BALIOE_01055 hypothetical protein
217 c1 cds 238367 239089 + BALIOE_01060 hypothetical protein
218 c1 cds 239086 239553 - BALIOE_01065 hypothetical protein
219 c1 cds 239609 240349 + BALIOE_01070 hypothetical protein
220 c1 tRNA 240482 240558 + BALIOE_01075 Asp_trna tRNA-Asp SO:0000256
221 c1 cds 240887 241687 + BALIOE_01080 hypothetical protein
222 c1 cds 241872 242168 - BALIOE_01085 hypothetical protein
223 c1 cds 242165 242614 - BALIOE_01090 hypothetical protein
224 c1 cds 242617 243213 - BALIOE_01095 hypothetical protein
225 c1 cds 243292 243513 - BALIOE_01100 hypothetical protein
226 c1 cds 243534 244013 - BALIOE_01105 hypothetical protein
227 c1 cds 243979 245388 - BALIOE_01110 hypothetical protein
228 c1 cds 245399 248833 - BALIOE_01115 hypothetical protein
229 c1 cds 248970 249764 - BALIOE_01120 hypothetical protein
230 c1 cds 249761 250381 - BALIOE_01125 hypothetical protein
231 c1 cds 250386 251129 - BALIOE_01130 hypothetical protein
232 c1 cds 251126 253897 - BALIOE_01135 hypothetical protein
233 c1 cds 253906 254667 - BALIOE_01140 hypothetical protein
234 c1 cds 254672 256003 - BALIOE_01145 hypothetical protein
235 c1 cds 256006 256530 - BALIOE_01150 hypothetical protein
236 c1 cds 256527 257807 - BALIOE_01155 hypothetical protein
237 c1 cds 257832 258914 - BALIOE_01160 hypothetical protein
238 c1 cds 258878 260728 - BALIOE_01165 hypothetical protein
239 c1 cds 260732 261145 - BALIOE_01170 hypothetical protein
240 c1 cds 261236 262627 - BALIOE_01175 hypothetical protein
241 c1 cds 262678 262902 - BALIOE_01180 hypothetical protein
242 c1 cds 262937 263437 - BALIOE_01185 hypothetical protein
243 c1 cds 264134 264652 + BALIOE_01190 hypothetical protein
244 c1 cds 264862 267003 + BALIOE_01195 hypothetical protein
245 c1 cds 267079 271293 + BALIOE_01200 hypothetical protein
246 c1 cds 271362 271907 + BALIOE_01205 hypothetical protein
247 c1 cds 272653 273789 + BALIOE_01210 hypothetical protein
248 c1 cds 273792 275552 + BALIOE_01215 hypothetical protein
249 c1 cds 275536 275706 + BALIOE_01220 hypothetical protein
250 c1 cds 275754 276017 + BALIOE_01225 hypothetical protein
251 c1 cds 276198 277370 + BALIOE_01230 hypothetical protein
252 c1 cds 277488 278258 - BALIOE_01235 hypothetical protein
253 c1 cds 278439 278885 + BALIOE_01240 hypothetical protein
254 c1 cds 278928 281372 - BALIOE_01245 hypothetical protein
255 c1 cds 281612 282190 + BALIOE_01250 hypothetical protein
256 c1 cds 282295 283062 + BALIOE_01255 hypothetical protein
257 c1 cds 283033 283773 - BALIOE_01260 hypothetical protein
258 c1 cds 284208 284468 - BALIOE_01265 hypothetical protein
259 c1 cds 284654 285427 + BALIOE_01270 hypothetical protein
260 c1 ncRNA 285427 285504 + BALIOE_01275 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
261 c1 cds 285603 285899 + BALIOE_01280 hypothetical protein
262 c1 cds 286245 287984 - BALIOE_01285 hypothetical protein
263 c1 cds 288079 288714 + BALIOE_01290 hypothetical protein
264 c1 cds 288785 289840 + BALIOE_01295 hypothetical protein
265 c1 cds 289892 290185 + BALIOE_01300 hypothetical protein
266 c1 cds 290188 290586 + BALIOE_01305 hypothetical protein
267 c1 cds 290671 291048 + BALIOE_01310 hypothetical protein
268 c1 cds 291355 291621 + BALIOE_01315 hypothetical protein
269 c1 cds 291590 292090 + BALIOE_01320 hypothetical protein
270 c1 cds 292147 293604 - BALIOE_01325 hypothetical protein
271 c1 cds 293865 294323 + BALIOE_01330 hypothetical protein
272 c1 cds 294415 295659 + BALIOE_01335 hypothetical protein
273 c1 cds 295717 296118 + BALIOE_01340 hypothetical protein
274 c1 cds 296157 297212 - BALIOE_01345 hypothetical protein
275 c1 cds 297500 298603 + BALIOE_01350 hypothetical protein
276 c1 cds 298615 299868 + BALIOE_01355 hypothetical protein
277 c1 tRNA 299983 300058 + BALIOE_01360 Thr_trna tRNA-Thr SO:0000270
278 c1 cds 300073 301047 - BALIOE_01365 hypothetical protein
279 c1 cds 301423 301812 - BALIOE_01370 hypothetical protein
280 c1 cds 301940 302653 - BALIOE_01375 hypothetical protein
281 c1 cds 302754 302954 + BALIOE_01380 hypothetical protein
282 c1 cds 303073 303366 + BALIOE_01385 hypothetical protein
283 c1 cds 303399 304007 + BALIOE_01390 hypothetical protein
284 c1 cds 303947 304321 + BALIOE_01395 hypothetical protein
285 c1 cds 304318 304629 + BALIOE_01400 hypothetical protein
286 c1 cds 304629 305423 + BALIOE_01405 hypothetical protein
287 c1 cds 305423 306016 + BALIOE_01410 hypothetical protein
288 c1 cds 305988 306431 - BALIOE_01415 hypothetical protein
289 c1 cds 306452 306862 - BALIOE_01420 hypothetical protein
290 c1 cds 306892 307446 + BALIOE_01425 hypothetical protein
291 c1 cds 307504 308277 - BALIOE_01430 hypothetical protein
292 c1 tRNA 308435 308518 + BALIOE_01435 tRNA-Xxx
293 c1 cds 309101 309844 + BALIOE_01440 hypothetical protein
294 c1 cds 309886 310239 - BALIOE_01445 hypothetical protein
295 c1 cds 310807 311988 + BALIOE_01450 hypothetical protein
296 c1 cds 311992 312408 + BALIOE_01455 hypothetical protein
297 c1 cds 312381 312998 + BALIOE_01460 hypothetical protein
298 c1 cds 312998 313456 + BALIOE_01465 hypothetical protein
299 c1 cds 313449 314081 + BALIOE_01470 hypothetical protein
300 c1 cds 314112 314702 + BALIOE_01475 hypothetical protein
301 c1 cds 314702 315268 + BALIOE_01480 hypothetical protein
302 c1 cds 315678 315950 - BALIOE_01485 hypothetical protein
303 c1 cds 315956 316507 - BALIOE_01490 hypothetical protein
304 c1 cds 316504 317256 - BALIOE_01495 hypothetical protein
305 c1 cds 318190 318450 + BALIOE_01500 hypothetical protein
306 c1 cds 318447 319004 + BALIOE_01505 hypothetical protein
307 c1 cds 319001 319222 + BALIOE_01510 hypothetical protein
308 c1 cds 319222 319545 + BALIOE_01515 hypothetical protein
309 c1 cds 319559 321892 + BALIOE_01520 hypothetical protein
310 c1 cds 322025 322981 - BALIOE_01525 hypothetical protein
311 c1 cds 323657 324556 - BALIOE_01530 hypothetical protein
312 c1 cds 324655 325377 + BALIOE_01535 hypothetical protein
313 c1 cds 325544 325822 + BALIOE_01540 hypothetical protein
314 c1 cds 326525 327427 - BALIOE_01545 hypothetical protein
315 c1 cds 327673 328731 + BALIOE_01550 hypothetical protein
316 c1 cds 328873 330000 + BALIOE_01555 hypothetical protein
317 c1 cds 330179 331135 - BALIOE_01560 hypothetical protein
318 c1 cds 331145 333343 - BALIOE_01565 hypothetical protein
319 c1 cds 333340 334296 - BALIOE_01570 hypothetical protein
320 c1 cds 334293 334982 - BALIOE_01575 hypothetical protein
321 c1 cds 335400 336014 + BALIOE_01580 hypothetical protein
322 c1 cds 336904 337614 - BALIOE_01585 hypothetical protein
323 c1 cds 337583 339226 - BALIOE_01590 hypothetical protein
324 c1 cds 339216 341741 - BALIOE_01595 hypothetical protein
325 c1 cds 341767 342435 - BALIOE_01600 hypothetical protein
326 c1 cds 342493 343080 - BALIOE_01605 hypothetical protein
327 c1 cds 343155 343697 - BALIOE_01610 hypothetical protein
328 c1 cds 344522 344713 + BALIOE_01615 hypothetical protein
329 c1 cds 344783 344923 - BALIOE_01620 hypothetical protein
330 c1 cds 344923 345189 - BALIOE_01625 hypothetical protein
331 c1 cds 345450 345830 + BALIOE_01630 hypothetical protein
332 c1 cds 345827 346174 + BALIOE_01635 hypothetical protein
333 c1 cds 346224 347762 + BALIOE_01640 hypothetical protein
334 c1 cds 348574 349716 - BALIOE_01645 hypothetical protein
335 c1 cds 349951 350871 - BALIOE_01650 hypothetical protein
336 c1 cds 351028 351954 + BALIOE_01655 hypothetical protein
337 c1 cds 352242 352598 - BALIOE_01660 hypothetical protein
338 c1 cds 352791 353366 - BALIOE_01665 hypothetical protein
339 c1 cds 353932 358185 + BALIOE_01670 hypothetical protein
340 c1 cds 358306 359163 - BALIOE_01675 hypothetical protein
341 c1 cds 359412 360281 + BALIOE_01680 hypothetical protein
342 c1 cds 360441 361034 - BALIOE_01685 hypothetical protein
343 c1 cds 361391 362716 - BALIOE_01690 hypothetical protein
344 c1 cds 362942 363796 + BALIOE_01695 hypothetical protein
345 c1 cds 364323 365042 + BALIOE_01700 hypothetical protein
346 c1 cds 365053 366480 + BALIOE_01705 hypothetical protein
347 c1 cds 366473 367168 + BALIOE_01710 hypothetical protein
348 c1 cds 367663 368079 - BALIOE_01715 hypothetical protein
349 c1 cds 368261 368473 - BALIOE_01720 hypothetical protein
350 c1 cds 368427 369521 - BALIOE_01725 hypothetical protein
351 c1 cds 369563 370324 - BALIOE_01730 hypothetical protein
352 c1 cds 370341 370481 - BALIOE_01735 hypothetical protein
353 c1 cds 371105 371272 - BALIOE_01740 hypothetical protein
354 c1 cds 372408 372542 + BALIOE_01745 hypothetical protein
355 c1 cds 372971 373222 + BALIOE_01750 hypothetical protein
356 c1 cds 373224 374912 - BALIOE_01755 hypothetical protein
357 c1 cds 374926 376398 - BALIOE_01760 hypothetical protein
358 c1 cds 376412 376999 - BALIOE_01765 hypothetical protein
359 c1 cds 377128 379161 + BALIOE_01770 hypothetical protein
360 c1 cds 379735 383718 + BALIOE_01775 hypothetical protein
361 c1 cds 383860 384948 + BALIOE_01780 hypothetical protein
362 c1 cds 384990 385250 - BALIOE_01785 hypothetical protein
363 c1 cds 385211 385921 - BALIOE_01790 hypothetical protein
364 c1 cds 386013 386315 - BALIOE_01795 hypothetical protein
365 c1 cds 386778 387383 + BALIOE_01800 hypothetical protein
366 c1 cds 387423 388286 + BALIOE_01805 hypothetical protein
367 c1 cds 388276 389823 + BALIOE_01810 hypothetical protein
368 c1 cds 389823 391241 + BALIOE_01815 hypothetical protein
369 c1 cds 391267 391587 + BALIOE_01820 hypothetical protein
370 c1 ncRNA 391309 391378 - BALIOE_01825 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
371 c1 ncRNA 391402 391471 - BALIOE_01830 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
372 c1 ncRNA 391495 391564 - BALIOE_01835 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
373 c1 ncRNA 391587 391656 - BALIOE_01840 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
374 c1 cds 391756 392706 + BALIOE_01845 hypothetical protein
375 c1 cds 392716 394098 + BALIOE_01850 hypothetical protein
376 c1 cds 394397 394807 + BALIOE_01855 hypothetical protein
377 c1 cds 395058 396044 + BALIOE_01860 hypothetical protein
378 c1 cds 396093 396353 + BALIOE_01865 hypothetical protein
379 c1 cds 396399 397577 + BALIOE_01870 hypothetical protein
380 c1 cds 397570 398541 + BALIOE_01875 hypothetical protein
381 c1 cds 398538 399494 + BALIOE_01880 hypothetical protein
382 c1 cds 399581 400630 + BALIOE_01885 hypothetical protein
383 c1 cds 400873 401688 + BALIOE_01890 hypothetical protein
384 c1 cds 402366 402998 - BALIOE_01895 hypothetical protein
385 c1 cds 403184 403459 + BALIOE_01900 hypothetical protein
386 c1 cds 403557 405143 - BALIOE_01905 hypothetical protein
387 c1 cds 405382 406272 + BALIOE_01910 hypothetical protein
388 c1 cds 406428 407597 + BALIOE_01915 hypothetical protein
389 c1 cds 407631 409082 + BALIOE_01920 hypothetical protein
390 c1 cds 409122 411008 + BALIOE_01925 hypothetical protein
391 c1 ncRNA 411107 411183 + BALIOE_01930 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
392 c1 ncRNA 411295 411371 + BALIOE_01935 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
393 c1 ncRNA 411389 411465 + BALIOE_01940 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
394 c1 ncRNA 411483 411558 + BALIOE_01945 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
395 c1 ncRNA 411576 411652 + BALIOE_01950 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
396 c1 ncRNA 411670 411746 + BALIOE_01955 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
397 c1 cds 411902 413161 + BALIOE_01960 hypothetical protein
398 c1 cds 413151 414434 + BALIOE_01965 hypothetical protein
399 c1 cds 414567 415466 - BALIOE_01970 hypothetical protein
400 c1 cds 415576 416235 + BALIOE_01975 hypothetical protein
401 c1 cds 416266 416736 + BALIOE_01980 hypothetical protein
402 c1 cds 416742 417923 + BALIOE_01985 hypothetical protein
403 c1 cds 418026 418637 - BALIOE_01990 hypothetical protein
404 c1 cds 418703 419956 - BALIOE_01995 hypothetical protein
405 c1 cds 420008 423082 - BALIOE_02000 hypothetical protein
406 c1 cds 423205 424296 - BALIOE_02005 hypothetical protein
407 c1 cds 424324 425277 - BALIOE_02010 hypothetical protein
408 c1 cds 425297 426073 - BALIOE_02015 hypothetical protein
409 c1 cds 426188 427135 - BALIOE_02020 hypothetical protein
410 c1 cds 427212 428876 + BALIOE_02025 hypothetical protein
411 c1 cds 428878 429822 + BALIOE_02030 hypothetical protein
412 c1 cds 429840 430706 + BALIOE_02035 hypothetical protein
413 c1 cds 430716 431525 + BALIOE_02040 hypothetical protein
414 c1 cds 431522 432472 + BALIOE_02045 hypothetical protein
415 c1 cds 432469 433482 + BALIOE_02050 hypothetical protein
416 c1 cds 433658 434869 + BALIOE_02055 hypothetical protein
417 c1 cds 434971 435510 + BALIOE_02060 hypothetical protein
418 c1 cds 435635 436468 - BALIOE_02065 hypothetical protein
419 c1 cds 436561 437670 - BALIOE_02070 hypothetical protein
420 c1 cds 437705 437980 - BALIOE_02075 hypothetical protein
421 c1 cds 438140 439186 - BALIOE_02080 hypothetical protein
422 c1 cds 439198 441276 - BALIOE_02085 hypothetical protein
423 c1 cds 441345 442376 - BALIOE_02090 hypothetical protein
424 c1 cds 442373 443677 - BALIOE_02095 hypothetical protein
425 c1 cds 443762 445303 - BALIOE_02100 hypothetical protein
426 c1 cds 445303 445932 - BALIOE_02105 hypothetical protein
427 c1 cds 446235 447197 + BALIOE_02110 hypothetical protein
428 c1 cds 447210 447977 + BALIOE_02115 hypothetical protein
429 c1 cds 447974 448801 + BALIOE_02120 hypothetical protein
430 c1 cds 448798 449649 + BALIOE_02125 hypothetical protein
431 c1 cds 449756 450730 - BALIOE_02130 hypothetical protein
432 c1 cds 451256 454198 + BALIOE_02135 hypothetical protein
433 c1 cds 454286 454909 + BALIOE_02140 hypothetical protein
434 c1 cds 454910 456067 - BALIOE_02145 hypothetical protein
435 c1 cds 456419 457639 + BALIOE_02150 hypothetical protein
436 c1 cds 457652 458746 + BALIOE_02155 hypothetical protein
437 c1 cds 458805 459113 - BALIOE_02160 hypothetical protein
438 c1 cds 459373 459585 + BALIOE_02165 hypothetical protein
439 c1 cds 459609 460703 - BALIOE_02170 hypothetical protein
440 c1 cds 461166 461426 + BALIOE_02175 hypothetical protein
441 c1 cds 461527 462942 + BALIOE_02180 hypothetical protein
442 c1 cds 463061 463381 + BALIOE_02185 hypothetical protein
443 c1 cds 463483 464598 + BALIOE_02190 hypothetical protein
444 c1 cds 464615 465424 - BALIOE_02195 hypothetical protein
445 c1 cds 465544 466002 + BALIOE_02200 hypothetical protein
446 c1 cds 466185 466709 + BALIOE_02205 hypothetical protein
447 c1 cds 466759 466950 + BALIOE_02210 hypothetical protein
448 c1 cds 467208 467885 + BALIOE_02215 hypothetical protein
449 c1 cds 467957 468241 + BALIOE_02220 hypothetical protein
450 c1 cds 468385 470664 + BALIOE_02225 hypothetical protein
451 c1 cds 470661 471110 + BALIOE_02230 hypothetical protein
452 c1 cds 471195 472172 - BALIOE_02235 hypothetical protein
453 c1 cds 472231 473139 + BALIOE_02240 hypothetical protein
454 c1 cds 473282 474550 - BALIOE_02245 hypothetical protein
455 c1 cds 474592 477735 - BALIOE_02250 hypothetical protein
456 c1 cds 477732 478934 - BALIOE_02255 hypothetical protein
457 c1 cds 479124 479813 + BALIOE_02260 hypothetical protein
458 c1 cds 479871 481166 + BALIOE_02265 hypothetical protein
459 c1 cds 481573 482892 + BALIOE_02270 hypothetical protein
460 c1 cds 482968 484341 + BALIOE_02275 hypothetical protein
461 c1 cds 484497 486314 + BALIOE_02280 hypothetical protein
462 c1 cds 486502 487947 + BALIOE_02285 hypothetical protein
463 c1 cds 487968 488549 - BALIOE_02290 hypothetical protein
464 c1 cds 488642 489712 + BALIOE_02295 hypothetical protein
465 c1 cds 489767 490894 + BALIOE_02300 hypothetical protein
466 c1 cds 490917 491249 + BALIOE_02305 hypothetical protein
467 c1 cds 491310 493124 + BALIOE_02310 hypothetical protein
468 c1 cds 493135 494106 + BALIOE_02315 hypothetical protein
469 c1 cds 494257 494499 + BALIOE_02320 hypothetical protein
470 c1 cds 494492 494773 + BALIOE_02325 hypothetical protein
471 c1 cds 494861 495208 + BALIOE_02330 hypothetical protein
472 c1 cds 495385 496269 - BALIOE_02335 hypothetical protein
473 c1 cds 496568 497107 - BALIOE_02340 hypothetical protein
474 c1 cds 497258 497707 + BALIOE_02345 hypothetical protein
475 c1 cds 497711 498814 + BALIOE_02350 hypothetical protein
476 c1 cds 498903 499373 + BALIOE_02355 hypothetical protein
477 c1 cds 499393 499812 + BALIOE_02360 hypothetical protein
478 c1 cds 499890 500867 + BALIOE_02365 hypothetical protein
479 c1 cds 500845 501360 + BALIOE_02370 hypothetical protein
480 c1 cds 501538 503109 - BALIOE_02375 hypothetical protein
481 c1 cds 503340 504314 - BALIOE_02380 hypothetical protein
482 c1 cds 504369 506231 - BALIOE_02385 hypothetical protein
483 c1 cds 506256 507155 - BALIOE_02390 hypothetical protein
484 c1 cds 507155 507397 - BALIOE_02395 hypothetical protein
485 c1 cds 507603 509051 + BALIOE_02400 hypothetical protein
486 c1 cds 509105 509695 - BALIOE_02405 hypothetical protein
487 c1 cds 509658 510569 - BALIOE_02410 hypothetical protein
488 c1 cds 510737 511228 + BALIOE_02415 hypothetical protein
489 c1 cds 511356 512720 - BALIOE_02420 hypothetical protein
490 c1 cds 512869 513759 - BALIOE_02425 hypothetical protein
491 c1 cds 513771 514100 - BALIOE_02430 hypothetical protein
492 c1 cds 514100 514714 - BALIOE_02435 hypothetical protein
493 c1 cds 514704 516695 - BALIOE_02440 hypothetical protein
494 c1 cds 516717 517664 - BALIOE_02445 hypothetical protein
495 c1 cds 518124 519599 - BALIOE_02450 hypothetical protein
496 c1 cds 519643 520221 - BALIOE_02455 hypothetical protein
497 c1 cds 520529 520843 + BALIOE_02460 hypothetical protein
498 c1 cds 521187 522485 + BALIOE_02465 hypothetical protein
499 c1 cds 522730 523353 + BALIOE_02470 hypothetical protein
500 c1 cds 523479 524753 + BALIOE_02475 hypothetical protein
501 c1 cds 524941 527295 + BALIOE_02480 hypothetical protein
502 c1 cds 527504 527776 + BALIOE_02485 hypothetical protein
503 c1 cds 527968 529839 + BALIOE_02490 hypothetical protein
504 c1 cds 529990 530361 + BALIOE_02495 hypothetical protein
505 c1 cds 530467 530865 + BALIOE_02500 hypothetical protein
506 c1 cds 530917 531612 - BALIOE_02505 hypothetical protein
507 c1 cds 531677 533377 - BALIOE_02510 hypothetical protein
508 c1 cds 533477 534295 + BALIOE_02515 hypothetical protein
509 c1 cds 534447 534905 + BALIOE_02520 hypothetical protein
510 c1 cds 534935 536707 + BALIOE_02525 hypothetical protein
511 c1 cds 536700 538481 + BALIOE_02530 hypothetical protein
512 c1 cds 538662 539000 + BALIOE_02535 hypothetical protein
513 c1 cds 539030 540316 + BALIOE_02540 hypothetical protein
514 c1 cds 540365 541225 - BALIOE_02545 hypothetical protein
515 c1 cds 541443 542015 + BALIOE_02550 hypothetical protein
516 c1 cds 542048 542359 - BALIOE_02555 hypothetical protein
517 c1 cds 542738 543091 + BALIOE_02560 hypothetical protein
518 c1 cds 543133 544683 - BALIOE_02565 hypothetical protein
519 c1 cds 544847 545317 - BALIOE_02570 hypothetical protein
520 c1 cds 545433 545984 - BALIOE_02575 hypothetical protein
521 c1 cds 546156 546374 - BALIOE_02580 hypothetical protein
522 c1 cds 546400 546774 - BALIOE_02585 hypothetical protein
523 c1 cds 547320 550469 - BALIOE_02590 hypothetical protein
524 c1 cds 550492 551685 - BALIOE_02595 hypothetical protein
525 c1 cds 551827 552474 + BALIOE_02600 hypothetical protein
526 c1 cds 552602 555964 + BALIOE_02605 hypothetical protein
527 c1 cds 556003 556167 - BALIOE_02610 hypothetical protein
528 c1 cds 556181 556708 - BALIOE_02615 hypothetical protein
529 c1 cds 556778 557155 + BALIOE_02620 hypothetical protein
530 c1 cds 557308 557859 + BALIOE_02625 hypothetical protein
531 c1 cds 557988 559919 + BALIOE_02630 hypothetical protein
532 c1 cds 559972 560301 + BALIOE_02635 hypothetical protein
533 c1 cds 560301 560906 + BALIOE_02640 hypothetical protein
534 c1 cds 561016 562890 + BALIOE_02645 hypothetical protein
535 c1 cds 563011 563715 + BALIOE_02650 hypothetical protein
536 c1 cds 563847 564809 + BALIOE_02655 hypothetical protein
537 c1 cds 564806 565765 - BALIOE_02660 hypothetical protein
538 c1 cds 565917 567221 + BALIOE_02665 hypothetical protein
539 c1 ncRNA 567239 567316 + BALIOE_02670 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
540 c1 cds 567354 569030 - BALIOE_02675 hypothetical protein
541 c1 cds 569267 570487 - BALIOE_02680 hypothetical protein
542 c1 cds 570514 570708 + BALIOE_02685 hypothetical protein
543 c1 cds 570705 572357 + BALIOE_02690 hypothetical protein
544 c1 cds 572394 572873 - BALIOE_02695 hypothetical protein
545 c1 cds 573077 573871 - BALIOE_02700 hypothetical protein
546 c1 cds 573955 574350 + BALIOE_02705 hypothetical protein
547 c1 ncRNA 574376 574453 + BALIOE_02710 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
548 c1 ncRNA 574376 574453 - BALIOE_02715 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
549 c1 cds 574565 577069 - BALIOE_02720 hypothetical protein
550 c1 cds 577331 578263 + BALIOE_02725 hypothetical protein
551 c1 cds 578266 579558 + BALIOE_02730 hypothetical protein
552 c1 cds 579896 581251 + BALIOE_02735 hypothetical protein
553 c1 cds 581354 585739 + BALIOE_02740 hypothetical protein
554 c1 cds 585947 601822 + BALIOE_02745 hypothetical protein
555 c1 cds 601826 603988 + BALIOE_02750 hypothetical protein
556 c1 cds 603985 605160 + BALIOE_02755 hypothetical protein
557 c1 cds 605157 605564 + BALIOE_02760 hypothetical protein
558 c1 cds 605568 605771 - BALIOE_02765 hypothetical protein
559 c1 cds 605768 606190 - BALIOE_02770 hypothetical protein
560 c1 cds 606275 607291 - BALIOE_02775 hypothetical protein
561 c1 cds 607658 608020 + BALIOE_02780 hypothetical protein
562 c1 ncRNA 608071 608148 - BALIOE_02785 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
563 c1 cds 608199 608657 - BALIOE_02790 hypothetical protein
564 c1 cds 608654 609571 - BALIOE_02795 hypothetical protein
565 c1 cds 609717 610394 + BALIOE_02800 hypothetical protein
566 c1 cds 610381 611160 + BALIOE_02805 hypothetical protein
567 c1 cds 611223 612077 - BALIOE_02810 hypothetical protein
568 c1 cds 612138 612947 - BALIOE_02815 hypothetical protein
569 c1 cds 612937 613530 - BALIOE_02820 hypothetical protein
570 c1 cds 613531 614217 + BALIOE_02825 hypothetical protein
571 c1 cds 614214 616628 + BALIOE_02830 hypothetical protein
572 c1 cds 617058 621254 + BALIOE_02835 hypothetical protein
573 c1 cds 621235 621495 + BALIOE_02840 hypothetical protein
574 c1 cds 622239 622610 - BALIOE_02845 hypothetical protein
575 c1 cds 622726 623820 - BALIOE_02850 hypothetical protein
576 c1 cds 623889 624815 - BALIOE_02855 hypothetical protein
577 c1 cds 625045 625527 + BALIOE_02860 hypothetical protein
578 c1 cds 625605 626420 + BALIOE_02865 hypothetical protein
579 c1 cds 626510 628291 + BALIOE_02870 hypothetical protein
580 c1 cds 628304 629080 + BALIOE_02875 hypothetical protein
581 c1 cds 629181 630059 + BALIOE_02880 hypothetical protein
582 c1 cds 630228 631619 + BALIOE_02885 hypothetical protein
583 c1 cds 631656 632546 + BALIOE_02890 hypothetical protein
584 c1 cds 632553 633017 + BALIOE_02895 Allantoinase SO:0001217, UniRef:UniRef50_A0A091C0K5, UniRef:UniRef90_A0A376X1Z1
585 c1 cds 633074 634375 + BALIOE_02900 hypothetical protein
586 c1 cds 634397 635542 + BALIOE_02905 hypothetical protein
587 c1 cds 635770 636555 - BALIOE_02910 hypothetical protein
588 c1 cds 636566 637801 - BALIOE_02915 hypothetical protein
589 c1 cds 637823 638872 - BALIOE_02920 hypothetical protein
590 c1 cds 639189 640856 + BALIOE_02925 hypothetical protein
591 c1 cds 640866 642125 + BALIOE_02930 hypothetical protein
592 c1 cds 642136 642951 + BALIOE_02935 hypothetical protein
593 c1 cds 642948 643841 + BALIOE_02940 hypothetical protein
594 c1 cds 643980 645047 - BALIOE_02945 hypothetical protein
595 c1 cds 645044 645553 - BALIOE_02950 hypothetical protein
596 c1 cds 645671 646393 - BALIOE_02955 hypothetical protein
597 c1 cds 646396 646890 - BALIOE_02960 hypothetical protein
598 c1 cds 647064 648449 + BALIOE_02965 hypothetical protein
599 c1 cds 648485 649006 - BALIOE_02970 hypothetical protein
600 c1 cds 649114 649326 - BALIOE_02975 hypothetical protein
601 c1 cds 649328 650194 - BALIOE_02980 hypothetical protein
602 c1 cds 650665 651207 + BALIOE_02985 hypothetical protein
603 c1 cds 651427 652119 + BALIOE_02990 hypothetical protein
604 c1 cds 652150 654759 + BALIOE_02995 hypothetical protein
605 c1 cds 654772 655779 + BALIOE_03000 hypothetical protein
606 c1 cds 655790 656305 + BALIOE_03005 hypothetical protein
607 c1 cds 656308 656940 - BALIOE_03010 hypothetical protein
608 c1 tRNA 657183 657259 + BALIOE_03015 Arg_trna tRNA-Arg SO:0001036
609 c1 cds 657305 658066 - BALIOE_03020 hypothetical protein
610 c1 cds 658249 659139 - BALIOE_03025 hypothetical protein
611 c1 cds 659140 662112 - BALIOE_03030 hypothetical protein
612 c1 cds 662099 664336 - BALIOE_03035 hypothetical protein
613 c1 cds 664602 665738 - BALIOE_03040 hypothetical protein
614 c1 cds 665953 666174 - BALIOE_03045 hypothetical protein
615 c1 cds 666201 667535 - BALIOE_03050 hypothetical protein
616 c1 cds 667704 668111 - BALIOE_03055 hypothetical protein
617 c1 cds 668129 672979 - BALIOE_03060 hypothetical protein
618 c1 cds 672999 673460 - BALIOE_03065 hypothetical protein
619 c1 cds 673488 675389 - BALIOE_03070 hypothetical protein
620 c1 cds 675983 677431 - BALIOE_03075 hypothetical protein
621 c1 cds 677421 678104 - BALIOE_03080 hypothetical protein
622 c1 cds 678261 679643 + BALIOE_03085 hypothetical protein
623 c1 cds 679667 679999 + BALIOE_03090 hypothetical protein
624 c1 cds 680015 681238 + BALIOE_03095 hypothetical protein
625 c1 cds 681250 684387 + BALIOE_03100 hypothetical protein
626 c1 cds 684489 685865 + BALIOE_03105 hypothetical protein
627 c1 cds 685933 687180 - BALIOE_03110 hypothetical protein
628 c1 cds 687288 687941 - BALIOE_03115 hypothetical protein
629 c1 cds 688035 688403 - BALIOE_03120 hypothetical protein
630 c1 cds 688468 688668 - BALIOE_03125 hypothetical protein
631 c1 cds 688782 689900 - BALIOE_03130 hypothetical protein
632 c1 cds 690339 690491 + BALIOE_03135 hypothetical protein
633 c1 cds 690842 690994 + BALIOE_03140 hypothetical protein
634 c1 cds 691116 691859 - BALIOE_03145 hypothetical protein
635 c1 cds 691911 694151 - BALIOE_03150 hypothetical protein
636 c1 cds 694394 695596 + BALIOE_03155 hypothetical protein
637 c1 cds 695599 695817 + BALIOE_03160 hypothetical protein
638 c1 cds 695814 699695 + BALIOE_03165 hypothetical protein
639 c1 cds 699911 701044 + BALIOE_03170 hypothetical protein
640 c1 cds 701041 701856 - BALIOE_03175 hypothetical protein
641 c1 cds 701853 702845 - BALIOE_03180 hypothetical protein
642 c1 cds 702842 703846 - BALIOE_03185 hypothetical protein
643 c1 cds 703957 705207 + BALIOE_03190 hypothetical protein
644 c1 cds 705211 706167 - BALIOE_03195 hypothetical protein
645 c1 cds 706356 707531 + BALIOE_03200 hypothetical protein
646 c1 cds 707541 709151 + BALIOE_03205 hypothetical protein
647 c1 cds 709165 710022 + BALIOE_03210 hypothetical protein
648 c1 cds 710022 710768 + BALIOE_03215 hypothetical protein
649 c1 cds 710771 711184 + BALIOE_03220 hypothetical protein
650 c1 cds 711365 713470 + BALIOE_03225 hypothetical protein
651 c1 cds 713652 713849 + BALIOE_03230 hypothetical protein
652 c1 cds 713859 714947 - BALIOE_03235 hypothetical protein
653 c1 cds 715056 716216 + BALIOE_03240 hypothetical protein
654 c1 cds 716217 716846 - BALIOE_03245 hypothetical protein
655 c1 cds 716819 718039 - BALIOE_03250 hypothetical protein
656 c1 cds 718186 719088 - BALIOE_03255 hypothetical protein
657 c1 cds 719298 720044 - BALIOE_03260 hypothetical protein
658 c1 cds 720416 720979 + BALIOE_03265 hypothetical protein PFAM:PF10417.10
659 c1 cds 721078 722673 + BALIOE_03270 hypothetical protein
660 c1 cds 722794 723222 - BALIOE_03275 hypothetical protein
661 c1 cds 723443 724681 + BALIOE_03280 hypothetical protein
662 c1 cds 724685 724774 - BALIOE_03285 hypothetical protein
663 c1 cds 724912 725322 - BALIOE_03290 hypothetical protein
664 c1 cds 725552 726358 - BALIOE_03295 hypothetical protein
665 c1 cds 726472 727935 - BALIOE_03300 hypothetical protein
666 c1 cds 727986 728864 - BALIOE_03305 hypothetical protein
667 c1 cds 728839 729390 - BALIOE_03310 hypothetical protein
668 c1 cds 729394 730926 - BALIOE_03315 hypothetical protein
669 c1 cds 730937 731845 - BALIOE_03320 hypothetical protein
670 c1 cds 731842 732138 - BALIOE_03325 hypothetical protein
671 c1 cds 732153 733211 - BALIOE_03330 hypothetical protein
672 c1 cds 733591 735249 + BALIOE_03335 hypothetical protein
673 c1 cds 735218 735898 + BALIOE_03340 hypothetical protein
674 c1 cds 735939 737324 - BALIOE_03345 hypothetical protein
675 c1 cds 737913 738473 + BALIOE_03350 hypothetical protein
676 c1 cds 738648 738857 + BALIOE_03355 hypothetical protein
677 c1 cds 738911 739294 - BALIOE_03360 hypothetical protein
678 c1 cds 739387 740175 + BALIOE_03365 hypothetical protein
679 c1 cds 740304 740507 + BALIOE_03370 hypothetical protein
680 c1 cds 740608 741573 - BALIOE_03375 hypothetical protein
681 c1 cds 741782 742735 - BALIOE_03380 hypothetical protein
682 c1 cds 742995 743636 - BALIOE_03385 hypothetical protein
683 c1 cds 743737 744000 - BALIOE_03390 hypothetical protein
684 c1 cds 744110 745321 - BALIOE_03395 hypothetical protein
685 c1 cds 745461 746549 - BALIOE_03400 hypothetical protein
686 c1 cds 746560 747672 - BALIOE_03405 hypothetical protein
687 c1 cds 747675 749576 - BALIOE_03410 hypothetical protein
688 c1 cds 749607 750074 - BALIOE_03415 hypothetical protein
689 c1 cds 750078 750395 - BALIOE_03420 hypothetical protein
690 c1 cds 750655 751266 - BALIOE_03425 hypothetical protein
691 c1 cds 751290 751931 - BALIOE_03430 hypothetical protein
692 c1 cds 751933 752964 - BALIOE_03435 hypothetical protein
693 c1 cds 752964 753545 - BALIOE_03440 hypothetical protein
694 c1 cds 753560 756142 - BALIOE_03445 hypothetical protein
695 c1 cds 756378 756860 + BALIOE_03450 hypothetical protein
696 c1 cds 756930 757517 - BALIOE_03455 hypothetical protein
697 c1 cds 757752 757907 - BALIOE_03460 hypothetical protein
698 c1 cds 758072 758779 + BALIOE_03465 hypothetical protein
699 c1 cds 758776 760203 + BALIOE_03470 hypothetical protein
700 c1 cds 760213 760767 - BALIOE_03475 hypothetical protein
701 c1 cds 760869 761576 + BALIOE_03480 hypothetical protein
702 c1 cds 761573 762025 + BALIOE_03485 hypothetical protein
703 c1 cds 762188 763024 + BALIOE_03490 hypothetical protein
704 c1 cds 763084 764754 - BALIOE_03495 hypothetical protein
705 c1 cds 764838 765773 - BALIOE_03500 hypothetical protein
706 c1 cds 765891 766616 - BALIOE_03505 hypothetical protein
707 c1 cds 766616 767290 - BALIOE_03510 hypothetical protein
708 c1 cds 767290 768030 - BALIOE_03515 hypothetical protein
709 c1 cds 768200 769108 - BALIOE_03520 hypothetical protein
710 c1 cds 769505 771043 - BALIOE_03525 hypothetical protein
711 c1 cds 771068 771946 - BALIOE_03530 hypothetical protein
712 c1 cds 772036 772503 - BALIOE_03535 hypothetical protein
713 c1 cds 772500 773579 - BALIOE_03540 hypothetical protein
714 c1 cds 773693 775117 - BALIOE_03545 hypothetical protein
715 c1 cds 775263 776438 + BALIOE_03550 hypothetical protein
716 c1 tRNA 776592 776666 - BALIOE_03555 Gln_trna tRNA-Gln SO:0000261
717 c1 tRNA 776704 776778 - BALIOE_03560 Gln_trna tRNA-Gln SO:0000261
718 c1 tRNA 776827 776903 - BALIOE_03565 Met_trna tRNA-Met SO:0000266
719 c1 tRNA 776919 776993 - BALIOE_03570 Gln_trna tRNA-Gln SO:0000261
720 c1 tRNA 777028 777102 - BALIOE_03575 Gln_trna tRNA-Gln SO:0000261
721 c1 tRNA 777126 777210 - BALIOE_03580 Leu_trna tRNA-Leu SO:0000264
722 c1 tRNA 777221 777297 - BALIOE_03585 Met_trna tRNA-Met SO:0000266
723 c1 cds 777677 779341 - BALIOE_03590 hypothetical protein
724 c1 cds 779598 780350 - BALIOE_03595 hypothetical protein
725 c1 cds 780398 781618 - BALIOE_03600 hypothetical protein
726 c1 cds 781627 782775 - BALIOE_03605 hypothetical protein
727 c1 cds 782835 783635 - BALIOE_03610 hypothetical protein
728 c1 cds 783968 785914 + BALIOE_03615 hypothetical protein
729 c1 cds 786117 787781 + BALIOE_03620 hypothetical protein
730 c1 cds 788360 788839 + BALIOE_03625 hypothetical protein
731 c1 cds 788857 789765 + BALIOE_03630 hypothetical protein
732 c1 cds 789815 790141 + BALIOE_03635 hypothetical protein
733 c1 cds 790225 790671 - BALIOE_03640 hypothetical protein
734 c1 cds 790960 791490 - BALIOE_03645 hypothetical protein
735 c1 cds 791630 791992 - BALIOE_03650 hypothetical protein
736 c1 cds 792063 792827 - BALIOE_03655 hypothetical protein
737 c1 cds 793012 793557 + BALIOE_03660 hypothetical protein
738 c1 cds 793583 795223 + BALIOE_03665 hypothetical protein
739 c1 cds 795280 796599 - BALIOE_03670 hypothetical protein
740 c1 cds 796596 798794 - BALIOE_03675 hypothetical protein
741 c1 cds 799105 799209 - BALIOE_03680 hypothetical protein
742 c1 cds 799484 800161 - BALIOE_03685 hypothetical protein
743 c1 cds 800158 802842 - BALIOE_03690 hypothetical protein
744 c1 cds 802835 803407 - BALIOE_03695 hypothetical protein
745 c1 cds 803416 805464 - BALIOE_03700 hypothetical protein
746 c1 cds 805487 807160 - BALIOE_03705 hypothetical protein
747 c1 cds 807562 807768 + BALIOE_03710 hypothetical protein
748 c1 cds 808010 812209 + BALIOE_03715 hypothetical protein
749 c1 cds 812234 812776 + BALIOE_03720 hypothetical protein
750 c1 cds 814426 815499 + BALIOE_03725 hypothetical protein
751 c1 cds 815648 816157 + BALIOE_03730 hypothetical protein
752 c1 cds 816154 817572 + BALIOE_03735 hypothetical protein
753 c1 cds 817722 819203 - BALIOE_03740 hypothetical protein
754 c1 cds 819474 820217 + BALIOE_03745 hypothetical protein
755 c1 cds 820240 820896 + BALIOE_03750 hypothetical protein
756 c1 cds 820890 821822 + BALIOE_03755 hypothetical protein
757 c1 cds 821812 822546 + BALIOE_03760 hypothetical protein
758 c1 cds 822582 823373 + BALIOE_03765 hypothetical protein
759 c1 cds 823370 824416 - BALIOE_03770 hypothetical protein
760 c1 cds 824565 825626 - BALIOE_03775 hypothetical protein
761 c1 cds 825623 826354 - BALIOE_03780 hypothetical protein
762 c1 cds 826369 826518 - BALIOE_03785 hypothetical protein
763 c1 cds 826657 828819 - BALIOE_03790 hypothetical protein
764 c1 cds 828878 829444 - BALIOE_03795 hypothetical protein
765 c1 cds 829831 831114 - BALIOE_03800 hypothetical protein
766 c1 cds 831320 831427 - BALIOE_03805 hypothetical protein
767 c1 cds 831808 832212 + BALIOE_03810 hypothetical protein
768 c1 cds 832206 832553 + BALIOE_03815 hypothetical protein
769 c1 cds 832553 834319 + BALIOE_03820 hypothetical protein
770 c1 cds 834335 835051 + BALIOE_03825 hypothetical protein
771 c1 ncRNA 835058 835128 - BALIOE_03830 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
772 c1 cds 835352 838153 + BALIOE_03835 hypothetical protein
773 c1 cds 838168 839385 + BALIOE_03840 hypothetical protein
774 c1 cds 839479 840645 + BALIOE_03845 hypothetical protein
775 c1 cds 840645 841514 + BALIOE_03850 hypothetical protein
776 c1 cds 842181 843086 + BALIOE_03855 hypothetical protein
777 c1 cds 843120 843722 - BALIOE_03860 hypothetical protein
778 c1 cds 843732 845384 - BALIOE_03865 hypothetical protein
779 c1 cds 845492 846772 - BALIOE_03870 hypothetical protein
780 c1 cds 846933 847250 - BALIOE_03875 hypothetical protein
781 c1 cds 847247 848617 - BALIOE_03880 hypothetical protein
782 c1 cds 848621 849862 - BALIOE_03885 hypothetical protein
783 c1 cds 849862 851307 - BALIOE_03890 hypothetical protein
784 c1 cds 851326 852714 - BALIOE_03895 hypothetical protein
785 c1 cds 852714 853163 - BALIOE_03900 hypothetical protein
786 c1 cds 853711 854133 - BALIOE_03905 hypothetical protein
787 c1 cds 854215 855159 - BALIOE_03910 hypothetical protein
788 c1 cds 855965 857533 + BALIOE_03915 hypothetical protein
789 c1 cds 857549 858688 + BALIOE_03920 hypothetical protein
790 c1 cds 858703 858816 + BALIOE_03925 hypothetical protein
791 c1 cds 858816 859109 + BALIOE_03930 hypothetical protein
792 c1 cds 859259 859663 + BALIOE_03935 hypothetical protein
793 c1 cds 859660 860352 + BALIOE_03940 hypothetical protein
794 c1 cds 860356 860784 + BALIOE_03945 hypothetical protein
795 c1 cds 860849 862033 + BALIOE_03950 hypothetical protein
796 c1 cds 862166 863458 + BALIOE_03955 hypothetical protein
797 c1 cds 863493 864014 + BALIOE_03960 hypothetical protein
798 c1 cds 864024 864815 + BALIOE_03965 hypothetical protein
799 c1 tRNA 864980 865055 + BALIOE_03970 Lys_trna tRNA-Lys SO:0000265
800 c1 tRNA 865091 865166 + BALIOE_03975 Val_trna tRNA-Val SO:0000273
801 c1 tRNA 865169 865244 + BALIOE_03980 Lys_trna tRNA-Lys SO:0000265
802 c1 tRNA 865296 865371 + BALIOE_03985 Val_trna tRNA-Val SO:0000273
803 c1 tRNA 865375 865450 + BALIOE_03990 Lys_trna tRNA-Lys SO:0000265
804 c1 tRNA 865597 865672 + BALIOE_03995 Lys_trna tRNA-Lys SO:0000265
805 c1 cds 865950 866993 + BALIOE_04000 hypothetical protein
806 c1 cds 867031 867750 + BALIOE_04005 hypothetical protein
807 c1 cds 867747 868688 - BALIOE_04010 hypothetical protein
808 c1 cds 868802 869182 - BALIOE_04015 hypothetical protein
809 c1 cds 869498 870550 + BALIOE_04020 hypothetical protein
810 c1 cds 870716 871468 - BALIOE_04025 hypothetical protein
811 c1 cds 871670 872710 - BALIOE_04030 hypothetical protein
812 c1 cds 872704 873852 - BALIOE_04035 hypothetical protein
813 c1 cds 873856 874902 - BALIOE_04040 hypothetical protein
814 c1 cds 874912 875928 - BALIOE_04045 hypothetical protein
815 c1 cds 876190 877662 - BALIOE_04050 hypothetical protein
816 c1 cds 877730 878518 - BALIOE_04055 hypothetical protein
817 c1 cds 878647 878796 + BALIOE_04060 hypothetical protein
818 c1 cds 878963 879736 + BALIOE_04065 hypothetical protein
819 c1 cds 879736 880425 + BALIOE_04070 hypothetical protein
820 c1 cds 880428 881486 + BALIOE_04075 hypothetical protein
821 c1 cds 881487 882305 - BALIOE_04080 hypothetical protein
822 c1 cds 882460 883455 + BALIOE_04085 hypothetical protein
823 c1 cds 883496 884449 - BALIOE_04090 hypothetical protein
824 c1 cds 884633 885685 + BALIOE_04095 hypothetical protein
825 c1 cds 885761 887194 + BALIOE_04100 hypothetical protein
826 c1 cds 887377 889638 + BALIOE_04105 hypothetical protein
827 c1 cds 889779 891062 - BALIOE_04110 hypothetical protein
828 c1 cds 891197 891967 - BALIOE_04115 hypothetical protein
829 c1 cds 892499 892666 - BALIOE_04120 hypothetical protein
830 c1 cds 892909 893511 + BALIOE_04125 hypothetical protein
831 c1 cds 893722 893943 - BALIOE_04130 hypothetical protein
832 c1 cds 894042 894257 - BALIOE_04135 hypothetical protein
833 c1 cds 894334 894525 - BALIOE_04140 hypothetical protein
834 c1 cds 894498 894680 - BALIOE_04145 hypothetical protein
835 c1 cds 894677 895357 - BALIOE_04150 hypothetical protein
836 c1 cds 895354 896001 - BALIOE_04155 hypothetical protein
837 c1 cds 896394 897017 + BALIOE_04160 hypothetical protein
838 c1 cds 897014 897679 + BALIOE_04165 hypothetical protein
839 c1 cds 897891 898850 - BALIOE_04170 hypothetical protein
840 c1 cds 899325 900014 + BALIOE_04175 hypothetical protein
841 c1 cds 900198 900941 + BALIOE_04180 hypothetical protein
842 c1 cds 900880 901005 - BALIOE_04185 hypothetical protein
843 c1 cds 901807 902022 + BALIOE_04190 hypothetical protein
844 c1 cds 902022 902519 + BALIOE_04195 hypothetical protein
845 c1 cds 902516 902983 + BALIOE_04200 hypothetical protein
846 c1 cds 902971 903123 + BALIOE_04205 hypothetical protein
847 c1 cds 903798 904289 + BALIOE_04210 hypothetical protein
848 c1 cds 904289 906391 + BALIOE_04215 hypothetical protein
849 c1 cds 906388 906600 + BALIOE_04220 hypothetical protein
850 c1 cds 906600 907652 + BALIOE_04225 hypothetical protein
851 c1 cds 907747 908109 + BALIOE_04230 hypothetical protein
852 c1 cds 908054 910081 + BALIOE_04235 hypothetical protein
853 c1 cds 910168 910491 + BALIOE_04240 hypothetical protein
854 c1 cds 910484 910759 + BALIOE_04245 hypothetical protein
855 c1 cds 910771 911349 + BALIOE_04250 hypothetical protein
856 c1 cds 911346 911747 + BALIOE_04255 hypothetical protein
857 c1 cds 911758 912501 + BALIOE_04260 hypothetical protein
858 c1 cds 912562 912948 + BALIOE_04265 hypothetical protein
859 c1 cds 912957 913286 + BALIOE_04270 hypothetical protein
860 c1 cds 913258 916323 + BALIOE_04275 hypothetical protein
861 c1 cds 916323 916652 + BALIOE_04280 hypothetical protein
862 c1 cds 916662 917360 + BALIOE_04285 hypothetical protein
863 c1 cds 917366 918109 + BALIOE_04290 hypothetical protein
864 c1 cds 918142 918654 + BALIOE_04295 hypothetical protein
865 c1 cds 918715 922128 + BALIOE_04300 hypothetical protein
866 c1 cds 922199 922798 + BALIOE_04305 hypothetical protein
867 c1 cds 922858 924174 + BALIOE_04310 hypothetical protein
868 c1 cds 924176 924445 + BALIOE_04315 hypothetical protein
869 c1 cds 924622 925602 + BALIOE_04320 hypothetical protein
870 c1 cds 925636 926655 + BALIOE_04325 hypothetical protein
871 c1 cds 927756 928364 + BALIOE_04330 hypothetical protein
872 c1 cds 928399 928533 + BALIOE_04335 hypothetical protein
873 c1 cds 928595 929293 + BALIOE_04340 hypothetical protein
874 c1 cds 929800 930276 - BALIOE_04345 hypothetical protein
875 c1 cds 930335 931624 - BALIOE_04350 hypothetical protein
876 c1 cds 931711 932751 + BALIOE_04355 hypothetical protein
877 c1 cds 932748 933902 + BALIOE_04360 hypothetical protein
878 c1 cds 933889 934644 + BALIOE_04365 hypothetical protein
879 c1 cds 934637 935314 + BALIOE_04370 hypothetical protein
880 c1 cds 935893 937914 + BALIOE_04375 hypothetical protein
881 c1 cds 938105 939013 - BALIOE_04380 hypothetical protein
882 c1 cds 939410 940399 + BALIOE_04385 hypothetical protein
883 c1 cds 940421 940933 + BALIOE_04390 hypothetical protein
884 c1 cds 940936 941421 + BALIOE_04395 hypothetical protein
885 c1 cds 941414 941659 + BALIOE_04400 hypothetical protein
886 c1 cds 941661 942113 + BALIOE_04405 hypothetical protein
887 c1 cds 942249 942953 + BALIOE_04410 hypothetical protein
888 c1 cds 943161 943874 + BALIOE_04415 hypothetical protein
889 c1 cds 943910 944866 - BALIOE_04420 hypothetical protein
890 c1 cds 944866 946107 - BALIOE_04425 hypothetical protein
891 c1 cds 946104 946865 - BALIOE_04430 hypothetical protein
892 c1 cds 946998 947408 + BALIOE_04435 hypothetical protein
893 c1 cds 947370 948476 - BALIOE_04440 hypothetical protein
894 c1 cds 948487 949620 - BALIOE_04445 hypothetical protein
895 c1 cds 949613 951349 - BALIOE_04450 hypothetical protein
896 c1 cds 951342 952337 - BALIOE_04455 hypothetical protein
897 c1 cds 952340 953011 - BALIOE_04460 hypothetical protein
898 c1 cds 953240 954607 + BALIOE_04465 hypothetical protein
899 c1 cds 955215 957227 + BALIOE_04470 hypothetical protein
900 c1 cds 957511 959661 + BALIOE_04475 hypothetical protein
901 c1 cds 959689 960651 + BALIOE_04480 hypothetical protein
902 c1 cds 960792 961877 + BALIOE_04485 hypothetical protein
903 c1 ncRNA 962029 962099 - BALIOE_04490 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
904 c1 cds 962106 962366 - BALIOE_04495 hypothetical protein
905 c1 cds 962631 962897 - BALIOE_04500 hypothetical protein
906 c1 cds 962973 963656 - BALIOE_04505 hypothetical protein
907 c1 cds 963701 965983 - BALIOE_04510 hypothetical protein
908 c1 cds 966248 966508 - BALIOE_04515 hypothetical protein
909 c1 cds 966784 967710 + BALIOE_04520 hypothetical protein
910 c1 cds 967707 969932 - BALIOE_04525 hypothetical protein
911 c1 cds 970049 970771 - BALIOE_04530 hypothetical protein
912 c1 cds 970768 971427 - BALIOE_04535 hypothetical protein
913 c1 cds 971565 972311 - BALIOE_04540 hypothetical protein
914 c1 cds 972715 973218 - BALIOE_04545 hypothetical protein
915 c1 cds 973517 974404 - BALIOE_04550 hypothetical protein
916 c1 cds 974757 975272 + BALIOE_04555 hypothetical protein
917 c1 cds 975321 976904 - BALIOE_04560 hypothetical protein
918 c1 cds 977176 977304 - BALIOE_04565 hypothetical protein
919 c1 cds 977490 977957 + BALIOE_04570 hypothetical protein
920 c1 cds 977954 979072 + BALIOE_04575 hypothetical protein
921 c1 cds 979130 980050 - BALIOE_04580 hypothetical protein
922 c1 cds 980269 981861 + BALIOE_04585 hypothetical protein
923 c1 cds 982029 983294 - BALIOE_04590 hypothetical protein
924 c1 cds 983446 984261 - BALIOE_04595 hypothetical protein
925 c1 cds 984407 986206 - BALIOE_04600 hypothetical protein
926 c1 cds 986284 986838 - BALIOE_04605 hypothetical protein
927 c1 cds 986844 987743 - BALIOE_04610 hypothetical protein
928 c1 cds 987874 988536 + BALIOE_04615 hypothetical protein
929 c1 ncRNA 988625 988702 + BALIOE_04620 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
930 c1 cds 988715 989464 - BALIOE_04625 hypothetical protein
931 c1 cds 989464 990699 - BALIOE_04630 hypothetical protein
932 c1 cds 990903 991250 + BALIOE_04635 hypothetical protein
933 c1 cds 991263 991868 + BALIOE_04640 hypothetical protein
934 c1 cds 991855 993726 + BALIOE_04645 hypothetical protein
935 c1 cds 993746 995284 + BALIOE_04650 hypothetical protein
936 c1 cds 995302 996222 + BALIOE_04655 hypothetical protein
937 c1 cds 996225 997136 + BALIOE_04660 hypothetical protein
938 c1 cds 997314 999662 + BALIOE_04665 hypothetical protein
939 c1 cds 999670 1000998 + BALIOE_04670 hypothetical protein
940 c1 cds 1001068 1001397 - BALIOE_04675 hypothetical protein
941 c1 cds 1001387 1001773 - BALIOE_04680 hypothetical protein
942 c1 cds 1001999 1003324 - BALIOE_04685 hypothetical protein
943 c1 cds 1003537 1003920 + BALIOE_04690 hypothetical protein
944 c1 cds 1004031 1005146 + BALIOE_04695 hypothetical protein
945 c1 cds 1005143 1005769 - BALIOE_04700 hypothetical protein
946 c1 cds 1006015 1007217 + BALIOE_04705 hypothetical protein
947 c1 cds 1007264 1008022 - BALIOE_04710 hypothetical protein
948 c1 cds 1008080 1008676 - BALIOE_04715 hypothetical protein
949 c1 cds 1008961 1010193 + BALIOE_04720 hypothetical protein
950 c1 cds 1010234 1010512 - BALIOE_04725 hypothetical protein
951 c1 cds 1010604 1011419 - BALIOE_04730 hypothetical protein
952 c1 cds 1011419 1012627 - BALIOE_04735 hypothetical protein
953 c1 cds 1012711 1013247 + BALIOE_04740 hypothetical protein
954 c1 cds 1013422 1015107 - BALIOE_04745 hypothetical protein
955 c1 cds 1015377 1015754 + BALIOE_04750 hypothetical protein
956 c1 cds 1015784 1016041 - BALIOE_04755 hypothetical protein
957 c1 cds 1016201 1016488 + BALIOE_04760 hypothetical protein
958 c1 cds 1016472 1017194 + BALIOE_04765 hypothetical protein
959 c1 cds 1017255 1018157 + BALIOE_04770 hypothetical protein
960 c1 cds 1018245 1018721 + BALIOE_04775 hypothetical protein
961 c1 cds 1019072 1020184 + BALIOE_04780 hypothetical protein
962 c1 cds 1020279 1021412 + BALIOE_04785 hypothetical protein
963 c1 cds 1021422 1022375 + BALIOE_04790 hypothetical protein
964 c1 cds 1022372 1023217 + BALIOE_04795 hypothetical protein
965 c1 cds 1023277 1023765 + BALIOE_04800 hypothetical protein
966 c1 cds 1023806 1024933 + BALIOE_04805 hypothetical protein
967 c1 cds 1025231 1026556 + BALIOE_04810 hypothetical protein
968 c1 cds 1026578 1026898 + BALIOE_04815 hypothetical protein
969 c1 cds 1026910 1028391 + BALIOE_04820 hypothetical protein
970 c1 cds 1028442 1029173 - BALIOE_04825 hypothetical protein
971 c1 cds 1029327 1029464 - BALIOE_04830 hypothetical protein
972 c1 ncRNA 1029351 1029431 + BALIOE_04835 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
973 c1 cds 1029464 1030132 - BALIOE_04840 hypothetical protein
974 c1 cds 1030132 1030848 - BALIOE_04845 hypothetical protein
975 c1 cds 1030855 1031586 - BALIOE_04850 hypothetical protein
976 c1 cds 1031604 1032332 - BALIOE_04855 hypothetical protein
977 c1 cds 1032550 1033065 - BALIOE_04860 hypothetical protein
978 c1 cds 1033689 1034930 + BALIOE_04865 hypothetical protein
979 c1 cds 1035205 1035495 + BALIOE_04870 hypothetical protein
980 c1 cds 1035706 1036029 + BALIOE_04875 hypothetical protein
981 c1 cds 1036026 1036856 + BALIOE_04880 hypothetical protein
982 c1 cds 1036853 1037866 - BALIOE_04885 hypothetical protein
983 c1 cds 1037965 1039395 - BALIOE_04890 hypothetical protein
984 c1 cds 1039406 1040407 - BALIOE_04895 hypothetical protein
985 c1 cds 1040444 1042162 - BALIOE_04900 hypothetical protein
986 c1 cds 1042295 1043263 - BALIOE_04905 hypothetical protein
987 c1 cds 1043275 1044927 - BALIOE_04910 hypothetical protein
988 c1 cds 1045071 1045970 - BALIOE_04915 hypothetical protein
989 c1 cds 1046428 1047123 - BALIOE_04920 hypothetical protein
990 c1 cds 1047549 1049207 + BALIOE_04925 hypothetical protein
991 c1 cds 1049204 1050196 - BALIOE_04930 hypothetical protein
992 c1 cds 1050311 1051426 + BALIOE_04935 hypothetical protein
993 c1 cds 1051423 1053369 + BALIOE_04940 hypothetical protein
994 c1 cds 1053442 1053666 - BALIOE_04945 hypothetical protein
995 c1 cds 1053989 1054309 + BALIOE_04950 hypothetical protein
996 c1 cds 1054340 1056616 + BALIOE_04955 hypothetical protein
997 c1 tRNA 1056962 1057049 - BALIOE_04960 Ser_trna tRNA-Ser SO:0000269
998 c1 cds 1057303 1057521 - BALIOE_04965 hypothetical protein
999 c1 cds 1057806 1058510 - BALIOE_04970 hypothetical protein
1000 c1 cds 1058552 1060273 - BALIOE_04975 hypothetical protein
1001 c1 cds 1060274 1062040 - BALIOE_04980 hypothetical protein
1002 c1 cds 1062163 1063128 - BALIOE_04985 hypothetical protein
1003 c1 cds 1063673 1064167 + BALIOE_04990 hypothetical protein
1004 c1 cds 1064302 1068330 + BALIOE_04995 hypothetical protein
1005 c1 cds 1068485 1069096 + BALIOE_05000 hypothetical protein
1006 c1 cds 1069107 1070450 + BALIOE_05005 hypothetical protein
1007 c1 cds 1070541 1071833 + BALIOE_05010 hypothetical protein
1008 c1 cds 1072072 1074516 + BALIOE_05015 hypothetical protein
1009 c1 cds 1074527 1075144 + BALIOE_05020 hypothetical protein
1010 c1 cds 1075146 1076009 + BALIOE_05025 hypothetical protein
1011 c1 cds 1076045 1076671 - BALIOE_05030 hypothetical protein
1012 c1 cds 1076986 1078134 + BALIOE_05035 hypothetical protein
1013 c1 cds 1078344 1079774 + BALIOE_05040 hypothetical protein
1014 c1 cds 1079984 1080724 - BALIOE_05045 hypothetical protein
1015 c1 cds 1080916 1083198 - BALIOE_05050 hypothetical protein
1016 c1 cds 1083253 1084110 - BALIOE_05055 hypothetical protein
1017 c1 cds 1084516 1086276 - BALIOE_05060 hypothetical protein
1018 c1 cds 1086406 1087098 + BALIOE_05065 hypothetical protein
1019 c1 cds 1087297 1088385 + BALIOE_05070 hypothetical protein
1020 c1 cds 1088456 1089739 + BALIOE_05075 hypothetical protein
1021 c1 cds 1089908 1090672 + BALIOE_05080 hypothetical protein
1022 c1 cds 1090845 1091528 + BALIOE_05085 hypothetical protein
1023 c1 cds 1091639 1093312 + BALIOE_05090 hypothetical protein
1024 c1 cds 1093472 1093756 + BALIOE_05095 hypothetical protein
1025 c1 cds 1093963 1096227 + BALIOE_05100 hypothetical protein
1026 c1 cds 1096264 1098012 + BALIOE_05105 hypothetical protein
1027 c1 cds 1098009 1098995 + BALIOE_05110 hypothetical protein
1028 c1 cds 1099032 1100264 + BALIOE_05115 hypothetical protein
1029 c1 cds 1100316 1100498 + BALIOE_05120 hypothetical protein
1030 c1 cds 1100495 1101241 + BALIOE_05125 hypothetical protein
1031 c1 cds 1101395 1102288 + BALIOE_05130 hypothetical protein
1032 c1 cds 1102265 1103044 - BALIOE_05135 hypothetical protein
1033 c1 cds 1103180 1103965 + BALIOE_05140 hypothetical protein
1034 c1 cds 1103962 1105284 + BALIOE_05145 hypothetical protein
1035 c1 cds 1105265 1105969 + BALIOE_05150 hypothetical protein
1036 c1 cds 1105969 1110429 + BALIOE_05155 hypothetical protein
1037 c1 cds 1110690 1112537 + BALIOE_05160 hypothetical protein
1038 c1 cds 1112718 1113266 + BALIOE_05165 hypothetical protein
1039 c1 cds 1113293 1113940 + BALIOE_05170 hypothetical protein
1040 c1 cds 1113991 1115181 - BALIOE_05175 hypothetical protein
1041 c1 cds 1115366 1116454 - BALIOE_05180 hypothetical protein
1042 c1 cds 1117057 1118457 - BALIOE_05185 hypothetical protein
1043 c1 cds 1118626 1119828 - BALIOE_05190 hypothetical protein
1044 c1 cds 1120094 1122706 + BALIOE_05195 hypothetical protein
1045 c1 cds 1122749 1123516 - BALIOE_05200 hypothetical protein
1046 c1 cds 1123513 1124304 - BALIOE_05205 hypothetical protein
1047 c1 cds 1124316 1125461 - BALIOE_05210 hypothetical protein
1048 c1 cds 1125458 1126417 - BALIOE_05215 hypothetical protein
1049 c1 cds 1126410 1126985 - BALIOE_05220 hypothetical protein
1050 c1 cds 1127341 1127880 + BALIOE_05225 hypothetical protein
1051 c1 cds 1127963 1128664 + BALIOE_05230 hypothetical protein
1052 c1 cds 1128689 1129291 + BALIOE_05235 hypothetical protein
1053 c1 cds 1129327 1131288 + BALIOE_05240 hypothetical protein
1054 c1 cds 1131279 1132259 + BALIOE_05245 hypothetical protein
1055 c1 cds 1132428 1132904 + BALIOE_05250 hypothetical protein
1056 c1 cds 1132864 1133427 + BALIOE_05255 hypothetical protein
1057 c1 cds 1133441 1133962 + BALIOE_05260 hypothetical protein
1058 c1 cds 1134240 1135250 + BALIOE_05265 hypothetical protein
1059 c1 cds 1135424 1135966 + BALIOE_05270 hypothetical protein
1060 c1 cds 1135963 1137072 - BALIOE_05275 hypothetical protein
1061 c1 cds 1137316 1139424 + BALIOE_05280 hypothetical protein
1062 c1 cds 1139436 1141343 + BALIOE_05285 hypothetical protein
1063 c1 cds 1141473 1142726 + BALIOE_05290 hypothetical protein
1064 c1 cds 1142731 1144371 + BALIOE_05295 hypothetical protein
1065 c1 cds 1144368 1144931 + BALIOE_05300 hypothetical protein
1066 c1 cds 1145187 1145354 + BALIOE_05305 hypothetical protein
1067 c1 cds 1145424 1146050 - BALIOE_05310 hypothetical protein
1068 c1 cds 1146011 1147771 - BALIOE_05315 hypothetical protein
1069 c1 cds 1147957 1148409 + BALIOE_05320 hypothetical protein
1070 c1 cds 1148485 1149525 - BALIOE_05325 hypothetical protein
1071 c1 cds 1149882 1150391 - BALIOE_05330 hypothetical protein
1072 c1 cds 1150610 1151239 + BALIOE_05335 hypothetical protein
1073 c1 cds 1151202 1153364 - BALIOE_05340 hypothetical protein
1074 c1 cds 1153374 1153820 - BALIOE_05345 hypothetical protein
1075 c1 cds 1153943 1155997 + BALIOE_05350 hypothetical protein
1076 c1 cds 1156029 1156487 - BALIOE_05355 hypothetical protein
1077 c1 cds 1156583 1157245 - BALIOE_05360 hypothetical protein
1078 c1 cds 1157418 1157831 + BALIOE_05365 hypothetical protein
1079 c1 cds 1157876 1158193 - BALIOE_05370 hypothetical protein
1080 c1 cds 1158251 1159426 - BALIOE_05375 hypothetical protein
1081 c1 cds 1159536 1159814 + BALIOE_05380 hypothetical protein
1082 c1 cds 1159811 1160140 - BALIOE_05385 hypothetical protein
1083 c1 cds 1160231 1160890 - BALIOE_05390 hypothetical protein
1084 c1 tRNA 1161097 1161186 - BALIOE_05395 Ser_trna (pseudo) tRNA-Ser SO:0000269
1085 c1 cds 1161298 1162317 - BALIOE_05400 hypothetical protein
1086 c1 cds 1162295 1162537 - BALIOE_05405 hypothetical protein
1087 c1 cds 1162605 1165076 - BALIOE_05410 hypothetical protein
1088 c1 cds 1165170 1165361 - BALIOE_05415 hypothetical protein
1089 c1 cds 1165358 1165546 - BALIOE_05420 hypothetical protein
1090 c1 cds 1166120 1166305 + BALIOE_05425 hypothetical protein
1091 c1 cds 1166492 1166881 - BALIOE_05430 hypothetical protein
1092 c1 cds 1166893 1167021 - BALIOE_05435 hypothetical protein
1093 c1 cds 1167023 1167178 - BALIOE_05440 hypothetical protein
1094 c1 cds 1167743 1167934 - BALIOE_05445 hypothetical protein
1095 c1 cds 1167962 1168363 - BALIOE_05450 hypothetical protein
1096 c1 cds 1168472 1168744 + BALIOE_05455 hypothetical protein
1097 c1 cds 1168728 1169153 + BALIOE_05460 hypothetical protein
1098 c1 cds 1169360 1169815 - BALIOE_05465 hypothetical protein
1099 c1 cds 1169894 1170985 + BALIOE_05470 hypothetical protein
1100 c1 cds 1170992 1171738 + BALIOE_05475 hypothetical protein
1101 c1 cds 1171760 1172530 + BALIOE_05480 hypothetical protein
1102 c1 cds 1172546 1172959 + BALIOE_05485 hypothetical protein
1103 c1 cds 1173311 1174084 - BALIOE_05490 hypothetical protein
1104 c1 cds 1174450 1174587 - BALIOE_05495 hypothetical protein
1105 c1 cds 1174632 1174844 + BALIOE_05500 hypothetical protein
1106 c1 cds 1175292 1176341 + BALIOE_05505 hypothetical protein
1107 c1 cds 1176354 1176725 + BALIOE_05510 hypothetical protein
1108 c1 cds 1176715 1177086 + BALIOE_05515 hypothetical protein
1109 c1 cds 1177238 1178056 + BALIOE_05520 hypothetical protein
1110 c1 cds 1178343 1178582 + BALIOE_05525 hypothetical protein
1111 c1 cds 1178646 1178786 - BALIOE_05530 hypothetical protein
1112 c1 cds 1178803 1179390 + BALIOE_05535 hypothetical protein
1113 c1 tRNA 1179419 1179494 + BALIOE_05540 Ile2_trna tRNA-Ile2 SO:0000263
1114 c1 tRNA 1179502 1179578 + BALIOE_05545 Arg_trna tRNA-Arg SO:0001036
1115 c1 tRNA 1179592 1179668 + BALIOE_05550 Arg_trna tRNA-Arg SO:0001036
1116 c1 cds 1180158 1182008 + BALIOE_05555 hypothetical protein
1117 c1 cds 1182184 1182510 + BALIOE_05560 hypothetical protein
1118 c1 cds 1182510 1183160 + BALIOE_05565 hypothetical protein
1119 c1 cds 1183365 1183679 - BALIOE_05570 hypothetical protein
1120 c1 cds 1184145 1184669 - BALIOE_05575 hypothetical protein
1121 c1 cds 1184614 1184727 - BALIOE_05580 hypothetical protein
1122 c1 cds 1184948 1185481 - BALIOE_05585 hypothetical protein
1123 c1 cds 1185641 1185913 + BALIOE_05590 hypothetical protein
1124 c1 cds 1186169 1186375 - BALIOE_05595 hypothetical protein
1125 c1 cds 1187126 1187401 + BALIOE_05600 hypothetical protein
1126 c1 cds 1187477 1187857 + BALIOE_05605 hypothetical protein
1127 c1 cds 1187854 1188201 + BALIOE_05610 hypothetical protein
1128 c1 cds 1188251 1189789 + BALIOE_05615 hypothetical protein
1129 c1 cds 1189823 1189939 - BALIOE_05620 hypothetical protein
1130 c1 cds 1190017 1191981 + BALIOE_05625 hypothetical protein
1131 c1 cds 1191965 1192171 + BALIOE_05630 hypothetical protein
1132 c1 cds 1192168 1193760 + BALIOE_05635 hypothetical protein
1133 c1 cds 1193750 1195255 + BALIOE_05640 hypothetical protein
1134 c1 cds 1195292 1195639 + BALIOE_05645 hypothetical protein
1135 c1 cds 1195697 1195963 + BALIOE_05650 hypothetical protein
1136 c1 cds 1196056 1196685 + BALIOE_05655 hypothetical protein
1137 c1 cds 1196699 1197130 + BALIOE_05660 hypothetical protein
1138 c1 cds 1197157 1197570 + BALIOE_05665 hypothetical protein
1139 c1 cds 1197551 1200130 + BALIOE_05670 hypothetical protein
1140 c1 cds 1200127 1200456 + BALIOE_05675 hypothetical protein
1141 c1 cds 1200456 1201154 + BALIOE_05680 hypothetical protein
1142 c1 cds 1201165 1201908 + BALIOE_05685 hypothetical protein
1143 c1 cds 1201905 1202486 + BALIOE_05690 hypothetical protein
1144 c1 cds 1202677 1203204 - BALIOE_05695 hypothetical protein
1145 c1 cds 1203338 1206811 + BALIOE_05700 hypothetical protein
1146 c1 cds 1206879 1207478 + BALIOE_05705 hypothetical protein
1147 c1 cds 1207543 1208856 + BALIOE_05710 hypothetical protein
1148 c1 cds 1208858 1209127 + BALIOE_05715 hypothetical protein
1149 c1 cds 1209252 1209962 - BALIOE_05720 hypothetical protein
1150 c1 cds 1210601 1210783 - BALIOE_05725 hypothetical protein
1151 c1 tRNA 1210888 1210975 - BALIOE_05730 Ser_trna tRNA-Ser SO:0000269
1152 c1 cds 1211401 1212519 + BALIOE_05735 hypothetical protein
1153 c1 cds 1212516 1214309 + BALIOE_05740 hypothetical protein
1154 c1 cds 1214328 1215035 + BALIOE_05745 hypothetical protein
1155 c1 cds 1215032 1215619 + BALIOE_05750 hypothetical protein
1156 c1 cds 1215616 1216014 + BALIOE_05755 hypothetical protein
1157 c1 cds 1216011 1216868 + BALIOE_05760 hypothetical protein
1158 c1 cds 1217002 1218546 + BALIOE_05765 hypothetical protein
1159 c1 cds 1218558 1219694 + BALIOE_05770 hypothetical protein
1160 c1 cds 1219879 1221183 + BALIOE_05775 hypothetical protein
1161 c1 cds 1221303 1223483 - BALIOE_05780 hypothetical protein
1162 c1 cds 1223503 1223949 - BALIOE_05785 hypothetical protein
1163 c1 cds 1223937 1225076 - BALIOE_05790 hypothetical protein
1164 c1 cds 1225122 1227218 - BALIOE_05795 hypothetical protein
1165 c1 cds 1227218 1227964 - BALIOE_05800 hypothetical protein
1166 c1 cds 1227961 1228605 - BALIOE_05805 hypothetical protein
1167 c1 cds 1228712 1229017 - BALIOE_05810 hypothetical protein
1168 c1 cds 1229957 1230169 + BALIOE_05815 hypothetical protein
1169 c1 cds 1230784 1231857 - BALIOE_05820 hypothetical protein
1170 c1 cds 1231929 1234628 - BALIOE_05825 hypothetical protein
1171 c1 cds 1234756 1235784 + BALIOE_05830 hypothetical protein
1172 c1 cds 1235757 1236449 - BALIOE_05835 hypothetical protein
1173 c1 cds 1236579 1237751 + BALIOE_05840 hypothetical protein
1174 c1 cds 1237751 1240297 + BALIOE_05845 hypothetical protein
1175 c1 cds 1240294 1240893 + BALIOE_05850 hypothetical protein
1176 c1 ncRNA 1240905 1240985 - BALIOE_05855 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
1177 c1 cds 1241047 1241352 - BALIOE_05860 hypothetical protein
1178 c1 cds 1241352 1242272 - BALIOE_05865 hypothetical protein
1179 c1 cds 1242532 1243431 + BALIOE_05870 hypothetical protein
1180 c1 cds 1243541 1243789 + BALIOE_05875 hypothetical protein
1181 c1 cds 1244080 1245321 + BALIOE_05880 hypothetical protein
1182 c1 cds 1245359 1245586 - BALIOE_05885 hypothetical protein
1183 c1 cds 1245607 1246185 - BALIOE_05890 hypothetical protein
1184 c1 cds 1246182 1247492 - BALIOE_05895 hypothetical protein
1185 c1 cds 1247545 1247829 - BALIOE_05900 hypothetical protein
1186 c1 cds 1247915 1248214 - BALIOE_05905 hypothetical protein
1187 c1 cds 1248286 1248570 - BALIOE_05910 hypothetical protein
1188 c1 cds 1248563 1249186 - BALIOE_05915 hypothetical protein
1189 c1 cds 1249190 1249477 - BALIOE_05920 hypothetical protein
1190 c1 cds 1249479 1249697 - BALIOE_05925 hypothetical protein
1191 c1 cds 1249699 1249914 - BALIOE_05930 hypothetical protein
1192 c1 cds 1249916 1250104 - BALIOE_05935 hypothetical protein
1193 c1 cds 1250256 1251029 - BALIOE_05940 hypothetical protein
1194 c1 cds 1251026 1251247 - BALIOE_05945 hypothetical protein
1195 c1 cds 1251346 1251561 - BALIOE_05950 hypothetical protein
1196 c1 cds 1251638 1251829 - BALIOE_05955 hypothetical protein
1197 c1 cds 1251802 1251984 - BALIOE_05960 hypothetical protein
1198 c1 cds 1251981 1252661 - BALIOE_05965 hypothetical protein
1199 c1 cds 1252658 1253443 - BALIOE_05970 hypothetical protein
1200 c1 cds 1253449 1253745 - BALIOE_05975 hypothetical protein
1201 c1 cds 1253820 1253963 - BALIOE_05980 hypothetical protein
1202 c1 cds 1253932 1254096 - BALIOE_05985 hypothetical protein
1203 c1 cds 1254169 1254537 - BALIOE_05990 hypothetical protein
1204 c1 cds 1254720 1254971 - BALIOE_05995 hypothetical protein
1205 c1 cds 1255030 1255302 - BALIOE_06000 hypothetical protein
1206 c1 cds 1255280 1255462 - BALIOE_06005 hypothetical protein
1207 c1 cds 1256031 1256552 - BALIOE_06010 hypothetical protein
1208 c1 cds 1257054 1257707 - BALIOE_06015 hypothetical protein
1209 c1 cds 1257825 1258040 + BALIOE_06020 hypothetical protein
1210 c1 cds 1258182 1258478 + BALIOE_06025 hypothetical protein
1211 c1 cds 1258511 1258657 + BALIOE_06030 hypothetical protein
1212 c1 cds 1258650 1259549 + BALIOE_06035 hypothetical protein
1213 c1 cds 1259539 1260975 + BALIOE_06040 hypothetical protein
1214 c1 cds 1260975 1261244 + BALIOE_06045 hypothetical protein
1215 c1 cds 1261315 1261593 + BALIOE_06050 hypothetical protein
1216 c1 cds 1261726 1261941 + BALIOE_06055 hypothetical protein
1217 c1 cds 1261952 1262188 + BALIOE_06060 hypothetical protein
1218 c1 cds 1262145 1262591 + BALIOE_06065 hypothetical protein
1219 c1 cds 1262588 1263115 + BALIOE_06070 hypothetical protein
1220 c1 cds 1263569 1264303 + BALIOE_06075 hypothetical protein
1221 c1 cds 1264378 1265100 + BALIOE_06080 hypothetical protein
1222 c1 cds 1265100 1265705 + BALIOE_06085 hypothetical protein
1223 c1 cds 1265702 1265896 + BALIOE_06090 hypothetical protein
1224 c1 cds 1265889 1266323 + BALIOE_06095 hypothetical protein
1225 c1 tRNA 1266765 1266840 + BALIOE_06100 Ile2_trna tRNA-Ile2 SO:0000263
1226 c1 tRNA 1266850 1266926 + BALIOE_06105 Arg_trna tRNA-Arg SO:0001036
1227 c1 tRNA 1266940 1267016 + BALIOE_06110 Arg_trna tRNA-Arg SO:0001036
1228 c1 cds 1267107 1268066 + BALIOE_06115 hypothetical protein
1229 c1 cds 1268078 1268347 + BALIOE_06120 hypothetical protein
1230 c1 cds 1268834 1270738 + BALIOE_06125 hypothetical protein
1231 c1 cds 1270545 1271432 - BALIOE_06130 hypothetical protein
1232 c1 cds 1271432 1271758 - BALIOE_06135 hypothetical protein
1233 c1 cds 1271816 1272085 + BALIOE_06140 hypothetical protein
1234 c1 cds 1272220 1272399 + BALIOE_06145 hypothetical protein
1235 c1 cds 1272440 1272712 + BALIOE_06150 hypothetical protein
1236 c1 cds 1272789 1273004 + BALIOE_06155 hypothetical protein
1237 c1 cds 1273009 1273542 + BALIOE_06160 hypothetical protein
1238 c1 cds 1273813 1274382 + BALIOE_06165 hypothetical protein
1239 c1 cds 1274382 1274528 + BALIOE_06170 hypothetical protein
1240 c1 cds 1274536 1275000 + BALIOE_06175 hypothetical protein
1241 c1 cds 1275032 1275325 - BALIOE_06180 hypothetical protein
1242 c1 cds 1275475 1275678 + BALIOE_06185 hypothetical protein
1243 c1 cds 1275734 1276540 + BALIOE_06190 hypothetical protein
1244 c1 cds 1276521 1278227 + BALIOE_06195 hypothetical protein
1245 c1 cds 1278227 1280371 + BALIOE_06200 hypothetical protein
1246 c1 cds 1280529 1281536 + BALIOE_06205 hypothetical protein
1247 c1 cds 1281560 1282774 + BALIOE_06210 hypothetical protein
1248 c1 cds 1282830 1283219 + BALIOE_06215 hypothetical protein
1249 c1 cds 1283269 1283730 + BALIOE_06220 hypothetical protein
1250 c1 cds 1283714 1284277 + BALIOE_06225 hypothetical protein
1251 c1 cds 1284277 1284927 + BALIOE_06230 hypothetical protein
1252 c1 cds 1284924 1286861 + BALIOE_06235 hypothetical protein
1253 c1 cds 1286863 1287132 + BALIOE_06240 hypothetical protein
1254 c1 cds 1287272 1287460 + BALIOE_06245 hypothetical protein
1255 c1 cds 1287755 1289380 + BALIOE_06250 hypothetical protein
1256 c1 cds 1289377 1290645 + BALIOE_06255 hypothetical protein
1257 c1 cds 1290660 1290938 + BALIOE_06260 hypothetical protein
1258 c1 cds 1290944 1291561 + BALIOE_06265 hypothetical protein
1259 c1 cds 1291652 1292386 + BALIOE_06270 hypothetical protein
1260 c1 cds 1292619 1292759 + BALIOE_06275 hypothetical protein
1261 c1 cds 1292816 1293217 + BALIOE_06280 hypothetical protein
1262 c1 cds 1293311 1293967 + BALIOE_06285 hypothetical protein
1263 c1 cds 1293970 1294416 + BALIOE_06290 hypothetical protein
1264 c1 cds 1294426 1294677 + BALIOE_06295 hypothetical protein
1265 c1 cds 1294688 1295953 + BALIOE_06300 hypothetical protein
1266 c1 cds 1296023 1304404 + BALIOE_06305 hypothetical protein
1267 c1 cds 1304527 1304622 + BALIOE_06310 hypothetical protein
1268 c1 cds 1304955 1305299 - BALIOE_06315 hypothetical protein
1269 c1 cds 1305419 1305631 - BALIOE_06320 hypothetical protein
1270 c1 cds 1305865 1306260 - BALIOE_06325 hypothetical protein
1271 c1 cds 1306260 1306919 - BALIOE_06330 hypothetical protein
1272 c1 cds 1306940 1307158 - BALIOE_06335 hypothetical protein
1273 c1 cds 1307145 1307429 - BALIOE_06340 hypothetical protein
1274 c1 cds 1307426 1307647 - BALIOE_06345 hypothetical protein
1275 c1 cds 1307695 1308324 - BALIOE_06350 hypothetical protein
1276 c1 cds 1309283 1309390 + BALIOE_06355 hypothetical protein
1277 c1 cds 1309473 1310801 - BALIOE_06360 hypothetical protein
1278 c1 cds 1310822 1311316 - BALIOE_06365 hypothetical protein
1279 c1 cds 1311327 1311917 - BALIOE_06370 hypothetical protein
1280 c1 cds 1311927 1312727 - BALIOE_06375 hypothetical protein
1281 c1 cds 1312735 1313121 - BALIOE_06380 hypothetical protein
1282 c1 cds 1313133 1313828 - BALIOE_06385 hypothetical protein
1283 c1 cds 1313825 1314916 - BALIOE_06390 hypothetical protein
1284 c1 cds 1315204 1315842 + BALIOE_06395 hypothetical protein
1285 c1 cds 1315882 1319844 - BALIOE_06400 hypothetical protein
1286 c1 cds 1319899 1320108 + BALIOE_06405 hypothetical protein
1287 c1 cds 1320267 1321775 + BALIOE_06410 hypothetical protein
1288 c1 cds 1321924 1323267 - BALIOE_06415 hypothetical protein
1289 c1 cds 1324267 1324413 - BALIOE_06420 hypothetical protein
1290 c1 cds 1324449 1325279 + BALIOE_06425 hypothetical protein
1291 c1 cds 1325337 1326464 + BALIOE_06430 hypothetical protein
1292 c1 cds 1326470 1327741 + BALIOE_06435 hypothetical protein
1293 c1 cds 1328085 1329149 + BALIOE_06440 hypothetical protein
1294 c1 cds 1329199 1329612 - BALIOE_06445 hypothetical protein
1295 c1 cds 1329614 1330939 - BALIOE_06450 hypothetical protein
1296 c1 cds 1330932 1332950 - BALIOE_06455 hypothetical protein
1297 c1 cds 1332959 1335382 - BALIOE_06460 hypothetical protein
1298 c1 cds 1335969 1337327 + BALIOE_06465 hypothetical protein
1299 c1 cds 1337425 1339035 + BALIOE_06470 hypothetical protein
1300 c1 cds 1339137 1339628 - BALIOE_06475 hypothetical protein
1301 c1 cds 1339633 1340445 - BALIOE_06480 hypothetical protein
1302 c1 cds 1341133 1341915 + BALIOE_06485 hypothetical protein
1303 c1 cds 1342061 1342750 - BALIOE_06490 hypothetical protein
1304 c1 cds 1342747 1344081 - BALIOE_06495 hypothetical protein
1305 c1 cds 1344097 1346619 - BALIOE_06500 hypothetical protein
1306 c1 cds 1346672 1347373 - BALIOE_06505 hypothetical protein
1307 c1 cds 1347459 1348019 - BALIOE_06510 hypothetical protein
1308 c1 cds 1348062 1348685 - BALIOE_06515 hypothetical protein
1309 c1 cds 1348954 1349064 - BALIOE_06520 hypothetical protein
1310 c1 cds 1350076 1353888 + BALIOE_06525 hypothetical protein
1311 c1 cds 1353977 1355596 + BALIOE_06530 hypothetical protein
1312 c1 cds 1355612 1355980 + BALIOE_06535 hypothetical protein
1313 c1 cds 1355994 1356755 + BALIOE_06540 hypothetical protein
1314 c1 cds 1356759 1357307 + BALIOE_06545 hypothetical protein
1315 c1 cds 1357329 1357610 + BALIOE_06550 hypothetical protein
1316 c1 cds 1357646 1358806 + BALIOE_06555 hypothetical protein
1317 c1 cds 1358880 1361438 + BALIOE_06560 hypothetical protein
1318 c1 cds 1361443 1362666 + BALIOE_06565 hypothetical protein
1319 c1 cds 1362663 1363616 + BALIOE_06570 hypothetical protein
1320 c1 cds 1363627 1364334 + BALIOE_06575 hypothetical protein
1321 c1 cds 1364318 1364974 + BALIOE_06580 hypothetical protein
1322 c1 cds 1364975 1366285 + BALIOE_06585 hypothetical protein
1323 c1 cds 1366294 1367082 + BALIOE_06590 hypothetical protein
1324 c1 cds 1367079 1368467 + BALIOE_06595 hypothetical protein
1325 c1 cds 1368481 1369422 + BALIOE_06600 hypothetical protein
1326 c1 cds 1369419 1370405 + BALIOE_06605 hypothetical protein
1327 c1 cds 1370772 1371974 + BALIOE_06610 hypothetical protein
1328 c1 cds 1372161 1373978 - BALIOE_06615 hypothetical protein
1329 c1 cds 1376029 1377414 + BALIOE_06620 hypothetical protein
1330 c1 cds 1378235 1378798 + BALIOE_06625 hypothetical protein
1331 c1 cds 1378953 1381313 + BALIOE_06630 hypothetical protein
1332 c1 cds 1381475 1381744 - BALIOE_06635 hypothetical protein
1333 c1 cds 1382070 1383608 - BALIOE_06640 hypothetical protein
1334 c1 cds 1383658 1384005 - BALIOE_06645 hypothetical protein
1335 c1 cds 1384002 1384382 - BALIOE_06650 hypothetical protein
1336 c1 cds 1384458 1384769 - BALIOE_06655 hypothetical protein
1337 c1 cds 1384909 1385727 + BALIOE_06660 hypothetical protein
1338 c1 cds 1385840 1386379 + BALIOE_06665 hypothetical protein
1339 c1 cds 1386427 1386678 - BALIOE_06670 hypothetical protein
1340 c1 cds 1386702 1386992 - BALIOE_06675 hypothetical protein
1341 c1 cds 1387678 1388037 + BALIOE_06680 hypothetical protein
1342 c1 cds 1388130 1389749 - BALIOE_06685 hypothetical protein
1343 c1 cds 1389974 1390249 - BALIOE_06690 hypothetical protein
1344 c1 cds 1390630 1391328 + BALIOE_06695 hypothetical protein
1345 c1 cds 1391419 1391721 + BALIOE_06700 hypothetical protein
1346 c1 cds 1391730 1392050 + BALIOE_06705 hypothetical protein
1347 c1 cds 1392043 1393746 + BALIOE_06710 hypothetical protein
1348 c1 cds 1393756 1394220 + BALIOE_06715 hypothetical protein
1349 c1 cds 1394221 1394895 + BALIOE_06720 hypothetical protein
1350 c1 cds 1394907 1395524 + BALIOE_06725 hypothetical protein
1351 c1 cds 1395780 1396121 - BALIOE_06730 hypothetical protein
1352 c1 cds 1396183 1396311 - BALIOE_06735 hypothetical protein
1353 c1 cds 1396736 1396999 + BALIOE_06740 hypothetical protein
1354 c1 cds 1397301 1397441 + BALIOE_06745 hypothetical protein
1355 c1 cds 1398313 1398984 - BALIOE_06750 hypothetical protein
1356 c1 cds 1400517 1401002 - BALIOE_06755 hypothetical protein
1357 c1 cds 1401322 1401747 + BALIOE_06760 hypothetical protein
1358 c1 cds 1401744 1402094 + BALIOE_06765 hypothetical protein
1359 c1 cds 1402125 1403738 + BALIOE_06770 hypothetical protein
1360 c1 cds 1403742 1404599 - BALIOE_06775 hypothetical protein
1361 c1 cds 1404681 1405022 - BALIOE_06780 hypothetical protein
1362 c1 cds 1405009 1405338 - BALIOE_06785 hypothetical protein
1363 c1 cds 1405599 1406066 - BALIOE_06790 hypothetical protein
1364 c1 cds 1406084 1407292 - BALIOE_06795 hypothetical protein
1365 c1 cds 1407303 1408259 - BALIOE_06800 hypothetical protein
1366 c1 cds 1408259 1409338 - BALIOE_06805 hypothetical protein
1367 c1 cds 1409340 1410113 - BALIOE_06810 hypothetical protein
1368 c1 cds 1410106 1411248 - BALIOE_06815 hypothetical protein
1369 c1 cds 1411258 1412316 - BALIOE_06820 hypothetical protein
1370 c1 cds 1412639 1413220 + BALIOE_06825 hypothetical protein
1371 c1 cds 1413220 1414377 + BALIOE_06830 hypothetical protein
1372 c1 cds 1414400 1414855 + BALIOE_06835 hypothetical protein
1373 c1 cds 1414878 1415918 + BALIOE_06840 hypothetical protein
1374 c1 cds 1415967 1416545 + BALIOE_06845 hypothetical protein
1375 c1 cds 1416614 1417189 + BALIOE_06850 hypothetical protein
1376 c1 cds 1417611 1417919 + BALIOE_06855 hypothetical protein
1377 c1 cds 1418511 1420601 - BALIOE_06860 hypothetical protein
1378 c1 cds 1422054 1422272 + BALIOE_06865 hypothetical protein
1379 c1 cds 1423550 1423678 - BALIOE_06870 hypothetical protein
1380 c1 cds 1424021 1424215 - BALIOE_06875 hypothetical protein
1381 c1 cds 1424267 1424446 - BALIOE_06880 hypothetical protein
1382 c1 cds 1424535 1424807 + BALIOE_06885 hypothetical protein
1383 c1 cds 1425372 1425569 + BALIOE_06890 hypothetical protein
1384 c1 cds 1426299 1427423 + BALIOE_06895 hypothetical protein
1385 c1 cds 1427842 1428135 - BALIOE_06900 hypothetical protein
1386 c1 cds 1428777 1429235 - BALIOE_06905 hypothetical protein
1387 c1 cds 1429693 1430202 + BALIOE_06910 hypothetical protein
1388 c1 cds 1430291 1430914 + BALIOE_06915 hypothetical protein
1389 c1 cds 1431010 1431243 + BALIOE_06920 hypothetical protein
1390 c1 cds 1431296 1431487 - BALIOE_06925 hypothetical protein
1391 c1 cds 1432081 1432968 - BALIOE_06930 hypothetical protein
1392 c1 cds 1432968 1433294 - BALIOE_06935 hypothetical protein
1393 c1 cds 1433475 1434521 + BALIOE_06940 hypothetical protein
1394 c1 cds 1434762 1435277 + BALIOE_06945 hypothetical protein
1395 c1 cds 1435274 1437442 + BALIOE_06950 hypothetical protein
1396 c1 cds 1437943 1439175 + BALIOE_06955 hypothetical protein
1397 c1 cds 1439160 1439798 + BALIOE_06960 hypothetical protein
1398 c1 cds 1440167 1440811 + BALIOE_06965 hypothetical protein
1399 c1 cds 1441127 1441627 + BALIOE_06970 hypothetical protein
1400 c1 cds 1441509 1441757 - BALIOE_06975 hypothetical protein
1401 c1 cds 1441811 1442236 + BALIOE_06980 hypothetical protein
1402 c1 cds 1442233 1442322 + BALIOE_06985 hypothetical protein
1403 c1 cds 1442536 1442718 - BALIOE_06990 hypothetical protein
1404 c1 cds 1443047 1443919 + BALIOE_06995 hypothetical protein
1405 c1 cds 1444291 1447140 + BALIOE_07000 hypothetical protein
1406 c1 cds 1447251 1449635 + BALIOE_07005 hypothetical protein
1407 c1 cds 1449632 1450537 + BALIOE_07010 hypothetical protein
1408 c1 cds 1450534 1451604 + BALIOE_07015 hypothetical protein
1409 c1 cds 1451944 1452762 + BALIOE_07020 hypothetical protein
1410 c1 cds 1452853 1453338 + BALIOE_07025 hypothetical protein
1411 c1 cds 1453354 1453830 + BALIOE_07030 hypothetical protein
1412 c1 cds 1453893 1454114 + BALIOE_07035 hypothetical protein
1413 c1 cds 1454114 1454227 + BALIOE_07040 hypothetical protein
1414 c1 cds 1454277 1454651 + BALIOE_07045 hypothetical protein
1415 c1 cds 1454698 1455072 + BALIOE_07050 hypothetical protein
1416 c1 cds 1455069 1455560 + BALIOE_07055 hypothetical protein
1417 c1 cds 1455572 1455769 + BALIOE_07060 hypothetical protein
1418 c1 cds 1455854 1456696 + BALIOE_07065 hypothetical protein
1419 c1 tRNA 1456846 1456933 - BALIOE_07070 Ser_trna tRNA-Ser SO:0000269
1420 c1 cds 1457167 1458105 + BALIOE_07075 hypothetical protein
1421 c1 cds 1458160 1458897 + BALIOE_07080 hypothetical protein
1422 c1 cds 1458921 1459475 + BALIOE_07085 hypothetical protein
1423 c1 cds 1459547 1460068 + BALIOE_07090 hypothetical protein
1424 c1 cds 1460132 1460965 - BALIOE_07095 hypothetical protein
1425 c1 cds 1460992 1461408 - BALIOE_07100 hypothetical protein
1426 c1 cds 1461433 1461822 - BALIOE_07105 hypothetical protein
1427 c1 cds 1461827 1462477 - BALIOE_07110 hypothetical protein
1428 c1 cds 1463231 1463686 + BALIOE_07115 hypothetical protein
1429 c1 cds 1463727 1464185 + BALIOE_07120 hypothetical protein
1430 c1 cds 1464244 1464576 + BALIOE_07125 hypothetical protein
1431 c1 cds 1464697 1465008 + BALIOE_07130 hypothetical protein
1432 c1 cds 1465103 1465636 + BALIOE_07135 hypothetical protein
1433 c1 cds 1465578 1467059 + BALIOE_07140 hypothetical protein
1434 c1 cds 1467067 1468224 - BALIOE_07145 hypothetical protein
1435 c1 cds 1468650 1470152 + BALIOE_07150 hypothetical protein
1436 c1 cds 1470175 1472688 + BALIOE_07155 hypothetical protein
1437 c1 cds 1472861 1473088 + BALIOE_07160 hypothetical protein
1438 c1 cds 1473089 1473463 - BALIOE_07165 hypothetical protein
1439 c1 cds 1473546 1474517 - BALIOE_07170 hypothetical protein
1440 c1 cds 1474944 1475864 - BALIOE_07175 hypothetical protein
1441 c1 cds 1476089 1477141 + BALIOE_07180 hypothetical protein
1442 c1 cds 1477183 1477758 - BALIOE_07185 hypothetical protein
1443 c1 cds 1477762 1478328 - BALIOE_07190 hypothetical protein
1444 c1 cds 1478589 1478702 - BALIOE_07195 hypothetical protein
1445 c1 cds 1478750 1479868 - BALIOE_07200 hypothetical protein
1446 c1 cds 1479983 1480237 - BALIOE_07205 hypothetical protein
1447 c1 cds 1480527 1480772 - BALIOE_07210 hypothetical protein
1448 c1 cds 1480846 1481892 - BALIOE_07215 hypothetical protein
1449 c1 cds 1481998 1482558 - BALIOE_07220 hypothetical protein
1450 c1 cds 1482692 1483339 - BALIOE_07225 hypothetical protein
1451 c1 cds 1483403 1484611 - BALIOE_07230 hypothetical protein
1452 c1 cds 1484847 1485431 + BALIOE_07235 hypothetical protein
1453 c1 cds 1485442 1486089 + BALIOE_07240 hypothetical protein
1454 c1 cds 1486091 1487014 + BALIOE_07245 hypothetical protein
1455 c1 cds 1487124 1488659 + BALIOE_07250 hypothetical protein
1456 c1 cds 1488699 1489115 - BALIOE_07255 hypothetical protein
1457 c1 cds 1489120 1489413 - BALIOE_07260 hypothetical protein
1458 c1 cds 1489489 1490148 - BALIOE_07265 hypothetical protein
1459 c1 cds 1490303 1490719 + BALIOE_07270 hypothetical protein
1460 c1 cds 1490723 1491127 + BALIOE_07275 hypothetical protein
1461 c1 cds 1491139 1491834 + BALIOE_07280 hypothetical protein
1462 c1 cds 1491859 1493064 + BALIOE_07285 hypothetical protein
1463 c1 cds 1493084 1493839 + BALIOE_07290 hypothetical protein
1464 c1 cds 1493977 1494759 + BALIOE_07295 hypothetical protein
1465 c1 cds 1494812 1495510 + BALIOE_07300 hypothetical protein
1466 c1 cds 1495522 1496619 + BALIOE_07305 hypothetical protein
1467 c1 cds 1496619 1497560 + BALIOE_07310 hypothetical protein
1468 c1 cds 1497626 1499269 + BALIOE_07315 hypothetical protein
1469 c1 cds 1499281 1500234 + BALIOE_07320 hypothetical protein
1470 c1 cds 1500429 1503614 - BALIOE_07325 hypothetical protein
1471 c1 cds 1504187 1505146 + BALIOE_07330 hypothetical protein
1472 c1 cds 1505247 1505870 - BALIOE_07335 hypothetical protein
1473 c1 cds 1506030 1506551 + BALIOE_07340 hypothetical protein
1474 c1 cds 1506603 1506776 + BALIOE_07345 hypothetical protein
1475 c1 cds 1506887 1507927 + BALIOE_07350 hypothetical protein
1476 c1 cds 1507995 1508948 + BALIOE_07355 hypothetical protein
1477 c1 cds 1508964 1509893 + BALIOE_07360 hypothetical protein
1478 c1 cds 1509906 1510640 + BALIOE_07365 hypothetical protein
1479 c1 cds 1510851 1511087 + BALIOE_07370 hypothetical protein
1480 c1 cds 1511175 1512416 + BALIOE_07375 hypothetical protein
1481 c1 cds 1512536 1513345 + BALIOE_07380 hypothetical protein
1482 c1 cds 1513348 1514370 + BALIOE_07385 hypothetical protein
1483 c1 cds 1514360 1515001 + BALIOE_07390 hypothetical protein
1484 c1 cds 1514998 1516002 + BALIOE_07395 hypothetical protein
1485 c1 cds 1516013 1516810 + BALIOE_07400 hypothetical protein
1486 c1 cds 1517105 1518538 + BALIOE_07405 hypothetical protein
1487 c1 cds 1518598 1520787 - BALIOE_07410 hypothetical protein
1488 c1 cds 1521133 1521492 + BALIOE_07415 hypothetical protein
1489 c1 cds 1521495 1521872 + BALIOE_07420 hypothetical protein
1490 c1 cds 1521886 1522527 + BALIOE_07425 hypothetical protein
1491 c1 cds 1522508 1523332 + BALIOE_07430 hypothetical protein
1492 c1 cds 1523343 1524368 + BALIOE_07435 hypothetical protein
1493 c1 cds 1524391 1524933 + BALIOE_07440 hypothetical protein
1494 c1 cds 1525333 1526637 + BALIOE_07445 hypothetical protein
1495 c1 cds 1526864 1527403 + BALIOE_07450 hypothetical protein
1496 c1 cds 1527465 1528160 - BALIOE_07455 hypothetical protein
1497 c1 cds 1528338 1528595 + BALIOE_07460 hypothetical protein
1498 c1 cds 1528678 1529637 - BALIOE_07465 hypothetical protein
1499 c1 cds 1529784 1533278 - BALIOE_07470 hypothetical protein
1500 c1 cds 1533358 1534431 - BALIOE_07475 hypothetical protein
1501 c1 cds 1534693 1535892 + BALIOE_07480 hypothetical protein
1502 c1 cds 1535885 1536586 + BALIOE_07485 hypothetical protein
1503 c1 cds 1536592 1537830 + BALIOE_07490 hypothetical protein
1504 c1 cds 1537859 1538770 + BALIOE_07495 hypothetical protein
1505 c1 cds 1538786 1539607 + BALIOE_07500 hypothetical protein
1506 c1 cds 1539763 1540809 - BALIOE_07505 hypothetical protein
1507 c1 cds 1540806 1541600 - BALIOE_07510 hypothetical protein
1508 c1 cds 1541767 1542885 - BALIOE_07515 hypothetical protein
1509 c1 cds 1542854 1543123 - BALIOE_07520 hypothetical protein
1510 c1 cds 1543185 1543529 - BALIOE_07525 hypothetical protein
1511 c1 cds 1543707 1544222 + BALIOE_07530 hypothetical protein
1512 c1 cds 1544337 1544567 - BALIOE_07535 hypothetical protein
1513 c1 cds 1544805 1545281 - BALIOE_07540 hypothetical protein
1514 c1 cds 1545406 1545729 + BALIOE_07545 hypothetical protein
1515 c1 cds 1545713 1546138 + BALIOE_07550 hypothetical protein
1516 c1 cds 1546207 1547244 + BALIOE_07555 hypothetical protein
1517 c1 cds 1547276 1547698 + BALIOE_07560 hypothetical protein
1518 c1 cds 1547732 1548448 + BALIOE_07565 hypothetical protein
1519 c1 cds 1548445 1548762 + BALIOE_07570 hypothetical protein
1520 c1 cds 1548759 1549061 + BALIOE_07575 hypothetical protein
1521 c1 cds 1549051 1549368 + BALIOE_07580 hypothetical protein
1522 c1 cds 1549322 1549639 + BALIOE_07585 hypothetical protein
1523 c1 cds 1549626 1550063 + BALIOE_07590 hypothetical protein
1524 c1 cds 1550065 1550256 + BALIOE_07595 hypothetical protein
1525 c1 cds 1550259 1550846 + BALIOE_07600 hypothetical protein
1526 c1 cds 1550962 1551066 + BALIOE_07605 hypothetical protein
1527 c1 cds 1551255 1551467 + BALIOE_07610 hypothetical protein
1528 c1 cds 1551915 1552964 + BALIOE_07615 hypothetical protein
1529 c1 cds 1552977 1553351 + BALIOE_07620 hypothetical protein
1530 c1 cds 1553348 1554169 + BALIOE_07625 hypothetical protein
1531 c1 cds 1554623 1554769 + BALIOE_07630 hypothetical protein
1532 c1 cds 1554766 1554933 + BALIOE_07635 hypothetical protein
1533 c1 cds 1555248 1557185 + BALIOE_07640 hypothetical protein
1534 c1 cds 1557333 1557515 + BALIOE_07645 hypothetical protein
1535 c1 cds 1557553 1557822 + BALIOE_07650 hypothetical protein
1536 c1 cds 1557898 1558113 + BALIOE_07655 hypothetical protein
1537 c1 cds 1558118 1558462 + BALIOE_07660 hypothetical protein
1538 c1 cds 1558513 1559046 + BALIOE_07665 hypothetical protein
1539 c1 cds 1559317 1559886 + BALIOE_07670 hypothetical protein
1540 c1 cds 1559886 1560032 + BALIOE_07675 hypothetical protein
1541 c1 cds 1560040 1560507 + BALIOE_07680 hypothetical protein
1542 c1 cds 1560531 1560755 + BALIOE_07685 hypothetical protein
1543 c1 cds 1561112 1561252 + BALIOE_07690 hypothetical protein
1544 c1 cds 1561475 1561564 + BALIOE_07695 hypothetical protein
1545 c1 cds 1561609 1561974 + BALIOE_07700 hypothetical protein
1546 c1 cds 1562264 1562827 + BALIOE_07705 hypothetical protein
1547 c1 cds 1562824 1564485 + BALIOE_07710 hypothetical protein
1548 c1 cds 1564549 1566486 + BALIOE_07715 hypothetical protein
1549 c1 cds 1566531 1566752 + BALIOE_07720 hypothetical protein
1550 c1 cds 1566698 1569199 + BALIOE_07725 hypothetical protein
1551 c1 cds 1569279 1569605 + BALIOE_07730 hypothetical protein
1552 c1 cds 1569615 1569965 + BALIOE_07735 hypothetical protein
1553 c1 cds 1569962 1570408 + BALIOE_07740 hypothetical protein
1554 c1 cds 1570405 1570749 + BALIOE_07745 hypothetical protein
1555 c1 cds 1570808 1571524 + BALIOE_07750 hypothetical protein
1556 c1 cds 1571530 1571904 + BALIOE_07755 hypothetical protein
1557 c1 cds 1572000 1572209 + BALIOE_07760 hypothetical protein
1558 c1 cds 1572262 1575504 + BALIOE_07765 hypothetical protein
1559 c1 cds 1575497 1575838 + BALIOE_07770 hypothetical protein
1560 c1 cds 1575838 1576536 + BALIOE_07775 hypothetical protein
1561 c1 cds 1577330 1578208 + BALIOE_07780 hypothetical protein
1562 c1 cds 1578262 1578999 + BALIOE_07785 hypothetical protein
1563 c1 cds 1578996 1579181 + BALIOE_07790 hypothetical protein
1564 c1 cds 1579194 1579283 + BALIOE_07795 hypothetical protein
1565 c1 cds 1579303 1581651 + BALIOE_07800 hypothetical protein
1566 c1 cds 1582242 1585643 + BALIOE_07805 hypothetical protein
1567 c1 cds 1585812 1586261 + BALIOE_07810 hypothetical protein
1568 c1 cds 1586186 1587091 - BALIOE_07815 hypothetical protein
1569 c1 cds 1587253 1587414 - BALIOE_07820 hypothetical protein
1570 c1 cds 1587425 1587724 + BALIOE_07825 hypothetical protein
1571 c1 cds 1587866 1588099 + BALIOE_07830 hypothetical protein
1572 c1 cds 1588288 1589649 - BALIOE_07835 hypothetical protein
1573 c1 cds 1590013 1590876 - BALIOE_07840 hypothetical protein
1574 c1 cds 1590860 1591996 - BALIOE_07845 hypothetical protein
1575 c1 cds 1592246 1593472 + BALIOE_07850 hypothetical protein
1576 c1 cds 1593521 1594642 - BALIOE_07855 hypothetical protein
1577 c1 cds 1594891 1596120 + BALIOE_07860 hypothetical protein
1578 c1 cds 1596731 1597474 + BALIOE_07865 hypothetical protein
1579 c1 cds 1597500 1597697 + BALIOE_07870 hypothetical protein
1580 c1 cds 1597690 1597875 + BALIOE_07875 hypothetical protein
1581 c1 cds 1597875 1598066 + BALIOE_07880 hypothetical protein
1582 c1 cds 1598056 1598298 + BALIOE_07885 hypothetical protein
1583 c1 cds 1598304 1598603 + BALIOE_07890 hypothetical protein
1584 c1 cds 1598600 1600732 + BALIOE_07895 hypothetical protein
1585 c1 cds 1601103 1601354 + BALIOE_07900 hypothetical protein
1586 c1 cds 1601351 1601761 + BALIOE_07905 hypothetical protein
1587 c1 cds 1601772 1602044 + BALIOE_07910 hypothetical protein
1588 c1 cds 1602169 1602393 + BALIOE_07915 hypothetical protein
1589 c1 cds 1602686 1603843 + BALIOE_07920 hypothetical protein
1590 c1 cds 1603883 1604455 + BALIOE_07925 hypothetical protein
1591 c1 cds 1604493 1605668 + BALIOE_07930 hypothetical protein
1592 c1 cds 1605665 1606003 + BALIOE_07935 hypothetical protein
1593 c1 cds 1606000 1606296 + BALIOE_07940 hypothetical protein
1594 c1 cds 1606296 1606736 + BALIOE_07945 hypothetical protein
1595 c1 cds 1607026 1607382 + BALIOE_07950 hypothetical protein
1596 c1 cds 1607366 1609027 + BALIOE_07955 hypothetical protein
1597 c1 cds 1609041 1609322 + BALIOE_07960 hypothetical protein
1598 c1 cds 1610179 1611639 - BALIOE_07965 hypothetical protein
1599 c1 cds 1611639 1612310 - BALIOE_07970 hypothetical protein
1600 c1 cds 1612479 1613849 - BALIOE_07975 hypothetical protein
1601 c1 cds 1613853 1614494 - BALIOE_07980 hypothetical protein
1602 c1 cds 1614530 1615636 - BALIOE_07985 hypothetical protein
1603 c1 cds 1615690 1616151 - BALIOE_07990 hypothetical protein
1604 c1 cds 1616161 1616814 - BALIOE_07995 hypothetical protein
1605 c1 cds 1616986 1618236 + BALIOE_08000 hypothetical protein
1606 c1 cds 1618350 1619492 - BALIOE_08005 hypothetical protein
1607 c1 cds 1619482 1619718 - BALIOE_08010 hypothetical protein
1608 c1 cds 1619822 1620646 + BALIOE_08015 hypothetical protein
1609 c1 cds 1620643 1621344 + BALIOE_08020 hypothetical protein
1610 c1 cds 1621341 1621643 + BALIOE_08025 hypothetical protein
1611 c1 cds 1621711 1622043 + BALIOE_08030 hypothetical protein
1612 c1 cds 1622288 1623814 + BALIOE_08035 hypothetical protein
1613 c1 cds 1624316 1624771 + BALIOE_08040 hypothetical protein
1614 c1 cds 1624771 1624941 + BALIOE_08045 hypothetical protein
1615 c1 cds 1624934 1625224 + BALIOE_08050 hypothetical protein
1616 c1 cds 1625221 1625583 + BALIOE_08055 hypothetical protein
1617 c1 cds 1625580 1625720 + BALIOE_08060 hypothetical protein
1618 c1 cds 1625717 1626406 + BALIOE_08065 hypothetical protein
1619 c1 cds 1626728 1627033 + BALIOE_08070 hypothetical protein
1620 c1 cds 1627020 1627496 + BALIOE_08075 hypothetical protein
1621 c1 cds 1627493 1627954 + BALIOE_08080 hypothetical protein
1622 c1 cds 1627986 1628279 - BALIOE_08085 hypothetical protein
1623 c1 cds 1628571 1628981 - BALIOE_08090 hypothetical protein
1624 c1 cds 1629267 1629473 + BALIOE_08095 hypothetical protein
1625 c1 cds 1630221 1630766 + BALIOE_08100 hypothetical protein
1626 c1 cds 1630741 1632666 + BALIOE_08105 hypothetical protein
1627 c1 cds 1632663 1632869 + BALIOE_08110 hypothetical protein
1628 c1 cds 1632866 1634467 + BALIOE_08115 hypothetical protein
1629 c1 cds 1634448 1635767 + BALIOE_08120 hypothetical protein
1630 c1 cds 1635777 1636109 + BALIOE_08125 hypothetical protein
1631 c1 cds 1636165 1637190 + BALIOE_08130 hypothetical protein
1632 c1 cds 1637232 1637630 + BALIOE_08135 hypothetical protein
1633 c1 cds 1637642 1637995 + BALIOE_08140 hypothetical protein
1634 c1 cds 1638007 1638585 + BALIOE_08145 hypothetical protein
1635 c1 cds 1638582 1638977 + BALIOE_08150 hypothetical protein
1636 c1 cds 1638985 1639725 + BALIOE_08155 hypothetical protein
1637 c1 cds 1639741 1640163 + BALIOE_08160 hypothetical protein
1638 c1 cds 1640145 1640579 + BALIOE_08165 hypothetical protein
1639 c1 cds 1640572 1643121 + BALIOE_08170 hypothetical protein
1640 c1 cds 1643118 1643447 + BALIOE_08175 hypothetical protein
1641 c1 cds 1643447 1644145 + BALIOE_08180 hypothetical protein
1642 c1 cds 1644151 1644894 + BALIOE_08185 hypothetical protein
1643 c1 cds 1644891 1645463 + BALIOE_08190 hypothetical protein
1644 c1 cds 1645524 1648922 + BALIOE_08195 hypothetical protein
1645 c1 cds 1648989 1649588 + BALIOE_08200 hypothetical protein
1646 c1 cds 1649653 1652568 + BALIOE_08205 hypothetical protein
1647 c1 cds 1652568 1653149 + BALIOE_08210 hypothetical protein
1648 c1 cds 1653269 1654159 - BALIOE_08215 hypothetical protein
1649 c1 cds 1654178 1654684 - BALIOE_08220 hypothetical protein
1650 c1 cds 1654721 1655221 - BALIOE_08225 hypothetical protein
1651 c1 cds 1655300 1655482 - BALIOE_08230 hypothetical protein
1652 c1 cds 1655980 1656648 - BALIOE_08235 hypothetical protein
1653 c1 cds 1656705 1656953 + BALIOE_08240 hypothetical protein
1654 c1 cds 1657029 1657409 + BALIOE_08245 hypothetical protein
1655 c1 cds 1657406 1657753 + BALIOE_08250 hypothetical protein
1656 c1 cds 1657803 1659341 + BALIOE_08255 hypothetical protein
1657 c1 cds 1659644 1661128 - BALIOE_08260 hypothetical protein
1658 c1 cds 1661315 1662268 - BALIOE_08265 hypothetical protein
1659 c1 cds 1662767 1663351 + BALIOE_08270 hypothetical protein
1660 c1 cds 1663525 1663851 + BALIOE_08275 hypothetical protein
1661 c1 cds 1663851 1664738 + BALIOE_08280 hypothetical protein
1662 c1 cds 1664822 1665532 + BALIOE_08285 hypothetical protein
1663 c1 cds 1665904 1666170 - BALIOE_08290 hypothetical protein
1664 c1 cds 1666174 1666986 - BALIOE_08295 hypothetical protein
1665 c1 cds 1667010 1667705 - BALIOE_08300 hypothetical protein
1666 c1 cds 1668225 1668593 + BALIOE_08305 hypothetical protein
1667 c1 cds 1668696 1669097 - BALIOE_08310 hypothetical protein
1668 c1 cds 1669168 1669326 + BALIOE_08315 hypothetical protein
1669 c1 cds 1669338 1669631 + BALIOE_08320 hypothetical protein
1670 c1 cds 1669703 1670362 + BALIOE_08325 hypothetical protein
1671 c1 cds 1670454 1670900 + BALIOE_08330 hypothetical protein
1672 c1 cds 1671107 1672018 - BALIOE_08335 hypothetical protein
1673 c1 cds 1672391 1672810 + BALIOE_08340 hypothetical protein
1674 c1 cds 1672810 1674078 + BALIOE_08345 hypothetical protein
1675 c1 cds 1674124 1674654 - BALIOE_08350 hypothetical protein
1676 c1 cds 1674800 1676341 - BALIOE_08355 hypothetical protein
1677 c1 cds 1676563 1677282 + BALIOE_08360 hypothetical protein
1678 c1 cds 1677334 1678866 - BALIOE_08365 hypothetical protein
1679 c1 cds 1679229 1680527 + BALIOE_08370 hypothetical protein
1680 c1 cds 1680537 1681607 + BALIOE_08375 hypothetical protein
1681 c1 cds 1681999 1683735 - BALIOE_08380 hypothetical protein
1682 c1 cds 1683831 1684745 - BALIOE_08385 hypothetical protein
1683 c1 cds 1684845 1685456 + BALIOE_08390 hypothetical protein
1684 c1 cds 1685644 1686531 - BALIOE_08395 hypothetical protein
1685 c1 cds 1686531 1686857 - BALIOE_08400 hypothetical protein
1686 c1 cds 1686909 1687505 - BALIOE_08405 hypothetical protein
1687 c1 cds 1687706 1687960 + BALIOE_08410 hypothetical protein
1688 c1 cds 1688010 1689980 - BALIOE_08415 hypothetical protein
1689 c1 cds 1690006 1690860 - BALIOE_08420 hypothetical protein
1690 c1 cds 1691025 1691669 - BALIOE_08425 hypothetical protein
1691 c1 cds 1691679 1692437 - BALIOE_08430 hypothetical protein
1692 c1 cds 1692434 1693414 - BALIOE_08435 hypothetical protein
1693 c1 cds 1693414 1694436 - BALIOE_08440 hypothetical protein
1694 c1 cds 1694544 1694744 - BALIOE_08445 hypothetical protein
1695 c1 cds 1694772 1696229 - BALIOE_08450 hypothetical protein
1696 c1 cds 1696776 1698194 - BALIOE_08455 hypothetical protein
1697 c1 cds 1698205 1698837 - BALIOE_08460 hypothetical protein
1698 c1 cds 1698848 1699918 - BALIOE_08465 hypothetical protein
1699 c1 cds 1700253 1701896 - BALIOE_08470 hypothetical protein
1700 c1 cds 1702740 1703831 - BALIOE_08475 hypothetical protein
1701 c1 cds 1703948 1704532 - BALIOE_08480 hypothetical protein
1702 c1 cds 1704810 1705088 + BALIOE_08485 hypothetical protein
1703 c1 cds 1705143 1706795 - BALIOE_08490 hypothetical protein
1704 c1 cds 1706947 1707960 - BALIOE_08495 hypothetical protein
1705 c1 cds 1708045 1708896 - BALIOE_08500 hypothetical protein
1706 c1 cds 1708896 1709519 - BALIOE_08505 hypothetical protein
1707 c1 cds 1709733 1710989 + BALIOE_08510 hypothetical protein
1708 c1 cds 1711031 1712113 + BALIOE_08515 hypothetical protein
1709 c1 cds 1712113 1712946 + BALIOE_08520 hypothetical protein
1710 c1 cds 1712943 1713335 + BALIOE_08525 hypothetical protein
1711 c1 cds 1713339 1714148 + BALIOE_08530 hypothetical protein
1712 c1 cds 1714184 1715038 + BALIOE_08535 hypothetical protein
1713 c1 cds 1715186 1715293 - BALIOE_08540 hypothetical protein
1714 c1 cds 1715722 1715829 - BALIOE_08545 hypothetical protein
1715 c1 cds 1716228 1717328 - BALIOE_08550 hypothetical protein
1716 c1 cds 1717598 1717828 + BALIOE_08555 hypothetical protein
1717 c1 cds 1717965 1718684 + BALIOE_08560 hypothetical protein
1718 c1 cds 1718728 1719081 - BALIOE_08565 hypothetical protein
1719 c1 cds 1719231 1720661 + BALIOE_08570 hypothetical protein
1720 c1 cds 1720662 1721312 - BALIOE_08575 hypothetical protein
1721 c1 cds 1721305 1723101 - BALIOE_08580 hypothetical protein
1722 c1 cds 1723127 1723345 + BALIOE_08585 hypothetical protein
1723 c1 cds 1723440 1724831 + BALIOE_08590 hypothetical protein
1724 c1 cds 1725224 1728967 + BALIOE_08595 hypothetical protein
1725 c1 cds 1728964 1730502 + BALIOE_08600 hypothetical protein
1726 c1 cds 1730499 1731209 + BALIOE_08605 hypothetical protein
1727 c1 cds 1731209 1731886 + BALIOE_08610 hypothetical protein
1728 c1 tRNA 1732426 1732510 - BALIOE_08615 Tyr_trna tRNA-Tyr SO:0000272
1729 c1 tRNA 1732720 1732804 - BALIOE_08620 Tyr_trna tRNA-Tyr SO:0000272
1730 c1 cds 1732964 1733806 - BALIOE_08625 hypothetical protein
1731 c1 cds 1733856 1734314 - BALIOE_08630 hypothetical protein
1732 c1 cds 1734388 1735332 + BALIOE_08635 hypothetical protein
1733 c1 cds 1735424 1736437 + BALIOE_08640 hypothetical protein
1734 c1 cds 1736639 1737547 + BALIOE_08645 hypothetical protein
1735 c1 cds 1737691 1738104 - BALIOE_08650 hypothetical protein
1736 c1 cds 1738708 1739325 + BALIOE_08655 hypothetical protein
1737 c1 cds 1739626 1742301 - BALIOE_08660 hypothetical protein
1738 c1 cds 1742778 1743425 + BALIOE_08665 hypothetical protein
1739 c1 cds 1743452 1743607 + BALIOE_08670 hypothetical protein
1740 c1 cds 1743583 1743744 - BALIOE_08675 hypothetical protein
1741 c1 cds 1744118 1745794 + BALIOE_08680 hypothetical protein
1742 c1 cds 1745880 1746800 + BALIOE_08685 hypothetical protein
1743 c1 cds 1746815 1747723 + BALIOE_08690 hypothetical protein
1744 c1 cds 1747735 1748748 + BALIOE_08695 hypothetical protein
1745 c1 cds 1748745 1749749 + BALIOE_08700 hypothetical protein
1746 c1 cds 1749802 1750131 - BALIOE_08705 hypothetical protein
1747 c1 cds 1750166 1751626 - BALIOE_08710 hypothetical protein
1748 c1 cds 1751997 1753250 - BALIOE_08715 hypothetical protein
1749 c1 cds 1753551 1753847 - BALIOE_08720 hypothetical protein
1750 c1 cds 1754071 1754790 + BALIOE_08725 hypothetical protein
1751 c1 cds 1754830 1755228 - BALIOE_08730 hypothetical protein
1752 c1 cds 1755333 1755872 - BALIOE_08735 hypothetical protein
1753 c1 cds 1755902 1756645 - BALIOE_08740 hypothetical protein
1754 c1 cds 1757002 1757640 + BALIOE_08745 hypothetical protein
1755 c1 cds 1757686 1758816 - BALIOE_08750 hypothetical protein
1756 c1 cds 1759107 1761578 - BALIOE_08755 hypothetical protein
1757 c1 cds 1761671 1761862 - BALIOE_08760 hypothetical protein
1758 c1 cds 1761859 1762047 - BALIOE_08765 hypothetical protein
1759 c1 cds 1762521 1762754 + BALIOE_08770 hypothetical protein
1760 c1 cds 1762732 1763139 - BALIOE_08775 hypothetical protein
1761 c1 cds 1763162 1763380 - BALIOE_08780 hypothetical protein
1762 c1 cds 1763453 1763752 - BALIOE_08785 hypothetical protein
1763 c1 cds 1764016 1764423 - BALIOE_08790 hypothetical protein
1764 c1 cds 1764500 1764727 + BALIOE_08795 hypothetical protein
1765 c1 cds 1764711 1765262 + BALIOE_08800 hypothetical protein
1766 c1 cds 1765234 1766274 + BALIOE_08805 hypothetical protein
1767 c1 cds 1766306 1766728 + BALIOE_08810 hypothetical protein
1768 c1 cds 1766915 1767496 + BALIOE_08815 hypothetical protein
1769 c1 cds 1767493 1767657 + BALIOE_08820 hypothetical protein
1770 c1 cds 1768356 1769114 + BALIOE_08825 hypothetical protein
1771 c1 cds 1769393 1769605 + BALIOE_08830 hypothetical protein
1772 c1 cds 1769826 1770083 + BALIOE_08835 hypothetical protein
1773 c1 cds 1770153 1770431 + BALIOE_08840 hypothetical protein
1774 c1 cds 1770433 1771479 + BALIOE_08845 hypothetical protein
1775 c1 cds 1771492 1771851 + BALIOE_08850 hypothetical protein
1776 c1 cds 1771860 1772390 + BALIOE_08855 hypothetical protein
1777 c1 cds 1772632 1772829 + BALIOE_08860 hypothetical protein
1778 c1 cds 1772980 1774038 + BALIOE_08865 hypothetical protein
1779 c1 tRNA 1774079 1774154 + BALIOE_08870 Ile2_trna tRNA-Ile2 SO:0000263
1780 c1 tRNA 1774235 1774311 + BALIOE_08875 Arg_trna tRNA-Arg SO:0001036
1781 c1 cds 1774835 1776688 + BALIOE_08880 hypothetical protein
1782 c1 cds 1776838 1777053 + BALIOE_08885 hypothetical protein
1783 c1 cds 1777058 1777402 + BALIOE_08890 hypothetical protein
1784 c1 cds 1777453 1777986 + BALIOE_08895 hypothetical protein
1785 c1 cds 1778257 1778826 + BALIOE_08900 hypothetical protein
1786 c1 cds 1778826 1778972 + BALIOE_08905 hypothetical protein
1787 c1 cds 1778980 1779447 + BALIOE_08910 hypothetical protein
1788 c1 cds 1779810 1780037 - BALIOE_08915 hypothetical protein
1789 c1 cds 1780079 1780444 + BALIOE_08920 hypothetical protein
1790 c1 cds 1780734 1781297 + BALIOE_08925 hypothetical protein
1791 c1 cds 1781294 1782955 + BALIOE_08930 hypothetical protein
1792 c1 cds 1783019 1784956 + BALIOE_08935 hypothetical protein
1793 c1 cds 1785001 1785222 + BALIOE_08940 hypothetical protein
1794 c1 cds 1785168 1787747 + BALIOE_08945 hypothetical protein
1795 c1 cds 1787750 1788076 + BALIOE_08950 hypothetical protein
1796 c1 cds 1788086 1788436 + BALIOE_08955 hypothetical protein
1797 c1 cds 1788433 1788879 + BALIOE_08960 hypothetical protein
1798 c1 cds 1788876 1789220 + BALIOE_08965 hypothetical protein
1799 c1 cds 1789279 1789995 + BALIOE_08970 hypothetical protein
1800 c1 cds 1790001 1790375 + BALIOE_08975 hypothetical protein
1801 c1 cds 1790471 1790680 + BALIOE_08980 hypothetical protein
1802 c1 cds 1790733 1793813 + BALIOE_08985 hypothetical protein
1803 c1 cds 1793806 1794147 + BALIOE_08990 hypothetical protein
1804 c1 cds 1794147 1794584 + BALIOE_08995 hypothetical protein
1805 c1 cds 1794772 1798248 + BALIOE_09000 hypothetical protein
1806 c1 cds 1798316 1798915 + BALIOE_09005 hypothetical protein
1807 c1 cds 1799067 1800380 + BALIOE_09010 hypothetical protein
1808 c1 cds 1800382 1800651 + BALIOE_09015 hypothetical protein
1809 c1 cds 1801003 1801338 + BALIOE_09020 hypothetical protein
1810 c1 cds 1801678 1803003 - BALIOE_09025 hypothetical protein
1811 c1 cds 1803664 1804356 - BALIOE_09030 hypothetical protein
1812 c1 cds 1804830 1805741 + BALIOE_09035 hypothetical protein
1813 c1 cds 1805807 1806376 + BALIOE_09040 hypothetical protein
1814 c1 cds 1806423 1806680 - BALIOE_09045 hypothetical protein
1815 c1 cds 1806710 1807057 - BALIOE_09050 hypothetical protein
1816 c1 cds 1807342 1808880 - BALIOE_09055 hypothetical protein
1817 c1 cds 1808930 1809277 - BALIOE_09060 hypothetical protein
1818 c1 cds 1809274 1809654 - BALIOE_09065 hypothetical protein
1819 c1 cds 1809959 1810228 + BALIOE_09070 hypothetical protein
1820 c1 cds 1810983 1811630 - BALIOE_09075 hypothetical protein
1821 c1 cds 1811814 1812404 + BALIOE_09080 hypothetical protein
1822 c1 cds 1814052 1814561 + BALIOE_09085 hypothetical protein
1823 c1 cds 1815875 1816381 - BALIOE_09090 hypothetical protein
1824 c1 cds 1816427 1816927 - BALIOE_09095 hypothetical protein
1825 c1 cds 1817013 1817192 - BALIOE_09100 hypothetical protein
1826 c1 cds 1817573 1818379 - BALIOE_09105 hypothetical protein
1827 c1 cds 1818379 1819572 - BALIOE_09110 hypothetical protein
1828 c1 cds 1819584 1820942 - BALIOE_09115 hypothetical protein
1829 c1 cds 1820946 1822541 - BALIOE_09120 hypothetical protein
1830 c1 cds 1822541 1824103 - BALIOE_09125 hypothetical protein
1831 c1 cds 1824377 1825258 + BALIOE_09130 hypothetical protein
1832 c1 cds 1825255 1825875 + BALIOE_09135 hypothetical protein
1833 c1 cds 1825903 1827486 + BALIOE_09140 hypothetical protein
1834 c1 cds 1827699 1828571 + BALIOE_09145 hypothetical protein
1835 c1 cds 1828611 1829201 - BALIOE_09150 hypothetical protein
1836 c1 cds 1829198 1829956 - BALIOE_09155 hypothetical protein
1837 c1 cds 1830176 1831225 + BALIOE_09160 hypothetical protein
1838 c1 cds 1831261 1831512 - BALIOE_09165 hypothetical protein
1839 c1 cds 1831892 1834489 + BALIOE_09170 hypothetical protein
1840 c1 cds 1834699 1835673 + BALIOE_09175 hypothetical protein
1841 c1 cds 1836004 1836132 + BALIOE_09180 hypothetical protein
1842 c1 cds 1836135 1836302 + BALIOE_09185 hypothetical protein
1843 c1 cds 1836675 1839350 + BALIOE_09190 hypothetical protein
1844 c1 cds 1839414 1840004 - BALIOE_09195 hypothetical protein
1845 c1 cds 1840174 1840938 + BALIOE_09200 hypothetical protein
1846 c1 cds 1841087 1841395 + BALIOE_09205 hypothetical protein
1847 c1 cds 1841402 1842571 + BALIOE_09210 hypothetical protein
1848 c1 cds 1842704 1843501 + BALIOE_09215 hypothetical protein
1849 c1 cds 1843501 1843827 + BALIOE_09220 hypothetical protein
1850 c1 cds 1843953 1844171 - BALIOE_09225 hypothetical protein
1851 c1 cds 1844440 1845189 - BALIOE_09230 hypothetical protein
1852 c1 cds 1845279 1845452 - BALIOE_09235 hypothetical protein
1853 c1 cds 1845600 1847585 - BALIOE_09240 hypothetical protein
1854 c1 cds 1847820 1849754 - BALIOE_09245 hypothetical protein
1855 c1 cds 1849822 1850949 - BALIOE_09250 hypothetical protein
1856 c1 cds 1851093 1851881 - BALIOE_09255 hypothetical protein
1857 c1 cds 1852359 1852925 + BALIOE_09260 hypothetical protein
1858 c1 cds 1853074 1854195 + BALIOE_09265 hypothetical protein
1859 c1 cds 1854195 1857278 + BALIOE_09270 hypothetical protein
1860 c1 cds 1857301 1858674 + BALIOE_09275 hypothetical protein
1861 c1 cds 1858683 1859846 + BALIOE_09280 hypothetical protein
1862 c1 cds 1859898 1860704 - BALIOE_09285 hypothetical protein
1863 c1 cds 1860706 1861698 - BALIOE_09290 hypothetical protein
1864 c1 cds 1861698 1862588 - BALIOE_09295 hypothetical protein
1865 c1 cds 1862575 1863540 - BALIOE_09300 hypothetical protein
1866 c1 cds 1863537 1865180 - BALIOE_09305 hypothetical protein
1867 c1 cds 1865493 1865738 - BALIOE_09310 hypothetical protein
1868 c1 cds 1865872 1867257 - BALIOE_09315 hypothetical protein
1869 c1 cds 1867560 1868978 - BALIOE_09320 hypothetical protein
1870 c1 cds 1869190 1869954 + BALIOE_09325 hypothetical protein
1871 c1 cds 1869981 1870538 + BALIOE_09330 hypothetical protein
1872 c1 cds 1870688 1872175 + BALIOE_09335 hypothetical protein
1873 c1 cds 1872177 1873457 + BALIOE_09340 hypothetical protein
1874 c1 cds 1873495 1874760 + BALIOE_09345 hypothetical protein
1875 c1 cds 1874891 1875868 - BALIOE_09350 hypothetical protein
1876 c1 cds 1876035 1876703 + BALIOE_09355 hypothetical protein
1877 c1 cds 1876757 1876981 + BALIOE_09360 hypothetical protein
1878 c1 cds 1876981 1877340 + BALIOE_09365 hypothetical protein
1879 c1 cds 1877349 1877570 + BALIOE_09370 hypothetical protein
1880 c1 cds 1877645 1877959 + BALIOE_09375 hypothetical protein
1881 c1 cds 1878169 1878543 + BALIOE_09380 hypothetical protein
1882 c1 cds 1878543 1879847 + BALIOE_09385 hypothetical protein
1883 c1 cds 1879861 1880490 + BALIOE_09390 hypothetical protein
1884 c1 cds 1880539 1881153 + BALIOE_09395 hypothetical protein
1885 c1 cds 1881174 1882055 + BALIOE_09400 hypothetical protein
1886 c1 cds 1882042 1882884 + BALIOE_09405 hypothetical protein
1887 c1 cds 1882915 1883967 + BALIOE_09410 hypothetical protein
1888 c1 cds 1883985 1884773 + BALIOE_09415 hypothetical protein
1889 c1 cds 1884783 1885838 + BALIOE_09420 hypothetical protein
1890 c1 cds 1885835 1888102 + BALIOE_09425 hypothetical protein
1891 c1 cds 1888099 1888758 + BALIOE_09430 hypothetical protein
1892 c1 cds 1888772 1889854 + BALIOE_09435 hypothetical protein
1893 c1 cds 1889899 1890804 + BALIOE_09440 hypothetical protein
1894 c1 cds 1890915 1891913 - BALIOE_09445 hypothetical protein
1895 c1 cds 1892068 1893465 + BALIOE_09450 hypothetical protein
1896 c1 cds 1893462 1894523 + BALIOE_09455 hypothetical protein
1897 c1 cds 1894671 1896212 + BALIOE_09460 hypothetical protein
1898 c1 cds 1896256 1896762 - BALIOE_09465 hypothetical protein
1899 c1 cds 1896881 1897846 + BALIOE_09470 hypothetical protein
1900 c1 cds 1897821 1898549 - BALIOE_09475 hypothetical protein
1901 c1 cds 1898840 1899478 - BALIOE_09480 hypothetical protein
1902 c1 cds 1899499 1900122 - BALIOE_09485 hypothetical protein
1903 c1 cds 1900061 1900429 - BALIOE_09490 hypothetical protein
1904 c1 cds 1900429 1901349 - BALIOE_09495 hypothetical protein
1905 c1 cds 1901487 1902386 + BALIOE_09500 hypothetical protein
1906 c1 cds 1902722 1904335 + BALIOE_09505 hypothetical protein
1907 c1 cds 1904386 1905417 - BALIOE_09510 hypothetical protein
1908 c1 cds 1905661 1905918 + BALIOE_09515 hypothetical protein
1909 c1 cds 1905968 1906918 - BALIOE_09520 hypothetical protein
1910 c1 cds 1907070 1907822 - BALIOE_09525 hypothetical protein
1911 c1 cds 1908017 1908532 - BALIOE_09530 hypothetical protein
1912 c1 cds 1908543 1909235 - BALIOE_09535 hypothetical protein
1913 c1 cds 1909346 1910233 - BALIOE_09540 hypothetical protein
1914 c1 cds 1910233 1910559 - BALIOE_09545 hypothetical protein
1915 c1 cds 1910585 1911382 - BALIOE_09550 hypothetical protein
1916 c1 cds 1911419 1912864 - BALIOE_09555 hypothetical protein
1917 c1 cds 1912864 1914174 - BALIOE_09560 hypothetical protein
1918 c1 cds 1914350 1915258 + BALIOE_09565 hypothetical protein
1919 c1 cds 1915588 1916151 + BALIOE_09570 hypothetical protein
1920 c1 cds 1916172 1917404 - BALIOE_09575 hypothetical protein
1921 c1 cds 1917659 1918642 + BALIOE_09580 hypothetical protein
1922 c1 cds 1918917 1919087 + BALIOE_09585 hypothetical protein
1923 c1 cds 1919120 1920493 + BALIOE_09590 hypothetical protein
1924 c1 cds 1920622 1921557 - BALIOE_09595 hypothetical protein
1925 c1 cds 1921609 1922844 - BALIOE_09600 hypothetical protein
1926 c1 cds 1922846 1923061 - BALIOE_09605 hypothetical protein
1927 c1 cds 1923161 1923349 - BALIOE_09610 hypothetical protein
1928 c1 cds 1923592 1924401 - BALIOE_09615 hypothetical protein
1929 c1 cds 1924394 1926994 - BALIOE_09620 hypothetical protein
1930 c1 cds 1927096 1927371 - BALIOE_09625 hypothetical protein
1931 c1 cds 1927446 1927616 - BALIOE_09630 hypothetical protein
1932 c1 cds 1927616 1927837 - BALIOE_09635 hypothetical protein
1933 c1 cds 1928156 1928767 + BALIOE_09640 hypothetical protein
1934 c1 cds 1928764 1928919 - BALIOE_09645 hypothetical protein
1935 c1 cds 1928930 1929064 - BALIOE_09650 hypothetical protein
1936 c1 cds 1929352 1929771 - BALIOE_09655 hypothetical protein
1937 c1 cds 1929851 1930105 + BALIOE_09660 hypothetical protein
1938 c1 cds 1930102 1930524 + BALIOE_09665 hypothetical protein
1939 c1 cds 1930602 1931390 + BALIOE_09670 hypothetical protein
1940 c1 cds 1931397 1932143 + BALIOE_09675 hypothetical protein
1941 c1 cds 1932166 1932927 + BALIOE_09680 hypothetical protein
1942 c1 cds 1932943 1933365 + BALIOE_09685 hypothetical protein
1943 c1 cds 1933471 1933683 + BALIOE_09690 hypothetical protein
1944 c1 cds 1933935 1934198 + BALIOE_09695 hypothetical protein
1945 c1 cds 1934209 1934370 + BALIOE_09700 hypothetical protein
1946 c1 cds 1935126 1936277 + BALIOE_09705 hypothetical protein
1947 c1 cds 1936245 1937234 - BALIOE_09710 hypothetical protein
1948 c1 cds 1937234 1938625 - BALIOE_09715 hypothetical protein
1949 c1 cds 1939125 1939724 + BALIOE_09720 hypothetical protein
1950 c1 cds 1939724 1940014 + BALIOE_09725 hypothetical protein
1951 c1 cds 1940011 1940565 + BALIOE_09730 hypothetical protein
1952 c1 tRNA 1940705 1940780 + BALIOE_09735 Ile2_trna tRNA-Ile2 SO:0000263
1953 c1 tRNA 1940881 1940957 + BALIOE_09740 Arg_trna tRNA-Arg SO:0001036
1954 c1 cds 1941127 1941558 + BALIOE_09745 hypothetical protein
1955 c1 cds 1941371 1941889 - BALIOE_09750 hypothetical protein
1956 c1 cds 1942133 1943986 + BALIOE_09755 hypothetical protein
1957 c1 cds 1944136 1944351 + BALIOE_09760 hypothetical protein
1958 c1 cds 1944356 1944700 + BALIOE_09765 hypothetical protein
1959 c1 cds 1944751 1945284 + BALIOE_09770 hypothetical protein
1960 c1 cds 1945555 1946124 + BALIOE_09775 hypothetical protein
1961 c1 cds 1946124 1946270 + BALIOE_09780 hypothetical protein
1962 c1 cds 1946278 1946745 + BALIOE_09785 hypothetical protein
1963 c1 cds 1947108 1947335 - BALIOE_09790 hypothetical protein
1964 c1 cds 1947377 1947742 + BALIOE_09795 hypothetical protein
1965 c1 cds 1948032 1948595 + BALIOE_09800 hypothetical protein
1966 c1 cds 1948592 1950253 + BALIOE_09805 hypothetical protein
1967 c1 cds 1950317 1952254 + BALIOE_09810 hypothetical protein
1968 c1 cds 1952299 1952520 + BALIOE_09815 hypothetical protein
1969 c1 cds 1952466 1953830 + BALIOE_09820 hypothetical protein
1970 c1 cds 1953827 1955050 + BALIOE_09825 hypothetical protein
1971 c1 cds 1955047 1955373 + BALIOE_09830 hypothetical protein
1972 c1 cds 1955383 1955733 + BALIOE_09835 hypothetical protein
1973 c1 cds 1955730 1956176 + BALIOE_09840 hypothetical protein
1974 c1 cds 1956173 1956517 + BALIOE_09845 hypothetical protein
1975 c1 cds 1956586 1957302 + BALIOE_09850 hypothetical protein
1976 c1 cds 1957308 1957682 + BALIOE_09855 hypothetical protein
1977 c1 cds 1957778 1957987 + BALIOE_09860 hypothetical protein
1978 c1 cds 1958039 1961119 + BALIOE_09865 hypothetical protein
1979 c1 cds 1961112 1961453 + BALIOE_09870 hypothetical protein
1980 c1 cds 1961453 1962151 + BALIOE_09875 hypothetical protein
1981 c1 cds 1962162 1962905 + BALIOE_09880 hypothetical protein
1982 c1 cds 1962902 1963483 + BALIOE_09885 hypothetical protein
1983 c1 cds 1963674 1964201 - BALIOE_09890 hypothetical protein
1984 c1 cds 1964335 1967832 + BALIOE_09895 hypothetical protein
1985 c1 cds 1967903 1968502 + BALIOE_09900 hypothetical protein
1986 c1 cds 1968567 1969880 + BALIOE_09905 hypothetical protein
1987 c1 cds 1969882 1970151 + BALIOE_09910 hypothetical protein
1988 c1 cds 1970264 1970839 + BALIOE_09915 hypothetical protein
1989 c1 cds 1970912 1971541 + BALIOE_09920 hypothetical protein
1990 c1 cds 1971623 1972264 + BALIOE_09925 hypothetical protein
1991 c1 cds 1972845 1973279 - BALIOE_09930 hypothetical protein
1992 c1 cds 1973420 1974187 - BALIOE_09935 hypothetical protein
1993 c1 cds 1974162 1974533 - BALIOE_09940 hypothetical protein
1994 c1 cds 1974899 1978423 - BALIOE_09945 hypothetical protein
1995 c1 cds 1978697 1978963 + BALIOE_09950 hypothetical protein
1996 c1 cds 1978960 1979382 - BALIOE_09955 hypothetical protein
1997 c1 cds 1979493 1980482 - BALIOE_09960 hypothetical protein
1998 c1 cds 1980690 1983329 + BALIOE_09965 hypothetical protein
1999 c1 cds 1983326 1983511 + BALIOE_09970 hypothetical protein
2000 c1 cds 1983519 1983842 + BALIOE_09975 hypothetical protein
2001 c1 cds 1984256 1987291 + BALIOE_09980 hypothetical protein
2002 c1 cds 1987511 1989970 + BALIOE_09985 hypothetical protein
2003 c1 cds 1990190 1991050 + BALIOE_09990 hypothetical protein
2004 c1 cds 1991114 1993420 + BALIOE_09995 hypothetical protein
2005 c1 cds 1993591 1994196 + BALIOE_10000 hypothetical protein
2006 c1 cds 1994196 1995092 + BALIOE_10005 hypothetical protein
2007 c1 cds 1995108 1996865 + BALIOE_10010 hypothetical protein
2008 c1 cds 1996855 1998171 + BALIOE_10015 hypothetical protein
2009 c1 cds 1998222 1998827 - BALIOE_10020 hypothetical protein
2010 c1 cds 1999028 2002930 + BALIOE_10025 hypothetical protein
2011 c1 cds 2003076 2003501 + BALIOE_10030 hypothetical protein
2012 c1 cds 2003506 2003844 + BALIOE_10035 hypothetical protein
2013 c1 cds 2003831 2004262 + BALIOE_10040 hypothetical protein
2014 c1 cds 2004387 2004764 + BALIOE_10045 hypothetical protein
2015 c1 cds 2004880 2005680 + BALIOE_10050 hypothetical protein
2016 c1 cds 2005877 2007316 + BALIOE_10055 hypothetical protein
2017 c1 cds 2007358 2008359 - BALIOE_10060 hypothetical protein
2018 c1 cds 2008548 2009078 + BALIOE_10065 hypothetical protein
2019 c1 cds 2009323 2009496 + BALIOE_10070 hypothetical protein
2020 c1 cds 2009608 2009775 - BALIOE_10075 hypothetical protein
2021 c1 cds 2010116 2011756 + BALIOE_10080 hypothetical protein
2022 c1 cds 2011794 2012717 - BALIOE_10085 hypothetical protein
2023 c1 cds 2012934 2014277 + BALIOE_10090 hypothetical protein
2024 c1 cds 2014538 2016157 + BALIOE_10095 hypothetical protein
2025 c1 cds 2016297 2016521 + BALIOE_10100 hypothetical protein
2026 c1 cds 2016584 2016880 + BALIOE_10105 hypothetical protein
2027 c1 cds 2017115 2018095 - BALIOE_10110 hypothetical protein
2028 c1 cds 2018219 2019211 + BALIOE_10115 hypothetical protein
2029 c1 cds 2019208 2019801 + BALIOE_10120 hypothetical protein
2030 c1 cds 2020105 2020773 + BALIOE_10125 hypothetical protein
2031 c1 cds 2020808 2021980 - BALIOE_10130 hypothetical protein
2032 c1 cds 2022072 2022608 + BALIOE_10135 hypothetical protein
2033 c1 cds 2022639 2024642 + BALIOE_10140 hypothetical protein
2034 c1 cds 2024734 2024904 - BALIOE_10145 hypothetical protein
2035 c1 cds 2025186 2025362 + BALIOE_10150 hypothetical protein
2036 c1 cds 2025387 2025824 + BALIOE_10155 hypothetical protein
2037 c1 cds 2025903 2027309 + BALIOE_10160 hypothetical protein
2038 c1 cds 2027554 2028699 + BALIOE_10165 hypothetical protein
2039 c1 cds 2028717 2029730 + BALIOE_10170 hypothetical protein
2040 c1 cds 2029731 2030672 + BALIOE_10175 hypothetical protein
2041 c1 cds 2030662 2031456 + BALIOE_10180 hypothetical protein
2042 c1 cds 2031478 2032902 + BALIOE_10185 hypothetical protein
2043 c1 cds 2033289 2033462 + BALIOE_10190 hypothetical protein
2044 c1 cds 2033548 2033781 + BALIOE_10195 hypothetical protein
2045 c1 cds 2033782 2034231 - BALIOE_10200 hypothetical protein
2046 c1 cds 2034228 2034746 - BALIOE_10205 hypothetical protein
2047 c1 cds 2034927 2035964 + BALIOE_10210 hypothetical protein
2048 c1 cds 2036162 2036827 + BALIOE_10215 hypothetical protein
2049 c1 cds 2036863 2038965 - BALIOE_10220 hypothetical protein
2050 c1 cds 2039207 2040268 + BALIOE_10225 hypothetical protein
2051 c1 cds 2040383 2041882 - BALIOE_10230 hypothetical protein
2052 c1 cds 2042149 2042766 + BALIOE_10235 hypothetical protein
2053 c1 cds 2042842 2043054 + BALIOE_10240 hypothetical protein
2054 c1 cds 2043875 2045983 + BALIOE_10245 hypothetical protein
2055 c1 cds 2046050 2050252 + BALIOE_10250 hypothetical protein
2056 c1 cds 2050264 2050449 + BALIOE_10255 hypothetical protein
2057 c1 cds 2050449 2050658 + BALIOE_10260 hypothetical protein
2058 c1 cds 2051166 2051345 + BALIOE_10265 hypothetical protein
2059 c1 cds 2051445 2052056 + BALIOE_10270 hypothetical protein
2060 c1 cds 2052425 2052652 + BALIOE_10275 hypothetical protein
2061 c1 cds 2052656 2053099 - BALIOE_10280 hypothetical protein
2062 c1 cds 2053103 2053225 - BALIOE_10285 hypothetical protein
2063 c1 cds 2053398 2054132 + BALIOE_10290 hypothetical protein
2064 c1 cds 2054132 2054242 + BALIOE_10295 hypothetical protein
2065 c1 cds 2054338 2055231 - BALIOE_10300 hypothetical protein
2066 c1 cds 2055310 2055990 - BALIOE_10305 hypothetical protein
2067 c1 cds 2055987 2056682 - BALIOE_10310 hypothetical protein
2068 c1 cds 2056682 2058226 - BALIOE_10315 hypothetical protein
2069 c1 cds 2058223 2061963 - BALIOE_10320 hypothetical protein
2070 c1 cds 2062045 2063433 - BALIOE_10325 hypothetical protein
2071 c1 cds 2063739 2064998 - BALIOE_10330 hypothetical protein
2072 c1 cds 2065061 2065693 - BALIOE_10335 hypothetical protein
2073 c1 cds 2065816 2066319 - BALIOE_10340 hypothetical protein
2074 c1 cds 2066488 2067588 - BALIOE_10345 hypothetical protein
2075 c1 cds 2067847 2068671 - BALIOE_10350 hypothetical protein
2076 c1 cds 2068960 2069547 + BALIOE_10355 hypothetical protein
2077 c1 cds 2069596 2072007 + BALIOE_10360 hypothetical protein
2078 c1 cds 2072020 2072904 + BALIOE_10365 hypothetical protein
2079 c1 cds 2072897 2073550 + BALIOE_10370 hypothetical protein
2080 c1 cds 2073778 2074062 - BALIOE_10375 hypothetical protein
2081 c1 cds 2074208 2075218 - BALIOE_10380 hypothetical protein
2082 c1 cds 2075352 2077049 - BALIOE_10385 hypothetical protein
2083 c1 cds 2077206 2077343 - BALIOE_10390 hypothetical protein
2084 c1 cds 2077445 2077660 - BALIOE_10395 hypothetical protein
2085 c1 cds 2078005 2078436 + BALIOE_10400 hypothetical protein
2086 c1 cds 2078492 2079418 - BALIOE_10405 hypothetical protein
2087 c1 cds 2079411 2080397 - BALIOE_10410 hypothetical protein
2088 c1 cds 2080394 2081290 - BALIOE_10415 hypothetical protein
2089 c1 cds 2081287 2082267 - BALIOE_10420 hypothetical protein
2090 c1 cds 2082310 2083860 - BALIOE_10425 hypothetical protein
2091 c1 cds 2083874 2084455 - BALIOE_10430 hypothetical protein
2092 c1 cds 2084713 2085864 - BALIOE_10435 hypothetical protein
2093 c1 cds 2085861 2087102 - BALIOE_10440 hypothetical protein
2094 c1 cds 2087127 2088509 - BALIOE_10445 hypothetical protein
2095 c1 cds 2088886 2090205 - BALIOE_10450 hypothetical protein
2096 c1 cds 2090336 2091871 - BALIOE_10455 hypothetical protein
2097 c1 cds 2092027 2093427 - BALIOE_10460 hypothetical protein
2098 c1 cds 2093788 2096571 - BALIOE_10465 hypothetical protein
2099 c1 cds 2096628 2099000 - BALIOE_10470 hypothetical protein
2100 c1 cds 2099038 2100696 - BALIOE_10475 hypothetical protein
2101 c1 cds 2101014 2102171 - BALIOE_10480 hypothetical protein
2102 c1 cds 2102223 2103905 - BALIOE_10485 hypothetical protein
2103 c1 cds 2104309 2105070 - BALIOE_10490 hypothetical protein
2104 c1 cds 2105144 2105341 - BALIOE_10495 hypothetical protein
2105 c1 cds 2105589 2107868 - BALIOE_10500 hypothetical protein
2106 c1 cds 2108202 2109116 - BALIOE_10505 hypothetical protein
2107 c1 cds 2109176 2109679 - BALIOE_10510 hypothetical protein
2108 c1 cds 2109692 2110222 - BALIOE_10515 hypothetical protein
2109 c1 cds 2110236 2112887 - BALIOE_10520 hypothetical protein
2110 c1 cds 2112929 2113639 - BALIOE_10525 hypothetical protein
2111 c1 cds 2114000 2114563 - BALIOE_10530 hypothetical protein
2112 c1 cds 2115537 2116559 - BALIOE_10535 hypothetical protein
2113 c1 cds 2116717 2118117 - BALIOE_10540 hypothetical protein
2114 c1 cds 2118114 2122145 - BALIOE_10545 hypothetical protein
2115 c1 cds 2122676 2124268 - BALIOE_10550 hypothetical protein
2116 c1 cds 2124347 2125300 - BALIOE_10555 hypothetical protein
2117 c1 cds 2125549 2127084 + BALIOE_10560 hypothetical protein
2118 c1 cds 2127078 2128106 + BALIOE_10565 hypothetical protein
2119 c1 cds 2128106 2129098 + BALIOE_10570 hypothetical protein
2120 c1 cds 2129110 2130132 + BALIOE_10575 hypothetical protein
2121 c1 cds 2130159 2131034 + BALIOE_10580 hypothetical protein
2122 c1 cds 2131058 2131348 + BALIOE_10585 hypothetical protein
2123 c1 cds 2131405 2132163 + BALIOE_10590 hypothetical protein
2124 c1 cds 2132167 2133081 - BALIOE_10595 hypothetical protein
2125 c1 cds 2133278 2134729 - BALIOE_10600 hypothetical protein
2126 c1 cds 2134956 2136374 - BALIOE_10605 hypothetical protein
2127 c1 cds 2136513 2136872 - BALIOE_10610 hypothetical protein
2128 c1 cds 2136872 2137798 - BALIOE_10615 hypothetical protein
2129 c1 cds 2137862 2139250 - BALIOE_10620 hypothetical protein
2130 c1 cds 2139351 2140232 + BALIOE_10625 hypothetical protein
2131 c1 cds 2140310 2141098 + BALIOE_10630 hypothetical protein
2132 c1 cds 2141177 2141425 + BALIOE_10635 hypothetical protein
2133 c1 cds 2141576 2142766 + BALIOE_10640 hypothetical protein
2134 c1 cds 2142791 2143456 - BALIOE_10645 hypothetical protein
2135 c1 cds 2143668 2144102 + BALIOE_10650 hypothetical protein
2136 c1 cds 2144122 2144505 + BALIOE_10655 hypothetical protein
2137 c1 cds 2144537 2144755 + BALIOE_10660 hypothetical protein
2138 c1 cds 2144786 2145685 - BALIOE_10665 hypothetical protein
2139 c1 cds 2145880 2147067 + BALIOE_10670 hypothetical protein
2140 c1 cds 2147108 2147503 - BALIOE_10675 hypothetical protein
2141 c1 cds 2147598 2148569 + BALIOE_10680 hypothetical protein
2142 c1 cds 2148677 2148772 + BALIOE_10685 hypothetical protein
2143 c1 cds 2148991 2149881 - BALIOE_10690 hypothetical protein
2144 c1 cds 2150136 2150528 - BALIOE_10695 hypothetical protein
2145 c1 cds 2150804 2151322 + BALIOE_10700 hypothetical protein
2146 c1 cds 2151367 2153412 - BALIOE_10705 hypothetical protein
2147 c1 cds 2153549 2154295 + BALIOE_10710 hypothetical protein
2148 c1 cds 2154384 2155070 + BALIOE_10715 hypothetical protein
2149 c1 cds 2155247 2155450 + BALIOE_10720 hypothetical protein
2150 c1 cds 2155486 2156946 - BALIOE_10725 hypothetical protein
2151 c1 cds 2157035 2158318 - BALIOE_10730 hypothetical protein
2152 c1 cds 2158378 2158692 + BALIOE_10735 hypothetical protein
2153 c1 cds 2158854 2159495 - BALIOE_10740 hypothetical protein
2154 c1 cds 2159577 2160206 - BALIOE_10745 hypothetical protein
2155 c1 cds 2160279 2160854 - BALIOE_10750 hypothetical protein
2156 c1 cds 2160968 2161237 - BALIOE_10755 hypothetical protein
2157 c1 cds 2161239 2161517 - BALIOE_10760 hypothetical protein
2158 c1 cds 2161651 2162460 - BALIOE_10765 hypothetical protein
2159 c1 cds 2162525 2163124 - BALIOE_10770 hypothetical protein
2160 c1 cds 2163192 2166671 - BALIOE_10775 hypothetical protein
2161 c1 cds 2166912 2167490 - BALIOE_10780 hypothetical protein
2162 c1 cds 2167487 2168230 - BALIOE_10785 hypothetical protein
2163 c1 cds 2168241 2168939 - BALIOE_10790 hypothetical protein
2164 c1 cds 2168939 2169268 - BALIOE_10795 hypothetical protein
2165 c1 cds 2169265 2171877 - BALIOE_10800 hypothetical protein
2166 c1 cds 2171858 2172271 - BALIOE_10805 hypothetical protein
2167 c1 cds 2172298 2172720 - BALIOE_10810 hypothetical protein
2168 c1 cds 2172734 2173486 - BALIOE_10815 hypothetical protein
2169 c1 cds 2173494 2173889 - BALIOE_10820 hypothetical protein
2170 c1 cds 2173886 2174419 - BALIOE_10825 hypothetical protein
2171 c1 cds 2174434 2174787 - BALIOE_10830 hypothetical protein
2172 c1 cds 2174799 2175197 - BALIOE_10835 hypothetical protein
2173 c1 cds 2175239 2176264 - BALIOE_10840 hypothetical protein
2174 c1 cds 2176320 2176652 - BALIOE_10845 hypothetical protein
2175 c1 cds 2176662 2177981 - BALIOE_10850 hypothetical protein
2176 c1 cds 2177962 2179563 - BALIOE_10855 hypothetical protein
2177 c1 cds 2179560 2179766 - BALIOE_10860 hypothetical protein
2178 c1 cds 2179763 2181688 - BALIOE_10865 hypothetical protein
2179 c1 cds 2181663 2182208 - BALIOE_10870 hypothetical protein
2180 c1 cds 2182901 2183215 - BALIOE_10875 hypothetical protein
2181 c1 cds 2183679 2184137 - BALIOE_10880 hypothetical protein
2182 c1 cds 2184149 2184295 - BALIOE_10885 hypothetical protein
2183 c1 cds 2184295 2184864 - BALIOE_10890 hypothetical protein
2184 c1 cds 2185135 2185668 - BALIOE_10895 hypothetical protein
2185 c1 cds 2185719 2186063 - BALIOE_10900 hypothetical protein
2186 c1 cds 2186068 2186274 - BALIOE_10905 hypothetical protein
2187 c1 cds 2186722 2188572 - BALIOE_10910 hypothetical protein
2188 c1 cds 2188886 2189053 - BALIOE_10915 hypothetical protein
2189 c1 cds 2189050 2189481 - BALIOE_10920 hypothetical protein
2190 c1 tRNA 2189651 2189727 - BALIOE_10925 Arg_trna tRNA-Arg SO:0001036
2191 c1 tRNA 2189828 2189903 - BALIOE_10930 Ile2_trna tRNA-Ile2 SO:0000263
2192 c1 cds 2189932 2190519 - BALIOE_10935 hypothetical protein
2193 c1 cds 2190781 2190978 - BALIOE_10940 hypothetical protein
2194 c1 cds 2191203 2191757 - BALIOE_10945 hypothetical protein
2195 c1 cds 2191820 2192125 - BALIOE_10950 hypothetical protein
2196 c1 cds 2192138 2193187 - BALIOE_10955 hypothetical protein
2197 c1 cds 2193189 2193461 - BALIOE_10960 hypothetical protein
2198 c1 cds 2193583 2193927 - BALIOE_10965 hypothetical protein
2199 c1 cds 2194047 2194259 - BALIOE_10970 hypothetical protein
2200 c1 cds 2194493 2195050 - BALIOE_10975 hypothetical protein
2201 c1 cds 2195398 2195709 - BALIOE_10980 hypothetical protein
2202 c1 cds 2195702 2195929 - BALIOE_10985 hypothetical protein
2203 c1 cds 2195926 2196207 - BALIOE_10990 hypothetical protein
2204 c1 cds 2196240 2196956 - BALIOE_10995 hypothetical protein
2205 c1 cds 2196990 2197451 - BALIOE_11000 hypothetical protein
2206 c1 cds 2197444 2198487 - BALIOE_11005 hypothetical protein
2207 c1 cds 2198556 2198981 - BALIOE_11010 hypothetical protein
2208 c1 cds 2198965 2199207 - BALIOE_11015 hypothetical protein
2209 c1 cds 2199599 2199937 + BALIOE_11020 hypothetical protein
2210 c1 cds 2200149 2200382 + BALIOE_11025 hypothetical protein
2211 c1 cds 2200394 2201032 + BALIOE_11030 hypothetical protein
2212 c1 cds 2201033 2201242 - BALIOE_11035 hypothetical protein
2213 c1 cds 2201807 2201995 + BALIOE_11040 hypothetical protein
2214 c1 cds 2201992 2202180 + BALIOE_11045 hypothetical protein
2215 c1 cds 2202273 2203517 + BALIOE_11050 hypothetical protein
2216 c1 cds 2203514 2204050 + BALIOE_11055 hypothetical protein
2217 c1 cds 2204156 2204410 + BALIOE_11060 hypothetical protein
2218 c1 cds 2204413 2205300 - BALIOE_11065 hypothetical protein
2219 c1 cds 2205300 2205626 - BALIOE_11070 hypothetical protein
2220 c1 cds 2205833 2206702 - BALIOE_11075 hypothetical protein
2221 c1 cds 2206746 2207126 + BALIOE_11080 hypothetical protein
2222 c1 cds 2207123 2207470 + BALIOE_11085 hypothetical protein
2223 c1 cds 2207520 2209058 + BALIOE_11090 hypothetical protein
2224 c1 cds 2209069 2209491 - BALIOE_11095 hypothetical protein
2225 c1 cds 2209641 2210291 - BALIOE_11100 hypothetical protein
2226 c1 cds 2210565 2210711 - BALIOE_11105 hypothetical protein
2227 c1 cds 2211002 2211511 - BALIOE_11110 hypothetical protein
2228 c1 cds 2211691 2211960 - BALIOE_11115 hypothetical protein
2229 c1 cds 2211962 2213185 - BALIOE_11120 hypothetical protein
2230 c1 cds 2213250 2213849 - BALIOE_11125 hypothetical protein
2231 c1 cds 2213917 2214132 - BALIOE_11130 hypothetical protein
2232 c1 cds 2214135 2216264 - BALIOE_11135 hypothetical protein
2233 c1 cds 2216216 2217391 - BALIOE_11140 hypothetical protein
2234 c1 cds 2217733 2218314 - BALIOE_11145 hypothetical protein
2235 c1 cds 2218311 2219054 - BALIOE_11150 hypothetical protein
2236 c1 cds 2219065 2219763 - BALIOE_11155 hypothetical protein
2237 c1 cds 2219763 2220104 - BALIOE_11160 hypothetical protein
2238 c1 cds 2220097 2223339 - BALIOE_11165 hypothetical protein
2239 c1 cds 2223387 2223596 - BALIOE_11170 hypothetical protein
2240 c1 cds 2223692 2224066 - BALIOE_11175 hypothetical protein
2241 c1 cds 2224081 2224797 - BALIOE_11180 hypothetical protein
2242 c1 cds 2224863 2225207 - BALIOE_11185 hypothetical protein
2243 c1 cds 2225204 2225650 - BALIOE_11190 hypothetical protein
2244 c1 cds 2225647 2225997 - BALIOE_11195 hypothetical protein
2245 c1 cds 2226007 2226333 - BALIOE_11200 hypothetical protein
2246 c1 cds 2226336 2228915 - BALIOE_11205 hypothetical protein
2247 c1 cds 2228861 2229082 - BALIOE_11210 hypothetical protein
2248 c1 cds 2229127 2231064 - BALIOE_11215 hypothetical protein
2249 c1 cds 2231128 2232789 - BALIOE_11220 hypothetical protein
2250 c1 cds 2232786 2233349 - BALIOE_11225 hypothetical protein
2251 c1 cds 2233639 2234004 - BALIOE_11230 hypothetical protein
2252 c1 cds 2234046 2234273 + BALIOE_11235 hypothetical protein
2253 c1 cds 2234636 2235103 - BALIOE_11240 hypothetical protein
2254 c1 cds 2235111 2235257 - BALIOE_11245 hypothetical protein
2255 c1 cds 2235257 2235826 - BALIOE_11250 hypothetical protein
2256 c1 cds 2236097 2236630 - BALIOE_11255 hypothetical protein
2257 c1 cds 2236681 2237025 - BALIOE_11260 hypothetical protein
2258 c1 cds 2237030 2237236 - BALIOE_11265 hypothetical protein
2259 c1 cds 2237685 2239535 - BALIOE_11270 hypothetical protein
2260 c1 cds 2239850 2240017 - BALIOE_11275 hypothetical protein
2261 c1 cds 2240014 2240442 - BALIOE_11280 hypothetical protein
2262 c1 tRNA 2240622 2240698 - BALIOE_11285 Arg_trna tRNA-Arg SO:0001036
2263 c1 tRNA 2240712 2240788 - BALIOE_11290 Arg_trna tRNA-Arg SO:0001036
2264 c1 tRNA 2240796 2240871 - BALIOE_11295 Ile2_trna tRNA-Ile2 SO:0000263
2265 c1 cds 2241082 2241771 - BALIOE_11300 hypothetical protein
2266 c1 cds 2241768 2242127 - BALIOE_11305 hypothetical protein
2267 c1 cds 2242140 2243189 - BALIOE_11310 hypothetical protein
2268 c1 cds 2243637 2243849 - BALIOE_11315 hypothetical protein
2269 c1 cds 2243894 2244049 + BALIOE_11320 hypothetical protein
2270 c1 cds 2244038 2244142 - BALIOE_11325 hypothetical protein
2271 c1 cds 2244258 2244842 - BALIOE_11330 hypothetical protein
2272 c1 cds 2244899 2245294 - BALIOE_11335 hypothetical protein
2273 c1 cds 2245310 2245978 - BALIOE_11340 hypothetical protein
2274 c1 cds 2246105 2246845 - BALIOE_11345 hypothetical protein
2275 c1 cds 2246852 2247814 - BALIOE_11350 hypothetical protein
2276 c1 cds 2247837 2248262 - BALIOE_11355 hypothetical protein
2277 c1 cds 2248259 2248561 - BALIOE_11360 hypothetical protein
2278 c1 cds 2248659 2249030 + BALIOE_11365 hypothetical protein
2279 c1 cds 2249051 2249242 + BALIOE_11370 hypothetical protein
2280 c1 cds 2249244 2249522 + BALIOE_11375 hypothetical protein
2281 c1 cds 2249953 2250153 - BALIOE_11380 hypothetical protein
2282 c1 cds 2250246 2250464 + BALIOE_11385 hypothetical protein
2283 c1 cds 2250468 2250632 - BALIOE_11390 hypothetical protein
2284 c1 cds 2251033 2251221 + BALIOE_11395 hypothetical protein
2285 c1 cds 2251218 2251409 + BALIOE_11400 hypothetical protein
2286 c1 cds 2251502 2253973 + BALIOE_11405 hypothetical protein
2287 c1 cds 2254061 2254297 + BALIOE_11410 hypothetical protein
2288 c1 cds 2254332 2254487 + BALIOE_11415 hypothetical protein
2289 c1 cds 2254988 2255080 - BALIOE_11420 hypothetical protein
2290 c1 cds 2255286 2255612 - BALIOE_11425 hypothetical protein
2291 c1 cds 2255747 2256088 + BALIOE_11430 hypothetical protein
2292 c1 cds 2256123 2256683 + BALIOE_11435 hypothetical protein
2293 c1 cds 2256686 2257432 - BALIOE_11440 hypothetical protein
2294 c1 cds 2257504 2257809 + BALIOE_11445 hypothetical protein
2295 c1 cds 2258008 2260434 + BALIOE_11450 hypothetical protein
2296 c1 cds 2260522 2262918 + BALIOE_11455 hypothetical protein
2297 c1 cds 2262929 2263546 + BALIOE_11460 hypothetical protein
2298 c1 cds 2263548 2264402 + BALIOE_11465 hypothetical protein
2299 c1 cds 2264445 2265059 + BALIOE_11470 hypothetical protein
2300 c1 cds 2265253 2266509 + BALIOE_11475 hypothetical protein
2301 c1 cds 2266462 2267157 - BALIOE_11480 hypothetical protein
2302 c1 cds 2267282 2268502 - BALIOE_11485 hypothetical protein
2303 c1 cds 2268637 2269530 - BALIOE_11490 hypothetical protein
2304 c1 cds 2269637 2270890 + BALIOE_11495 hypothetical protein
2305 c1 cds 2271314 2271622 + BALIOE_11500 hypothetical protein
2306 c1 cds 2271898 2272719 + BALIOE_11505 hypothetical protein
2307 c1 cds 2272758 2273087 - BALIOE_11510 hypothetical protein
2308 c1 cds 2273074 2273439 - BALIOE_11515 hypothetical protein
2309 c1 cds 2273851 2274885 + BALIOE_11520 hypothetical protein
2310 c1 cds 2274910 2276298 - BALIOE_11525 hypothetical protein
2311 c1 cds 2276309 2277841 - BALIOE_11530 hypothetical protein
2312 c1 cds 2278365 2279309 + BALIOE_11535 hypothetical protein
2313 c1 cds 2279495 2280877 + BALIOE_11540 hypothetical protein
2314 c1 cds 2280914 2281636 + BALIOE_11545 hypothetical protein
2315 c1 cds 2281633 2281968 - BALIOE_11550 hypothetical protein
2316 c1 cds 2282097 2282816 + BALIOE_11555 hypothetical protein
2317 c1 cds 2282820 2284121 + BALIOE_11560 hypothetical protein
2318 c1 cds 2284197 2285126 + BALIOE_11565 hypothetical protein
2319 c1 cds 2285123 2286526 - BALIOE_11570 hypothetical protein
2320 c1 cds 2286669 2288315 - BALIOE_11575 hypothetical protein
2321 c1 cds 2288514 2289689 + BALIOE_11580 hypothetical protein
2322 c1 cds 2289790 2291298 + BALIOE_11585 hypothetical protein
2323 c1 cds 2291343 2291564 - BALIOE_11590 hypothetical protein
2324 c1 cds 2291579 2292607 - BALIOE_11595 hypothetical protein
2325 c1 cds 2292646 2294019 - BALIOE_11600 hypothetical protein
2326 c1 cds 2294016 2295122 - BALIOE_11605 hypothetical protein
2327 c1 cds 2295116 2295829 - BALIOE_11610 hypothetical protein
2328 c1 cds 2296220 2296810 - BALIOE_11615 hypothetical protein
2329 c1 cds 2297039 2297806 - BALIOE_11620 hypothetical protein
2330 c1 cds 2297918 2298946 - BALIOE_11625 hypothetical protein
2331 c1 cds 2299121 2300713 + BALIOE_11630 hypothetical protein
2332 c1 cds 2300723 2301895 + BALIOE_11635 hypothetical protein
2333 c1 cds 2301999 2303000 + BALIOE_11640 hypothetical protein
2334 c1 cds 2303036 2304076 - BALIOE_11645 hypothetical protein
2335 c1 cds 2304319 2304444 + BALIOE_11650 hypothetical protein
2336 c1 cds 2304717 2304932 + BALIOE_11655 hypothetical protein
2337 c1 cds 2305018 2305458 + BALIOE_11660 hypothetical protein
2338 c1 cds 2305535 2306116 + BALIOE_11665 hypothetical protein
2339 c1 cds 2306116 2306694 + BALIOE_11670 hypothetical protein
2340 c1 cds 2306687 2309005 + BALIOE_11675 hypothetical protein
2341 c1 cds 2309006 2310064 + BALIOE_11680 hypothetical protein
2342 c1 cds 2310068 2310688 + BALIOE_11685 hypothetical protein
2343 c1 cds 2310692 2311387 + BALIOE_11690 hypothetical protein
2344 c1 cds 2311387 2312022 + BALIOE_11695 hypothetical protein
2345 c1 cds 2312150 2312350 + BALIOE_11700 hypothetical protein
2346 c1 cds 2312633 2314135 + BALIOE_11705 hypothetical protein
2347 c1 cds 2314241 2314846 + BALIOE_11710 hypothetical protein
2348 c1 cds 2314890 2315750 - BALIOE_11715 hypothetical protein
2349 c1 cds 2315812 2317086 - BALIOE_11720 hypothetical protein
2350 c1 cds 2317215 2317871 - BALIOE_11725 hypothetical protein
2351 c1 cds 2317930 2318253 - BALIOE_11730 hypothetical protein
2352 c1 cds 2318357 2319466 - BALIOE_11735 hypothetical protein
2353 c1 cds 2319739 2320206 + BALIOE_11740 hypothetical protein
2354 c1 cds 2320253 2320687 - BALIOE_11745 hypothetical protein
2355 c1 cds 2320888 2321124 + BALIOE_11750 hypothetical protein
2356 c1 cds 2321127 2321984 + BALIOE_11755 hypothetical protein
2357 c1 cds 2321984 2323996 + BALIOE_11760 hypothetical protein
2358 c1 cds 2323997 2324518 - BALIOE_11765 hypothetical protein
2359 c1 cds 2324707 2325495 - BALIOE_11770 hypothetical protein
2360 c1 cds 2325544 2325783 - BALIOE_11775 hypothetical protein
2361 c1 cds 2325886 2326485 + BALIOE_11780 hypothetical protein
2362 c1 cds 2326522 2327619 + BALIOE_11785 hypothetical protein
2363 c1 cds 2327700 2328107 + BALIOE_11790 hypothetical protein
2364 c1 cds 2328210 2328857 + BALIOE_11795 hypothetical protein
2365 c1 cds 2328950 2333566 + BALIOE_11800 hypothetical protein
2366 c1 cds 2333617 2333964 - BALIOE_11805 hypothetical protein
2367 c1 cds 2334299 2335114 + BALIOE_11810 hypothetical protein
2368 c1 cds 2335242 2335823 + BALIOE_11815 hypothetical protein
2369 c1 cds 2335969 2337138 - BALIOE_11820 hypothetical protein
2370 c1 cds 2337304 2337393 - BALIOE_11825 hypothetical protein
2371 c1 cds 2337692 2338717 + BALIOE_11830 hypothetical protein
2372 c1 cds 2338714 2339646 - BALIOE_11835 hypothetical protein
2373 c1 cds 2339759 2340970 + BALIOE_11840 hypothetical protein
2374 c1 cds 2341261 2342409 + BALIOE_11845 hypothetical protein
2375 c1 cds 2342449 2343090 - BALIOE_11850 hypothetical protein
2376 c1 cds 2343305 2344678 + BALIOE_11855 hypothetical protein
2377 c1 cds 2344719 2345975 - BALIOE_11860 hypothetical protein
2378 c1 tRNA 2346283 2346359 + BALIOE_11865 Val_trna tRNA-Val SO:0000273
2379 c1 tRNA 2346364 2346440 + BALIOE_11870 Val_trna tRNA-Val SO:0000273
2380 c1 cds 2346548 2346853 + BALIOE_11875 hypothetical protein
2381 c1 cds 2346979 2348583 + BALIOE_11880 hypothetical protein
2382 c1 cds 2348595 2349359 - BALIOE_11885 hypothetical protein
2383 c1 cds 2349411 2350196 - BALIOE_11890 hypothetical protein
2384 c1 cds 2350193 2350861 - BALIOE_11895 hypothetical protein
2385 c1 cds 2350925 2351563 - BALIOE_11900 hypothetical protein
2386 c1 cds 2351576 2353678 - BALIOE_11905 hypothetical protein
2387 c1 cds 2353699 2354325 - BALIOE_11910 hypothetical protein
2388 c1 cds 2354781 2354990 - BALIOE_11915 hypothetical protein
2389 c1 cds 2355547 2356959 + BALIOE_11920 hypothetical protein
2390 c1 cds 2357270 2357506 + BALIOE_11925 hypothetical protein
2391 c1 cds 2357569 2358573 - BALIOE_11930 hypothetical protein
2392 c1 cds 2358722 2359138 - BALIOE_11935 hypothetical protein
2393 c1 cds 2359151 2360371 - BALIOE_11940 hypothetical protein
2394 c1 cds 2360368 2361639 - BALIOE_11945 hypothetical protein
2395 c1 cds 2361614 2362360 - BALIOE_11950 hypothetical protein
2396 c1 cds 2362370 2363857 - BALIOE_11955 hypothetical protein
2397 c1 cds 2363866 2364234 - BALIOE_11960 hypothetical protein
2398 c1 cds 2364783 2364971 - BALIOE_11965 hypothetical protein
2399 c1 cds 2365071 2365481 - BALIOE_11970 hypothetical protein
2400 c1 cds 2365478 2368534 - BALIOE_11975 hypothetical protein
2401 c1 cds 2368923 2370035 + BALIOE_11980 hypothetical protein
2402 c1 cds 2370464 2370820 + BALIOE_11985 hypothetical protein
2403 c1 cds 2370920 2372134 + BALIOE_11990 hypothetical protein
2404 c1 cds 2372361 2373626 + BALIOE_11995 hypothetical protein
2405 c1 cds 2373638 2374504 + BALIOE_12000 hypothetical protein
2406 c1 cds 2374535 2375293 + BALIOE_12005 hypothetical protein
2407 c1 cds 2375438 2377033 + BALIOE_12010 hypothetical protein
2408 c1 cds 2377047 2378198 + BALIOE_12015 hypothetical protein
2409 c1 cds 2378241 2379152 - BALIOE_12020 hypothetical protein
2410 c1 cds 2379255 2379431 - BALIOE_12025 hypothetical protein
2411 c1 cds 2379468 2380232 + BALIOE_12030 hypothetical protein
2412 c1 cds 2380252 2381190 + BALIOE_12035 hypothetical protein
2413 c1 cds 2381246 2382535 + BALIOE_12040 hypothetical protein
2414 c1 cds 2382532 2382825 + BALIOE_12045 hypothetical protein
2415 c1 cds 2382882 2384528 + BALIOE_12050 hypothetical protein
2416 c1 cds 2384585 2386963 - BALIOE_12055 hypothetical protein
2417 c1 cds 2387296 2388129 + BALIOE_12060 hypothetical protein
2418 c1 cds 2388286 2389332 + BALIOE_12065 hypothetical protein
2419 c1 cds 2389464 2389655 + BALIOE_12070 hypothetical protein
2420 c1 cds 2389659 2391095 - BALIOE_12075 hypothetical protein
2421 c1 cds 2391158 2391871 - BALIOE_12080 hypothetical protein
2422 c1 cds 2392118 2392582 - BALIOE_12085 hypothetical protein
2423 c1 cds 2392660 2393409 - BALIOE_12090 hypothetical protein
2424 c1 cds 2393409 2393960 - BALIOE_12095 hypothetical protein
2425 c1 cds 2394023 2395003 - BALIOE_12100 hypothetical protein
2426 c1 cds 2395104 2395403 - BALIOE_12105 hypothetical protein
2427 c1 cds 2395408 2397795 - BALIOE_12110 hypothetical protein
2428 c1 cds 2397810 2398793 - BALIOE_12115 hypothetical protein
2429 c1 cds 2399243 2399599 - BALIOE_12120 hypothetical protein
2430 c1 cds 2399652 2399849 - BALIOE_12125 hypothetical protein
2431 c1 cds 2399946 2400380 - BALIOE_12130 hypothetical protein
2432 c1 cds 2400492 2402420 - BALIOE_12135 hypothetical protein
2433 c1 cds 2402943 2404841 + BALIOE_12140 hypothetical protein
2434 c1 cds 2405016 2405123 + BALIOE_12145 hypothetical protein
2435 c1 cds 2405176 2405934 - BALIOE_12150 hypothetical protein
2436 c1 cds 2406221 2407150 + BALIOE_12155 hypothetical protein
2437 c1 cds 2407251 2407541 + BALIOE_12160 hypothetical protein
2438 c1 cds 2407647 2408507 + BALIOE_12165 hypothetical protein
2439 c1 cds 2408548 2409084 - BALIOE_12170 hypothetical protein
2440 c1 cds 2409231 2409899 + BALIOE_12175 hypothetical protein
2441 c1 cds 2410062 2410652 + BALIOE_12180 hypothetical protein
2442 c1 cds 2410785 2412176 + BALIOE_12185 hypothetical protein
2443 c1 cds 2412227 2412982 - BALIOE_12190 hypothetical protein
2444 c1 cds 2413271 2413534 - BALIOE_12195 hypothetical protein
2445 c1 cds 2413717 2415978 + BALIOE_12200 hypothetical protein
2446 c1 cds 2416025 2416783 - BALIOE_12205 hypothetical protein
2447 c1 cds 2416796 2418148 - BALIOE_12210 hypothetical protein
2448 c1 cds 2418254 2419093 - BALIOE_12215 hypothetical protein
2449 c1 cds 2419104 2419454 - BALIOE_12220 hypothetical protein
2450 c1 cds 2419505 2420863 - BALIOE_12225 hypothetical protein
2451 c1 cds 2420948 2421268 - BALIOE_12230 hypothetical protein
2452 c1 cds 2421568 2421906 - BALIOE_12235 hypothetical protein
2453 c1 cds 2422108 2422935 + BALIOE_12240 hypothetical protein
2454 c1 cds 2423165 2424052 + BALIOE_12245 hypothetical protein
2455 c1 cds 2424012 2424587 - BALIOE_12250 hypothetical protein
2456 c1 cds 2424790 2425275 - BALIOE_12255 hypothetical protein
2457 c1 cds 2425604 2426572 - BALIOE_12260 hypothetical protein
2458 c1 cds 2426565 2427908 - BALIOE_12265 hypothetical protein
2459 c1 cds 2427905 2429383 - BALIOE_12270 hypothetical protein
2460 c1 cds 2429380 2430414 - BALIOE_12275 hypothetical protein
2461 c1 cds 2430411 2431631 - BALIOE_12280 hypothetical protein
2462 c1 cds 2432077 2432883 + BALIOE_12285 hypothetical protein
2463 c1 cds 2433050 2433760 + BALIOE_12290 hypothetical protein
2464 c1 cds 2433765 2434442 + BALIOE_12295 hypothetical protein
2465 c1 cds 2434457 2435164 + BALIOE_12300 hypothetical protein
2466 c1 cds 2435164 2435712 + BALIOE_12305 hypothetical protein
2467 c1 cds 2435722 2436888 + BALIOE_12310 hypothetical protein
2468 c1 cds 2436861 2438396 + BALIOE_12315 hypothetical protein
2469 c1 cds 2438396 2439049 + BALIOE_12320 hypothetical protein
2470 c1 cds 2439116 2440423 + BALIOE_12325 hypothetical protein
2471 c1 cds 2440432 2441052 - BALIOE_12330 hypothetical protein
2472 c1 cds 2441139 2441546 + BALIOE_12335 hypothetical protein
2473 c1 cds 2441512 2441784 - BALIOE_12340 hypothetical protein
2474 c1 cds 2442020 2443363 + BALIOE_12345 hypothetical protein
2475 c1 cds 2443480 2444520 - BALIOE_12350 hypothetical protein
2476 c1 cds 2444648 2446609 - BALIOE_12355 hypothetical protein
2477 c1 cds 2446614 2447657 - BALIOE_12360 hypothetical protein
2478 c1 cds 2447774 2448325 - BALIOE_12365 hypothetical protein
2479 c1 cds 2448486 2450342 + BALIOE_12370 hypothetical protein
2480 c1 cds 2450458 2451168 + BALIOE_12375 hypothetical protein
2481 c1 cds 2451300 2452316 + BALIOE_12380 hypothetical protein
2482 c1 cds 2452327 2452968 + BALIOE_12385 hypothetical protein
2483 c1 cds 2453061 2454221 - BALIOE_12390 hypothetical protein
2484 c1 cds 2454374 2454700 + BALIOE_12395 hypothetical protein
2485 c1 cds 2454700 2455587 + BALIOE_12400 hypothetical protein
2486 c1 cds 2455562 2455732 - BALIOE_12405 hypothetical protein
2487 c1 cds 2455850 2456608 - BALIOE_12410 hypothetical protein
2488 c1 cds 2456745 2457725 - BALIOE_12415 hypothetical protein
2489 c1 cds 2457735 2458667 - BALIOE_12420 hypothetical protein
2490 c1 cds 2458672 2459508 - BALIOE_12425 hypothetical protein
2491 c1 cds 2459529 2460572 - BALIOE_12430 hypothetical protein
2492 c1 cds 2460589 2461968 - BALIOE_12435 hypothetical protein
2493 c1 cds 2461995 2463071 - BALIOE_12440 hypothetical protein
2494 c1 cds 2463441 2463713 - BALIOE_12445 hypothetical protein
2495 c1 cds 2463755 2464168 - BALIOE_12450 hypothetical protein
2496 c1 cds 2464510 2465505 + BALIOE_12455 hypothetical protein
2497 c1 cds 2465589 2466473 + BALIOE_12460 hypothetical protein
2498 c1 cds 2466524 2467378 - BALIOE_12465 hypothetical protein
2499 c1 cds 2467468 2468214 - BALIOE_12470 hypothetical protein
2500 c1 cds 2468650 2470584 + BALIOE_12475 hypothetical protein
2501 c1 cds 2470697 2471980 + BALIOE_12480 hypothetical protein
2502 c1 cds 2472259 2473602 + BALIOE_12485 hypothetical protein
2503 c1 cds 2473783 2475273 + BALIOE_12490 hypothetical protein
2504 c1 cds 2475316 2475819 + BALIOE_12495 hypothetical protein
2505 c1 cds 2476094 2476540 + BALIOE_12500 hypothetical protein
2506 c1 cds 2476497 2477315 - BALIOE_12505 hypothetical protein
2507 c1 cds 2477415 2478596 + BALIOE_12510 hypothetical protein
2508 c1 cds 2478651 2478998 + BALIOE_12515 hypothetical protein
2509 c1 cds 2479020 2479274 - BALIOE_12520 hypothetical protein
2510 c1 cds 2479457 2480305 + BALIOE_12525 hypothetical protein
2511 c1 cds 2480749 2480997 - BALIOE_12530 hypothetical protein
2512 c1 cds 2481144 2481326 - BALIOE_12535 hypothetical protein
2513 c1 cds 2481330 2481689 - BALIOE_12540 hypothetical protein
2514 c1 cds 2481862 2482500 - BALIOE_12545 hypothetical protein
2515 c1 cds 2482627 2483550 - BALIOE_12550 hypothetical protein
2516 c1 cds 2483653 2484738 + BALIOE_12555 hypothetical protein
2517 c1 cds 2484989 2486599 + BALIOE_12560 hypothetical protein
2518 c1 cds 2486631 2487755 + BALIOE_12565 hypothetical protein
2519 c1 cds 2487811 2488776 + BALIOE_12570 hypothetical protein
2520 c1 cds 2488830 2489945 - BALIOE_12575 hypothetical protein
2521 c1 cds 2490027 2491778 - BALIOE_12580 hypothetical protein
2522 c1 cds 2491917 2492498 - BALIOE_12585 hypothetical protein
2523 c1 cds 2492538 2493233 - BALIOE_12590 hypothetical protein
2524 c1 cds 2493291 2495201 - BALIOE_12595 hypothetical protein
2525 c1 cds 2495330 2495677 + BALIOE_12600 hypothetical protein
2526 c1 cds 2496099 2496398 + BALIOE_12605 hypothetical protein
2527 c1 cds 2496518 2496697 - BALIOE_12610 hypothetical protein
2528 c1 cds 2496771 2498132 + BALIOE_12615 hypothetical protein
2529 c1 cds 2498136 2498714 + BALIOE_12620 hypothetical protein
2530 c1 cds 2498898 2500262 + BALIOE_12625 hypothetical protein
2531 c1 cds 2500393 2501991 + BALIOE_12630 hypothetical protein
2532 c1 cds 2501995 2503551 - BALIOE_12635 hypothetical protein
2533 c1 cds 2504014 2504985 + BALIOE_12640 hypothetical protein
2534 c1 cds 2505048 2505848 + BALIOE_12645 hypothetical protein
2535 c1 cds 2505861 2506712 + BALIOE_12650 hypothetical protein
2536 c1 cds 2506767 2507225 + BALIOE_12655 hypothetical protein
2537 c1 cds 2507536 2507658 + BALIOE_12660 hypothetical protein
2538 c1 cds 2507655 2508221 + BALIOE_12665 hypothetical protein
2539 c1 cds 2508218 2509027 - BALIOE_12670 hypothetical protein
2540 c1 cds 2509193 2509402 - BALIOE_12675 hypothetical protein
2541 c1 cds 2510227 2510514 - BALIOE_12680 hypothetical protein
2542 c1 cds 2510892 2511131 + BALIOE_12685 hypothetical protein
2543 c1 cds 2511275 2512066 - BALIOE_12690 hypothetical protein
2544 c1 cds 2512243 2513616 + BALIOE_12695 hypothetical protein
2545 c1 cds 2513662 2514543 - BALIOE_12700 hypothetical protein
2546 c1 cds 2514735 2516783 - BALIOE_12705 hypothetical protein
2547 c1 cds 2516803 2517501 - BALIOE_12710 hypothetical protein
2548 c1 cds 2517598 2518149 - BALIOE_12715 hypothetical protein
2549 c1 cds 2518225 2519508 + BALIOE_12720 hypothetical protein
2550 c1 cds 2519477 2522110 + BALIOE_12725 hypothetical protein
2551 c1 cds 2522110 2523630 + BALIOE_12730 hypothetical protein
2552 c1 cds 2523748 2523984 + BALIOE_12735 hypothetical protein
2553 c1 cds 2524005 2524280 + BALIOE_12740 hypothetical protein
2554 c1 cds 2524281 2524937 - BALIOE_12745 hypothetical protein
2555 c1 cds 2525333 2525674 - BALIOE_12750 hypothetical protein
2556 c1 cds 2525687 2526559 - BALIOE_12755 hypothetical protein
2557 c1 cds 2526563 2526937 - BALIOE_12760 hypothetical protein
2558 c1 cds 2527076 2527306 + BALIOE_12765 hypothetical protein
2559 c1 cds 2527408 2528064 + BALIOE_12770 hypothetical protein
2560 c1 cds 2528088 2528750 + BALIOE_12775 hypothetical protein
2561 c1 cds 2528747 2530807 - BALIOE_12780 hypothetical protein
2562 c1 cds 2531016 2531675 - BALIOE_12785 hypothetical protein
2563 c1 cds 2531735 2531845 + BALIOE_12790 hypothetical protein
2564 c1 cds 2531882 2532088 + BALIOE_12795 hypothetical protein
2565 c1 cds 2532002 2532358 - BALIOE_12800 hypothetical protein
2566 c1 cds 2532425 2532715 - BALIOE_12805 hypothetical protein
2567 c1 cds 2532849 2534027 + BALIOE_12810 hypothetical protein
2568 c1 cds 2534083 2534724 - BALIOE_12815 hypothetical protein
2569 c1 cds 2534761 2536572 - BALIOE_12820 hypothetical protein
2570 c1 cds 2536807 2538282 - BALIOE_12825 hypothetical protein
2571 c1 cds 2538448 2538597 - BALIOE_12830 hypothetical protein
2572 c1 cds 2538620 2539489 + BALIOE_12835 hypothetical protein
2573 c1 cds 2539617 2541059 + BALIOE_12840 hypothetical protein
2574 c1 cds 2541190 2542161 - BALIOE_12845 hypothetical protein
2575 c1 cds 2542281 2543603 - BALIOE_12850 hypothetical protein
2576 c1 cds 2543619 2544605 - BALIOE_12855 hypothetical protein
2577 c1 cds 2544630 2545385 + BALIOE_12860 hypothetical protein
2578 c1 cds 2545382 2546167 + BALIOE_12865 hypothetical protein
2579 c1 ncRNA 2546239 2546314 - BALIOE_12870 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
2580 c1 cds 2546413 2547423 - BALIOE_12875 hypothetical protein
2581 c1 cds 2547432 2548043 - BALIOE_12880 hypothetical protein
2582 c1 cds 2548318 2548920 + BALIOE_12885 hypothetical protein
2583 c1 cds 2548922 2549443 - BALIOE_12890 hypothetical protein
2584 c1 cds 2549478 2550218 - BALIOE_12895 hypothetical protein
2585 c1 cds 2550247 2550756 - BALIOE_12900 hypothetical protein
2586 c1 cds 2550817 2552589 - BALIOE_12905 hypothetical protein
2587 c1 cds 2552899 2553465 + BALIOE_12910 hypothetical protein
2588 c1 cds 2553462 2554280 + BALIOE_12915 hypothetical protein
2589 c1 cds 2554333 2554728 + BALIOE_12920 hypothetical protein
2590 c1 cds 2554769 2555512 + BALIOE_12925 hypothetical protein
2591 c1 cds 2555509 2556480 + BALIOE_12930 hypothetical protein
2592 c1 cds 2556645 2559074 - BALIOE_12935 hypothetical protein
2593 c1 cds 2559099 2560199 - BALIOE_12940 hypothetical protein
2594 c1 cds 2560587 2561333 - BALIOE_12945 hypothetical protein
2595 c1 cds 2561347 2561913 - BALIOE_12950 hypothetical protein
2596 c1 cds 2562129 2563862 + BALIOE_12955 hypothetical protein
2597 c1 cds 2564039 2564527 + BALIOE_12960 hypothetical protein
2598 c1 cds 2564647 2565042 - BALIOE_12965 hypothetical protein
2599 c1 cds 2565039 2567117 - BALIOE_12970 hypothetical protein
2600 c1 cds 2567110 2568258 - BALIOE_12975 hypothetical protein
2601 c1 cds 2568460 2569104 - BALIOE_12980 hypothetical protein
2602 c1 cds 2569115 2569504 - BALIOE_12985 hypothetical protein
2603 c1 cds 2569519 2570568 - BALIOE_12990 hypothetical protein
2604 c1 cds 2570571 2571431 - BALIOE_12995 hypothetical protein
2605 c1 cds 2571450 2573051 - BALIOE_13000 hypothetical protein
2606 c1 cds 2573097 2574758 - BALIOE_13005 hypothetical protein
2607 c1 cds 2574901 2575404 - BALIOE_13010 hypothetical protein
2608 c1 cds 2575425 2577389 - BALIOE_13015 hypothetical protein
2609 c1 cds 2577394 2578320 - BALIOE_13020 hypothetical protein
2610 c1 cds 2578317 2579204 - BALIOE_13025 hypothetical protein
2611 c1 cds 2579331 2579909 - BALIOE_13030 hypothetical protein
2612 c1 cds 2579912 2580262 - BALIOE_13035 hypothetical protein
2613 c1 cds 2581042 2581470 + BALIOE_13040 hypothetical protein
2614 c1 cds 2581477 2582901 - BALIOE_13045 hypothetical protein
2615 c1 cds 2582876 2583676 - BALIOE_13050 hypothetical protein
2616 c1 cds 2583843 2584550 - BALIOE_13055 hypothetical protein
2617 c1 cds 2584569 2584829 - BALIOE_13060 hypothetical protein
2618 c1 cds 2584844 2586358 - BALIOE_13065 hypothetical protein
2619 c1 cds 2586428 2587417 - BALIOE_13070 hypothetical protein
2620 c1 cds 2588214 2588717 + BALIOE_13075 hypothetical protein
2621 c1 cds 2588797 2589048 - BALIOE_13080 hypothetical protein
2622 c1 cds 2589511 2589834 + BALIOE_13085 hypothetical protein
2623 c1 cds 2590005 2590502 + BALIOE_13090 hypothetical protein
2624 c1 cds 2590539 2590778 - BALIOE_13095 hypothetical protein
2625 c1 cds 2590970 2592181 + BALIOE_13100 hypothetical protein
2626 c1 cds 2592243 2592908 - BALIOE_13105 hypothetical protein
2627 c1 cds 2593265 2594266 - BALIOE_13110 hypothetical protein
2628 c1 cds 2594272 2594619 - BALIOE_13115 hypothetical protein
2629 c1 cds 2594649 2595299 - BALIOE_13120 hypothetical protein
2630 c1 cds 2595315 2595719 - BALIOE_13125 hypothetical protein
2631 c1 cds 2596018 2596221 + BALIOE_13130 hypothetical protein
2632 c1 cds 2596243 2596593 + BALIOE_13135 hypothetical protein
2633 c1 cds 2596604 2596882 + BALIOE_13140 hypothetical protein
2634 c1 cds 2596894 2597136 + BALIOE_13145 hypothetical protein
2635 c1 cds 2597133 2597246 + BALIOE_13150 hypothetical protein
2636 c1 cds 2597339 2597755 + BALIOE_13155 hypothetical protein
2637 c1 cds 2597779 2597982 + BALIOE_13160 hypothetical protein
2638 c1 cds 2597979 2598245 + BALIOE_13165 hypothetical protein
2639 c1 cds 2598242 2598541 + BALIOE_13170 hypothetical protein
2640 c1 cds 2598864 2599094 + BALIOE_13175 hypothetical protein
2641 c1 cds 2599167 2599532 + BALIOE_13180 hypothetical protein
2642 c1 cds 2599539 2602361 + BALIOE_13185 hypothetical protein
2643 c1 cds 2602438 2603397 + BALIOE_13190 hypothetical protein
2644 c1 cds 2603402 2603716 + BALIOE_13195 hypothetical protein
2645 c1 cds 2603736 2604425 - BALIOE_13200 hypothetical protein
2646 c1 cds 2604425 2604751 - BALIOE_13205 hypothetical protein
2647 c1 cds 2604922 2605338 + BALIOE_13210 hypothetical protein
2648 c1 cds 2605382 2605954 - BALIOE_13215 hypothetical protein
2649 c1 cds 2606111 2606599 - BALIOE_13220 hypothetical protein
2650 c1 cds 2606612 2607313 - BALIOE_13225 hypothetical protein
2651 c1 cds 2607325 2609415 - BALIOE_13230 hypothetical protein
2652 c1 cds 2609566 2609931 - BALIOE_13235 hypothetical protein
2653 c1 cds 2609986 2610498 - BALIOE_13240 hypothetical protein
2654 c1 cds 2610498 2611682 - BALIOE_13245 hypothetical protein
2655 c1 cds 2611840 2612163 + BALIOE_13250 hypothetical protein
2656 c1 cds 2612114 2613145 - BALIOE_13255 hypothetical protein
2657 c1 tRNA 2614224 2614310 - BALIOE_13260 Leu_trna tRNA-Leu SO:0000264
2658 c1 tRNA 2614323 2614396 - BALIOE_13265 Cys_trna tRNA-Cys SO:0000258
2659 c1 tRNA 2614450 2614525 - BALIOE_13270 Gly_trna tRNA-Gly SO:0000260
2660 c1 cds 2614677 2615225 - BALIOE_13275 hypothetical protein
2661 c1 cds 2615282 2617114 - BALIOE_13280 hypothetical protein
2662 c1 cds 2617111 2617767 - BALIOE_13285 hypothetical protein
2663 c1 cds 2618226 2618450 + BALIOE_13290 hypothetical protein
2664 c1 cds 2618518 2619240 - BALIOE_13295 hypothetical protein
2665 c1 cds 2619470 2620222 - BALIOE_13300 hypothetical protein
2666 c1 cds 2620219 2620887 - BALIOE_13305 hypothetical protein
2667 c1 cds 2620902 2621381 - BALIOE_13310 hypothetical protein
2668 c1 cds 2621387 2621887 - BALIOE_13315 hypothetical protein
2669 c1 cds 2621992 2622849 - BALIOE_13320 hypothetical protein
2670 c1 cds 2622880 2623431 - BALIOE_13325 hypothetical protein
2671 c1 cds 2623477 2624196 - BALIOE_13330 hypothetical protein
2672 c1 cds 2624516 2626273 - BALIOE_13335 hypothetical protein
2673 c1 cds 2626539 2627936 + BALIOE_13340 hypothetical protein
2674 c1 cds 2627961 2628371 + BALIOE_13345 hypothetical protein
2675 c1 cds 2628371 2628736 + BALIOE_13350 hypothetical protein
2676 c1 cds 2628814 2630301 + BALIOE_13355 hypothetical protein
2677 c1 cds 2630335 2630748 - BALIOE_13360 hypothetical protein
2678 c1 cds 2630935 2632140 + BALIOE_13365 hypothetical protein
2679 c1 cds 2632137 2632370 + BALIOE_13370 hypothetical protein
2680 c1 cds 2632479 2633147 + BALIOE_13375 hypothetical protein
2681 c1 cds 2633258 2633737 + BALIOE_13380 hypothetical protein
2682 c1 cds 2633875 2635014 - BALIOE_13385 hypothetical protein
2683 c1 cds 2635833 2636972 - BALIOE_13390 hypothetical protein
2684 c1 cds 2637321 2637635 - BALIOE_13395 hypothetical protein
2685 c1 cds 2637850 2639508 + BALIOE_13400 hypothetical protein
2686 c1 cds 2639501 2640496 + BALIOE_13405 hypothetical protein
2687 c1 cds 2640489 2641175 + BALIOE_13410 hypothetical protein
2688 c1 cds 2641237 2642610 + BALIOE_13415 hypothetical protein
2689 c1 cds 2642629 2643072 + BALIOE_13420 hypothetical protein
2690 c1 cds 2643069 2644196 + BALIOE_13425 hypothetical protein
2691 c1 cds 2644301 2644765 + BALIOE_13430 hypothetical protein
2692 c1 cds 2644770 2645774 + BALIOE_13435 hypothetical protein
2693 c1 cds 2645771 2646184 + BALIOE_13440 hypothetical protein
2694 c1 cds 2646187 2646552 + BALIOE_13445 hypothetical protein
2695 c1 cds 2646552 2647289 + BALIOE_13450 hypothetical protein
2696 c1 cds 2647299 2647568 + BALIOE_13455 hypothetical protein
2697 c1 cds 2647576 2648361 + BALIOE_13460 hypothetical protein
2698 c1 cds 2648651 2649274 + BALIOE_13465 hypothetical protein
2699 c1 cds 2649318 2649506 - BALIOE_13470 hypothetical protein
2700 c1 cds 2649669 2649896 + BALIOE_13475 hypothetical protein
2701 c1 cds 2650194 2651009 + BALIOE_13480 hypothetical protein
2702 c1 cds 2651006 2652700 - BALIOE_13485 hypothetical protein
2703 c1 cds 2652871 2653053 - BALIOE_13490 hypothetical protein
2704 c1 cds 2653132 2654049 - BALIOE_13495 hypothetical protein
2705 c1 cds 2654222 2655142 + BALIOE_13500 hypothetical protein
2706 c1 cds 2655131 2655601 - BALIOE_13505 hypothetical protein
2707 c1 cds 2655582 2657000 - BALIOE_13510 hypothetical protein
2708 c1 cds 2657067 2657762 - BALIOE_13515 hypothetical protein
2709 c1 cds 2658733 2659377 + BALIOE_13520 hypothetical protein
2710 c1 cds 2659344 2659919 + BALIOE_13525 hypothetical protein
2711 c1 cds 2660511 2661362 + BALIOE_13530 hypothetical protein
2712 c1 cds 2661470 2662828 - BALIOE_13535 hypothetical protein
2713 c1 cds 2662828 2663610 - BALIOE_13540 hypothetical protein
2714 c1 cds 2663632 2664045 + BALIOE_13545 hypothetical protein
2715 c1 cds 2664153 2665157 + BALIOE_13550 hypothetical protein
2716 c1 cds 2665158 2665793 + BALIOE_13555 hypothetical protein
2717 c1 cds 2666029 2666700 + BALIOE_13560 hypothetical protein
2718 c1 cds 2667043 2667573 + BALIOE_13565 hypothetical protein
2719 c1 tRNA 2668144 2668233 - BALIOE_13570 (pseudo) tRNA-Xxx
2720 c1 cds 2668284 2668502 + BALIOE_13575 hypothetical protein
2721 c1 cds 2668710 2669363 + BALIOE_13580 hypothetical protein
2722 c1 cds 2669688 2670701 + BALIOE_13585 hypothetical protein
2723 c1 cds 2670827 2671096 - BALIOE_13590 hypothetical protein
2724 c1 cds 2671098 2672411 - BALIOE_13595 hypothetical protein
2725 c1 cds 2672476 2673075 - BALIOE_13600 hypothetical protein
2726 c1 cds 2673143 2675494 - BALIOE_13605 hypothetical protein
2727 c1 cds 2675446 2676621 - BALIOE_13610 hypothetical protein
2728 c1 cds 2676862 2677440 - BALIOE_13615 hypothetical protein
2729 c1 cds 2677437 2678180 - BALIOE_13620 hypothetical protein
2730 c1 cds 2678191 2678889 - BALIOE_13625 hypothetical protein
2731 c1 cds 2678889 2679218 - BALIOE_13630 hypothetical protein
2732 c1 cds 2679215 2679979 - BALIOE_13635 hypothetical protein
2733 c1 cds 2679931 2681793 - BALIOE_13640 hypothetical protein
2734 c1 cds 2681774 2682187 - BALIOE_13645 hypothetical protein
2735 c1 cds 2682214 2682645 - BALIOE_13650 hypothetical protein
2736 c1 cds 2682659 2683288 - BALIOE_13655 hypothetical protein
2737 c1 cds 2683381 2683647 - BALIOE_13660 hypothetical protein
2738 c1 cds 2683705 2684052 - BALIOE_13665 hypothetical protein
2739 c1 cds 2684089 2685594 - BALIOE_13670 hypothetical protein
2740 c1 cds 2685584 2687176 - BALIOE_13675 hypothetical protein
2741 c1 cds 2687173 2687379 - BALIOE_13680 hypothetical protein
2742 c1 cds 2687363 2689291 - BALIOE_13685 hypothetical protein
2743 c1 cds 2689263 2689772 - BALIOE_13690 hypothetical protein
2744 c1 cds 2690473 2690787 - BALIOE_13695 hypothetical protein
2745 c1 cds 2691252 2691719 - BALIOE_13700 hypothetical protein
2746 c1 cds 2691727 2691858 - BALIOE_13705 hypothetical protein
2747 c1 cds 2691871 2692053 - BALIOE_13710 hypothetical protein
2748 c1 cds 2692209 2692742 - BALIOE_13715 hypothetical protein
2749 c1 cds 2692793 2693137 - BALIOE_13720 hypothetical protein
2750 c1 cds 2693142 2693348 - BALIOE_13725 hypothetical protein
2751 c1 cds 2693668 2693994 + BALIOE_13730 hypothetical protein
2752 c1 cds 2693994 2694881 + BALIOE_13735 hypothetical protein
2753 c1 cds 2694963 2696813 - BALIOE_13740 hypothetical protein
2754 c1 cds 2697127 2697294 - BALIOE_13745 hypothetical protein
2755 c1 cds 2697291 2697719 - BALIOE_13750 hypothetical protein
2756 c1 tRNA 2697893 2697969 - BALIOE_13755 Arg_trna tRNA-Arg SO:0001036
2757 c1 tRNA 2697983 2698059 - BALIOE_13760 Arg_trna tRNA-Arg SO:0001036
2758 c1 tRNA 2698067 2698142 - BALIOE_13765 Ile2_trna tRNA-Ile2 SO:0000263
2759 c1 cds 2698353 2699042 - BALIOE_13770 hypothetical protein
2760 c1 cds 2699039 2699398 - BALIOE_13775 hypothetical protein
2761 c1 cds 2699411 2700460 - BALIOE_13780 hypothetical protein
2762 c1 cds 2700908 2701120 - BALIOE_13785 hypothetical protein
2763 c1 cds 2701307 2701411 - BALIOE_13790 hypothetical protein
2764 c1 cds 2701521 2702084 - BALIOE_13795 hypothetical protein
2765 c1 cds 2702211 2702522 - BALIOE_13800 hypothetical protein
2766 c1 cds 2702519 2702671 - BALIOE_13805 hypothetical protein
2767 c1 cds 2702704 2703060 - BALIOE_13810 hypothetical protein
2768 c1 cds 2703057 2703281 - BALIOE_13815 hypothetical protein
2769 c1 cds 2703303 2704001 - BALIOE_13820 hypothetical protein
2770 c1 cds 2704036 2704458 - BALIOE_13825 hypothetical protein
2771 c1 cds 2704490 2705527 - BALIOE_13830 hypothetical protein
2772 c1 cds 2705596 2706021 - BALIOE_13835 hypothetical protein
2773 c1 cds 2706018 2706245 - BALIOE_13840 hypothetical protein
2774 c1 cds 2706343 2706987 + BALIOE_13845 hypothetical protein
2775 c1 cds 2707262 2707414 + BALIOE_13850 hypothetical protein
2776 c1 cds 2707895 2708083 + BALIOE_13855 hypothetical protein
2777 c1 cds 2708080 2708268 + BALIOE_13860 hypothetical protein
2778 c1 cds 2708364 2710835 + BALIOE_13865 hypothetical protein
2779 c1 cds 2710894 2711097 + BALIOE_13870 hypothetical protein
2780 c1 cds 2711097 2712119 + BALIOE_13875 hypothetical protein
2781 c1 tRNA 2712172 2712261 - BALIOE_13880 Ser_trna tRNA-Ser SO:0000269
2782 c1 cds 2712355 2713152 + BALIOE_13885 hypothetical protein
2783 c1 tRNA 2713253 2713328 + BALIOE_13890 Asn_trna tRNA-Asn SO:0000257
2784 c1 cds 2713452 2713601 + BALIOE_13895 hypothetical protein
2785 c1 cds 2713615 2717622 + BALIOE_13900 hypothetical protein
2786 c1 cds 2717588 2721625 + BALIOE_13905 hypothetical protein
2787 c1 cds 2721887 2722939 - BALIOE_13910 hypothetical protein
2788 c1 cds 2723253 2724569 + BALIOE_13915 hypothetical protein
2789 c1 cds 2724671 2726125 + BALIOE_13920 hypothetical protein
2790 c1 cds 2726468 2727184 + BALIOE_13925 hypothetical protein
2791 c1 tRNA 2727634 2727709 - BALIOE_13930 Asn_trna tRNA-Asn SO:0000257
2792 c1 cds 2728158 2729264 - BALIOE_13935 hypothetical protein
2793 c1 tRNA 2729458 2729533 + BALIOE_13940 Asn_trna tRNA-Asn SO:0000257
2794 c1 cds 2729571 2730521 - BALIOE_13945 hypothetical protein
2795 c1 cds 2730623 2731540 - BALIOE_13950 hypothetical protein
2796 c1 tRNA 2731866 2731941 + BALIOE_13955 Asn_trna tRNA-Asn SO:0000257
2797 c1 cds 2731997 2732932 - BALIOE_13960 hypothetical protein
2798 c1 cds 2732994 2734073 - BALIOE_13965 hypothetical protein
2799 c1 cds 2734085 2734828 - BALIOE_13970 hypothetical protein
2800 c1 cds 2734825 2735367 - BALIOE_13975 hypothetical protein
2801 c1 cds 2735732 2736112 + BALIOE_13980 hypothetical protein
2802 c1 cds 2736109 2736456 + BALIOE_13985 hypothetical protein
2803 c1 cds 2736506 2738044 + BALIOE_13990 hypothetical protein
2804 c1 cds 2739492 2741639 + BALIOE_13995 hypothetical protein
2805 c1 cds 2741627 2741755 + BALIOE_14000 hypothetical protein
2806 c1 cds 2742011 2742337 + BALIOE_14005 hypothetical protein
2807 c1 cds 2742337 2743224 + BALIOE_14010 hypothetical protein
2808 c1 cds 2743190 2744089 + BALIOE_14015 hypothetical protein
2809 c1 cds 2744086 2744991 + BALIOE_14020 hypothetical protein
2810 c1 cds 2744988 2746058 + BALIOE_14025 hypothetical protein
2811 c1 cds 2746194 2746877 + BALIOE_14030 hypothetical protein
2812 c1 cds 2746893 2747303 + BALIOE_14035 hypothetical protein
2813 c1 cds 2747524 2748345 + BALIOE_14040 hypothetical protein
2814 c1 cds 2748427 2748906 + BALIOE_14045 hypothetical protein
2815 c1 cds 2748921 2749397 + BALIOE_14050 hypothetical protein
2816 c1 cds 2749460 2749681 + BALIOE_14055 hypothetical protein
2817 c1 cds 2749755 2750123 + BALIOE_14060 hypothetical protein
2818 c1 cds 2750212 2750475 + BALIOE_14065 hypothetical protein
2819 c1 cds 2750582 2750776 + BALIOE_14070 hypothetical protein
2820 c1 cds 2751674 2752003 - BALIOE_14075 hypothetical protein
2821 c1 cds 2752175 2753233 - BALIOE_14080 hypothetical protein
2822 c1 cds 2753432 2753905 - BALIOE_14085 hypothetical protein
2823 c1 cds 2754024 2755190 - BALIOE_14090 hypothetical protein
2824 c1 cds 2755399 2756826 + BALIOE_14095 hypothetical protein
2825 c1 cds 2756869 2757096 - BALIOE_14100 hypothetical protein
2826 c1 cds 2757110 2758114 - BALIOE_14105 hypothetical protein
2827 c1 cds 2758347 2759705 - BALIOE_14110 hypothetical protein
2828 c1 cds 2759972 2760922 - BALIOE_14115 hypothetical protein
2829 c1 cds 2760947 2761771 - BALIOE_14120 hypothetical protein
2830 c1 cds 2762393 2763292 + BALIOE_14125 hypothetical protein
2831 c1 cds 2763298 2764602 + BALIOE_14130 hypothetical protein
2832 c1 cds 2764599 2765669 + BALIOE_14135 hypothetical protein
2833 c1 cds 2765669 2766736 + BALIOE_14140 hypothetical protein
2834 c1 cds 2766736 2767326 + BALIOE_14145 hypothetical protein
2835 c1 cds 2767326 2768063 + BALIOE_14150 hypothetical protein
2836 c1 cds 2768045 2768821 + BALIOE_14155 hypothetical protein
2837 c1 cds 2768815 2769426 + BALIOE_14160 hypothetical protein
2838 c1 cds 2769523 2770500 - BALIOE_14165 hypothetical protein
2839 c1 cds 2770646 2771812 - BALIOE_14170 hypothetical protein
2840 c1 cds 2772061 2773467 - BALIOE_14175 hypothetical protein
2841 c1 cds 2773668 2774333 - BALIOE_14180 hypothetical protein
2842 c1 cds 2775596 2776966 - BALIOE_14185 hypothetical protein
2843 c1 cds 2776970 2778418 - BALIOE_14190 hypothetical protein
2844 c1 cds 2778400 2778909 - BALIOE_14195 hypothetical protein
2845 c1 cds 2778912 2779877 - BALIOE_14200 hypothetical protein
2846 c1 cds 2779880 2780998 - BALIOE_14205 hypothetical protein
2847 c1 cds 2781018 2782232 - BALIOE_14210 hypothetical protein
2848 c1 cds 2782257 2783351 - BALIOE_14215 hypothetical protein
2849 c1 cds 2783354 2784745 - BALIOE_14220 hypothetical protein
2850 c1 cds 2784732 2785478 - BALIOE_14225 hypothetical protein
2851 c1 cds 2785447 2786631 - BALIOE_14230 hypothetical protein
2852 c1 cds 2786628 2787410 - BALIOE_14235 hypothetical protein
2853 c1 cds 2787729 2788622 - BALIOE_14240 hypothetical protein
2854 c1 cds 2788865 2789860 - BALIOE_14245 hypothetical protein
2855 c1 cds 2790018 2791412 - BALIOE_14250 hypothetical protein
2856 c1 cds 2791423 2792643 - BALIOE_14255 hypothetical protein
2857 c1 cds 2792640 2793920 - BALIOE_14260 hypothetical protein
2858 c1 cds 2794100 2795578 - BALIOE_14265 hypothetical protein
2859 c1 cds 2795580 2796974 - BALIOE_14270 hypothetical protein
2860 c1 cds 2797029 2798399 - BALIOE_14275 hypothetical protein
2861 c1 cds 2798592 2800028 - BALIOE_14280 hypothetical protein
2862 c1 cds 2800031 2801254 - BALIOE_14285 hypothetical protein
2863 c1 cds 2801251 2801733 - BALIOE_14290 hypothetical protein
2864 c1 cds 2801733 2802698 - BALIOE_14295 hypothetical protein
2865 c1 cds 2802701 2803822 - BALIOE_14300 hypothetical protein
2866 c1 cds 2803851 2804399 - BALIOE_14305 hypothetical protein
2867 c1 cds 2804415 2805161 - BALIOE_14310 hypothetical protein
2868 c1 cds 2805172 2806389 - BALIOE_14315 hypothetical protein
2869 c1 cds 2806364 2807581 - BALIOE_14320 hypothetical protein
2870 c1 cds 2807578 2808066 - BALIOE_14325 hypothetical protein
2871 c1 cds 2808069 2808908 - BALIOE_14330 hypothetical protein
2872 c1 cds 2809001 2811163 - BALIOE_14335 hypothetical protein
2873 c1 cds 2811166 2811609 - BALIOE_14340 hypothetical protein
2874 c1 cds 2811615 2812754 - BALIOE_14345 hypothetical protein
2875 c1 cds 2813413 2814996 + BALIOE_14350 hypothetical protein
2876 c1 cds 2815071 2815409 + BALIOE_14355 hypothetical protein
2877 c1 cds 2815399 2815689 + BALIOE_14360 hypothetical protein
2878 c1 cds 2815742 2817595 - BALIOE_14365 hypothetical protein
2879 c1 cds 2817617 2818198 - BALIOE_14370 hypothetical protein
2880 c1 cds 2818290 2818931 - BALIOE_14375 hypothetical protein
2881 c1 cds 2819249 2819782 + BALIOE_14380 hypothetical protein
2882 c1 cds 2819760 2822567 + BALIOE_14385 hypothetical protein
2883 c1 cds 2822668 2823516 - BALIOE_14390 hypothetical protein
2884 c1 cds 2823698 2825002 + BALIOE_14395 hypothetical protein
2885 c1 cds 2825015 2826955 - BALIOE_14400 hypothetical protein
2886 c1 cds 2826952 2827632 - BALIOE_14405 hypothetical protein
2887 c1 cds 2827710 2828369 - BALIOE_14410 hypothetical protein
2888 c1 cds 2829585 2830832 + BALIOE_14415 hypothetical protein
2889 c1 cds 2830832 2833954 + BALIOE_14420 hypothetical protein
2890 c1 cds 2833955 2837032 + BALIOE_14425 hypothetical protein
2891 c1 cds 2837033 2838448 + BALIOE_14430 hypothetical protein
2892 c1 cds 2838445 2839848 + BALIOE_14435 hypothetical protein
2893 c1 cds 2839845 2840567 + BALIOE_14440 hypothetical protein
2894 c1 cds 2840758 2841090 + BALIOE_14445 hypothetical protein
2895 c1 cds 2841238 2842599 + BALIOE_14450 hypothetical protein
2896 c1 cds 2842929 2843246 - BALIOE_14455 hypothetical protein
2897 c1 cds 2843652 2844551 + BALIOE_14460 hypothetical protein
2898 c1 cds 2844633 2845412 - BALIOE_14465 hypothetical protein
2899 c1 cds 2845512 2846552 - BALIOE_14470 hypothetical protein
2900 c1 cds 2846600 2847955 - BALIOE_14475 hypothetical protein
2901 c1 cds 2847959 2848243 - BALIOE_14480 hypothetical protein
2902 c1 cds 2848274 2848726 - BALIOE_14485 hypothetical protein
2903 c1 cds 2848736 2849998 - BALIOE_14490 hypothetical protein
2904 c1 cds 2850027 2850881 - BALIOE_14495 hypothetical protein
2905 c1 ncRNA 2851088 2851158 - BALIOE_14500 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
2906 c1 cds 2851180 2852232 - BALIOE_14505 hypothetical protein
2907 c1 cds 2852489 2853766 + BALIOE_14510 hypothetical protein
2908 c1 cds 2853763 2854767 + BALIOE_14515 hypothetical protein
2909 c1 cds 2854764 2855729 + BALIOE_14520 hypothetical protein
2910 c1 cds 2855703 2856449 - BALIOE_14525 hypothetical protein
2911 c1 cds 2856501 2857319 - BALIOE_14530 hypothetical protein
2912 c1 cds 2857384 2858184 - BALIOE_14535 hypothetical protein
2913 c1 cds 2858181 2858969 - BALIOE_14540 hypothetical protein
2914 c1 cds 2859303 2859542 + BALIOE_14545 hypothetical protein
2915 c1 cds 2860593 2860940 + BALIOE_14550 hypothetical protein
2916 c1 cds 2860950 2861264 + BALIOE_14555 hypothetical protein
2917 c1 cds 2861374 2861646 - BALIOE_14560 hypothetical protein
2918 c1 cds 2861767 2862606 + BALIOE_14565 hypothetical protein
2919 c1 cds 2862824 2863162 + BALIOE_14570 hypothetical protein
2920 c1 cds 2863244 2864278 - BALIOE_14575 hypothetical protein
2921 c1 cds 2864289 2866769 - BALIOE_14580 hypothetical protein
2922 c1 cds 2866785 2867459 - BALIOE_14585 hypothetical protein
2923 c1 cds 2867547 2868089 - BALIOE_14590 hypothetical protein
2924 c1 cds 2868381 2868662 - BALIOE_14595 hypothetical protein
2925 c1 cds 2868924 2870033 - BALIOE_14600 hypothetical protein
2926 c1 cds 2870165 2872198 + BALIOE_14605 hypothetical protein
2927 c1 cds 2872339 2873067 + BALIOE_14610 hypothetical protein
2928 c1 cds 2873257 2876148 + BALIOE_14615 hypothetical protein
2929 c1 cds 2876161 2877441 + BALIOE_14620 hypothetical protein
2930 c1 cds 2877407 2879146 + BALIOE_14625 hypothetical protein
2931 c1 cds 2879156 2882785 + BALIOE_14630 hypothetical protein
2932 c1 cds 2882847 2883164 + BALIOE_14635 hypothetical protein
2933 c1 cds 2883274 2883363 - BALIOE_14640 hypothetical protein
2934 c1 cds 2884405 2885493 + BALIOE_14645 hypothetical protein
2935 c1 cds 2885504 2887033 + BALIOE_14650 hypothetical protein
2936 c1 cds 2887052 2887783 + BALIOE_14655 hypothetical protein
2937 c1 cds 2887776 2888912 + BALIOE_14660 hypothetical protein
2938 c1 cds 2888909 2891146 + BALIOE_14665 hypothetical protein
2939 c1 cds 2890953 2891840 - BALIOE_14670 hypothetical protein
2940 c1 cds 2891840 2892166 - BALIOE_14675 hypothetical protein
2941 c1 cds 2892350 2892811 + BALIOE_14680 hypothetical protein
2942 c1 cds 2892853 2893323 - BALIOE_14685 hypothetical protein
2943 c1 cds 2893370 2894089 - BALIOE_14690 hypothetical protein
2944 c1 cds 2894086 2895771 - BALIOE_14695 hypothetical protein
2945 c1 cds 2896286 2896534 + BALIOE_14700 hypothetical protein
2946 c1 cds 2896902 2897171 - BALIOE_14705 hypothetical protein
2947 c1 cds 2897173 2898486 - BALIOE_14710 hypothetical protein
2948 c1 cds 2898551 2899150 - BALIOE_14715 hypothetical protein
2949 c1 cds 2899218 2901563 - BALIOE_14720 hypothetical protein
2950 c1 cds 2901515 2902690 - BALIOE_14725 hypothetical protein
2951 c1 cds 2902931 2903509 - BALIOE_14730 hypothetical protein
2952 c1 cds 2903506 2904249 - BALIOE_14735 hypothetical protein
2953 c1 cds 2904260 2904958 - BALIOE_14740 hypothetical protein
2954 c1 cds 2904958 2905287 - BALIOE_14745 hypothetical protein
2955 c1 cds 2905284 2907929 - BALIOE_14750 hypothetical protein
2956 c1 cds 2907973 2908281 - BALIOE_14755 hypothetical protein
2957 c1 cds 2908308 2908730 - BALIOE_14760 hypothetical protein
2958 c1 cds 2908744 2909496 - BALIOE_14765 hypothetical protein
2959 c1 cds 2909504 2909902 - BALIOE_14770 hypothetical protein
2960 c1 cds 2909915 2910538 - BALIOE_14775 hypothetical protein
2961 c1 cds 2910541 2910822 - BALIOE_14780 hypothetical protein
2962 c1 cds 2910815 2911141 - BALIOE_14785 hypothetical protein
2963 c1 cds 2911229 2912269 - BALIOE_14790 hypothetical protein
2964 c1 cds 2912391 2912717 + BALIOE_14795 hypothetical protein
2965 c1 cds 2912717 2913604 + BALIOE_14800 hypothetical protein
2966 c1 cds 2913607 2914566 - BALIOE_14805 hypothetical protein
2967 c1 cds 2914511 2916013 - BALIOE_14810 hypothetical protein
2968 c1 cds 2916013 2916225 - BALIOE_14815 hypothetical protein
2969 c1 cds 2916222 2918345 - BALIOE_14820 hypothetical protein
2970 c1 cds 2918342 2918818 - BALIOE_14825 hypothetical protein
2971 c1 cds 2919273 2919740 - BALIOE_14830 hypothetical protein
2972 c1 cds 2919748 2919894 - BALIOE_14835 hypothetical protein
2973 c1 cds 2919894 2920463 - BALIOE_14840 hypothetical protein
2974 c1 cds 2920734 2921267 - BALIOE_14845 hypothetical protein
2975 c1 cds 2921272 2921487 - BALIOE_14850 hypothetical protein
2976 c1 cds 2921565 2921810 - BALIOE_14855 hypothetical protein
2977 c1 cds 2921851 2922030 - BALIOE_14860 hypothetical protein
2978 c1 cds 2922168 2924114 - BALIOE_14865 hypothetical protein
2979 c1 cds 2924625 2924894 - BALIOE_14870 hypothetical protein
2980 c1 cds 2924904 2925851 - BALIOE_14875 hypothetical protein
2981 c1 cds 2926358 2926840 - BALIOE_14880 hypothetical protein
2982 c1 cds 2926785 2926979 - BALIOE_14885 hypothetical protein
2983 c1 cds 2926976 2927581 - BALIOE_14890 hypothetical protein
2984 c1 cds 2927574 2927783 - BALIOE_14895 hypothetical protein
2985 c1 cds 2927743 2928144 - BALIOE_14900 hypothetical protein
2986 c1 cds 2928320 2928847 - BALIOE_14905 hypothetical protein
2987 c1 cds 2928844 2929290 - BALIOE_14910 hypothetical protein
2988 c1 cds 2929247 2929483 - BALIOE_14915 hypothetical protein
2989 c1 cds 2929494 2929709 - BALIOE_14920 hypothetical protein
2990 c1 cds 2929842 2930120 - BALIOE_14925 hypothetical protein
2991 c1 cds 2930191 2930481 - BALIOE_14930 hypothetical protein
2992 c1 cds 2930478 2931179 - BALIOE_14935 hypothetical protein
2993 c1 cds 2931176 2932114 - BALIOE_14940 hypothetical protein
2994 c1 cds 2932147 2932443 - BALIOE_14945 hypothetical protein
2995 c1 cds 2932558 2932776 - BALIOE_14950 hypothetical protein
2996 c1 cds 2932894 2933532 + BALIOE_14955 hypothetical protein
2997 c1 cds 2933655 2933936 + BALIOE_14960 hypothetical protein
2998 c1 cds 2933943 2934494 + BALIOE_14965 hypothetical protein
2999 c1 cds 2935007 2935279 + BALIOE_14970 hypothetical protein
3000 c1 cds 2935296 2935877 - BALIOE_14975 hypothetical protein
3001 c1 cds 2936138 2936506 + BALIOE_14980 hypothetical protein
3002 c1 cds 2936579 2936743 + BALIOE_14985 hypothetical protein
3003 c1 cds 2936712 2936855 + BALIOE_14990 hypothetical protein
3004 c1 cds 2936931 2937227 + BALIOE_14995 hypothetical protein
3005 c1 cds 2937233 2938018 + BALIOE_15000 hypothetical protein
3006 c1 cds 2938015 2938692 + BALIOE_15005 hypothetical protein
3007 c1 cds 2938692 2938874 + BALIOE_15010 hypothetical protein
3008 c1 cds 2938847 2939038 + BALIOE_15015 hypothetical protein
3009 c1 cds 2939115 2939330 + BALIOE_15020 hypothetical protein
3010 c1 cds 2939429 2939650 + BALIOE_15025 hypothetical protein
3011 c1 cds 2939647 2940594 + BALIOE_15030 hypothetical protein
3012 c1 cds 2940596 2940772 + BALIOE_15035 hypothetical protein
3013 c1 cds 2941106 2941462 + BALIOE_15040 hypothetical protein
3014 c1 cds 2941459 2941821 + BALIOE_15045 hypothetical protein
3015 c1 cds 2941909 2942151 + BALIOE_15050 hypothetical protein
3016 c1 cds 2942155 2942289 + BALIOE_15055 hypothetical protein
3017 c1 cds 2942308 2942562 + BALIOE_15060 hypothetical protein
3018 c1 cds 2942596 2943882 + BALIOE_15065 hypothetical protein
3019 c1 cds 2943957 2944604 + BALIOE_15070 hypothetical protein
3020 c1 cds 2944664 2944771 + BALIOE_15075 hypothetical protein
3021 c1 cds 2944752 2945483 - BALIOE_15080 hypothetical protein
3022 c1 cds 2945488 2946414 - BALIOE_15085 hypothetical protein
3023 c1 cds 2946407 2947564 - BALIOE_15090 hypothetical protein
3024 c1 cds 2947571 2948488 - BALIOE_15095 hypothetical protein
3025 c1 cds 2948740 2951007 - BALIOE_15100 hypothetical protein
3026 c1 cds 2951233 2952948 + BALIOE_15105 hypothetical protein
3027 c1 cds 2952986 2953918 - BALIOE_15110 hypothetical protein
3028 c1 cds 2954092 2954679 - BALIOE_15115 hypothetical protein
3029 c1 cds 2954849 2955427 + BALIOE_15120 hypothetical protein
3030 c1 cds 2955557 2956318 - BALIOE_15125 hypothetical protein
3031 c1 cds 2956371 2957897 - BALIOE_15130 hypothetical protein
3032 c1 cds 2958502 2959452 - BALIOE_15135 hypothetical protein
3033 c1 cds 2959612 2960805 - BALIOE_15140 hypothetical protein
3034 c1 cds 2960820 2961464 - BALIOE_15145 hypothetical protein
3035 c1 cds 2961473 2962174 - BALIOE_15150 hypothetical protein
3036 c1 cds 2962189 2963217 - BALIOE_15155 hypothetical protein
3037 c1 cds 2963229 2964587 - BALIOE_15160 hypothetical protein
3038 c1 cds 2964714 2965622 + BALIOE_15165 hypothetical protein
3039 c1 cds 2965753 2966151 + BALIOE_15170 hypothetical protein
3040 c1 cds 2966148 2966843 + BALIOE_15175 hypothetical protein
3041 c1 cds 2966973 2967857 + BALIOE_15180 hypothetical protein
3042 c1 cds 2968007 2968726 + BALIOE_15185 hypothetical protein
3043 c1 cds 2968729 2968968 + BALIOE_15190 hypothetical protein
3044 c1 cds 2969162 2970400 + BALIOE_15195 hypothetical protein
3045 c1 cds 2970394 2971629 + BALIOE_15200 hypothetical protein
3046 c1 ncRNA 2971732 2971809 - BALIOE_15205 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3047 c1 cds 2971872 2972882 - BALIOE_15210 hypothetical protein
3048 c1 cds 2972898 2974418 - BALIOE_15215 hypothetical protein
3049 c1 cds 2974479 2975477 - BALIOE_15220 hypothetical protein
3050 c1 cds 2975756 2976796 - BALIOE_15225 hypothetical protein
3051 c1 cds 2976938 2978095 - BALIOE_15230 hypothetical protein
3052 c1 cds 2978112 2978780 - BALIOE_15235 hypothetical protein
3053 c1 cds 2979038 2979874 + BALIOE_15240 hypothetical protein
3054 c1 cds 2979906 2981885 - BALIOE_15245 hypothetical protein
3055 c1 cds 2982177 2983646 - BALIOE_15250 hypothetical protein
3056 c1 cds 2983851 2984732 - BALIOE_15255 hypothetical protein
3057 c1 cds 2984831 2985880 + BALIOE_15260 hypothetical protein
3058 c1 cds 2985954 2986811 + BALIOE_15265 hypothetical protein
3059 c1 cds 2986814 2987902 + BALIOE_15270 hypothetical protein
3060 c1 cds 2987958 2989208 - BALIOE_15275 hypothetical protein
3061 c1 cds 2989308 2990249 - BALIOE_15280 hypothetical protein
3062 c1 cds 2990379 2991077 + BALIOE_15285 hypothetical protein
3063 c1 cds 2991148 2992398 - BALIOE_15290 hypothetical protein
3064 c1 cds 2992492 2993430 - BALIOE_15295 hypothetical protein
3065 c1 cds 2993418 2994359 - BALIOE_15300 hypothetical protein
3066 c1 cds 2994783 2996474 - BALIOE_15305 hypothetical protein
3067 c1 cds 2996491 2997429 - BALIOE_15310 hypothetical protein
3068 c1 cds 2997429 2998559 - BALIOE_15315 hypothetical protein
3069 c1 cds 2998927 3000108 + BALIOE_15320 hypothetical protein
3070 c1 cds 3000105 3000359 - BALIOE_15325 hypothetical protein
3071 c1 cds 3000514 3001086 + BALIOE_15330 hypothetical protein
3072 c1 cds 3001300 3002775 + BALIOE_15335 hypothetical protein
3073 c1 cds 3002893 3003879 + BALIOE_15340 hypothetical protein
3074 c1 cds 3003918 3004631 + BALIOE_15345 hypothetical protein
3075 c1 cds 3005044 3005610 + BALIOE_15350 hypothetical protein
3076 c1 cds 3005791 3007347 + BALIOE_15355 hypothetical protein
3077 c1 cds 3007429 3009243 + BALIOE_15360 hypothetical protein
3078 c1 cds 3009244 3010338 + BALIOE_15365 hypothetical protein
3079 c1 cds 3010338 3011363 + BALIOE_15370 hypothetical protein
3080 c1 cds 3011365 3012954 + BALIOE_15375 hypothetical protein
3081 c1 cds 3012958 3013302 - BALIOE_15380 hypothetical protein
3082 c1 cds 3013635 3014825 - BALIOE_15385 hypothetical protein
3083 c1 cds 3014853 3015548 - BALIOE_15390 hypothetical protein
3084 c1 cds 3015697 3017457 + BALIOE_15395 hypothetical protein
3085 c1 cds 3017582 3017866 + BALIOE_15400 hypothetical protein
3086 c1 cds 3018005 3019012 - BALIOE_15405 hypothetical protein
3087 c1 cds 3019194 3019421 + BALIOE_15410 hypothetical protein
3088 c1 cds 3019441 3021201 + BALIOE_15415 hypothetical protein
3089 c1 tRNA 3021276 3021352 + BALIOE_15420 Pro_trna tRNA-Pro SO:0000268
3090 c1 cds 3021453 3024044 - BALIOE_15425 hypothetical protein
3091 c1 cds 3024364 3025011 + BALIOE_15430 hypothetical protein
3092 c1 cds 3025046 3026098 - BALIOE_15435 hypothetical protein
3093 c1 cds 3026095 3026652 - BALIOE_15440 hypothetical protein
3094 c1 cds 3026649 3028592 - BALIOE_15445 hypothetical protein
3095 c1 cds 3028589 3029068 - BALIOE_15450 hypothetical protein
3096 c1 cds 3029065 3029274 - BALIOE_15455 hypothetical protein
3097 c1 cds 3029271 3030008 - BALIOE_15460 hypothetical protein
3098 c1 cds 3030050 3030712 - BALIOE_15465 hypothetical protein
3099 c1 cds 3030709 3031326 - BALIOE_15470 hypothetical protein
3100 c1 cds 3031345 3031947 - BALIOE_15475 hypothetical protein
3101 c1 cds 3031957 3032406 - BALIOE_15480 hypothetical protein
3102 c1 cds 3032403 3033266 - BALIOE_15485 hypothetical protein
3103 c1 cds 3033253 3033948 - BALIOE_15490 hypothetical protein
3104 c1 cds 3033955 3036441 - BALIOE_15495 hypothetical protein
3105 c1 cds 3036438 3036701 - BALIOE_15500 hypothetical protein
3106 c1 cds 3036691 3037185 - BALIOE_15505 hypothetical protein
3107 c1 cds 3037294 3037458 + BALIOE_15510 hypothetical protein
3108 c1 cds 3037592 3038080 + BALIOE_15515 hypothetical protein
3109 c1 cds 3038230 3039876 - BALIOE_15520 hypothetical protein
3110 c1 cds 3040094 3041737 - BALIOE_15525 hypothetical protein
3111 c1 cds 3041813 3042463 - BALIOE_15530 hypothetical protein
3112 c1 cds 3042463 3043527 - BALIOE_15535 hypothetical protein
3113 c1 cds 3043601 3044656 - BALIOE_15540 hypothetical protein
3114 c1 cds 3044768 3045871 - BALIOE_15545 hypothetical protein
3115 c1 cds 3046610 3049282 + BALIOE_15550 hypothetical protein
3116 c1 cds 3049299 3049949 + BALIOE_15555 hypothetical protein
3117 c1 ncRNA 3049959 3050035 - BALIOE_15560 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3118 c1 ncRNA 3050073 3050149 - BALIOE_15565 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3119 c1 cds 3050149 3052998 - BALIOE_15570 hypothetical protein
3120 c1 cds 3053273 3054049 - BALIOE_15575 hypothetical protein
3121 c1 cds 3054054 3054836 - BALIOE_15580 hypothetical protein
3122 c1 cds 3054909 3055703 - BALIOE_15585 hypothetical protein
3123 c1 cds 3055704 3060098 - BALIOE_15590 hypothetical protein
3124 c1 cds 3060242 3060865 - BALIOE_15595 hypothetical protein
3125 c1 cds 3060862 3062415 - BALIOE_15600 hypothetical protein
3126 c1 cds 3062698 3065325 - BALIOE_15605 hypothetical protein
3127 c1 cds 3065472 3066194 + BALIOE_15610 hypothetical protein
3128 c1 cds 3066335 3070087 - BALIOE_15615 hypothetical protein
3129 c1 cds 3070783 3073068 + BALIOE_15620 hypothetical protein
3130 c1 ncRNA 3073125 3073188 - BALIOE_15625 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3131 c1 cds 3073295 3074425 + BALIOE_15630 hypothetical protein
3132 c1 cds 3074425 3074679 + BALIOE_15635 hypothetical protein
3133 c1 cds 3074733 3075383 - BALIOE_15640 hypothetical protein
3134 c1 cds 3075464 3076654 - BALIOE_15645 hypothetical protein
3135 c1 cds 3076806 3077684 + BALIOE_15650 hypothetical protein
3136 c1 cds 3077838 3077969 + BALIOE_15655 hypothetical protein
3137 c1 cds 3078148 3079218 + BALIOE_15660 hypothetical protein
3138 c1 cds 3079442 3080518 - BALIOE_15665 hypothetical protein
3139 c1 cds 3080523 3081881 - BALIOE_15670 hypothetical protein
3140 c1 cds 3082154 3083782 + BALIOE_15675 hypothetical protein
3141 c1 cds 3083772 3085031 + BALIOE_15680 hypothetical protein
3142 c1 cds 3085028 3086218 + BALIOE_15685 hypothetical protein
3143 c1 cds 3086411 3087337 + BALIOE_15690 hypothetical protein
3144 c1 cds 3087378 3088130 - BALIOE_15695 hypothetical protein
3145 c1 cds 3088198 3088950 - BALIOE_15700 hypothetical protein
3146 c1 cds 3089027 3089353 + BALIOE_15705 hypothetical protein
3147 c1 cds 3089353 3090240 + BALIOE_15710 hypothetical protein
3148 c1 cds 3090243 3090800 - BALIOE_15715 hypothetical protein
3149 c1 cds 3090857 3092062 - BALIOE_15720 hypothetical protein
3150 c1 cds 3092077 3092859 - BALIOE_15725 hypothetical protein
3151 c1 cds 3093079 3094281 - BALIOE_15730 hypothetical protein
3152 c1 cds 3094381 3094923 - BALIOE_15735 hypothetical protein
3153 c1 cds 3095202 3095627 + BALIOE_15740 hypothetical protein
3154 c1 cds 3095666 3096268 - BALIOE_15745 hypothetical protein
3155 c1 cds 3096558 3097715 + BALIOE_15750 hypothetical protein
3156 c1 cds 3097719 3098687 + BALIOE_15755 hypothetical protein
3157 c1 cds 3098687 3100669 + BALIOE_15760 hypothetical protein
3158 c1 cds 3100666 3101556 + BALIOE_15765 hypothetical protein
3159 c1 cds 3101556 3103208 + BALIOE_15770 hypothetical protein
3160 c1 cds 3103205 3103540 + BALIOE_15775 hypothetical protein
3161 c1 cds 3103540 3103926 + BALIOE_15780 hypothetical protein
3162 c1 cds 3103920 3104186 - BALIOE_15785 hypothetical protein
3163 c1 cds 3104296 3105651 - BALIOE_15790 hypothetical protein
3164 c1 cds 3105648 3106610 - BALIOE_15795 hypothetical protein
3165 c1 cds 3106610 3107467 - BALIOE_15800 hypothetical protein
3166 c1 cds 3107482 3108240 - BALIOE_15805 hypothetical protein
3167 c1 cds 3108237 3109907 - BALIOE_15810 hypothetical protein
3168 c1 cds 3109996 3111291 - BALIOE_15815 hypothetical protein
3169 c1 cds 3111370 3111675 - BALIOE_15820 hypothetical protein
3170 c1 cds 3111730 3112191 - BALIOE_15825 hypothetical protein
3171 c1 cds 3112256 3113173 + BALIOE_15830 hypothetical protein
3172 c1 cds 3113364 3114584 + BALIOE_15835 hypothetical protein
3173 c1 cds 3115716 3116219 + BALIOE_15840 hypothetical protein
3174 c1 cds 3116286 3117743 - BALIOE_15845 hypothetical protein
3175 c1 cds 3117750 3119279 - BALIOE_15850 hypothetical protein
3176 c1 cds 3119510 3121351 - BALIOE_15855 hypothetical protein
3177 c1 cds 3121348 3121650 - BALIOE_15860 hypothetical protein
3178 c1 cds 3121647 3122201 - BALIOE_15865 hypothetical protein
3179 c1 cds 3122213 3122755 - BALIOE_15870 hypothetical protein
3180 c1 cds 3122770 3123747 - BALIOE_15875 hypothetical protein
3181 c1 cds 3123744 3126470 - BALIOE_15880 hypothetical protein
3182 c1 cds 3126523 3127860 - BALIOE_15885 hypothetical protein
3183 c1 cds 3127857 3128357 - BALIOE_15890 hypothetical protein
3184 c1 cds 3128360 3130162 - BALIOE_15895 hypothetical protein
3185 c1 cds 3130256 3130918 - BALIOE_15900 hypothetical protein
3186 c1 cds 3130934 3131377 - BALIOE_15905 hypothetical protein
3187 c1 cds 3131640 3131804 + BALIOE_15910 hypothetical protein
3188 c1 cds 3132008 3132946 - BALIOE_15915 hypothetical protein
3189 c1 cds 3133866 3135083 + BALIOE_15920 hypothetical protein
3190 c1 cds 3135167 3135766 + BALIOE_15925 hypothetical protein
3191 c1 cds 3135825 3137657 - BALIOE_15930 hypothetical protein
3192 c1 cds 3137744 3138394 - BALIOE_15935 hypothetical protein
3193 c1 cds 3138405 3138899 - BALIOE_15940 hypothetical protein
3194 c1 cds 3138982 3139437 - BALIOE_15945 hypothetical protein
3195 c1 cds 3139775 3140977 + BALIOE_15950 hypothetical protein
3196 c1 cds 3141052 3143196 + BALIOE_15955 hypothetical protein
3197 c1 cds 3143428 3144906 + BALIOE_15960 hypothetical protein
3198 c1 cds 3144939 3145481 - BALIOE_15965 hypothetical protein
3199 c1 cds 3145539 3146090 - BALIOE_15970 hypothetical protein
3200 c1 cds 3146146 3146790 - BALIOE_15975 hypothetical protein
3201 c1 cds 3146926 3147573 + BALIOE_15980 hypothetical protein
3202 c1 cds 3147630 3147992 + BALIOE_15985 hypothetical protein
3203 c1 cds 3148013 3148906 + BALIOE_15990 hypothetical protein
3204 c1 cds 3148954 3149844 - BALIOE_15995 hypothetical protein
3205 c1 cds 3150041 3150814 - BALIOE_16000 hypothetical protein
3206 c1 cds 3150822 3151538 - BALIOE_16005 hypothetical protein
3207 c1 cds 3151535 3152221 - BALIOE_16010 hypothetical protein
3208 c1 cds 3152311 3153093 - BALIOE_16015 hypothetical protein
3209 c1 cds 3153314 3154096 - BALIOE_16020 hypothetical protein
3210 c1 cds 3154362 3154931 - BALIOE_16025 hypothetical protein
3211 c1 cds 3155026 3156543 - BALIOE_16030 hypothetical protein
3212 c1 cds 3156580 3157068 - BALIOE_16035 hypothetical protein
3213 c1 ncRNA 3157285 3157355 - BALIOE_16040 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3214 c1 ncRNA 3157376 3157446 - BALIOE_16045 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3215 c1 cds 3157509 3158171 - BALIOE_16050 hypothetical protein
3216 c1 cds 3158161 3159429 - BALIOE_16055 hypothetical protein
3217 c1 cds 3159499 3160413 - BALIOE_16060 hypothetical protein
3218 c1 cds 3160569 3161228 - BALIOE_16065 hypothetical protein
3219 c1 cds 3161311 3162123 - BALIOE_16070 hypothetical protein
3220 c1 cds 3162123 3163136 - BALIOE_16075 hypothetical protein
3221 c1 cds 3163202 3164338 - BALIOE_16080 hypothetical protein
3222 c1 cds 3164437 3165432 + BALIOE_16085 hypothetical protein
3223 c1 cds 3165429 3166607 - BALIOE_16090 hypothetical protein
3224 c1 cds 3166882 3168102 - BALIOE_16095 hypothetical protein
3225 c1 cds 3168261 3170267 + BALIOE_16100 hypothetical protein
3226 c1 cds 3170388 3170666 - BALIOE_16105 hypothetical protein
3227 c1 cds 3170700 3171248 - BALIOE_16110 hypothetical protein
3228 c1 cds 3171248 3172057 - BALIOE_16115 hypothetical protein
3229 c1 cds 3172057 3172881 - BALIOE_16120 hypothetical protein
3230 c1 cds 3172885 3173970 - BALIOE_16125 hypothetical protein
3231 c1 cds 3174005 3174937 - BALIOE_16130 hypothetical protein
3232 c1 cds 3175103 3175654 + BALIOE_16135 hypothetical protein
3233 c1 cds 3175825 3176667 - BALIOE_16140 hypothetical protein
3234 c1 cds 3176669 3177190 - BALIOE_16145 hypothetical protein
3235 c1 cds 3177187 3177615 - BALIOE_16150 hypothetical protein
3236 c1 cds 3177654 3178154 - BALIOE_16155 hypothetical protein
3237 c1 cds 3178165 3178923 - BALIOE_16160 hypothetical protein
3238 c1 cds 3178946 3181585 - BALIOE_16165 hypothetical protein
3239 c1 cds 3181667 3182230 - BALIOE_16170 hypothetical protein
3240 c1 cds 3182876 3183361 - BALIOE_16175 hypothetical protein
3241 c1 cds 3183564 3185708 - BALIOE_16180 hypothetical protein
3242 c1 cds 3185708 3187018 - BALIOE_16185 hypothetical protein
3243 c1 cds 3187198 3187482 - BALIOE_16190 hypothetical protein
3244 c1 cds 3187854 3189194 + BALIOE_16195 hypothetical protein
3245 c1 cds 3189559 3190590 + BALIOE_16200 hypothetical protein
3246 c1 cds 3190985 3191740 - BALIOE_16205 hypothetical protein
3247 c1 cds 3192034 3192966 + BALIOE_16210 hypothetical protein
3248 c1 tRNA 3193042 3193116 + BALIOE_16215 Arg_trna tRNA-Arg SO:0001036
3249 c1 cds 3193278 3194435 + BALIOE_16220 hypothetical protein
3250 c1 cds 3194610 3195746 - BALIOE_16225 hypothetical protein
3251 c1 cds 3195756 3196436 - BALIOE_16230 hypothetical protein
3252 c1 cds 3196423 3196890 - BALIOE_16235 hypothetical protein
3253 c1 cds 3196890 3197459 - BALIOE_16240 hypothetical protein
3254 c1 cds 3197490 3198137 + BALIOE_16245 hypothetical protein
3255 c1 cds 3198807 3200219 - BALIOE_16250 hypothetical protein
3256 c1 cds 3200406 3200582 - BALIOE_16255 hypothetical protein
3257 c1 cds 3200885 3201511 + BALIOE_16260 hypothetical protein
3258 c1 cds 3202109 3203356 - BALIOE_16265 hypothetical protein
3259 c1 cds 3203428 3204342 - BALIOE_16270 hypothetical protein
3260 c1 cds 3204558 3205991 + BALIOE_16275 hypothetical protein
3261 c1 cds 3205999 3206952 - BALIOE_16280 hypothetical protein
3262 c1 cds 3207237 3207455 + BALIOE_16285 hypothetical protein
3263 c1 cds 3207473 3208801 + BALIOE_16290 hypothetical protein
3264 c1 cds 3208909 3210447 - BALIOE_16295 hypothetical protein
3265 c1 cds 3210447 3211610 - BALIOE_16300 hypothetical protein
3266 c1 cds 3212026 3212640 + BALIOE_16305 hypothetical protein
3267 c1 cds 3212645 3216238 + BALIOE_16310 hypothetical protein
3268 c1 cds 3216294 3217172 - BALIOE_16315 hypothetical protein
3269 c1 cds 3217205 3217435 - BALIOE_16320 hypothetical protein
3270 c1 cds 3217509 3218453 - BALIOE_16325 hypothetical protein
3271 c1 cds 3218523 3220217 - BALIOE_16330 hypothetical protein
3272 c1 cds 3220271 3221521 - BALIOE_16335 hypothetical protein
3273 c1 cds 3222034 3222669 - BALIOE_16340 hypothetical protein
3274 c1 cds 3222965 3223240 + BALIOE_16345 hypothetical protein
3275 c1 cds 3223317 3223559 - BALIOE_16350 hypothetical protein
3276 c1 cds 3223912 3224832 + BALIOE_16355 hypothetical protein
3277 c1 cds 3225324 3226562 - BALIOE_16360 hypothetical protein
3278 c1 cds 3226939 3228636 + BALIOE_16365 hypothetical protein
3279 c1 cds 3228651 3229385 + BALIOE_16370 hypothetical protein
3280 c1 cds 3229398 3230255 + BALIOE_16375 hypothetical protein
3281 c1 cds 3230258 3232753 - BALIOE_16380 hypothetical protein
3282 c1 cds 3232778 3233815 - BALIOE_16385 hypothetical protein
3283 c1 cds 3233815 3234900 - BALIOE_16390 hypothetical protein
3284 c1 cds 3234915 3236162 - BALIOE_16395 hypothetical protein
3285 c1 cds 3236184 3236510 - BALIOE_16400 hypothetical protein
3286 c1 cds 3236729 3237694 - BALIOE_16405 hypothetical protein
3287 c1 cds 3237898 3239154 + BALIOE_16410 hypothetical protein
3288 c1 cds 3239269 3239595 + BALIOE_16415 hypothetical protein
3289 c1 cds 3239735 3240973 - BALIOE_16420 hypothetical protein
3290 c1 cds 3241309 3242511 + BALIOE_16425 hypothetical protein
3291 c1 cds 3242561 3244750 - BALIOE_16430 hypothetical protein
3292 c1 tRNA 3244958 3245033 - BALIOE_16435 Ala_trna tRNA-Ala SO:0000254
3293 c1 tRNA 3245073 3245148 - BALIOE_16440 Ala_trna tRNA-Ala SO:0000254
3294 c1 cds 3245369 3245728 + BALIOE_16445 hypothetical protein
3295 c1 cds 3245751 3246122 + BALIOE_16450 hypothetical protein
3296 c1 cds 3246162 3247310 - BALIOE_16455 hypothetical protein
3297 c1 cds 3247378 3247920 + BALIOE_16460 hypothetical protein
3298 c1 cds 3247921 3249336 - BALIOE_16465 hypothetical protein
3299 c1 tRNA 3249595 3249670 + BALIOE_16470 Val_trna tRNA-Val SO:0000273
3300 c1 tRNA 3249715 3249790 + BALIOE_16475 Val_trna tRNA-Val SO:0000273
3301 c1 tRNA 3249837 3249912 + BALIOE_16480 Val_trna tRNA-Val SO:0000273
3302 c1 tRNA 3249917 3249992 + BALIOE_16485 Lys_trna tRNA-Lys SO:0000265
3303 c1 cds 3250112 3250453 + BALIOE_16490 hypothetical protein
3304 c1 cds 3250444 3250791 - BALIOE_16495 hypothetical protein
3305 c1 cds 3250816 3251370 - BALIOE_16500 hypothetical protein
3306 c1 cds 3251460 3252458 + BALIOE_16505 hypothetical protein
3307 c1 cds 3252455 3252673 - BALIOE_16510 hypothetical protein
3308 c1 cds 3252675 3254690 - BALIOE_16515 hypothetical protein
3309 c1 cds 3254761 3255759 - BALIOE_16520 hypothetical protein
3310 c1 cds 3255989 3256750 + BALIOE_16525 hypothetical protein
3311 c1 cds 3256935 3257906 + BALIOE_16530 hypothetical protein
3312 c1 cds 3258290 3258547 + BALIOE_16535 hypothetical protein
3313 c1 cds 3258592 3260319 + BALIOE_16540 hypothetical protein
3314 c1 cds 3260360 3260869 + BALIOE_16545 hypothetical protein
3315 c1 cds 3260912 3261763 - BALIOE_16550 hypothetical protein
3316 c1 cds 3261868 3262200 + BALIOE_16555 hypothetical protein
3317 c1 cds 3262238 3263149 - BALIOE_16560 hypothetical protein
3318 c1 cds 3263283 3264380 - BALIOE_16565 hypothetical protein
3319 c1 cds 3264370 3265245 - BALIOE_16570 hypothetical protein
3320 c1 cds 3265245 3266078 - BALIOE_16575 hypothetical protein
3321 c1 cds 3266078 3267094 - BALIOE_16580 hypothetical protein
3322 c1 cds 3267252 3268043 - BALIOE_16585 hypothetical protein
3323 c1 cds 3268172 3269029 - BALIOE_16590 hypothetical protein
3324 c1 cds 3269193 3270089 + BALIOE_16595 hypothetical protein
3325 c1 cds 3270093 3271517 + BALIOE_16600 hypothetical protein
3326 c1 cds 3271522 3272826 + BALIOE_16605 hypothetical protein
3327 c1 cds 3272884 3273783 - BALIOE_16610 hypothetical protein
3328 c1 cds 3273879 3274454 - BALIOE_16615 hypothetical protein
3329 c1 cds 3274515 3274964 - BALIOE_16620 hypothetical protein
3330 c1 cds 3274951 3275376 - BALIOE_16625 hypothetical protein
3331 c1 cds 3275590 3276459 + BALIOE_16630 hypothetical protein
3332 c1 cds 3276463 3277362 + BALIOE_16635 hypothetical protein
3333 c1 cds 3277368 3278420 - BALIOE_16640 hypothetical protein
3334 c1 cds 3278466 3278966 - BALIOE_16645 hypothetical protein
3335 c1 cds 3278979 3279638 - BALIOE_16650 hypothetical protein
3336 c1 cds 3279648 3280535 - BALIOE_16655 hypothetical protein
3337 c1 cds 3280556 3281917 - BALIOE_16660 hypothetical protein
3338 c1 cds 3281929 3283332 - BALIOE_16665 hypothetical protein
3339 c1 cds 3283329 3284555 - BALIOE_16670 hypothetical protein
3340 c1 cds 3284655 3285842 - BALIOE_16675 hypothetical protein
3341 c1 cds 3285832 3286668 - BALIOE_16680 hypothetical protein
3342 c1 cds 3286679 3288082 - BALIOE_16685 hypothetical protein
3343 c1 cds 3288094 3288381 - BALIOE_16690 hypothetical protein
3344 c1 cds 3288488 3288823 - BALIOE_16695 hypothetical protein
3345 c1 cds 3288820 3289836 - BALIOE_16700 hypothetical protein
3346 c1 cds 3289833 3290564 - BALIOE_16705 hypothetical protein
3347 c1 cds 3290561 3291262 - BALIOE_16710 hypothetical protein
3348 c1 cds 3291237 3291716 - BALIOE_16715 hypothetical protein
3349 c1 cds 3291729 3292064 - BALIOE_16720 hypothetical protein
3350 c1 cds 3292357 3294636 - BALIOE_16725 hypothetical protein
3351 c1 cds 3294925 3295875 + BALIOE_16730 hypothetical protein
3352 c1 cds 3295895 3297898 + BALIOE_16735 hypothetical protein
3353 c1 cds 3297993 3299036 - BALIOE_16740 hypothetical protein
3354 c1 cds 3299162 3299737 - BALIOE_16745 hypothetical protein
3355 c1 cds 3299805 3301784 - BALIOE_16750 hypothetical protein
3356 c1 cds 3301990 3303690 + BALIOE_16755 hypothetical protein
3357 c1 cds 3303854 3306967 + BALIOE_16760 hypothetical protein
3358 c1 cds 3307506 3307862 + BALIOE_16765 hypothetical protein
3359 c1 cds 3307866 3308993 + BALIOE_16770 hypothetical protein
3360 c1 cds 3309021 3309221 + BALIOE_16775 hypothetical protein
3361 c1 cds 3309302 3310000 - BALIOE_16780 hypothetical protein
3362 c1 cds 3310074 3312089 - BALIOE_16785 hypothetical protein
3363 c1 cds 3312104 3312967 - BALIOE_16790 hypothetical protein
3364 c1 cds 3313135 3313848 - BALIOE_16795 hypothetical protein
3365 c1 cds 3313920 3314150 + BALIOE_16800 hypothetical protein
3366 c1 cds 3314061 3315095 - BALIOE_16805 hypothetical protein
3367 c1 cds 3315112 3315990 - BALIOE_16810 hypothetical protein
3368 c1 cds 3316136 3316708 + BALIOE_16815 hypothetical protein
3369 c1 cds 3316708 3317178 + BALIOE_16820 hypothetical protein
3370 c1 cds 3317431 3318048 + BALIOE_16825 hypothetical protein
3371 c1 cds 3318048 3320066 + BALIOE_16830 hypothetical protein
3372 c1 cds 3320077 3321024 + BALIOE_16835 hypothetical protein
3373 c1 cds 3321041 3322480 + BALIOE_16840 hypothetical protein
3374 c1 cds 3322492 3323142 + BALIOE_16845 hypothetical protein
3375 c1 cds 3323162 3324727 + BALIOE_16850 hypothetical protein
3376 c1 cds 3324717 3326432 + BALIOE_16855 hypothetical protein
3377 c1 cds 3326442 3326987 + BALIOE_16860 hypothetical protein
3378 c1 cds 3326984 3327742 + BALIOE_16865 hypothetical protein
3379 c1 cds 3327735 3328148 + BALIOE_16870 hypothetical protein
3380 c1 cds 3328178 3330190 + BALIOE_16875 hypothetical protein
3381 c1 cds 3330212 3331060 + BALIOE_16880 hypothetical protein
3382 c1 cds 3331098 3332159 - BALIOE_16885 hypothetical protein
3383 c1 cds 3332372 3333835 + BALIOE_16890 hypothetical protein
3384 c1 cds 3333856 3334215 + BALIOE_16895 hypothetical protein
3385 c1 cds 3334353 3335099 - BALIOE_16900 hypothetical protein
3386 c1 cds 3335149 3336438 - BALIOE_16905 hypothetical protein
3387 c1 cds 3336524 3337150 - BALIOE_16910 hypothetical protein
3388 c1 cds 3337475 3338512 + BALIOE_16915 hypothetical protein
3389 c1 cds 3338512 3339150 + BALIOE_16920 hypothetical protein
3390 c1 cds 3339321 3341387 + BALIOE_16925 hypothetical protein
3391 c1 cds 3341392 3342933 + BALIOE_16930 hypothetical protein
3392 c1 cds 3342972 3345215 - BALIOE_16935 hypothetical protein
3393 c1 cds 3345397 3345549 - BALIOE_16940 hypothetical protein
3394 c1 cds 3345585 3345758 + BALIOE_16945 hypothetical protein
3395 c1 cds 3346072 3346587 + BALIOE_16950 hypothetical protein
3396 c1 cds 3346603 3347142 + BALIOE_16955 hypothetical protein
3397 c1 cds 3347235 3348812 - BALIOE_16960 hypothetical protein
3398 c1 cds 3348881 3350347 - BALIOE_16965 hypothetical protein
3399 c1 cds 3350509 3351879 + BALIOE_16970 hypothetical protein
3400 c1 cds 3351876 3352091 - BALIOE_16975 hypothetical protein
3401 c1 cds 3352160 3353632 - BALIOE_16980 hypothetical protein
3402 c1 cds 3353750 3354928 - BALIOE_16985 hypothetical protein
3403 c1 cds 3354939 3355559 - BALIOE_16990 hypothetical protein
3404 c1 cds 3355577 3356851 - BALIOE_16995 hypothetical protein
3405 c1 cds 3356962 3358080 - BALIOE_17000 hypothetical protein
3406 c1 cds 3358107 3359120 - BALIOE_17005 hypothetical protein
3407 c1 cds 3359405 3360559 - BALIOE_17010 hypothetical protein
3408 c1 cds 3360709 3361140 - BALIOE_17015 hypothetical protein
3409 c1 cds 3361281 3362135 - BALIOE_17020 hypothetical protein
3410 c1 cds 3362135 3362956 - BALIOE_17025 hypothetical protein
3411 c1 cds 3362949 3363578 - BALIOE_17030 hypothetical protein
3412 c1 cds 3363575 3365956 - BALIOE_17035 hypothetical protein
3413 c1 cds 3366120 3368432 - BALIOE_17040 hypothetical protein
3414 c1 cds 3368433 3373394 - BALIOE_17045 hypothetical protein
3415 c1 cds 3373601 3374446 + BALIOE_17050 hypothetical protein
3416 c1 cds 3374946 3375722 - BALIOE_17055 hypothetical protein
3417 c1 cds 3375865 3377148 - BALIOE_17060 hypothetical protein
3418 c1 cds 3377326 3377526 - BALIOE_17065 hypothetical protein
3419 c1 cds 3377538 3377873 - BALIOE_17070 hypothetical protein
3420 c1 cds 3377875 3379725 - BALIOE_17075 hypothetical protein
3421 c1 cds 3379742 3380257 - BALIOE_17080 hypothetical protein
3422 c1 cds 3380353 3380676 - BALIOE_17085 hypothetical protein
3423 c1 cds 3380693 3381079 - BALIOE_17090 hypothetical protein
3424 c1 cds 3381107 3382321 - BALIOE_17095 hypothetical protein
3425 c1 cds 3382433 3382921 - BALIOE_17100 hypothetical protein
3426 c1 cds 3383222 3383959 - BALIOE_17105 hypothetical protein
3427 c1 cds 3384078 3384881 + BALIOE_17110 hypothetical protein
3428 c1 cds 3385026 3385880 + BALIOE_17115 hypothetical protein
3429 c1 cds 3386071 3387351 + BALIOE_17120 hypothetical protein
3430 c1 cds 3387343 3388482 - BALIOE_17125 hypothetical protein
3431 c1 cds 3388642 3389532 - BALIOE_17130 hypothetical protein
3432 c1 cds 3389668 3391029 + BALIOE_17135 hypothetical protein
3433 c1 cds 3391026 3391544 + BALIOE_17140 hypothetical protein
3434 c1 cds 3391544 3391864 + BALIOE_17145 hypothetical protein
3435 c1 cds 3391861 3392673 + BALIOE_17150 hypothetical protein
3436 c1 cds 3392683 3393885 + BALIOE_17155 hypothetical protein
3437 c1 cds 3393982 3394404 + BALIOE_17160 hypothetical protein
3438 c1 cds 3394452 3395324 - BALIOE_17165 hypothetical protein
3439 c1 cds 3395336 3396163 - BALIOE_17170 hypothetical protein
3440 c1 cds 3396206 3396397 - BALIOE_17175 hypothetical protein
3441 c1 cds 3396463 3397461 - BALIOE_17180 hypothetical protein
3442 c1 cds 3397486 3398997 - BALIOE_17185 hypothetical protein
3443 c1 cds 3399020 3400003 - BALIOE_17190 hypothetical protein
3444 c1 cds 3400100 3403381 - BALIOE_17195 hypothetical protein
3445 c1 cds 3403499 3404692 + BALIOE_17200 hypothetical protein
3446 c1 cds 3404755 3406008 - BALIOE_17205 hypothetical protein
3447 c1 cds 3406336 3407526 + BALIOE_17210 hypothetical protein
3448 c1 cds 3407571 3407909 - BALIOE_17215 hypothetical protein
3449 c1 cds 3407970 3409304 - BALIOE_17220 hypothetical protein
3450 c1 cds 3409294 3410007 - BALIOE_17225 hypothetical protein
3451 c1 cds 3410172 3411554 - BALIOE_17230 hypothetical protein
3452 c1 cds 3412175 3416062 - BALIOE_17235 hypothetical protein
3453 c1 cds 3416319 3417875 + BALIOE_17240 hypothetical protein
3454 c1 cds 3417872 3418375 - BALIOE_17245 hypothetical protein
3455 c1 cds 3418433 3419068 - BALIOE_17250 hypothetical protein
3456 c1 cds 3419277 3420125 + BALIOE_17255 hypothetical protein
3457 c1 cds 3420181 3420441 + BALIOE_17260 hypothetical protein
3458 c1 cds 3421137 3421517 - BALIOE_17265 hypothetical protein
3459 c1 cds 3421517 3422248 - BALIOE_17270 hypothetical protein
3460 c1 cds 3422260 3422988 - BALIOE_17275 hypothetical protein
3461 c1 cds 3423000 3423905 - BALIOE_17280 hypothetical protein
3462 c1 cds 3423902 3424582 - BALIOE_17285 hypothetical protein
3463 c1 cds 3424855 3425829 - BALIOE_17290 hypothetical protein
3464 c1 cds 3425845 3427644 - BALIOE_17295 hypothetical protein
3465 c1 cds 3427842 3428321 - BALIOE_17300 hypothetical protein
3466 c1 cds 3428318 3429274 - BALIOE_17305 hypothetical protein
3467 c1 cds 3429274 3429912 - BALIOE_17310 hypothetical protein
3468 c1 cds 3429945 3430520 - BALIOE_17315 hypothetical protein
3469 c1 cds 3430928 3432550 + BALIOE_17320 hypothetical protein
3470 c1 cds 3432535 3433272 - BALIOE_17325 hypothetical protein
3471 c1 cds 3433404 3434738 + BALIOE_17330 hypothetical protein
3472 c1 cds 3434771 3435652 - BALIOE_17335 hypothetical protein
3473 c1 cds 3435755 3436342 + BALIOE_17340 hypothetical protein
3474 c1 cds 3436398 3436781 - BALIOE_17345 hypothetical protein
3475 c1 cds 3437086 3437775 + BALIOE_17350 hypothetical protein
3476 c1 cds 3437823 3438860 - BALIOE_17355 hypothetical protein
3477 c1 cds 3439067 3439486 + BALIOE_17360 hypothetical protein
3478 c1 cds 3439555 3440253 + BALIOE_17365 hypothetical protein
3479 c1 cds 3440285 3442945 + BALIOE_17370 hypothetical protein
3480 c1 cds 3443059 3444414 + BALIOE_17375 hypothetical protein
3481 c1 cds 3444511 3444783 + BALIOE_17380 hypothetical protein
3482 c1 cds 3444780 3446078 - BALIOE_17385 hypothetical protein
3483 c1 tRNA 3449707 3449782 - BALIOE_17390 Glu_trna tRNA-Glu SO:0000259
3484 c1 rRNA 3449868 3451409 - BALIOE_17395 16S_rrna 16S ribosomal RNA GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
3485 c1 cds 3451852 3454425 - BALIOE_17400 hypothetical protein
3486 c1 cds 3454555 3455286 - BALIOE_17405 hypothetical protein
3487 c1 cds 3455283 3456263 - BALIOE_17410 hypothetical protein
3488 c1 cds 3456398 3457135 + BALIOE_17415 hypothetical protein
3489 c1 cds 3457406 3457747 + BALIOE_17420 hypothetical protein
3490 c1 cds 3457997 3459157 + BALIOE_17425 hypothetical protein
3491 c1 cds 3459200 3460321 - BALIOE_17430 hypothetical protein
3492 c1 cds 3460332 3461402 - BALIOE_17435 hypothetical protein
3493 c1 cds 3461615 3461977 + BALIOE_17440 hypothetical protein
3494 c1 cds 3462127 3462645 + BALIOE_17445 hypothetical protein
3495 c1 cds 3462635 3463861 + BALIOE_17450 hypothetical protein
3496 c1 cds 3463877 3464359 + BALIOE_17455 hypothetical protein
3497 c1 cds 3464436 3464783 - BALIOE_17460 hypothetical protein
3498 c1 cds 3464825 3465592 - BALIOE_17465 hypothetical protein
3499 c1 cds 3465623 3466171 - BALIOE_17470 hypothetical protein
3500 c1 cds 3466190 3466438 - BALIOE_17475 hypothetical protein
3501 c1 cds 3466575 3467936 - BALIOE_17480 hypothetical protein
3502 c1 cds 3468028 3468894 + BALIOE_17485 hypothetical protein
3503 c1 cds 3468961 3470202 + BALIOE_17490 hypothetical protein
3504 c1 cds 3470257 3470850 - BALIOE_17495 hypothetical protein
3505 c1 cds 3470973 3471851 + BALIOE_17500 hypothetical protein
3506 c1 cds 3471937 3473598 + BALIOE_17505 hypothetical protein
3507 c1 cds 3473747 3474088 + BALIOE_17510 hypothetical protein
3508 c1 cds 3474150 3474440 - BALIOE_17515 hypothetical protein
3509 c1 cds 3474430 3474879 - BALIOE_17520 hypothetical protein
3510 c1 cds 3475038 3475520 + BALIOE_17525 hypothetical protein
3511 c1 tmRNA 3475735 3476097 + BALIOE_17530 ssrA transfer-messenger RNA, SsrA SO:0000584
3512 c1 cds 3476366 3476614 + BALIOE_17535 hypothetical protein
3513 c1 cds 3477116 3477706 - BALIOE_17540 hypothetical protein
3514 c1 cds 3477889 3478539 + BALIOE_17545 hypothetical protein
3515 c1 cds 3478618 3479676 + BALIOE_17550 hypothetical protein
3516 c1 cds 3479806 3480213 - BALIOE_17555 hypothetical protein
3517 c1 cds 3480389 3480658 - BALIOE_17560 hypothetical protein
3518 c1 cds 3480876 3481202 + BALIOE_17565 hypothetical protein
3519 c1 cds 3481202 3482089 + BALIOE_17570 hypothetical protein
3520 c1 cds 3481896 3482540 - BALIOE_17575 hypothetical protein
3521 c1 cds 3482590 3482937 - BALIOE_17580 hypothetical protein
3522 c1 cds 3482934 3483314 - BALIOE_17585 hypothetical protein
3523 c1 cds 3483390 3483620 - BALIOE_17590 hypothetical protein
3524 c1 cds 3483671 3484015 - BALIOE_17595 hypothetical protein
3525 c1 cds 3484020 3484235 - BALIOE_17600 hypothetical protein
3526 c1 cds 3484385 3486238 - BALIOE_17605 hypothetical protein
3527 c1 cds 3486479 3486808 + BALIOE_17610 hypothetical protein
3528 c1 cds 3486899 3487642 - BALIOE_17615 hypothetical protein
3529 c1 cds 3487895 3488518 - BALIOE_17620 hypothetical protein
3530 c1 cds 3488515 3489180 - BALIOE_17625 hypothetical protein
3531 c1 cds 3489177 3489788 - BALIOE_17630 hypothetical protein
3532 c1 cds 3489763 3490329 - BALIOE_17635 hypothetical protein
3533 c1 cds 3490322 3490438 - BALIOE_17640 hypothetical protein
3534 c1 cds 3490659 3491414 + BALIOE_17645 hypothetical protein
3535 c1 cds 3491450 3491752 + BALIOE_17650 hypothetical protein
3536 c1 cds 3491828 3493090 - BALIOE_17655 hypothetical protein
3537 c1 cds 3493486 3493899 - BALIOE_17660 hypothetical protein
3538 c1 cds 3493997 3494395 - BALIOE_17665 hypothetical protein
3539 c1 cds 3494396 3496027 - BALIOE_17670 hypothetical protein
3540 c1 cds 3496024 3497337 - BALIOE_17675 hypothetical protein
3541 c1 cds 3497339 3498544 - BALIOE_17680 hypothetical protein
3542 c1 cds 3498867 3499073 - BALIOE_17685 hypothetical protein
3543 c1 cds 3499173 3500024 - BALIOE_17690 hypothetical protein
3544 c1 cds 3500451 3505037 - BALIOE_17695 hypothetical protein
3545 c1 cds 3505973 3507322 - BALIOE_17700 hypothetical protein
3546 c1 tRNA 3508074 3508149 - BALIOE_17705 Ile2_trna tRNA-Ile2 SO:0000263
3547 c1 cds 3508710 3509948 + BALIOE_17710 hypothetical protein
3548 c1 cds 3509955 3510962 + BALIOE_17715 hypothetical protein
3549 c1 cds 3511299 3512276 + BALIOE_17720 hypothetical protein
3550 c1 cds 3512296 3513564 + BALIOE_17725 hypothetical protein
3551 c1 cds 3513587 3515035 + BALIOE_17730 hypothetical protein
3552 c1 cds 3515049 3516329 + BALIOE_17735 hypothetical protein
3553 c1 cds 3516567 3517967 + BALIOE_17740 hypothetical protein
3554 c1 cds 3517988 3518650 + BALIOE_17745 hypothetical protein
3555 c1 cds 3518651 3519100 - BALIOE_17750 hypothetical protein
3556 c1 cds 3519184 3519342 - BALIOE_17755 hypothetical protein
3557 c1 cds 3519525 3519824 + BALIOE_17760 hypothetical protein
3558 c1 cds 3519834 3520352 + BALIOE_17765 hypothetical protein
3559 c1 cds 3520405 3520809 - BALIOE_17770 hypothetical protein
3560 c1 cds 3521477 3521926 + BALIOE_17775 hypothetical protein
3561 c1 cds 3521963 3522307 - BALIOE_17780 hypothetical protein
3562 c1 cds 3522459 3522788 + BALIOE_17785 hypothetical protein
3563 c1 cds 3522938 3524272 - BALIOE_17790 hypothetical protein
3564 c1 cds 3524360 3524791 + BALIOE_17795 hypothetical protein
3565 c1 cds 3525000 3525245 + BALIOE_17800 hypothetical protein
3566 c1 cds 3525242 3525652 + BALIOE_17805 hypothetical protein
3567 c1 cds 3525625 3527769 + BALIOE_17810 hypothetical protein
3568 c1 cds 3527779 3528738 + BALIOE_17815 hypothetical protein
3569 c1 cds 3529094 3530296 + BALIOE_17820 hypothetical protein
3570 c1 cds 3530289 3531353 + BALIOE_17825 hypothetical protein
3571 c1 cds 3531410 3532402 + BALIOE_17830 hypothetical protein
3572 c1 ncRNA 3532412 3532489 + BALIOE_17835 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3573 c1 cds 3532594 3533778 + BALIOE_17840 hypothetical protein
3574 c1 cds 3533902 3534639 + BALIOE_17845 hypothetical protein
3575 c1 cds 3534629 3534964 + BALIOE_17850 hypothetical protein
3576 c1 cds 3535055 3535585 + BALIOE_17855 hypothetical protein
3577 c1 cds 3535712 3536884 + BALIOE_17860 hypothetical protein
3578 c1 cds 3536901 3538439 + BALIOE_17865 hypothetical protein
3579 c1 cds 3538503 3539018 - BALIOE_17870 hypothetical protein
3580 c1 cds 3539168 3540724 - BALIOE_17875 hypothetical protein
3581 c1 cds 3540797 3541225 - BALIOE_17880 hypothetical protein
3582 c1 cds 3541222 3541788 - BALIOE_17885 hypothetical protein
3583 c1 tRNA 3542069 3542145 - BALIOE_17890 Arg_trna tRNA-Arg SO:0001036
3584 c1 tRNA 3542248 3542324 - BALIOE_17895 Arg_trna tRNA-Arg SO:0001036
3585 c1 tRNA 3542387 3542463 - BALIOE_17900 Arg_trna tRNA-Arg SO:0001036
3586 c1 tRNA 3542528 3542604 - BALIOE_17905 Arg_trna tRNA-Arg SO:0001036
3587 c1 tRNA 3542608 3542700 - BALIOE_17910 Ser_trna tRNA-Ser SO:0000269
3588 c1 cds 3543016 3543201 - BALIOE_17915 hypothetical protein
3589 c1 cds 3543436 3546066 - BALIOE_17920 hypothetical protein
3590 c1 cds 3546194 3546694 - BALIOE_17925 hypothetical protein
3591 c1 cds 3546762 3547823 - BALIOE_17930 hypothetical protein
3592 c1 cds 3547903 3548400 - BALIOE_17935 hypothetical protein
3593 c1 cds 3548545 3549735 - BALIOE_17940 hypothetical protein
3594 c1 cds 3549880 3550275 + BALIOE_17945 hypothetical protein
3595 c1 cds 3550439 3550645 + BALIOE_17950 hypothetical protein
3596 c1 cds 3550750 3551400 + BALIOE_17955 hypothetical protein
3597 c1 cds 3551411 3551782 + BALIOE_17960 hypothetical protein
3598 c1 cds 3551786 3552565 + BALIOE_17965 hypothetical protein
3599 c1 cds 3552671 3553030 + BALIOE_17970 hypothetical protein
3600 c1 cds 3553097 3553870 + BALIOE_17975 hypothetical protein
3601 c1 cds 3553863 3554828 + BALIOE_17980 hypothetical protein
3602 c1 cds 3554825 3556339 - BALIOE_17985 hypothetical protein
3603 c1 cds 3556526 3557761 + BALIOE_17990 hypothetical protein
3604 c1 cds 3557758 3558891 + BALIOE_17995 hypothetical protein
3605 c1 cds 3559019 3561271 - BALIOE_18000 hypothetical protein
3606 c1 cds 3561424 3561951 - BALIOE_18005 hypothetical protein
3607 c1 cds 3562100 3563113 - BALIOE_18010 hypothetical protein
3608 c1 cds 3563370 3564827 + BALIOE_18015 hypothetical protein
3609 c1 cds 3564836 3566260 + BALIOE_18020 hypothetical protein
3610 c1 cds 3566384 3566854 - BALIOE_18025 hypothetical protein
3611 c1 cds 3566847 3567257 - BALIOE_18030 hypothetical protein
3612 c1 cds 3567254 3568021 - BALIOE_18035 hypothetical protein
3613 c1 cds 3568021 3568563 - BALIOE_18040 hypothetical protein
3614 c1 cds 3568573 3570282 - BALIOE_18045 hypothetical protein
3615 c1 cds 3570300 3571223 - BALIOE_18050 hypothetical protein
3616 c1 cds 3571226 3573052 - BALIOE_18055 hypothetical protein
3617 c1 cds 3573049 3573660 - BALIOE_18060 hypothetical protein
3618 c1 cds 3573785 3574246 - BALIOE_18065 hypothetical protein
3619 c1 cds 3574458 3574808 + BALIOE_18070 hypothetical protein
3620 c1 cds 3574812 3575684 + BALIOE_18075 hypothetical protein
3621 c1 cds 3575675 3575947 + BALIOE_18080 hypothetical protein
3622 c1 cds 3575947 3577068 + BALIOE_18085 hypothetical protein
3623 c1 cds 3577065 3578075 + BALIOE_18090 hypothetical protein
3624 c1 cds 3578149 3580227 + BALIOE_18095 hypothetical protein
3625 c1 cds 3580264 3580617 - BALIOE_18100 hypothetical protein
3626 c1 cds 3580694 3580828 - BALIOE_18105 hypothetical protein
3627 c1 cds 3580904 3583465 + BALIOE_18110 hypothetical protein
3628 c1 cds 3583571 3584227 + BALIOE_18115 hypothetical protein
3629 c1 cds 3584268 3584504 - BALIOE_18120 hypothetical protein
3630 c1 cds 3584515 3585942 - BALIOE_18125 hypothetical protein
3631 c1 cds 3585942 3586535 - BALIOE_18130 hypothetical protein
3632 c1 cds 3586682 3587089 + BALIOE_18135 hypothetical protein
3633 c1 cds 3587209 3588201 - BALIOE_18140 hypothetical protein
3634 c1 cds 3588264 3589403 - BALIOE_18145 hypothetical protein
3635 c1 cds 3589543 3590169 - BALIOE_18150 hypothetical protein
3636 c1 cds 3590163 3590924 - BALIOE_18155 hypothetical protein
3637 c1 cds 3590905 3591954 - BALIOE_18160 hypothetical protein
3638 c1 cds 3591951 3592430 - BALIOE_18165 hypothetical protein
3639 c1 cds 3592430 3593140 - BALIOE_18170 hypothetical protein
3640 c1 cds 3593159 3593470 - BALIOE_18175 hypothetical protein
3641 c1 cds 3593664 3593987 - BALIOE_18180 hypothetical protein
3642 c1 cds 3594037 3594642 - BALIOE_18185 hypothetical protein
3643 c1 cds 3594642 3596069 - BALIOE_18190 hypothetical protein
3644 c1 cds 3596071 3596979 - BALIOE_18195 hypothetical protein
3645 c1 cds 3597231 3598268 + BALIOE_18200 hypothetical protein
3646 c1 crispr 3598411 3598562 ? CRISPR array with 3 repeats of length 30, consensus sequence CGGTTTATCCCCGCTGGCGCGGGGAACACA and spacer length 31 SO:0001459
3647 c1 cds 3598658 3598951 - BALIOE_18205 hypothetical protein
3648 c1 cds 3598948 3599871 - BALIOE_18210 hypothetical protein
3649 c1 cds 3599868 3600518 - BALIOE_18215 hypothetical protein
3650 c1 cds 3600500 3601246 - BALIOE_18220 hypothetical protein
3651 c1 cds 3601257 3602312 - BALIOE_18225 hypothetical protein
3652 c1 cds 3602324 3602860 - BALIOE_18230 hypothetical protein
3653 c1 cds 3602857 3604419 - BALIOE_18235 hypothetical protein
3654 c1 cds 3604517 3607216 - BALIOE_18240 hypothetical protein
3655 c1 cds 3607408 3607560 - BALIOE_18245 hypothetical protein
3656 c1 cds 3607824 3608558 - BALIOE_18250 hypothetical protein
3657 c1 cds 3608632 3610344 - BALIOE_18255 hypothetical protein
3658 c1 cds 3610344 3612143 - BALIOE_18260 hypothetical protein
3659 c1 cds 3612459 3612824 + BALIOE_18265 hypothetical protein
3660 c1 cds 3612902 3614173 + BALIOE_18270 hypothetical protein
3661 c1 cds 3614164 3614424 + BALIOE_18275 hypothetical protein
3662 c1 cds 3614441 3615016 + BALIOE_18280 hypothetical protein
3663 c1 cds 3615164 3615439 - BALIOE_18285 hypothetical protein
3664 c1 cds 3615455 3616024 - BALIOE_18290 hypothetical protein
3665 c1 cds 3616021 3616800 - BALIOE_18295 hypothetical protein
3666 c1 cds 3616778 3616984 - BALIOE_18300 hypothetical protein
3667 c1 cds 3616981 3618186 - BALIOE_18305 hypothetical protein
3668 c1 cds 3618208 3619662 - BALIOE_18310 hypothetical protein
3669 c1 cds 3619732 3620517 - BALIOE_18315 hypothetical protein
3670 c1 cds 3620836 3622113 + BALIOE_18320 hypothetical protein
3671 c1 cds 3622140 3623618 + BALIOE_18325 hypothetical protein
3672 c1 cds 3624682 3625353 - BALIOE_18330 hypothetical protein
3673 c1 cds 3625634 3626128 + BALIOE_18335 hypothetical protein
3674 c1 cds 3626142 3626816 + BALIOE_18340 hypothetical protein
3675 c1 cds 3627050 3628198 + BALIOE_18345 hypothetical protein
3676 c1 cds 3628195 3629109 + BALIOE_18350 hypothetical protein
3677 c1 cds 3629169 3630467 - BALIOE_18355 hypothetical protein
3678 c1 cds 3630555 3632192 - BALIOE_18360 hypothetical protein
3679 c1 cds 3632420 3633211 - BALIOE_18365 hypothetical protein
3680 c1 cds 3633282 3633617 - BALIOE_18370 hypothetical protein
3681 c1 cds 3633617 3633865 - BALIOE_18375 hypothetical protein
3682 c1 cds 3633943 3636177 - BALIOE_18380 hypothetical protein
3683 c1 cds 3636225 3637526 - BALIOE_18385 hypothetical protein
3684 c1 cds 3637583 3640339 + BALIOE_18390 hypothetical protein
3685 c1 cds 3640572 3641912 - BALIOE_18395 hypothetical protein
3686 c1 cds 3641933 3643030 - BALIOE_18400 hypothetical protein
3687 c1 cds 3643052 3643273 - BALIOE_18405 hypothetical protein
3688 c1 cds 3643275 3644627 - BALIOE_18410 hypothetical protein
3689 c1 cds 3645062 3645511 - BALIOE_18415 hypothetical protein
3690 c1 cds 3645529 3646311 - BALIOE_18420 hypothetical protein
3691 c1 cds 3646311 3646640 - BALIOE_18425 hypothetical protein
3692 c1 cds 3647262 3647807 - BALIOE_18430 hypothetical protein
3693 c1 cds 3647875 3648723 + BALIOE_18435 hypothetical protein
3694 c1 cds 3648835 3650199 + BALIOE_18440 hypothetical protein
3695 c1 cds 3650756 3652045 + BALIOE_18445 hypothetical protein
3696 c1 cds 3652103 3653470 + BALIOE_18450 hypothetical protein
3697 c1 cds 3653492 3654337 + BALIOE_18455 hypothetical protein
3698 c1 cds 3654392 3655540 - BALIOE_18460 hypothetical protein
3699 c1 cds 3655568 3656215 - BALIOE_18465 hypothetical protein
3700 c1 cds 3656762 3658078 + BALIOE_18470 hypothetical protein
3701 c1 cds 3658111 3659886 + BALIOE_18475 hypothetical protein
3702 c1 cds 3659995 3661413 + BALIOE_18480 hypothetical protein
3703 c1 cds 3661415 3661837 + BALIOE_18485 hypothetical protein
3704 c1 cds 3661895 3662626 + BALIOE_18490 hypothetical protein
3705 c1 cds 3662670 3663770 - BALIOE_18495 hypothetical protein
3706 c1 cds 3663763 3664158 - BALIOE_18500 hypothetical protein
3707 c1 cds 3664177 3665094 - BALIOE_18505 hypothetical protein
3708 c1 cds 3665445 3665672 - BALIOE_18510 hypothetical protein
3709 c1 cds 3665864 3667069 + BALIOE_18515 hypothetical protein
3710 c1 cds 3667069 3667512 + BALIOE_18520 hypothetical protein
3711 c1 cds 3667563 3668369 - BALIOE_18525 hypothetical protein
3712 c1 cds 3668608 3669705 - BALIOE_18530 hypothetical protein
3713 c1 tRNA 3669914 3669990 + BALIOE_18535 fMet_trna tRNA-fMet SO:0000266
3714 c1 tRNA 3670024 3670100 + BALIOE_18540 fMet_trna tRNA-fMet SO:0000266
3715 c1 tRNA 3670134 3670210 + BALIOE_18545 fMet_trna tRNA-fMet SO:0000266
3716 c1 cds 3670284 3671537 - BALIOE_18550 hypothetical protein
3717 c1 cds 3671769 3673100 + BALIOE_18555 hypothetical protein
3718 c1 cds 3673162 3674988 - BALIOE_18560 hypothetical protein
3719 c1 cds 3674988 3678530 - BALIOE_18565 hypothetical protein
3720 c1 cds 3678523 3681411 - BALIOE_18570 hypothetical protein
3721 c1 cds 3681587 3684955 - BALIOE_18575 hypothetical protein
3722 c1 cds 3684968 3685291 - BALIOE_18580 hypothetical protein
3723 c1 cds 3685276 3685683 - BALIOE_18585 hypothetical protein
3724 c1 cds 3685680 3686243 - BALIOE_18590 hypothetical protein
3725 c1 cds 3686234 3686704 - BALIOE_18595 hypothetical protein
3726 c1 cds 3686888 3687682 - BALIOE_18600 hypothetical protein
3727 c1 cds 3687689 3688564 - BALIOE_18605 hypothetical protein
3728 c1 cds 3688715 3690961 - BALIOE_18610 hypothetical protein
3729 c1 cds 3690974 3691504 - BALIOE_18615 hypothetical protein
3730 c1 cds 3691857 3692003 - BALIOE_18620 hypothetical protein
3731 c1 cds 3692189 3692878 + BALIOE_18625 hypothetical protein
3732 c1 cds 3692947 3693660 + BALIOE_18630 hypothetical protein
3733 c1 cds 3693798 3694016 + BALIOE_18635 hypothetical protein
3734 c1 cds 3694124 3695164 + BALIOE_18640 hypothetical protein
3735 c1 cds 3695196 3696389 - BALIOE_18645 hypothetical protein
3736 c1 cds 3696382 3698541 - BALIOE_18650 hypothetical protein
3737 c1 cds 3699127 3700158 + BALIOE_18655 hypothetical protein
3738 c1 cds 3700165 3701427 - BALIOE_18660 hypothetical protein
3739 c1 cds 3701549 3702484 + BALIOE_18665 hypothetical protein
3740 c1 cds 3702471 3703163 - BALIOE_18670 hypothetical protein
3741 c1 cds 3703292 3704710 - BALIOE_18675 hypothetical protein
3742 c1 cds 3705025 3705786 - BALIOE_18680 hypothetical protein
3743 c1 cds 3705816 3706652 - BALIOE_18685 hypothetical protein
3744 c1 cds 3706939 3708120 - BALIOE_18690 hypothetical protein
3745 c1 cds 3708375 3709604 + BALIOE_18695 hypothetical protein
3746 c1 cds 3710064 3710696 + BALIOE_18700 hypothetical protein
3747 c1 cds 3710778 3710909 - BALIOE_18705 hypothetical protein
3748 c1 cds 3711030 3711839 + BALIOE_18710 hypothetical protein
3749 c1 cds 3711836 3712315 + BALIOE_18715 hypothetical protein
3750 c1 cds 3712348 3712488 - BALIOE_18720 hypothetical protein
3751 c1 cds 3712464 3712889 - BALIOE_18725 hypothetical protein
3752 c1 cds 3713319 3713810 + BALIOE_18730 hypothetical protein
3753 c1 cds 3714036 3714527 + BALIOE_18735 hypothetical protein
3754 c1 cds 3714861 3716237 + BALIOE_18740 hypothetical protein
3755 c1 cds 3716404 3716622 + BALIOE_18745 hypothetical protein
3756 c1 cds 3716809 3717210 + BALIOE_18750 hypothetical protein
3757 c1 cds 3717229 3717861 - BALIOE_18755 hypothetical protein
3758 c1 cds 3718084 3718515 - BALIOE_18760 hypothetical protein
3759 c1 cds 3718532 3718792 - BALIOE_18765 hypothetical protein
3760 c1 cds 3718734 3719315 - BALIOE_18770 hypothetical protein
3761 c1 cds 3719331 3720065 - BALIOE_18775 hypothetical protein
3762 c1 cds 3720062 3720394 - BALIOE_18780 hypothetical protein
3763 c1 cds 3720414 3720653 - BALIOE_18785 hypothetical protein
3764 c1 cds 3720667 3721401 - BALIOE_18790 hypothetical protein
3765 c1 cds 3722105 3722605 + BALIOE_18795 hypothetical protein
3766 c1 cds 3722962 3724083 - BALIOE_18800 hypothetical protein
3767 c1 cds 3724092 3724328 - BALIOE_18805 hypothetical protein
3768 c1 cds 3724407 3724859 - BALIOE_18810 hypothetical protein
3769 c1 cds 3724861 3725121 - BALIOE_18815 hypothetical protein
3770 c1 cds 3725132 3725797 - BALIOE_18820 hypothetical protein
3771 c1 cds 3725787 3726773 - BALIOE_18825 hypothetical protein
3772 c1 cds 3726733 3727302 - BALIOE_18830 hypothetical protein
3773 c1 cds 3727375 3727608 - BALIOE_18835 hypothetical protein
3774 c1 cds 3727586 3728044 - BALIOE_18840 hypothetical protein
3775 c1 cds 3728034 3729326 - BALIOE_18845 hypothetical protein
3776 c1 cds 3729358 3731418 - BALIOE_18850 hypothetical protein
3777 c1 cds 3731411 3732556 - BALIOE_18855 hypothetical protein
3778 c1 cds 3732561 3734264 - BALIOE_18860 hypothetical protein
3779 c1 cds 3734261 3735010 - BALIOE_18865 hypothetical protein
3780 c1 cds 3735356 3735535 - BALIOE_18870 hypothetical protein
3781 c1 cds 3735602 3736660 - BALIOE_18875 hypothetical protein
3782 c1 cds 3736644 3737207 - BALIOE_18880 hypothetical protein
3783 c1 tRNA 3737441 3737514 - BALIOE_18885 Gly_trna tRNA-Gly SO:0000260
3784 c1 cds 3737593 3738348 - BALIOE_18890 hypothetical protein
3785 c1 cds 3738764 3741061 + BALIOE_18895 hypothetical protein
3786 c1 cds 3741072 3741950 + BALIOE_18900 hypothetical protein
3787 c1 cds 3741947 3742426 + BALIOE_18905 hypothetical protein
3788 c1 cds 3742466 3744244 - BALIOE_18910 hypothetical protein
3789 c1 cds 3744723 3745910 + BALIOE_18915 hypothetical protein
3790 c1 cds 3745968 3747164 + BALIOE_18920 hypothetical protein
3791 c1 cds 3747222 3748433 + BALIOE_18925 hypothetical protein
3792 c1 cds 3748486 3749871 + BALIOE_18930 hypothetical protein
3793 c1 cds 3749919 3750851 + BALIOE_18935 hypothetical protein
3794 c1 cds 3750892 3752517 - BALIOE_18940 hypothetical protein
3795 c1 cds 3752565 3753335 - BALIOE_18945 hypothetical protein
3796 c1 cds 3753438 3754016 + BALIOE_18950 hypothetical protein
3797 c1 cds 3754338 3757436 + BALIOE_18955 hypothetical protein
3798 c1 cds 3757439 3758767 + BALIOE_18960 hypothetical protein
3799 c1 cds 3758817 3759596 + BALIOE_18965 hypothetical protein
3800 c1 cds 3759593 3762463 + BALIOE_18970 hypothetical protein
3801 c1 cds 3762628 3764028 + BALIOE_18975 hypothetical protein
3802 c1 cds 3764046 3765362 + BALIOE_18980 hypothetical protein
3803 c1 cds 3765398 3766765 + BALIOE_18985 hypothetical protein
3804 c1 cds 3766801 3767070 - BALIOE_18990 hypothetical protein
3805 c1 cds 3767289 3769208 - BALIOE_18995 hypothetical protein
3806 c1 cds 3769644 3771092 + BALIOE_19000 hypothetical protein
3807 c1 cds 3771094 3771219 + BALIOE_19005 hypothetical protein
3808 c1 cds 3771342 3771890 + BALIOE_19010 hypothetical protein
3809 c1 cds 3771933 3773450 - BALIOE_19015 hypothetical protein
3810 c1 cds 3773460 3774341 - BALIOE_19020 hypothetical protein
3811 c1 cds 3774649 3776382 - BALIOE_19025 hypothetical protein
3812 c1 cds 3776388 3777098 - BALIOE_19030 hypothetical protein
3813 c1 cds 3777123 3778019 - BALIOE_19035 hypothetical protein
3814 c1 cds 3778131 3778652 + BALIOE_19040 hypothetical protein
3815 c1 cds 3778692 3779099 - BALIOE_19045 hypothetical protein
3816 c1 cds 3779080 3779346 - BALIOE_19050 hypothetical protein
3817 c1 cds 3779589 3780569 + BALIOE_19055 hypothetical protein
3818 c1 cds 3780646 3781305 - BALIOE_19060 hypothetical protein
3819 c1 cds 3781469 3781780 - BALIOE_19065 hypothetical protein
3820 c1 cds 3781825 3783258 + BALIOE_19070 hypothetical protein
3821 c1 cds 3783424 3786297 - BALIOE_19075 hypothetical protein
3822 c1 cds 3786415 3786804 - BALIOE_19080 hypothetical protein
3823 c1 cds 3786828 3787922 - BALIOE_19085 hypothetical protein
3824 c1 cds 3788370 3789572 - BALIOE_19090 hypothetical protein
3825 c1 cds 3789596 3790774 - BALIOE_19095 hypothetical protein
3826 c1 cds 3790771 3792096 - BALIOE_19100 hypothetical protein
3827 c1 cds 3792122 3792700 - BALIOE_19105 hypothetical protein
3828 c1 cds 3792868 3793197 + BALIOE_19110 hypothetical protein
3829 c1 cds 3793443 3794045 + BALIOE_19115 hypothetical protein
3830 c1 cds 3794827 3796059 - BALIOE_19120 hypothetical protein
3831 c1 cds 3796314 3796973 - BALIOE_19125 hypothetical protein
3832 c1 cds 3797356 3798249 + BALIOE_19130 hypothetical protein
3833 c1 cds 3798453 3800597 + BALIOE_19135 hypothetical protein
3834 c1 cds 3800590 3801585 + BALIOE_19140 hypothetical protein
3835 c1 cds 3801596 3802381 + BALIOE_19145 hypothetical protein
3836 c1 cds 3802405 3803883 + BALIOE_19150 hypothetical protein
3837 c1 cds 3803880 3804191 - BALIOE_19155 hypothetical protein
3838 c1 cds 3804198 3804776 - BALIOE_19160 hypothetical protein
3839 c1 cds 3804943 3805683 - BALIOE_19165 hypothetical protein
3840 c1 cds 3805776 3806411 - BALIOE_19170 hypothetical protein
3841 c1 cds 3806550 3807410 - BALIOE_19175 hypothetical protein
3842 c1 cds 3807768 3808847 - BALIOE_19180 hypothetical protein
3843 c1 cds 3809062 3810225 - BALIOE_19185 hypothetical protein
3844 c1 cds 3810275 3811294 - BALIOE_19190 hypothetical protein
3845 c1 cds 3811666 3812097 + BALIOE_19195 hypothetical protein
3846 c1 cds 3812120 3812698 + BALIOE_19200 hypothetical protein
3847 c1 cds 3812699 3813406 + BALIOE_19205 hypothetical protein
3848 c1 cds 3813394 3814071 + BALIOE_19210 hypothetical protein
3849 c1 cds 3814065 3814742 + BALIOE_19215 hypothetical protein
3850 c1 cds 3814714 3815427 - BALIOE_19220 hypothetical protein
3851 c1 cds 3815424 3815933 - BALIOE_19225 hypothetical protein
3852 c1 cds 3815955 3816920 - BALIOE_19230 hypothetical protein
3853 c1 cds 3816917 3818194 - BALIOE_19235 hypothetical protein
3854 c1 cds 3818209 3819597 - BALIOE_19240 hypothetical protein
3855 c1 cds 3819625 3820068 - BALIOE_19245 hypothetical protein
3856 c1 cds 3820382 3822373 - BALIOE_19250 hypothetical protein
3857 c1 cds 3822651 3823409 + BALIOE_19255 hypothetical protein
3858 c1 cds 3823615 3824535 - BALIOE_19260 hypothetical protein
3859 c1 cds 3824671 3825402 - BALIOE_19265 hypothetical protein
3860 c1 cds 3825548 3827524 - BALIOE_19270 hypothetical protein
3861 c1 cds 3828012 3828263 - BALIOE_19275 hypothetical protein
3862 c1 cds 3828319 3829473 + BALIOE_19280 hypothetical protein
3863 c1 cds 3829910 3831304 + BALIOE_19285 hypothetical protein
3864 c1 cds 3831423 3831878 + BALIOE_19290 hypothetical protein
3865 c1 cds 3831973 3832680 + BALIOE_19295 hypothetical protein
3866 c1 cds 3832760 3833491 + BALIOE_19300 hypothetical protein
3867 c1 cds 3833504 3834451 + BALIOE_19305 hypothetical protein
3868 c1 cds 3834491 3835126 + BALIOE_19310 hypothetical protein
3869 c1 cds 3835126 3835542 + BALIOE_19315 hypothetical protein
3870 c1 cds 3835733 3836713 - BALIOE_19320 hypothetical protein
3871 c1 cds 3836731 3837435 + BALIOE_19325 hypothetical protein
3872 c1 cds 3837453 3838019 + BALIOE_19330 hypothetical protein
3873 c1 cds 3838016 3838306 + BALIOE_19335 hypothetical protein
3874 c1 cds 3838314 3838907 + BALIOE_19340 hypothetical protein
3875 c1 cds 3838900 3840036 + BALIOE_19345 hypothetical protein
3876 c1 ncRNA 3840097 3840167 - BALIOE_19350 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3877 c1 cds 3840279 3841286 - BALIOE_19355 hypothetical protein
3878 c1 cds 3841403 3842449 - BALIOE_19360 hypothetical protein
3879 c1 cds 3842625 3843344 - BALIOE_19365 hypothetical protein
3880 c1 cds 3843528 3843854 - BALIOE_19370 hypothetical protein
3881 c1 cds 3843854 3844573 - BALIOE_19375 hypothetical protein
3882 c1 cds 3844734 3845786 + BALIOE_19380 hypothetical protein
3883 c1 cds 3845814 3846089 + BALIOE_19385 hypothetical protein
3884 c1 cds 3846154 3847233 + BALIOE_19390 hypothetical protein
3885 c1 cds 3847435 3848691 + BALIOE_19395 hypothetical protein
3886 c1 cds 3848741 3850876 - BALIOE_19400 hypothetical protein
3887 c1 cds 3851274 3851981 + BALIOE_19405 hypothetical protein
3888 c1 tRNA 3852087 3852162 + BALIOE_19410 Phe_trna tRNA-Phe SO:0000267
3889 c1 cds 3852360 3853625 + BALIOE_19415 hypothetical protein
3890 c1 cds 3853742 3854527 - BALIOE_19420 hypothetical protein
3891 c1 cds 3854616 3855290 + BALIOE_19425 hypothetical protein
3892 c1 cds 3855287 3855634 + BALIOE_19430 hypothetical protein
3893 c1 cds 3855654 3857102 + BALIOE_19435 hypothetical protein
3894 c1 cds 3857956 3858489 - BALIOE_19440 hypothetical protein
3895 c1 cds 3859806 3860696 + BALIOE_19445 hypothetical protein
3896 c1 cds 3861484 3863133 + BALIOE_19450 hypothetical protein
3897 c1 cds 3863741 3864730 + BALIOE_19455 hypothetical protein
3898 c1 cds 3864779 3865453 + BALIOE_19460 hypothetical protein
3899 c1 cds 3865888 3866676 + BALIOE_19465 hypothetical protein
3900 c1 cds 3867328 3868629 + BALIOE_19470 hypothetical protein
3901 c1 cds 3868635 3869462 + BALIOE_19475 hypothetical protein
3902 c1 cds 3869502 3870389 - BALIOE_19480 hypothetical protein
3903 c1 cds 3870389 3870715 - BALIOE_19485 hypothetical protein
3904 c1 cds 3870906 3871253 + BALIOE_19490 hypothetical protein
3905 c1 cds 3871303 3872841 + BALIOE_19495 hypothetical protein
3906 c1 cds 3873064 3873414 + BALIOE_19500 hypothetical protein
3907 c1 cds 3873627 3875030 + BALIOE_19505 hypothetical protein
3908 c1 cds 3875349 3875693 + BALIOE_19510 hypothetical protein
3909 c1 cds 3875536 3876852 - BALIOE_19515 hypothetical protein
3910 c1 cds 3877144 3879003 - BALIOE_19520 hypothetical protein
3911 c1 cds 3879208 3880074 + BALIOE_19525 hypothetical protein
3912 c1 ncRNA 3880105 3880181 + BALIOE_19530 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3913 c1 cds 3880197 3880445 - BALIOE_19535 hypothetical protein
3914 c1 cds 3880458 3880799 - BALIOE_19540 hypothetical protein
3915 c1 cds 3880792 3881280 - BALIOE_19545 hypothetical protein
3916 c1 cds 3881273 3881767 - BALIOE_19550 hypothetical protein
3917 c1 cds 3881767 3883470 - BALIOE_19555 hypothetical protein
3918 c1 cds 3883467 3884645 - BALIOE_19560 hypothetical protein
3919 c1 cds 3884635 3885621 - BALIOE_19565 hypothetical protein
3920 c1 cds 3885624 3886742 - BALIOE_19570 hypothetical protein
3921 c1 cds 3886931 3887218 - BALIOE_19575 hypothetical protein
3922 c1 cds 3887337 3888224 - BALIOE_19580 hypothetical protein
3923 c1 cds 3888381 3889421 + BALIOE_19585 hypothetical protein
3924 c1 cds 3889461 3889955 - BALIOE_19590 hypothetical protein
3925 c1 cds 3890146 3891030 + BALIOE_19595 hypothetical protein
3926 c1 ncRNA 3891154 3891224 - BALIOE_19600 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3927 c1 cds 3891302 3891727 - BALIOE_19605 hypothetical protein
3928 c1 cds 3891734 3892468 - BALIOE_19610 hypothetical protein
3929 c1 cds 3892720 3893907 + BALIOE_19615 hypothetical protein
3930 c1 cds 3894047 3894706 + BALIOE_19620 hypothetical protein
3931 c1 cds 3894746 3895702 - BALIOE_19625 hypothetical protein
3932 c1 cds 3895839 3897002 + BALIOE_19630 hypothetical protein
3933 c1 cds 3897107 3897934 + BALIOE_19635 hypothetical protein
3934 c1 cds 3898134 3898409 + BALIOE_19640 hypothetical protein
3935 c1 cds 3898403 3899056 + BALIOE_19645 hypothetical protein
3936 c1 cds 3899105 3899362 + BALIOE_19650 hypothetical protein
3937 c1 cds 3899405 3901624 - BALIOE_19655 hypothetical protein
3938 c1 cds 3901735 3903147 - BALIOE_19660 hypothetical protein
3939 c1 cds 3903222 3903959 - BALIOE_19665 hypothetical protein
3940 c1 cds 3904193 3906451 - BALIOE_19670 hypothetical protein
3941 c1 cds 3906589 3908196 - BALIOE_19675 hypothetical protein
3942 c1 cds 3908305 3908787 - BALIOE_19680 hypothetical protein
3943 c1 cds 3908840 3909232 - BALIOE_19685 hypothetical protein
3944 c1 cds 3909384 3910043 + BALIOE_19690 hypothetical protein
3945 c1 cds 3910040 3911389 + BALIOE_19695 hypothetical protein
3946 c1 cds 3911499 3912080 + BALIOE_19700 hypothetical protein
3947 c1 cds 3912111 3912425 + BALIOE_19705 hypothetical protein
3948 c1 cds 3912470 3913357 - BALIOE_19710 hypothetical protein
3949 c1 cds 3913354 3914301 - BALIOE_19715 hypothetical protein
3950 c1 cds 3914312 3915349 - BALIOE_19720 hypothetical protein
3951 c1 cds 3915358 3916341 - BALIOE_19725 hypothetical protein
3952 c1 cds 3916338 3917147 - BALIOE_19730 hypothetical protein
3953 c1 cds 3917521 3919662 + BALIOE_19735 hypothetical protein
3954 c1 cds 3919726 3921618 - BALIOE_19740 hypothetical protein
3955 c1 cds 3921647 3922228 - BALIOE_19745 hypothetical protein
3956 c1 cds 3922228 3923055 - BALIOE_19750 hypothetical protein
3957 c1 cds 3923080 3923502 - BALIOE_19755 hypothetical protein
3958 c1 cds 3923503 3924132 - BALIOE_19760 hypothetical protein
3959 c1 cds 3924337 3925818 + BALIOE_19765 hypothetical protein
3960 c1 cds 3925966 3926637 + BALIOE_19770 hypothetical protein
3961 c1 cds 3926643 3927803 + BALIOE_19775 hypothetical protein
3962 c1 cds 3927841 3928656 - BALIOE_19780 hypothetical protein
3963 c1 cds 3928772 3929545 + BALIOE_19785 hypothetical protein
3964 c1 cds 3929603 3929773 - BALIOE_19790 hypothetical protein
3965 c1 cds 3930035 3930688 - BALIOE_19795 hypothetical protein
3966 c1 cds 3931062 3931361 + BALIOE_19800 hypothetical protein
3967 c1 cds 3931396 3931596 - BALIOE_19805 hypothetical protein
3968 c1 cds 3931865 3932479 + BALIOE_19810 hypothetical protein
3969 c1 cds 3932521 3934182 + BALIOE_19815 hypothetical protein
3970 c1 cds 3934976 3936409 - BALIOE_19820 hypothetical protein
3971 c1 cds 3936457 3939297 - BALIOE_19825 hypothetical protein
3972 c1 cds 3939320 3940621 - BALIOE_19830 hypothetical protein
3973 c1 cds 3940863 3941483 + BALIOE_19835 hypothetical protein
3974 c1 cds 3941547 3942785 + BALIOE_19840 hypothetical protein
3975 c1 ncRNA 3942851 3942921 - BALIOE_19845 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
3976 c1 cds 3942966 3943787 - BALIOE_19850 hypothetical protein
3977 c1 cds 3943878 3944246 - BALIOE_19855 hypothetical protein
3978 c1 cds 3944352 3944969 + BALIOE_19860 hypothetical protein
3979 c1 cds 3944982 3945914 - BALIOE_19865 hypothetical protein
3980 c1 cds 3946121 3947032 + BALIOE_19870 hypothetical protein
3981 c1 cds 3947029 3947634 + BALIOE_19875 hypothetical protein
3982 c1 cds 3947683 3949146 + BALIOE_19880 hypothetical protein
3983 c1 cds 3949189 3950202 - BALIOE_19885 hypothetical protein
3984 c1 cds 3950440 3950655 + BALIOE_19890 hypothetical protein
3985 c1 cds 3950766 3952511 + BALIOE_19895 hypothetical protein
3986 c1 cds 3952706 3954547 + BALIOE_19900 hypothetical protein
3987 c1 cds 3954626 3955132 - BALIOE_19905 hypothetical protein
3988 c1 tRNA 3955257 3955332 + BALIOE_19910 Ile2_trna tRNA-Ile2 SO:0000263
3989 c1 cds 3955386 3956150 - BALIOE_19915 hypothetical protein
3990 c1 cds 3956438 3957061 + BALIOE_19920 hypothetical protein
3991 c1 cds 3957215 3958735 - BALIOE_19925 hypothetical protein
3992 c1 cds 3959042 3960532 + BALIOE_19930 hypothetical protein
3993 c1 cds 3960574 3960906 - BALIOE_19935 hypothetical protein
3994 c1 cds 3961125 3962108 + BALIOE_19940 hypothetical protein
3995 c1 cds 3962292 3965384 + BALIOE_19945 hypothetical protein
3996 c1 cds 3965381 3965830 + BALIOE_19950 hypothetical protein
3997 c1 cds 3965893 3967326 + BALIOE_19955 hypothetical protein
3998 c1 cds 3967460 3968530 + BALIOE_19960 hypothetical protein
3999 c1 cds 3968547 3970898 + BALIOE_19965 hypothetical protein
4000 c1 ncRNA 3971060 3971141 - BALIOE_19970 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
4001 c1 ncRNA 3971160 3971241 - BALIOE_19975 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
4002 c1 cds 3971424 3973442 + BALIOE_19980 hypothetical protein
4003 c1 cds 3973487 3973903 - BALIOE_19985 hypothetical protein
4004 c1 cds 3973900 3974214 - BALIOE_19990 hypothetical protein
4005 c1 cds 3974498 3975634 - BALIOE_19995 hypothetical protein
4006 c1 cds 3975719 3976222 + BALIOE_20000 hypothetical protein
4007 c1 cds 3976299 3976991 + BALIOE_20005 hypothetical protein
4008 c1 cds 3977070 3978056 + BALIOE_20010 hypothetical protein
4009 c1 cds 3978340 3979305 + BALIOE_20015 hypothetical protein
4010 c1 cds 3979704 3980948 + BALIOE_20020 hypothetical protein
4011 c1 cds 3980953 3981504 - BALIOE_20025 hypothetical protein
4012 c1 cds 3981587 3983074 - BALIOE_20030 hypothetical protein
4013 c1 cds 3983089 3984501 - BALIOE_20035 hypothetical protein
4014 c1 cds 3984984 3986282 + BALIOE_20040 hypothetical protein
4015 c1 cds 3986412 3987188 + BALIOE_20045 hypothetical protein
4016 c1 cds 3987533 3988195 + BALIOE_20050 hypothetical protein
4017 c1 cds 3988199 3988582 + BALIOE_20055 hypothetical protein
4018 c1 cds 3988729 3989097 + BALIOE_20060 hypothetical protein
4019 c1 cds 3989135 3989440 + BALIOE_20065 hypothetical protein
4020 c1 cds 3989443 3989847 + BALIOE_20070 hypothetical protein
4021 c1 cds 3989837 3990136 + BALIOE_20075 hypothetical protein
4022 c1 cds 3990232 3990714 + BALIOE_20080 hypothetical protein
4023 c1 cds 3990784 3991770 + BALIOE_20085 hypothetical protein
4024 c1 cds 3992062 3992427 + BALIOE_20090 hypothetical protein
4025 c1 cds 3992668 3993024 + BALIOE_20095 hypothetical protein
4026 c1 cds 3993075 3993971 - BALIOE_20100 hypothetical protein
4027 c1 cds 3994076 3994777 + BALIOE_20105 hypothetical protein
4028 c1 cds 3994800 3994964 + BALIOE_20110 hypothetical protein
4029 c1 cds 3995098 3996408 - BALIOE_20115 hypothetical protein
4030 c1 cds 3996436 3997767 - BALIOE_20120 hypothetical protein
4031 c1 cds 3998042 3999406 - BALIOE_20125 hypothetical protein
4032 c1 cds 3999478 3999867 - BALIOE_20130 hypothetical protein
4033 c1 cds 3999881 4002175 - BALIOE_20135 hypothetical protein
4034 c1 cds 4002209 4003417 - BALIOE_20140 hypothetical protein
4035 c1 cds 4003443 4004774 - BALIOE_20145 hypothetical protein
4036 c1 cds 4004796 4005785 - BALIOE_20150 hypothetical protein
4037 c1 cds 4005884 4006822 - BALIOE_20155 hypothetical protein
4038 c1 cds 4007011 4007355 + BALIOE_20160 hypothetical protein
4039 c1 cds 4007611 4008150 + BALIOE_20165 hypothetical protein
4040 c1 cds 4008172 4009359 + BALIOE_20170 hypothetical protein
4041 c1 cds 4009988 4011133 - BALIOE_20175 hypothetical protein
4042 c1 cds 4011230 4012120 - BALIOE_20180 hypothetical protein
4043 c1 cds 4012150 4012920 - BALIOE_20185 hypothetical protein
4044 c1 cds 4012936 4014270 - BALIOE_20190 hypothetical protein
4045 c1 cds 4014645 4016216 + BALIOE_20195 hypothetical protein
4046 c1 cds 4016365 4016700 + BALIOE_20200 hypothetical protein
4047 c1 cds 4016700 4017164 + BALIOE_20205 hypothetical protein
4048 c1 cds 4017219 4018028 - BALIOE_20210 hypothetical protein
4049 c1 cds 4018277 4019557 + BALIOE_20215 hypothetical protein
4050 c1 cds 4019580 4020053 + BALIOE_20220 hypothetical protein
4051 c1 cds 4020064 4020843 + BALIOE_20225 hypothetical protein
4052 c1 cds 4020833 4021711 + BALIOE_20230 hypothetical protein
4053 c1 cds 4021729 4022163 + BALIOE_20235 hypothetical protein
4054 c1 cds 4022160 4023293 + BALIOE_20240 hypothetical protein
4055 c1 cds 4023644 4024798 + BALIOE_20245 hypothetical protein
4056 c1 cds 4024811 4025671 + BALIOE_20250 hypothetical protein
4057 c1 cds 4025838 4026314 + BALIOE_20255 hypothetical protein
4058 c1 cds 4026527 4027156 + BALIOE_20260 hypothetical protein
4059 c1 cds 4027146 4027937 + BALIOE_20265 hypothetical protein
4060 c1 cds 4027992 4028153 + BALIOE_20270 hypothetical protein
4061 c1 cds 4028184 4028693 + BALIOE_20275 hypothetical protein
4062 c1 cds 4029094 4029678 + BALIOE_20280 hypothetical protein
4063 c1 cds 4029779 4030453 + BALIOE_20285 hypothetical protein
4064 c1 cds 4030482 4032998 + BALIOE_20290 hypothetical protein
4065 c1 cds 4033009 4033362 + BALIOE_20295 hypothetical protein
4066 c1 cds 4033388 4033714 + BALIOE_20300 hypothetical protein
4067 c1 cds 4033714 4034601 + BALIOE_20305 hypothetical protein
4068 c1 cds 4034567 4035058 + BALIOE_20310 hypothetical protein
4069 c1 cds 4035101 4035961 - BALIOE_20315 hypothetical protein
4070 c1 cds 4036026 4038062 + BALIOE_20320 hypothetical protein
4071 c1 cds 4038020 4038415 + BALIOE_20325 hypothetical protein
4072 c1 cds 4038435 4039025 + BALIOE_20330 hypothetical protein
4073 c1 cds 4039035 4039610 + BALIOE_20335 hypothetical protein
4074 c1 cds 4039724 4040764 - BALIOE_20340 hypothetical protein
4075 c1 cds 4040837 4041472 - BALIOE_20345 hypothetical protein
4076 c1 cds 4041600 4042118 + BALIOE_20350 hypothetical protein
4077 c1 cds 4042098 4042541 - BALIOE_20355 hypothetical protein
4078 c1 cds 4042592 4042894 + BALIOE_20360 hypothetical protein
4079 c1 cds 4042881 4043384 - BALIOE_20365 hypothetical protein
4080 c1 cds 4043378 4043902 - BALIOE_20370 hypothetical protein
4081 c1 cds 4044111 4045106 + BALIOE_20375 hypothetical protein
4082 c1 cds 4045115 4045993 + BALIOE_20380 hypothetical protein
4083 c1 cds 4046074 4047081 + BALIOE_20385 hypothetical protein
4084 c1 cds 4047198 4048442 - BALIOE_20390 hypothetical protein
4085 c1 cds 4048596 4050485 - BALIOE_20395 hypothetical protein
4086 c1 cds 4050665 4051549 - BALIOE_20400 hypothetical protein
4087 c1 cds 4051658 4053793 - BALIOE_20405 hypothetical protein
4088 c1 cds 4054040 4054309 - BALIOE_20410 hypothetical protein
4089 c1 cds 4054458 4055402 - BALIOE_20415 hypothetical protein
4090 c1 cds 4055402 4055803 - BALIOE_20420 hypothetical protein
4091 c1 ncRNA 4055881 4055951 - BALIOE_20425 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
4092 c1 cds 4055968 4058640 - BALIOE_20430 hypothetical protein
4093 c1 cds 4058665 4060152 - BALIOE_20435 hypothetical protein
4094 c1 cds 4060180 4060632 - BALIOE_20440 hypothetical protein
4095 c1 tRNA 4060839 4060915 - BALIOE_20445 fMet_trna tRNA-fMet SO:0000266
4096 c1 cds 4061263 4062606 + BALIOE_20450 hypothetical protein
4097 c1 cds 4062614 4064131 - BALIOE_20455 hypothetical protein
4098 c1 tRNA 4064698 4064784 - BALIOE_20460 Leu_trna tRNA-Leu SO:0000264
4099 c1 cds 4064799 4065131 - BALIOE_20465 hypothetical protein
4100 c1 cds 4065359 4066696 - BALIOE_20470 hypothetical protein
4101 c1 cds 4066689 4067537 - BALIOE_20475 hypothetical protein
4102 c1 cds 4067627 4069570 - BALIOE_20480 hypothetical protein
4103 c1 cds 4069661 4070290 - BALIOE_20485 hypothetical protein
4104 c1 cds 4070416 4070709 + BALIOE_20490 hypothetical protein
4105 c1 cds 4070865 4071341 - BALIOE_20495 hypothetical protein
4106 c1 cds 4071589 4073022 + BALIOE_20500 hypothetical protein
4107 c1 cds 4073062 4074234 - BALIOE_20505 hypothetical protein
4108 c1 cds 4074250 4075215 - BALIOE_20510 hypothetical protein
4109 c1 cds 4075342 4075599 - BALIOE_20515 hypothetical protein
4110 c1 cds 4075620 4075931 - BALIOE_20520 hypothetical protein
4111 c1 cds 4076190 4077161 + BALIOE_20525 hypothetical protein
4112 c1 cds 4077390 4077668 + BALIOE_20530 hypothetical protein
4113 c1 cds 4077716 4078975 - BALIOE_20535 hypothetical protein
4114 c1 cds 4079030 4079299 - BALIOE_20540 hypothetical protein
4115 c1 cds 4079444 4079737 - BALIOE_20545 hypothetical protein
4116 c1 cds 4079737 4080372 - BALIOE_20550 hypothetical protein
4117 c1 cds 4080391 4080942 - BALIOE_20555 hypothetical protein
4118 c1 cds 4080947 4081729 - BALIOE_20560 hypothetical protein
4119 c1 cds 4081737 4082546 - BALIOE_20565 hypothetical protein
4120 c1 cds 4082756 4083733 + BALIOE_20570 hypothetical protein
4121 c1 cds 4083747 4084733 + BALIOE_20575 hypothetical protein
4122 c1 cds 4084754 4085320 + BALIOE_20580 hypothetical protein
4123 c1 cds 4085317 4085892 + BALIOE_20585 hypothetical protein
4124 c1 cds 4085861 4086418 + BALIOE_20590 hypothetical protein
4125 c1 cds 4086425 4087150 + BALIOE_20595 hypothetical protein
4126 c1 cds 4087198 4088631 + BALIOE_20600 hypothetical protein
4127 c1 cds 4088654 4088941 + BALIOE_20605 hypothetical protein
4128 c1 cds 4089059 4089550 + BALIOE_20610 hypothetical protein
4129 c1 cds 4089596 4090450 + BALIOE_20615 hypothetical protein
4130 c1 cds 4090447 4090719 + BALIOE_20620 hypothetical protein
4131 c1 cds 4090933 4091565 + BALIOE_20625 hypothetical protein
4132 c1 cds 4091562 4092290 - BALIOE_20630 hypothetical protein
4133 c1 cds 4092287 4092940 - BALIOE_20635 hypothetical protein
4134 c1 cds 4093170 4095506 - BALIOE_20640 hypothetical protein
4135 c1 cds 4095602 4096531 - BALIOE_20645 hypothetical protein
4136 c1 cds 4097112 4101665 + BALIOE_20650 hypothetical protein
4137 c1 cds 4101678 4103096 + BALIOE_20655 hypothetical protein
4138 c1 cds 4103280 4104329 + BALIOE_20660 hypothetical protein
4139 c1 cds 4104389 4104853 - BALIOE_20665 hypothetical protein
4140 c1 cds 4104850 4105725 - BALIOE_20670 hypothetical protein
4141 c1 cds 4105722 4106411 - BALIOE_20675 hypothetical protein
4142 c1 cds 4106459 4107949 - BALIOE_20680 hypothetical protein
4143 c1 cds 4108058 4108951 - BALIOE_20685 hypothetical protein
4144 c1 cds 4109073 4109864 - BALIOE_20690 hypothetical protein
4145 c1 cds 4110244 4111608 + BALIOE_20695 hypothetical protein
4146 c1 cds 4111643 4112140 - BALIOE_20700 hypothetical protein
4147 c1 cds 4112146 4112784 - BALIOE_20705 hypothetical protein
4148 c1 cds 4113179 4113571 - BALIOE_20710 hypothetical protein
4149 c1 cds 4113587 4114015 - BALIOE_20715 hypothetical protein
4150 c1 cds 4114234 4115361 - BALIOE_20720 hypothetical protein
4151 c1 cds 4115555 4115953 + BALIOE_20725 hypothetical protein
4152 c1 cds 4116107 4117474 + BALIOE_20730 hypothetical protein
4153 c1 cds 4117564 4118631 + BALIOE_20735 hypothetical protein
4154 c1 cds 4118695 4119633 - BALIOE_20740 hypothetical protein
4155 c1 cds 4120068 4120538 + BALIOE_20745 hypothetical protein
4156 c1 cds 4120903 4121166 + BALIOE_20750 hypothetical protein
4157 c1 cds 4121222 4121494 - BALIOE_20755 hypothetical protein
4158 c1 cds 4121586 4123553 - BALIOE_20760 hypothetical protein
4159 c1 cds 4123559 4124488 - BALIOE_20765 hypothetical protein
4160 c1 cds 4124496 4124699 - BALIOE_20770 hypothetical protein
4161 c1 cds 4124882 4125811 + BALIOE_20775 hypothetical protein
4162 c1 cds 4125945 4127390 - BALIOE_20780 hypothetical protein
4163 c1 cds 4127546 4131346 - BALIOE_20785 hypothetical protein
4164 c1 cds 4131414 4132883 - BALIOE_20790 hypothetical protein
4165 c1 cds 4132873 4133466 - BALIOE_20795 hypothetical protein
4166 c1 cds 4133475 4133963 - BALIOE_20800 hypothetical protein
4167 c1 cds 4133963 4135066 - BALIOE_20805 hypothetical protein
4168 c1 cds 4135132 4136175 - BALIOE_20810 hypothetical protein
4169 c1 cds 4136480 4138420 - BALIOE_20815 hypothetical protein
4170 c1 cds 4138572 4139546 + BALIOE_20820 hypothetical protein
4171 c1 cds 4140524 4140994 + BALIOE_20825 hypothetical protein
4172 c1 cds 4141005 4142354 + BALIOE_20830 hypothetical protein
4173 c1 cds 4142463 4142705 + BALIOE_20835 hypothetical protein
4174 c1 cds 4142695 4144146 + BALIOE_20840 hypothetical protein
4175 c1 cds 4144158 4145039 + BALIOE_20845 hypothetical protein
4176 c1 cds 4145368 4146333 + BALIOE_20850 hypothetical protein
4177 c1 cds 4146359 4146655 + BALIOE_20855 hypothetical protein
4178 c1 cds 4146740 4147624 + BALIOE_20860 hypothetical protein
4179 c1 cds 4147708 4147887 + BALIOE_20865 hypothetical protein
4180 c1 cds 4147890 4148552 - BALIOE_20870 hypothetical protein
4181 c1 cds 4148951 4150108 + BALIOE_20875 hypothetical protein
4182 c1 cds 4150120 4152006 + BALIOE_20880 hypothetical protein
4183 c1 cds 4152037 4153269 + BALIOE_20885 hypothetical protein
4184 c1 cds 4153120 4153416 - BALIOE_20890 hypothetical protein
4185 c1 cds 4153522 4153743 + BALIOE_20895 hypothetical protein
4186 c1 cds 4154174 4155199 + BALIOE_20900 hypothetical protein
4187 c1 cds 4155267 4156448 + BALIOE_20905 hypothetical protein
4188 c1 cds 4156458 4157561 + BALIOE_20910 hypothetical protein
4189 c1 cds 4157569 4158327 + BALIOE_20915 hypothetical protein
4190 c1 tRNA 4158713 4158788 - BALIOE_20920 Thr_trna tRNA-Thr SO:0000270
4191 c1 tRNA 4162099 4162174 - BALIOE_20925 Ala_trna tRNA-Ala SO:0000254
4192 c1 tRNA 4162217 4162293 - BALIOE_20930 Ile_trna tRNA-Ile SO:0000263
4193 c1 rRNA 4162362 4163903 - BALIOE_20935 16S_rrna 16S ribosomal RNA GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
4194 c1 cds 4164376 4164930 + BALIOE_20940 hypothetical protein
4195 c1 cds 4164906 4165163 - BALIOE_20945 hypothetical protein
4196 c1 cds 4165160 4165978 - BALIOE_20950 hypothetical protein
4197 c1 cds 4165983 4166555 - BALIOE_20955 hypothetical protein
4198 c1 cds 4166560 4167102 - BALIOE_20960 hypothetical protein
4199 c1 cds 4167131 4167604 - BALIOE_20965 hypothetical protein
4200 c1 cds 4167576 4168700 - BALIOE_20970 hypothetical protein
4201 c1 cds 4168830 4169339 + BALIOE_20975 hypothetical protein
4202 c1 cds 4169354 4170301 + BALIOE_20980 hypothetical protein
4203 c1 cds 4170347 4171636 + BALIOE_20985 hypothetical protein
4204 c1 cds 4171658 4173034 + BALIOE_20990 hypothetical protein
4205 c1 cds 4173164 4173574 + BALIOE_20995 hypothetical protein
4206 c1 cds 4173571 4173789 - BALIOE_21000 hypothetical protein
4207 c1 cds 4173845 4174270 - BALIOE_21005 hypothetical protein
4208 c1 cds 4174281 4174649 - BALIOE_21010 hypothetical protein
4209 c1 cds 4174756 4175139 - BALIOE_21015 hypothetical protein
4210 c1 cds 4175180 4176169 - BALIOE_21020 hypothetical protein
4211 c1 cds 4176195 4176815 - BALIOE_21025 hypothetical protein
4212 c1 cds 4176849 4177238 - BALIOE_21030 hypothetical protein
4213 c1 cds 4177255 4177611 - BALIOE_21035 hypothetical protein
4214 c1 cds 4177758 4177874 - BALIOE_21040 hypothetical protein
4215 c1 cds 4177906 4179237 - BALIOE_21045 hypothetical protein
4216 c1 cds 4179245 4179679 - BALIOE_21050 hypothetical protein
4217 c1 cds 4179683 4179862 - BALIOE_21055 hypothetical protein
4218 c1 cds 4179866 4180369 - BALIOE_21060 hypothetical protein
4219 c1 cds 4180384 4180737 - BALIOE_21065 hypothetical protein
4220 c1 cds 4180747 4181280 - BALIOE_21070 hypothetical protein
4221 c1 cds 4181293 4181685 - BALIOE_21075 hypothetical protein
4222 c1 cds 4181719 4182024 - BALIOE_21080 hypothetical protein
4223 c1 cds 4182039 4182578 - BALIOE_21085 hypothetical protein
4224 c1 cds 4182593 4182907 - BALIOE_21090 hypothetical protein
4225 c1 cds 4182918 4183289 - BALIOE_21095 hypothetical protein
4226 c1 cds 4183454 4183708 - BALIOE_21100 hypothetical protein
4227 c1 cds 4183708 4183899 - BALIOE_21105 hypothetical protein
4228 c1 cds 4183899 4184309 - BALIOE_21110 hypothetical protein
4229 c1 cds 4184322 4185023 - BALIOE_21115 hypothetical protein
4230 c1 cds 4185041 4185373 - BALIOE_21120 hypothetical protein
4231 c1 cds 4185388 4185666 - BALIOE_21125 hypothetical protein
4232 c1 cds 4185683 4186504 - BALIOE_21130 hypothetical protein
4233 c1 cds 4186522 4186824 - BALIOE_21135 hypothetical protein
4234 c1 cds 4186821 4187426 - BALIOE_21140 hypothetical protein
4235 c1 cds 4187437 4188066 - BALIOE_21145 hypothetical protein
4236 c1 cds 4188099 4188410 - BALIOE_21150 hypothetical protein
4237 c1 cds 4188789 4189256 + BALIOE_21155 hypothetical protein
4238 c1 cds 4189253 4189729 - BALIOE_21160 hypothetical protein
4239 c1 cds 4189802 4189996 - BALIOE_21165 hypothetical protein
4240 c1 cds 4190179 4191363 - BALIOE_21170 hypothetical protein
4241 c1 cds 4191434 4193548 - BALIOE_21175 hypothetical protein
4242 c1 cds 4193645 4194115 - BALIOE_21180 hypothetical protein
4243 c1 cds 4194212 4194586 - BALIOE_21185 hypothetical protein
4244 c1 cds 4194712 4194999 - BALIOE_21190 hypothetical protein
4245 c1 cds 4195007 4195366 - BALIOE_21195 hypothetical protein
4246 c1 cds 4195366 4195752 - BALIOE_21200 hypothetical protein
4247 c1 cds 4195752 4196474 - BALIOE_21205 hypothetical protein
4248 c1 cds 4196641 4197453 - BALIOE_21210 hypothetical protein
4249 c1 cds 4197674 4197892 + BALIOE_21215 hypothetical protein
4250 c1 cds 4197941 4198531 - BALIOE_21220 hypothetical protein
4251 c1 cds 4198626 4198826 - BALIOE_21225 hypothetical protein
4252 c1 cds 4198863 4200641 - BALIOE_21230 hypothetical protein
4253 c1 cds 4200641 4201192 - BALIOE_21235 hypothetical protein
4254 c1 cds 4201323 4203236 + BALIOE_21240 hypothetical protein
4255 c1 cds 4203236 4204258 + BALIOE_21245 hypothetical protein
4256 c1 cds 4204252 4204470 + BALIOE_21250 hypothetical protein
4257 c1 cds 4204524 4205393 + BALIOE_21255 hypothetical protein
4258 c1 cds 4205448 4205852 - BALIOE_21260 hypothetical protein
4259 c1 cds 4206154 4206786 + BALIOE_21265 hypothetical protein
4260 c1 cds 4206837 4208927 + BALIOE_21270 hypothetical protein
4261 c1 cds 4208994 4210214 - BALIOE_21275 hypothetical protein
4262 c1 cds 4210300 4210863 - BALIOE_21280 hypothetical protein
4263 c1 cds 4210895 4211497 - BALIOE_21285 hypothetical protein
4264 c1 cds 4211487 4211654 - BALIOE_21290 hypothetical protein
4265 c1 cds 4211759 4212331 - BALIOE_21295 hypothetical protein
4266 c1 cds 4212602 4213783 + BALIOE_21300 hypothetical protein
4267 c1 cds 4214045 4216588 + BALIOE_21305 hypothetical protein
4268 c1 cds 4216585 4216911 + BALIOE_21310 hypothetical protein
4269 c1 cds 4217037 4217843 + BALIOE_21315 hypothetical protein
4270 c1 cds 4217862 4219235 + BALIOE_21320 hypothetical protein
4271 c1 cds 4219490 4219657 + BALIOE_21325 hypothetical protein
4272 c1 cds 4219953 4221290 + BALIOE_21330 hypothetical protein
4273 c1 cds 4221311 4222333 + BALIOE_21335 hypothetical protein
4274 c1 cds 4222384 4223211 + BALIOE_21340 hypothetical protein
4275 c1 cds 4223211 4223543 + BALIOE_21345 hypothetical protein
4276 c1 cds 4223562 4223996 + BALIOE_21350 hypothetical protein
4277 c1 cds 4224096 4224827 + BALIOE_21355 hypothetical protein
4278 c1 cds 4224958 4225962 - BALIOE_21360 hypothetical protein
4279 c1 cds 4225955 4226713 - BALIOE_21365 hypothetical protein
4280 c1 cds 4226706 4227383 - BALIOE_21370 hypothetical protein
4281 c1 cds 4227401 4228237 - BALIOE_21375 hypothetical protein
4282 c1 cds 4228344 4229630 - BALIOE_21380 hypothetical protein
4283 c1 cds 4229722 4230810 - BALIOE_21385 hypothetical protein
4284 c1 cds 4230867 4231544 - BALIOE_21390 hypothetical protein
4285 c1 cds 4231789 4232997 - BALIOE_21395 hypothetical protein
4286 c1 cds 4232939 4233343 - BALIOE_21400 hypothetical protein
4287 c1 cds 4233333 4233773 - BALIOE_21405 hypothetical protein
4288 c1 cds 4233757 4234296 - BALIOE_21410 hypothetical protein
4289 c1 cds 4234280 4235074 - BALIOE_21415 hypothetical protein
4290 c1 cds 4235194 4237746 + BALIOE_21420 hypothetical protein
4291 c1 cds 4237911 4238471 - BALIOE_21425 hypothetical protein
4292 c1 cds 4238803 4240926 + BALIOE_21430 hypothetical protein
4293 c1 cds 4240991 4241659 + BALIOE_21435 hypothetical protein
4294 c1 cds 4241670 4242071 + BALIOE_21440 hypothetical protein
4295 c1 cds 4242096 4242974 + BALIOE_21445 hypothetical protein
4296 c1 cds 4243037 4244761 - BALIOE_21450 hypothetical protein
4297 c1 cds 4245140 4246762 + BALIOE_21455 hypothetical protein
4298 c1 cds 4246838 4248190 - BALIOE_21460 hypothetical protein
4299 c1 cds 4248187 4248906 - BALIOE_21465 hypothetical protein
4300 c1 cds 4249134 4249610 + BALIOE_21470 hypothetical protein
4301 c1 cds 4249707 4252028 + BALIOE_21475 hypothetical protein
4302 c1 cds 4252466 4252693 + BALIOE_21480 hypothetical protein
4303 c1 cds 4252710 4255031 + BALIOE_21485 hypothetical protein
4304 c1 cds 4255031 4255267 + BALIOE_21490 hypothetical protein
4305 c1 cds 4255470 4256348 + BALIOE_21495 hypothetical protein
4306 c1 cds 4256375 4257145 - BALIOE_21500 hypothetical protein
4307 c1 cds 4257183 4257866 + BALIOE_21505 hypothetical protein
4308 c1 cds 4257925 4258500 + BALIOE_21510 hypothetical protein
4309 c1 cds 4258861 4260177 + BALIOE_21515 hypothetical protein
4310 c1 cds 4260222 4262306 - BALIOE_21520 hypothetical protein
4311 c1 cds 4262316 4264709 - BALIOE_21525 hypothetical protein
4312 c1 cds 4265321 4268026 + BALIOE_21530 hypothetical protein
4313 c1 cds 4268093 4268371 + BALIOE_21535 hypothetical protein
4314 c1 cds 4268362 4268847 + BALIOE_21540 hypothetical protein
4315 c1 cds 4268897 4269925 - BALIOE_21545 hypothetical protein
4316 c1 cds 4269929 4271155 - BALIOE_21550 hypothetical protein
4317 c1 cds 4271343 4272941 + BALIOE_21555 hypothetical protein
4318 c1 cds 4272923 4273681 - BALIOE_21560 hypothetical protein
4319 c1 cds 4273698 4274528 - BALIOE_21565 hypothetical protein
4320 c1 cds 4274573 4274899 - BALIOE_21570 hypothetical protein
4321 c1 cds 4275089 4276594 + BALIOE_21575 hypothetical protein
4322 c1 cds 4276809 4277411 - BALIOE_21580 hypothetical protein
4323 c1 cds 4277411 4278403 - BALIOE_21585 hypothetical protein
4324 c1 cds 4278429 4279937 - BALIOE_21590 hypothetical protein
4325 c1 cds 4280062 4282509 - BALIOE_21595 hypothetical protein
4326 c1 cds 4282528 4283961 - BALIOE_21600 hypothetical protein
4327 c1 cds 4283961 4285256 - BALIOE_21605 hypothetical protein
4328 c1 cds 4285274 4287247 - BALIOE_21610 hypothetical protein
4329 c1 cds 4287244 4289430 - BALIOE_21615 hypothetical protein
4330 c1 cds 4289703 4290806 - BALIOE_21620 hypothetical protein
4331 c1 cds 4290998 4291591 + BALIOE_21625 hypothetical protein
4332 c1 cds 4291637 4292932 - BALIOE_21630 hypothetical protein
4333 c1 cds 4292991 4293965 - BALIOE_21635 hypothetical protein
4334 c1 cds 4293969 4294358 - BALIOE_21640 hypothetical protein
4335 c1 cds 4294355 4294963 - BALIOE_21645 hypothetical protein
4336 c1 cds 4295103 4296443 - BALIOE_21650 hypothetical protein
4337 c1 cds 4296447 4296974 - BALIOE_21655 hypothetical protein
4338 c1 cds 4297113 4298108 - BALIOE_21660 hypothetical protein
4339 c1 cds 4298332 4299027 - BALIOE_21665 hypothetical protein
4340 c1 cds 4299150 4300187 - BALIOE_21670 hypothetical protein
4341 c1 cds 4300521 4301009 + BALIOE_21675 hypothetical protein
4342 c1 cds 4301220 4302131 + BALIOE_21680 hypothetical protein
4343 c1 cds 4302080 4302496 - BALIOE_21685 hypothetical protein
4344 c1 cds 4302865 4304610 - BALIOE_21690 hypothetical protein
4345 c1 cds 4304730 4305170 + BALIOE_21695 hypothetical protein
4346 c1 cds 4305157 4305900 - BALIOE_21700 hypothetical protein
4347 c1 cds 4305897 4306967 - BALIOE_21705 hypothetical protein
4348 c1 cds 4306969 4307814 - BALIOE_21710 hypothetical protein
4349 c1 cds 4307811 4308698 - BALIOE_21715 hypothetical protein
4350 c1 cds 4308796 4310112 - BALIOE_21720 hypothetical protein
4351 c1 cds 4310472 4311218 - BALIOE_21725 hypothetical protein
4352 c1 cds 4311337 4312050 - BALIOE_21730 hypothetical protein
4353 c1 cds 4312052 4312819 - BALIOE_21735 hypothetical protein
4354 c1 cds 4312816 4314093 - BALIOE_21740 hypothetical protein
4355 c1 cds 4314090 4315016 - BALIOE_21745 hypothetical protein
4356 c1 cds 4315064 4316173 - BALIOE_21750 hypothetical protein
4357 c1 cds 4316597 4316980 + BALIOE_21755 hypothetical protein
4358 c1 cds 4316977 4317504 - BALIOE_21760 hypothetical protein
4359 c1 cds 4317511 4317777 - BALIOE_21765 hypothetical protein
4360 c1 cds 4317927 4319030 - BALIOE_21770 hypothetical protein
4361 c1 cds 4319301 4320155 - BALIOE_21775 hypothetical protein
4362 c1 cds 4320400 4321458 - BALIOE_21780 hypothetical protein
4363 c1 cds 4321451 4322119 - BALIOE_21785 hypothetical protein
4364 c1 cds 4322122 4323618 - BALIOE_21790 hypothetical protein
4365 c1 cds 4323768 4324364 + BALIOE_21795 hypothetical protein
4366 c1 cds 4324354 4324623 + BALIOE_21800 hypothetical protein
4367 c1 cds 4324626 4324985 - BALIOE_21805 hypothetical protein
4368 c1 cds 4325126 4325752 + BALIOE_21810 hypothetical protein
4369 c1 cds 4325826 4328024 + BALIOE_21815 hypothetical protein
4370 c1 cds 4328126 4328371 - BALIOE_21820 hypothetical protein
4371 c1 cds 4328592 4329257 + BALIOE_21825 hypothetical protein
4372 c1 cds 4329330 4329887 + BALIOE_21830 hypothetical protein
4373 c1 cds 4329891 4331141 - BALIOE_21835 hypothetical protein
4374 c1 cds 4331240 4332289 + BALIOE_21840 hypothetical protein
4375 c1 cds 4332681 4333058 + BALIOE_21845 hypothetical protein
4376 c1 cds 4333127 4334185 + BALIOE_21850 hypothetical protein
4377 c1 cds 4334226 4334948 + BALIOE_21855 hypothetical protein
4378 c1 cds 4334945 4335766 + BALIOE_21860 hypothetical protein
4379 c1 cds 4335741 4335998 + BALIOE_21865 hypothetical protein
4380 c1 cds 4336010 4336261 + BALIOE_21870 hypothetical protein
4381 c1 cds 4336266 4336847 + BALIOE_21875 hypothetical protein
4382 c1 cds 4336844 4338205 + BALIOE_21880 hypothetical protein
4383 c1 cds 4338192 4338545 + BALIOE_21885 hypothetical protein
4384 c1 cds 4338536 4340212 + BALIOE_21890 hypothetical protein
4385 c1 cds 4340216 4340638 + BALIOE_21895 hypothetical protein
4386 c1 cds 4340635 4341240 + BALIOE_21900 hypothetical protein
4387 c1 cds 4341209 4343527 + BALIOE_21905 hypothetical protein
4388 c1 cds 4343524 4344108 + BALIOE_21910 hypothetical protein
4389 c1 cds 4344110 4345279 + BALIOE_21915 hypothetical protein
4390 c1 cds 4345276 4345740 + BALIOE_21920 hypothetical protein
4391 c1 cds 4345740 4346471 + BALIOE_21925 hypothetical protein
4392 c1 cds 4346468 4347697 + BALIOE_21930 hypothetical protein
4393 c1 cds 4347699 4348286 + BALIOE_21935 hypothetical protein
4394 c1 cds 4348397 4349971 + BALIOE_21940 hypothetical protein
4395 c1 cds 4349971 4350915 + BALIOE_21945 hypothetical protein
4396 c1 cds 4350912 4351745 + BALIOE_21950 hypothetical protein
4397 c1 cds 4351745 4352509 + BALIOE_21955 hypothetical protein
4398 c1 cds 4352506 4353312 + BALIOE_21960 hypothetical protein
4399 c1 cds 4353318 4353719 + BALIOE_21965 hypothetical protein
4400 c1 cds 4353918 4354664 + BALIOE_21970 hypothetical protein
4401 c1 cds 4354689 4355162 + BALIOE_21975 hypothetical protein
4402 c1 cds 4355159 4355440 + BALIOE_21980 hypothetical protein
4403 c1 cds 4355517 4356875 + BALIOE_21985 hypothetical protein
4404 c1 cds 4356868 4358376 + BALIOE_21990 hypothetical protein
4405 c1 cds 4358366 4358635 + BALIOE_21995 hypothetical protein
4406 c1 cds 4358667 4359527 + BALIOE_22000 hypothetical protein
4407 c1 cds 4359577 4359936 - BALIOE_22005 hypothetical protein
4408 c1 cds 4359933 4360208 - BALIOE_22010 hypothetical protein
4409 c1 cds 4360281 4361405 - BALIOE_22015 hypothetical protein
4410 c1 cds 4361405 4364140 - BALIOE_22020 hypothetical protein
4411 c1 cds 4364137 4365204 - BALIOE_22025 hypothetical protein
4412 c1 cds 4365570 4367192 - BALIOE_22030 hypothetical protein
4413 c1 cds 4367454 4369064 - BALIOE_22035 hypothetical protein
4414 c1 cds 4369448 4370500 + BALIOE_22040 hypothetical protein
4415 c1 cds 4370527 4370682 - BALIOE_22045 hypothetical protein
4416 c1 cds 4370818 4372020 - BALIOE_22050 hypothetical protein
4417 c1 cds 4372252 4373751 + BALIOE_22055 hypothetical protein
4418 c1 cds 4373822 4374157 - BALIOE_22060 hypothetical protein
4419 c1 cds 4374548 4374982 + BALIOE_22065 hypothetical protein
4420 c1 cds 4375299 4376768 + BALIOE_22070 hypothetical protein
4421 c1 cds 4376817 4377569 - BALIOE_22075 hypothetical protein
4422 c1 cds 4377577 4379619 - BALIOE_22080 hypothetical protein
4423 c1 cds 4379822 4380664 + BALIOE_22085 hypothetical protein
4424 c1 cds 4380736 4382088 + BALIOE_22090 hypothetical protein
4425 c1 cds 4382253 4382426 + BALIOE_22095 hypothetical protein
4426 c1 cds 4382969 4383322 + BALIOE_22100 hypothetical protein
4427 c1 cds 4383376 4384665 + BALIOE_22105 hypothetical protein
4428 c1 cds 4384678 4385103 + BALIOE_22110 hypothetical protein
4429 c1 cds 4385730 4386845 + BALIOE_22115 hypothetical protein
4430 c1 cds 4387199 4387765 + BALIOE_22120 hypothetical protein
4431 c1 cds 4387921 4388451 + BALIOE_22125 hypothetical protein
4432 c1 cds 4388512 4389540 - BALIOE_22130 hypothetical protein
4433 c1 cds 4389589 4391571 - BALIOE_22135 hypothetical protein
4434 c1 cds 4392254 4393168 + BALIOE_22140 hypothetical protein
4435 c1 cds 4393188 4394525 + BALIOE_22145 hypothetical protein
4436 c1 cds 4394538 4395032 + BALIOE_22150 hypothetical protein
4437 c1 cds 4395032 4395655 + BALIOE_22155 hypothetical protein
4438 c1 cds 4395740 4396696 + BALIOE_22160 hypothetical protein
4439 c1 cds 4396693 4397463 + BALIOE_22165 hypothetical protein
4440 c1 cds 4397515 4398090 - BALIOE_22170 hypothetical protein
4441 c1 cds 4398226 4398564 - BALIOE_22175 hypothetical protein
4442 c1 cds 4398668 4399000 - BALIOE_22180 hypothetical protein
4443 c1 cds 4399255 4399827 + BALIOE_22185 hypothetical protein
4444 c1 cds 4400626 4401153 + BALIOE_22190 hypothetical protein
4445 c1 cds 4401154 4401432 - BALIOE_22195 hypothetical protein
4446 c1 cds 4401492 4402649 + BALIOE_22200 hypothetical protein
4447 c1 cds 4402674 4405787 + BALIOE_22205 hypothetical protein
4448 c1 cds 4405724 4406005 - BALIOE_22210 hypothetical protein
4449 c1 cds 4406150 4406878 - BALIOE_22215 hypothetical protein
4450 c1 cds 4407246 4408070 - BALIOE_22220 hypothetical protein
4451 c1 cds 4408441 4409841 - BALIOE_22225 hypothetical protein
4452 c1 cds 4410052 4411449 - BALIOE_22230 hypothetical protein
4453 c1 cds 4411854 4413503 + BALIOE_22235 hypothetical protein
4454 c1 cds 4413554 4414156 - BALIOE_22240 hypothetical protein
4455 c1 cds 4414604 4415575 + BALIOE_22245 hypothetical protein
4456 c1 cds 4415624 4416637 + BALIOE_22250 hypothetical protein
4457 c1 cds 4417049 4418371 + BALIOE_22255 hypothetical protein
4458 c1 cds 4418553 4420613 - BALIOE_22260 hypothetical protein
4459 c1 cds 4420683 4421450 - BALIOE_22265 hypothetical protein
4460 c1 cds 4421682 4422611 + BALIOE_22270 hypothetical protein
4461 c1 cds 4422707 4424203 - BALIOE_22275 hypothetical protein
4462 c1 cds 4424424 4425710 - BALIOE_22280 hypothetical protein
4463 c1 cds 4425893 4427842 - BALIOE_22285 hypothetical protein
4464 c1 cds 4427963 4430971 - BALIOE_22290 hypothetical protein
4465 c1 cds 4430926 4431426 - BALIOE_22295 hypothetical protein
4466 c1 cds 4431408 4432514 - BALIOE_22300 hypothetical protein
4467 c1 cds 4432521 4434842 - BALIOE_22305 hypothetical protein
4468 c1 cds 4434889 4437507 - BALIOE_22310 hypothetical protein
4469 c1 cds 4437504 4438040 - BALIOE_22315 hypothetical protein
4470 c1 cds 4438059 4438256 - BALIOE_22320 hypothetical protein
4471 c1 cds 4438268 4438456 - BALIOE_22325 hypothetical protein
4472 c1 cds 4438741 4440300 + BALIOE_22330 hypothetical protein
4473 c1 cds 4440297 4440488 + BALIOE_22335 hypothetical protein
4474 c1 cds 4440485 4442164 + BALIOE_22340 hypothetical protein
4475 c1 cds 4442251 4442358 - BALIOE_22345 hypothetical protein
4476 c1 cds 4442834 4444105 + BALIOE_22350 hypothetical protein
4477 c1 cds 4444135 4445139 - BALIOE_22355 hypothetical protein
4478 c1 cds 4445136 4446119 - BALIOE_22360 hypothetical protein
4479 c1 cds 4446130 4447032 - BALIOE_22365 hypothetical protein
4480 c1 cds 4447042 4448061 - BALIOE_22370 hypothetical protein
4481 c1 cds 4448212 4449819 - BALIOE_22375 hypothetical protein
4482 c1 ncRNA 4450389 4450470 + BALIOE_22380 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
4483 c1 tRNA 4450564 4450640 - BALIOE_22385 Pro_trna tRNA-Pro SO:0000268
4484 c1 cds 4450732 4452423 - BALIOE_22390 hypothetical protein
4485 c1 cds 4452678 4453208 - BALIOE_22395 hypothetical protein
4486 c1 cds 4453213 4454268 - BALIOE_22400 hypothetical protein
4487 c1 cds 4454283 4455740 - BALIOE_22405 hypothetical protein
4488 c1 cds 4455753 4456856 - BALIOE_22410 hypothetical protein
4489 c1 cds 4456885 4457571 - BALIOE_22415 hypothetical protein
4490 c1 cds 4457636 4458160 - BALIOE_22420 hypothetical protein
4491 c1 cds 4458504 4459706 - BALIOE_22425 hypothetical protein
4492 c1 cds 4459935 4460633 - BALIOE_22430 hypothetical protein
4493 c1 cds 4460791 4461354 + BALIOE_22435 hypothetical protein
4494 c1 cds 4461351 4461791 + BALIOE_22440 hypothetical protein
4495 c1 cds 4461760 4464093 - BALIOE_22445 hypothetical protein
4496 c1 cds 4464246 4464905 + BALIOE_22450 hypothetical protein
4497 c1 cds 4465009 4465983 + BALIOE_22455 hypothetical protein
4498 c1 cds 4466033 4466743 - BALIOE_22460 hypothetical protein
4499 c1 cds 4467177 4467467 + BALIOE_22465 hypothetical protein
4500 c1 cds 4467748 4467960 + BALIOE_22470 hypothetical protein
4501 c1 cds 4468148 4468360 - BALIOE_22475 hypothetical protein
4502 c1 cds 4468623 4470692 - BALIOE_22480 hypothetical protein
4503 c1 cds 4470702 4471613 - BALIOE_22485 hypothetical protein
4504 c1 cds 4471708 4472007 - BALIOE_22490 hypothetical protein
4505 c1 cds 4472182 4473177 + BALIOE_22495 hypothetical protein
4506 c1 cds 4473219 4473656 - BALIOE_22500 hypothetical protein
4507 c1 cds 4473702 4474043 - BALIOE_22505 hypothetical protein
4508 c1 cds 4474212 4475666 - BALIOE_22510 hypothetical protein
4509 c1 cds 4475738 4477060 - BALIOE_22515 hypothetical protein
4510 c1 cds 4477426 4478418 + BALIOE_22520 hypothetical protein
4511 c1 cds 4478496 4480037 + BALIOE_22525 hypothetical protein
4512 c1 cds 4480015 4481196 + BALIOE_22530 hypothetical protein
4513 c1 cds 4481274 4482452 + BALIOE_22535 hypothetical protein
4514 c1 cds 4482560 4483384 - BALIOE_22540 hypothetical protein
4515 c1 cds 4483704 4485734 + BALIOE_22545 hypothetical protein
4516 c1 cds 4485912 4487165 + BALIOE_22550 hypothetical protein
4517 c1 cds 4487317 4487790 - BALIOE_22555 hypothetical protein
4518 c1 cds 4488034 4488849 - BALIOE_22560 hypothetical protein
4519 c1 cds 4489075 4490475 + BALIOE_22565 hypothetical protein
4520 c1 cds 4490486 4492456 + BALIOE_22570 hypothetical protein
4521 c1 cds 4492586 4493326 - BALIOE_22575 hypothetical protein
4522 c1 cds 4493450 4494424 + BALIOE_22580 hypothetical protein
4523 c1 cds 4494421 4495557 - BALIOE_22585 hypothetical protein
4524 c1 cds 4495563 4495886 - BALIOE_22590 hypothetical protein
4525 c1 cds 4496431 4497969 - BALIOE_22595 hypothetical protein
4526 c1 cds 4498077 4499372 - BALIOE_22600 hypothetical protein
4527 c1 cds 4499502 4500653 - BALIOE_22605 hypothetical protein
4528 c1 cds 4500842 4502686 - BALIOE_22610 hypothetical protein
4529 c1 cds 4502683 4504074 - BALIOE_22615 hypothetical protein
4530 c1 cds 4504172 4504780 - BALIOE_22620 hypothetical protein
4531 c1 cds 4505009 4509238 + BALIOE_22625 hypothetical protein
4532 c1 cds 4509250 4509711 + BALIOE_22630 hypothetical protein
4533 c1 cds 4511315 4512451 - BALIOE_22635 hypothetical protein
4534 c1 cds 4512454 4512816 - BALIOE_22640 hypothetical protein
4535 c1 cds 4513353 4515266 + BALIOE_22645 hypothetical protein
4536 c1 cds 4515361 4516509 + BALIOE_22650 hypothetical protein
4537 c1 cds 4516509 4517096 + BALIOE_22655 hypothetical protein
4538 c1 cds 4517108 4517317 - BALIOE_22660 hypothetical protein
4539 c1 cds 4517602 4517964 + BALIOE_22665 hypothetical protein
4540 c1 cds 4518609 4519190 + BALIOE_22670 hypothetical protein
4541 c1 cds 4519234 4524000 + BALIOE_22675 hypothetical protein
4542 c1 cds 4524368 4526023 + BALIOE_22680 hypothetical protein
4543 c1 cds 4526023 4526799 + BALIOE_22685 hypothetical protein
4544 c1 cds 4526796 4527986 + BALIOE_22690 hypothetical protein
4545 c1 cds 4528172 4528645 + BALIOE_22695 hypothetical protein
4546 c1 cds 4528698 4529519 - BALIOE_22700 hypothetical protein
4547 c1 cds 4529599 4530618 - BALIOE_22705 hypothetical protein
4548 c1 cds 4530618 4531085 - BALIOE_22710 hypothetical protein
4549 c1 cds 4531148 4531399 - BALIOE_22715 hypothetical protein
4550 c1 cds 4531541 4531972 - BALIOE_22720 hypothetical protein
4551 c1 cds 4532217 4533761 + BALIOE_22725 hypothetical protein
4552 c1 cds 4533795 4535054 + BALIOE_22730 hypothetical protein
4553 c1 cds 4535058 4536017 + BALIOE_22735 hypothetical protein
4554 c1 cds 4536023 4537039 - BALIOE_22740 hypothetical protein
4555 c1 cds 4537278 4538303 - BALIOE_22745 hypothetical protein
4556 c1 cds 4538313 4539509 - BALIOE_22750 hypothetical protein
4557 c1 cds 4539784 4540656 - BALIOE_22755 hypothetical protein
4558 c1 cds 4540945 4541877 + BALIOE_22760 hypothetical protein
4559 c1 cds 4541887 4542933 + BALIOE_22765 hypothetical protein
4560 c1 cds 4542937 4543929 + BALIOE_22770 hypothetical protein
4561 c1 cds 4543926 4545134 + BALIOE_22775 hypothetical protein
4562 c1 cds 4545170 4546312 - BALIOE_22780 hypothetical protein
4563 c1 cds 4546321 4547334 - BALIOE_22785 hypothetical protein
4564 c1 cds 4547359 4548066 - BALIOE_22790 hypothetical protein
4565 c1 cds 4548092 4549099 - BALIOE_22795 hypothetical protein
4566 c1 cds 4549142 4549939 - BALIOE_22800 hypothetical protein
4567 c1 cds 4549932 4551056 - BALIOE_22805 hypothetical protein
4568 c1 cds 4551053 4552111 - BALIOE_22810 hypothetical protein
4569 c1 cds 4552524 4553801 + BALIOE_22815 hypothetical protein
4570 c1 cds 4553809 4554288 + BALIOE_22820 hypothetical protein
4571 c1 cds 4554327 4555136 - BALIOE_22825 hypothetical protein
4572 c1 cds 4555234 4555401 - BALIOE_22830 hypothetical protein
4573 c1 cds 4555422 4555658 - BALIOE_22835 hypothetical protein
4574 c1 cds 4555875 4556543 - BALIOE_22840 hypothetical protein
4575 c1 cds 4556715 4557935 + BALIOE_22845 hypothetical protein
4576 c1 cds 4557913 4558371 + BALIOE_22850 hypothetical protein
4577 c1 cds 4558478 4559074 + BALIOE_22855 hypothetical protein
4578 c1 cds 4559111 4559752 - BALIOE_22860 hypothetical protein
4579 c1 cds 4559818 4560534 - BALIOE_22865 hypothetical protein
4580 c1 cds 4560661 4561524 + BALIOE_22870 hypothetical protein
4581 c1 cds 4561745 4562569 + BALIOE_22875 hypothetical protein
4582 c1 cds 4562861 4563478 + BALIOE_22880 hypothetical protein
4583 c1 cds 4563475 4565157 - BALIOE_22885 hypothetical protein
4584 c1 cds 4565415 4566038 + BALIOE_22890 hypothetical protein
4585 c1 cds 4566093 4566368 + BALIOE_22895 hypothetical protein
4586 c1 cds 4566387 4568495 + BALIOE_22900 hypothetical protein
4587 c1 cds 4568535 4569191 + BALIOE_22905 hypothetical protein
4588 c1 cds 4569197 4571278 + BALIOE_22910 hypothetical protein
4589 c1 cds 4571263 4572129 - BALIOE_22915 hypothetical protein
4590 c1 cds 4572132 4573337 - BALIOE_22920 hypothetical protein
4591 c1 cds 4573617 4575008 + BALIOE_22925 hypothetical protein
4592 c1 cds 4575129 4576838 + BALIOE_22930 hypothetical protein
4593 c1 cds 4576891 4579209 - BALIOE_22935 hypothetical protein
4594 c1 cds 4579219 4580601 - BALIOE_22940 hypothetical protein
4595 c1 tRNA 4580894 4580988 + BALIOE_22945 SeC_trna tRNA-SeC SO:0005857
4596 c1 cds 4581184 4582365 + BALIOE_22950 hypothetical protein
4597 c1 cds 4582500 4582814 + BALIOE_22955 hypothetical protein
4598 c1 cds 4582934 4583680 + BALIOE_22960 hypothetical protein
4599 c1 cds 4583931 4584305 + BALIOE_22965 hypothetical protein
4600 c1 cds 4584302 4584793 + BALIOE_22970 hypothetical protein
4601 c1 cds 4584805 4585002 + BALIOE_22975 hypothetical protein
4602 c1 cds 4585087 4585428 + BALIOE_22980 hypothetical protein
4603 c1 cds 4585489 4585632 + BALIOE_22985 hypothetical protein
4604 c1 cds 4586205 4586585 + BALIOE_22990 hypothetical protein
4605 c1 cds 4586582 4586929 + BALIOE_22995 hypothetical protein
4606 c1 cds 4586979 4588517 + BALIOE_23000 hypothetical protein
4607 c1 cds 4589382 4590128 - BALIOE_23005 hypothetical protein
4608 c1 cds 4590213 4590491 - BALIOE_23010 hypothetical protein
4609 c1 cds 4590497 4590718 - BALIOE_23015 hypothetical protein
4610 c1 cds 4590754 4591161 - BALIOE_23020 hypothetical protein
4611 c1 cds 4591168 4592106 - BALIOE_23025 hypothetical protein
4612 c1 cds 4592127 4593251 - BALIOE_23030 hypothetical protein
4613 c1 cds 4593264 4593842 - BALIOE_23035 hypothetical protein
4614 c1 cds 4593901 4594956 - BALIOE_23040 hypothetical protein
4615 c1 cds 4595099 4596319 + BALIOE_23045 hypothetical protein
4616 c1 cds 4596583 4599387 - BALIOE_23050 hypothetical protein
4617 c1 cds 4599447 4599917 - BALIOE_23055 hypothetical protein
4618 c1 cds 4600055 4601731 - BALIOE_23060 hypothetical protein
4619 c1 cds 4602155 4602766 - BALIOE_23065 hypothetical protein
4620 c1 cds 4603032 4603415 + BALIOE_23070 hypothetical protein
4621 c1 cds 4603613 4604119 - BALIOE_23075 hypothetical protein
4622 c1 cds 4604150 4605067 - BALIOE_23080 hypothetical protein
4623 c1 cds 4605439 4605759 - BALIOE_23085 hypothetical protein
4624 c1 cds 4605819 4607159 - BALIOE_23090 hypothetical protein
4625 c1 cds 4607143 4609170 - BALIOE_23095 hypothetical protein
4626 c1 cds 4609167 4609520 - BALIOE_23100 hypothetical protein
4627 c1 cds 4609705 4610004 + BALIOE_23105 hypothetical protein
4628 c1 cds 4610088 4610465 + BALIOE_23110 hypothetical protein
4629 c1 cds 4610468 4611040 + BALIOE_23115 hypothetical protein
4630 c1 cds 4611046 4611501 + BALIOE_23120 hypothetical protein
4631 c1 cds 4611501 4613039 + BALIOE_23125 hypothetical protein
4632 c1 cds 4613053 4613508 + BALIOE_23130 hypothetical protein
4633 c1 cds 4613892 4614305 - BALIOE_23135 hypothetical protein
4634 c1 cds 4614360 4614731 - BALIOE_23140 hypothetical protein
4635 c1 cds 4614927 4615385 + BALIOE_23145 hypothetical protein
4636 c1 cds 4615382 4616419 - BALIOE_23150 hypothetical protein
4637 c1 cds 4616412 4617188 - BALIOE_23155 hypothetical protein
4638 c1 cds 4617188 4617457 - BALIOE_23160 hypothetical protein
4639 c1 cds 4617457 4618110 - BALIOE_23165 hypothetical protein
4640 c1 cds 4618115 4618768 - BALIOE_23170 hypothetical protein
4641 c1 cds 4618755 4619354 - BALIOE_23175 hypothetical protein
4642 c1 cds 4619351 4619665 - BALIOE_23180 hypothetical protein
4643 c1 cds 4619678 4619896 - BALIOE_23185 hypothetical protein
4644 c1 cds 4619911 4620282 - BALIOE_23190 hypothetical protein
4645 c1 cds 4621596 4622741 + BALIOE_23195 hypothetical protein
4646 c1 cds 4622869 4623687 + BALIOE_23200 hypothetical protein
4647 c1 cds 4624081 4624188 - BALIOE_23205 hypothetical protein
4648 c1 cds 4624707 4625630 + BALIOE_23210 hypothetical protein
4649 c1 cds 4625634 4626452 - BALIOE_23215 hypothetical protein
4650 c1 cds 4626674 4626967 + BALIOE_23220 hypothetical protein
4651 c1 cds 4627008 4628246 - BALIOE_23225 hypothetical protein
4652 c1 cds 4628432 4628785 + BALIOE_23230 hypothetical protein
4653 c1 cds 4628769 4629092 + BALIOE_23235 hypothetical protein
4654 c1 cds 4629208 4629660 - BALIOE_23240 hypothetical protein
4655 c1 cds 4629713 4630078 - BALIOE_23245 hypothetical protein
4656 c1 cds 4630051 4631046 - BALIOE_23250 hypothetical protein
4657 c1 cds 4631221 4632987 + BALIOE_23255 hypothetical protein
4658 c1 cds 4633033 4634424 - BALIOE_23260 hypothetical protein
4659 c1 cds 4634562 4635881 - BALIOE_23265 hypothetical protein
4660 c1 cds 4635891 4637393 - BALIOE_23270 hypothetical protein
4661 c1 cds 4637393 4637983 - BALIOE_23275 hypothetical protein
4662 c1 cds 4638145 4639248 - BALIOE_23280 hypothetical protein
4663 c1 cds 4639264 4639578 - BALIOE_23285 hypothetical protein
4664 c1 cds 4639856 4640338 - BALIOE_23290 hypothetical protein
4665 c1 cds 4640486 4641139 - BALIOE_23295 hypothetical protein
4666 c1 cds 4641402 4641692 - BALIOE_23300 hypothetical protein
4667 c1 cds 4641696 4643384 - BALIOE_23305 hypothetical protein
4668 c1 cds 4644153 4644242 + BALIOE_23310 hypothetical protein
4669 c1 cds 4644522 4645706 + BALIOE_23315 hypothetical protein
4670 c1 cds 4645714 4646211 - BALIOE_23320 hypothetical protein
4671 c1 cds 4646208 4646570 - BALIOE_23325 hypothetical protein
4672 c1 cds 4646560 4646907 - BALIOE_23330 hypothetical protein
4673 c1 cds 4647016 4647465 + BALIOE_23335 hypothetical protein
4674 c1 cds 4647512 4649005 - BALIOE_23340 hypothetical protein
4675 c1 cds 4649002 4650717 - BALIOE_23345 hypothetical protein
4676 c1 cds 4650884 4651777 + BALIOE_23350 hypothetical protein
4677 c1 cds 4651774 4653096 - BALIOE_23355 hypothetical protein
4678 c1 cds 4653096 4654712 - BALIOE_23360 hypothetical protein
4679 c1 cds 4655008 4655724 + BALIOE_23365 hypothetical protein
4680 c1 cds 4655721 4657382 - BALIOE_23370 hypothetical protein
4681 c1 cds 4657578 4658006 - BALIOE_23375 hypothetical protein
4682 c1 cds 4658118 4658531 - BALIOE_23380 hypothetical protein
4683 c1 cds 4658909 4659169 + BALIOE_23385 hypothetical protein
4684 c1 cds 4659171 4660385 - BALIOE_23390 hypothetical protein
4685 c1 cds 4660486 4661550 + BALIOE_23395 hypothetical protein
4686 c1 cds 4661796 4662452 + BALIOE_23400 hypothetical protein
4687 c1 cds 4662498 4663310 - BALIOE_23405 hypothetical protein
4688 c1 cds 4663425 4663823 - BALIOE_23410 hypothetical protein
4689 c1 cds 4664063 4666477 - BALIOE_23415 hypothetical protein
4690 c1 cds 4666506 4667579 - BALIOE_23420 hypothetical protein
4691 c1 cds 4667579 4668679 - BALIOE_23425 hypothetical protein
4692 c1 cds 4668684 4670087 - BALIOE_23430 dnaA Chromosomal replication initiator protein DnaA COG:COG0593, COG:L, GO:0003688, GO:0005524, GO:0005737, GO:0006270, GO:0006275, RefSeq:WP_000059116.1, SO:0001217, UniParc:UPI0000129520, UniRef:UniRef100_Q8XBZ3, UniRef:UniRef50_Q9KVX6, UniRef:UniRef90_Q6CYR4
4693 c1 cds 4670694 4670834 + BALIOE_23435 hypothetical protein
4694 c1 cds 4670884 4671210 + BALIOE_23440 hypothetical protein
4695 c1 cds 4671434 4673080 + BALIOE_23445 hypothetical protein
4696 c1 cds 4673186 4674550 + BALIOE_23450 hypothetical protein
4697 c1 cds 4674700 4674930 - BALIOE_23455 hypothetical protein
4698 c1 cds 4674881 4676869 - BALIOE_23460 hypothetical protein
4699 c1 cds 4677564 4678979 + BALIOE_23465 hypothetical protein
4700 c1 cds 4679070 4680317 + BALIOE_23470 hypothetical protein
4701 c1 cds 4680449 4681624 + BALIOE_23475 hypothetical protein
4702 c1 cds 4681599 4682558 + BALIOE_23480 hypothetical protein
4703 c1 cds 4682715 4683464 + BALIOE_23485 hypothetical protein
4704 c1 cds 4683486 4684052 + BALIOE_23490 hypothetical protein
4705 c1 cds 4684106 4685443 - BALIOE_23495 hypothetical protein
4706 c1 cds 4685609 4686274 + BALIOE_23500 hypothetical protein
4707 c1 cds 4686411 4688819 - BALIOE_23505 hypothetical protein
4708 c1 cds 4689120 4689791 + BALIOE_23510 hypothetical protein
4709 c1 cds 4689882 4690307 + BALIOE_23515 hypothetical protein
4710 c1 cds 4690776 4693037 - BALIOE_23520 hypothetical protein
4711 c1 cds 4693127 4693261 - BALIOE_23525 hypothetical protein
4712 c1 cds 4693686 4694411 - BALIOE_23530 hypothetical protein
4713 c1 cds 4694426 4695199 - BALIOE_23535 hypothetical protein
4714 c1 cds 4695382 4696272 - BALIOE_23540 hypothetical protein
4715 c1 cds 4696272 4697231 - BALIOE_23545 hypothetical protein
4716 c1 cds 4697318 4698358 - BALIOE_23550 hypothetical protein
4717 c1 cds 4698570 4699652 - BALIOE_23555 hypothetical protein
4718 c1 cds 4699680 4700750 - BALIOE_23560 hypothetical protein
4719 c1 cds 4700762 4703296 - BALIOE_23565 hypothetical protein
4720 c1 cds 4703620 4704003 - BALIOE_23570 hypothetical protein
4721 c1 cds 4704107 4704709 - BALIOE_23575 hypothetical protein
4722 c1 cds 4705409 4707238 - BALIOE_23580 hypothetical protein
4723 c1 cds 4707400 4708770 - BALIOE_23585 hypothetical protein
4724 c1 cds 4709122 4709541 - BALIOE_23590 hypothetical protein
4725 c1 cds 4709562 4710944 - BALIOE_23595 hypothetical protein
4726 c1 cds 4710971 4711834 - BALIOE_23600 hypothetical protein
4727 c1 cds 4711885 4713426 - BALIOE_23605 hypothetical protein
4728 c1 cds 4713439 4713972 - BALIOE_23610 hypothetical protein
4729 c1 cds 4713987 4714457 - BALIOE_23615 hypothetical protein
4730 c1 cds 4714519 4714758 - BALIOE_23620 hypothetical protein
4731 c1 cds 4714805 4715620 - BALIOE_23625 hypothetical protein
4732 c1 cds 4715629 4716009 - BALIOE_23630 hypothetical protein
4733 c1 cds 4716626 4717249 - BALIOE_23635 hypothetical protein
4734 c1 cds 4717313 4719202 - BALIOE_23640 hypothetical protein
4735 c1 cds 4719581 4720024 - BALIOE_23645 hypothetical protein
4736 c1 cds 4720114 4720572 - BALIOE_23650 hypothetical protein
4737 c1 cds 4720724 4721716 + BALIOE_23655 hypothetical protein
4738 c1 cds 4721721 4723172 - BALIOE_23660 hypothetical protein
4739 c1 cds 4723166 4724662 - BALIOE_23665 hypothetical protein
4740 c1 cds 4724885 4726753 + BALIOE_23670 hypothetical protein
4741 c1 cds 4726920 4727339 + BALIOE_23675 hypothetical protein
4742 c1 cds 4727347 4728852 + BALIOE_23680 hypothetical protein
4743 c1 cds 4728857 4729822 + BALIOE_23685 hypothetical protein
4744 c1 cds 4729847 4730737 + BALIOE_23690 hypothetical protein
4745 c1 cds 4730863 4731792 + BALIOE_23695 hypothetical protein
4746 c1 cds 4731796 4732788 + BALIOE_23700 hypothetical protein
4747 c1 cds 4732754 4734181 - BALIOE_23705 hypothetical protein
4748 c1 cds 4734204 4734896 - BALIOE_23710 hypothetical protein
4749 c1 rRNA 4735377 4736918 + BALIOE_23715 16S_rrna 16S ribosomal RNA GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
4750 c1 tRNA 4737004 4737079 + BALIOE_23720 Glu_trna tRNA-Glu SO:0000259
4751 c1 tRNA 4740442 4740518 + BALIOE_23725 Asp_trna tRNA-Asp SO:0000256
4752 c1 tRNA 4740527 4740602 + BALIOE_23730 Trp_trna tRNA-Trp SO:0000271
4753 c1 cds 4740698 4741537 - BALIOE_23735 hypothetical protein
4754 c1 cds 4741656 4741994 + BALIOE_23740 hypothetical protein
4755 c1 cds 4742019 4743539 - BALIOE_23745 hypothetical protein
4756 c1 cds 4743694 4743783 + BALIOE_23750 hypothetical protein
4757 c1 cds 4744130 4745776 + BALIOE_23755 hypothetical protein
4758 c1 cds 4745773 4746036 + BALIOE_23760 hypothetical protein
4759 c1 cds 4746056 4746985 + BALIOE_23765 hypothetical protein
4760 c1 cds 4747050 4748900 + BALIOE_23770 hypothetical protein
4761 c1 cds 4748903 4750447 + BALIOE_23775 hypothetical protein
4762 c1 cds 4750499 4751392 - BALIOE_23780 hypothetical protein
4763 c1 cds 4751542 4753017 + BALIOE_23785 hypothetical protein
4764 c1 cds 4753063 4753344 - BALIOE_23790 hypothetical protein
4765 c1 cds 4753543 4753992 - BALIOE_23795 hypothetical protein
4766 c1 cds 4754209 4756230 + BALIOE_23800 hypothetical protein
4767 c1 cds 4756277 4757761 - BALIOE_23805 hypothetical protein
4768 c1 cds 4757897 4759162 - BALIOE_23810 hypothetical protein
4769 c1 cds 4759293 4759622 + BALIOE_23815 hypothetical protein
4770 c1 cds 4759949 4761208 + BALIOE_23820 hypothetical protein
4771 c1 cds 4761218 4761436 + BALIOE_23825 hypothetical protein
4772 c1 cds 4761448 4762551 + BALIOE_23830 hypothetical protein
4773 c1 cds 4762563 4763609 + BALIOE_23835 hypothetical protein
4774 c1 cds 4763665 4764795 + BALIOE_23840 hypothetical protein
4775 c1 cds 4764792 4766054 + BALIOE_23845 hypothetical protein
4776 c1 cds 4766054 4767121 + BALIOE_23850 hypothetical protein
4777 c1 cds 4767140 4768021 + BALIOE_23855 hypothetical protein
4778 c1 cds 4767999 4768673 + BALIOE_23860 hypothetical protein
4779 c1 cds 4768678 4769808 + BALIOE_23865 hypothetical protein
4780 c1 cds 4769810 4771060 + BALIOE_23870 hypothetical protein
4781 c1 cds 4771057 4772136 + BALIOE_23875 hypothetical protein
4782 c1 cds 4772133 4773485 + BALIOE_23880 hypothetical protein
4783 c1 cds 4773488 4774228 + BALIOE_23885 hypothetical protein
4784 c1 cds 4774419 4775804 + BALIOE_23890 hypothetical protein
4785 c1 tRNA 4775907 4775983 + BALIOE_23895 Arg_trna tRNA-Arg SO:0001036
4786 c1 tRNA 4776042 4776117 + BALIOE_23900 His_trna tRNA-His SO:0000262
4787 c1 tRNA 4776138 4776224 + BALIOE_23905 Leu_trna tRNA-Leu SO:0000264
4788 c1 tRNA 4776273 4776343 + BALIOE_23910 Pro_trna (pseudo) tRNA-Pro SO:0000268
4789 c1 tRNA 4776364 4776450 + BALIOE_23915 Leu_trna tRNA-Leu SO:0000264
4790 c1 tRNA 4776493 4776569 + BALIOE_23920 Pro_trna tRNA-Pro SO:0000268
4791 c1 cds 4776716 4777951 + BALIOE_23925 hypothetical protein
4792 c1 cds 4778119 4779774 - BALIOE_23930 hypothetical protein
4793 c1 cds 4780453 4781649 - BALIOE_23935 hypothetical protein
4794 c1 cds 4781652 4782851 - BALIOE_23940 hypothetical protein
4795 c1 cds 4782873 4783613 - BALIOE_23945 hypothetical protein
4796 c1 cds 4783610 4784572 - BALIOE_23950 hypothetical protein
4797 c1 cds 4784938 4787484 + BALIOE_23955 hypothetical protein
4798 c1 cds 4787524 4787844 - BALIOE_23960 hypothetical protein
4799 c1 cds 4788307 4788510 + BALIOE_23965 hypothetical protein
4800 c1 cds 4788547 4789371 + BALIOE_23970 hypothetical protein
4801 c1 cds 4789368 4790075 + BALIOE_23975 hypothetical protein
4802 c1 cds 4790072 4790968 + BALIOE_23980 hypothetical protein
4803 c1 cds 4790968 4791684 + BALIOE_23985 hypothetical protein
4804 c1 cds 4791768 4793930 + BALIOE_23990 hypothetical protein
4805 c1 cds 4793975 4794877 - BALIOE_23995 hypothetical protein
4806 c1 cds 4794960 4795724 - BALIOE_24000 hypothetical protein
4807 c1 cds 4796094 4797044 + BALIOE_24005 hypothetical protein
4808 c1 cds 4797086 4797577 - BALIOE_24010 hypothetical protein
4809 c1 cds 4797574 4798422 - BALIOE_24015 hypothetical protein
4810 c1 cds 4799382 4799681 + BALIOE_24020 hypothetical protein
4811 c1 cds 4799728 4800615 - BALIOE_24025 hypothetical protein
4812 c1 cds 4800667 4801134 - BALIOE_24030 hypothetical protein
4813 c1 cds 4801299 4802168 + BALIOE_24035 hypothetical protein
4814 c1 cds 4802295 4804130 + BALIOE_24040 hypothetical protein
4815 c1 cds 4804194 4804814 + BALIOE_24045 hypothetical protein
4816 c1 cds 4804876 4805496 - BALIOE_24050 hypothetical protein
4817 c1 cds 4805607 4806629 + BALIOE_24055 hypothetical protein
4818 c1 cds 4806637 4807437 + BALIOE_24060 hypothetical protein
4819 c1 cds 4807513 4808412 + BALIOE_24065 hypothetical protein
4820 c1 cds 4808300 4809253 - BALIOE_24070 hypothetical protein
4821 c1 cds 4809489 4811750 + BALIOE_24075 hypothetical protein
4822 c1 cds 4811790 4812605 - BALIOE_24080 hypothetical protein
4823 c1 cds 4812867 4813628 + BALIOE_24085 hypothetical protein
4824 c1 cds 4813769 4815196 + BALIOE_24090 hypothetical protein
4825 c1 cds 4815291 4816046 + BALIOE_24095 hypothetical protein
4826 c1 cds 4816060 4816665 + BALIOE_24100 hypothetical protein
4827 c1 cds 4816662 4818302 + BALIOE_24105 hypothetical protein
4828 c1 cds 4818381 4818650 + BALIOE_24110 hypothetical protein
4829 c1 cds 4818654 4819169 + BALIOE_24115 hypothetical protein
4830 c1 cds 4819172 4819948 + BALIOE_24120 hypothetical protein
4831 c1 cds 4819990 4820772 + BALIOE_24125 hypothetical protein
4832 c1 cds 4820769 4821257 - BALIOE_24130 hypothetical protein
4833 c1 cds 4821424 4822917 + BALIOE_24135 hypothetical protein
4834 c1 cds 4822963 4823664 + BALIOE_24140 hypothetical protein
4835 c1 cds 4823856 4825019 - BALIOE_24145 hypothetical protein
4836 c1 cds 4825029 4827218 - BALIOE_24150 hypothetical protein
4837 c1 cds 4827408 4828739 + BALIOE_24155 hypothetical protein
4838 c1 cds 4828739 4829353 + BALIOE_24160 hypothetical protein
4839 c1 cds 4829392 4830843 + BALIOE_24165 hypothetical protein
4840 c1 cds 4830855 4831400 + BALIOE_24170 hypothetical protein
4841 c1 rRNA 4831781 4833322 + BALIOE_24175 16S_rrna 16S ribosomal RNA GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
4842 c1 tRNA 4833391 4833467 + BALIOE_24180 Ile_trna tRNA-Ile SO:0000263
4843 c1 tRNA 4833510 4833585 + BALIOE_24185 Ala_trna tRNA-Ala SO:0000254
4844 c1 cds 4836985 4837512 - BALIOE_24190 hypothetical protein
4845 c1 cds 4837494 4838078 - BALIOE_24195 hypothetical protein
4846 c1 cds 4838148 4838417 + BALIOE_24200 hypothetical protein
4847 c1 cds 4838494 4839480 + BALIOE_24205 hypothetical protein
4848 c1 cds 4839497 4840123 + BALIOE_24210 hypothetical protein
4849 c1 cds 4840278 4841708 + BALIOE_24215 hypothetical protein
4850 c1 cds 4841749 4842681 - BALIOE_24220 hypothetical protein
4851 c1 cds 4842801 4842986 - BALIOE_24225 hypothetical protein
4852 c1 cds 4843045 4845831 + BALIOE_24230 hypothetical protein
4853 c1 cds 4846213 4846845 - BALIOE_24235 hypothetical protein
4854 c1 cds 4847427 4847933 + BALIOE_24240 hypothetical protein
4855 c1 cds 4848122 4849495 + BALIOE_24245 hypothetical protein
4856 c1 cds 4849685 4849795 - BALIOE_24250 hypothetical protein
4857 c1 cds 4849907 4851316 - BALIOE_24255 hypothetical protein
4858 c1 cds 4851328 4852377 - BALIOE_24260 hypothetical protein
4859 c1 cds 4852551 4853960 - BALIOE_24265 hypothetical protein
4860 c1 cds 4854333 4856156 + BALIOE_24270 hypothetical protein
4861 c1 cds 4856373 4857083 + BALIOE_24275 hypothetical protein
4862 c1 cds 4857091 4858071 + BALIOE_24280 hypothetical protein
4863 c1 cds 4858173 4859438 + BALIOE_24285 hypothetical protein
4864 c1 cds 4859529 4860287 - BALIOE_24290 hypothetical protein
4865 c1 cds 4860288 4861691 - BALIOE_24295 hypothetical protein
4866 c1 cds 4861734 4863119 - BALIOE_24300 hypothetical protein
4867 c1 cds 4863165 4865201 - BALIOE_24305 hypothetical protein
4868 c1 cds 4865309 4866184 - BALIOE_24310 hypothetical protein
4869 c1 cds 4866245 4867147 - BALIOE_24315 hypothetical protein
4870 c1 cds 4867214 4868455 - BALIOE_24320 hypothetical protein
4871 c1 cds 4868471 4869349 - BALIOE_24325 hypothetical protein
4872 c1 cds 4869373 4870269 - BALIOE_24330 hypothetical protein
4873 c1 cds 4870437 4871333 + BALIOE_24335 hypothetical protein
4874 c1 cds 4871367 4872152 + BALIOE_24340 hypothetical protein
4875 c1 cds 4872251 4872850 + BALIOE_24345 hypothetical protein
4876 c1 cds 4872844 4873716 + BALIOE_24350 hypothetical protein
4877 c1 cds 4873713 4874150 + BALIOE_24355 hypothetical protein
4878 c1 cds 4874195 4875136 + BALIOE_24360 hypothetical protein
4879 c1 cds 4875547 4876440 + BALIOE_24365 hypothetical protein
4880 c1 cds 4876447 4877361 + BALIOE_24370 hypothetical protein
4881 c1 cds 4878055 4878273 + BALIOE_24375 hypothetical protein
4882 c1 cds 4878490 4878732 + BALIOE_24380 hypothetical protein
4883 c1 cds 4878732 4878914 + BALIOE_24385 hypothetical protein
4884 c1 cds 4879062 4879991 - BALIOE_24390 hypothetical protein
4885 c1 cds 4879988 4880623 - BALIOE_24395 hypothetical protein
4886 c1 cds 4880620 4881522 - BALIOE_24400 hypothetical protein
4887 c1 cds 4881535 4883949 - BALIOE_24405 hypothetical protein
4888 c1 cds 4883998 4884585 - BALIOE_24410 hypothetical protein
4889 c1 cds 4884779 4885612 + BALIOE_24415 hypothetical protein
4890 c1 cds 4885765 4886820 + BALIOE_24420 hypothetical protein
4891 c1 cds 4886870 4888618 - BALIOE_24425 hypothetical protein
4892 c1 cds 4888618 4889688 - BALIOE_24430 hypothetical protein
4893 c1 cds 4889678 4891117 - BALIOE_24435 hypothetical protein
4894 c1 cds 4891128 4891574 - BALIOE_24440 hypothetical protein
4895 c1 cds 4892052 4893446 + BALIOE_24445 hypothetical protein
4896 c1 cds 4893487 4893801 - BALIOE_24450 hypothetical protein
4897 c1 cds 4893811 4894635 - BALIOE_24455 hypothetical protein
4898 c1 ncRNA 4894682 4894752 + BALIOE_24460 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
4899 c1 cds 4894810 4896069 - BALIOE_24465 hypothetical protein
4900 c1 cds 4896066 4897535 - BALIOE_24470 hypothetical protein
4901 c1 cds 4897823 4898659 + BALIOE_24475 hypothetical protein
4902 c1 cds 4898643 4899581 + BALIOE_24480 hypothetical protein
4903 c1 cds 4899578 4900369 - BALIOE_24485 hypothetical protein
4904 c1 cds 4900460 4900612 - BALIOE_24490 hypothetical protein
4905 c1 cds 4900897 4901517 + BALIOE_24495 hypothetical protein
4906 c1 cds 4901777 4902760 + BALIOE_24500 hypothetical protein
4907 c1 cds 4902909 4903583 + BALIOE_24505 hypothetical protein
4908 c1 ncRNA 4903597 4903674 - BALIOE_24510 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
4909 c1 cds 4903689 4905062 - BALIOE_24515 hypothetical protein
4910 c1 cds 4905059 4905757 - BALIOE_24520 hypothetical protein
4911 c1 cds 4905907 4906407 + BALIOE_24525 hypothetical protein
4912 c1 cds 4906556 4907458 + BALIOE_24530 hypothetical protein
4913 c1 cds 4907404 4907508 - BALIOE_24535 hypothetical protein
4914 c1 cds 4907639 4908601 + BALIOE_24540 hypothetical protein
4915 c1 cds 4908920 4909909 + BALIOE_24545 hypothetical protein
4916 c1 cds 4910016 4910771 + BALIOE_24550 hypothetical protein
4917 c1 cds 4910826 4911593 - BALIOE_24555 hypothetical protein
4918 c1 cds 4911701 4912300 - BALIOE_24560 hypothetical protein
4919 c1 cds 4912401 4912841 + BALIOE_24565 hypothetical protein
4920 c1 cds 4913053 4913352 + BALIOE_24570 hypothetical protein
4921 c1 cds 4913379 4913807 + BALIOE_24575 hypothetical protein
4922 c1 cds 4913812 4914558 - BALIOE_24580 hypothetical protein
4923 c1 cds 4914655 4915665 - BALIOE_24585 hypothetical protein
4924 c1 cds 4915895 4917403 - BALIOE_24590 hypothetical protein
4925 c1 cds 4917426 4918271 - BALIOE_24595 hypothetical protein
4926 c1 cds 4918703 4918942 + BALIOE_24600 hypothetical protein
4927 c1 cds 4918981 4919607 - BALIOE_24605 hypothetical protein
4928 c1 cds 4919730 4920404 - BALIOE_24610 hypothetical protein
4929 c1 cds 4920464 4920949 - BALIOE_24615 hypothetical protein
4930 c1 cds 4921042 4921968 - BALIOE_24620 hypothetical protein
4931 c1 cds 4922035 4923366 - BALIOE_24625 hypothetical protein
4932 c1 cds 4923376 4923906 - BALIOE_24630 hypothetical protein
4933 c1 cds 4923999 4924853 - BALIOE_24635 hypothetical protein
4934 c1 cds 4925050 4926075 - BALIOE_24640 hypothetical protein
4935 c1 cds 4926231 4928429 - BALIOE_24645 hypothetical protein
4936 c1 cds 4928632 4928844 + BALIOE_24650 hypothetical protein
4937 c1 cds 4929004 4933188 + BALIOE_24655 hypothetical protein
4938 c1 cds 4933190 4933426 + BALIOE_24660 hypothetical protein
4939 c1 cds 4933479 4933757 + BALIOE_24665 hypothetical protein
4940 c1 cds 4934002 4934274 - BALIOE_24670 hypothetical protein
4941 c1 cds 4934419 4935027 - BALIOE_24675 hypothetical protein
4942 c1 cds 4935087 4935404 - BALIOE_24680 hypothetical protein
4943 c1 cds 4935681 4936841 + BALIOE_24685 hypothetical protein
4944 c1 cds 4936844 4939276 + BALIOE_24690 hypothetical protein
4945 c1 cds 4939625 4940515 + BALIOE_24695 hypothetical protein
4946 c1 cds 4940844 4943024 + BALIOE_24700 hypothetical protein
4947 c1 cds 4943118 4944023 + BALIOE_24705 hypothetical protein
4948 c1 cds 4944050 4944667 - BALIOE_24710 hypothetical protein
4949 c1 cds 4944941 4946044 - BALIOE_24715 hypothetical protein
4950 c1 cds 4946055 4946717 - BALIOE_24720 hypothetical protein
4951 c1 cds 4946729 4949230 - BALIOE_24725 hypothetical protein
4952 c1 cds 4949539 4950279 + BALIOE_24730 hypothetical protein
4953 c1 cds 4950301 4950618 + BALIOE_24735 hypothetical protein
4954 c1 cds 4950633 4950953 + BALIOE_24740 hypothetical protein
4955 c1 cds 4951004 4953301 + BALIOE_24745 hypothetical protein
4956 c1 cds 4953267 4954145 + BALIOE_24750 hypothetical protein
4957 c1 cds 4954147 4954488 + BALIOE_24755 hypothetical protein
4958 c1 cds 4954475 4955326 - BALIOE_24760 hypothetical protein
4959 c1 cds 4955541 4957274 - BALIOE_24765 hypothetical protein
4960 c1 cds 4957457 4960108 - BALIOE_24770 hypothetical protein
4961 c1 cds 4960460 4961611 - BALIOE_24775 hypothetical protein
4962 c1 cds 4961765 4962769 + BALIOE_24780 hypothetical protein
4963 c1 cds 4962780 4963553 + BALIOE_24785 hypothetical protein
4964 c1 cds 4963614 4964987 + BALIOE_24790 hypothetical protein
4965 c1 cds 4965254 4966171 + BALIOE_24795 hypothetical protein
4966 c1 cds 4966154 4967554 - BALIOE_24800 hypothetical protein
4967 c1 cds 4967884 4969050 + BALIOE_24805 hypothetical protein
4968 c1 cds 4969093 4970409 + BALIOE_24810 hypothetical protein
4969 c1 cds 4970459 4971163 + BALIOE_24815 hypothetical protein
4970 c1 cds 4971163 4971522 + BALIOE_24820 hypothetical protein
4971 c1 cds 4971562 4972662 - BALIOE_24825 hypothetical protein
4972 c1 cds 4973031 4974875 + BALIOE_24830 hypothetical protein
4973 c1 cds 4974820 4975677 + BALIOE_24835 hypothetical protein
4974 c1 rRNA 4976054 4977595 + BALIOE_24840 16S_rrna 16S ribosomal RNA GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
4975 c1 tRNA 4977681 4977756 + BALIOE_24845 Glu_trna tRNA-Glu SO:0000259
4976 c1 cds 4981201 4982229 + BALIOE_24850 hypothetical protein
4977 c1 cds 4982226 4983191 + BALIOE_24855 hypothetical protein
4978 c1 cds 4983220 4984146 - BALIOE_24860 hypothetical protein
4979 c1 tRNA 4984532 4984607 + BALIOE_24865 Thr_trna tRNA-Thr SO:0000270
4980 c1 tRNA 4984616 4984700 + BALIOE_24870 Tyr_trna tRNA-Tyr SO:0000272
4981 c1 tRNA 4984817 4984891 + BALIOE_24875 Gly_trna tRNA-Gly SO:0000260
4982 c1 tRNA 4984898 4984973 + BALIOE_24880 Thr_trna tRNA-Thr SO:0000270
4983 c1 cds 4985088 4986272 + BALIOE_24885 hypothetical protein
4984 c1 cds 4986502 4986885 + BALIOE_24890 hypothetical protein
4985 c1 cds 4986887 4987432 + BALIOE_24895 hypothetical protein
4986 c1 cds 4987591 4988019 + BALIOE_24900 hypothetical protein
4987 c1 cds 4988023 4988727 + BALIOE_24905 hypothetical protein
4988 c1 cds 4989019 4989516 + BALIOE_24910 hypothetical protein
4989 c1 cds 4989583 4989948 + BALIOE_24915 hypothetical protein
4990 c1 cds 4990268 4994296 + BALIOE_24920 hypothetical protein
4991 c1 cds 4994373 4998596 + BALIOE_24925 hypothetical protein
4992 c1 cds 4998809 4999252 + BALIOE_24930 hypothetical protein
4993 c1 cds 4999687 5000820 - BALIOE_24935 hypothetical protein
4994 c1 cds 5000817 5001587 - BALIOE_24940 hypothetical protein
4995 c1 cds 5001589 5001789 - BALIOE_24945 hypothetical protein
4996 c1 cds 5001773 5002528 - BALIOE_24950 hypothetical protein
4997 c1 cds 5002521 5003156 - BALIOE_24955 hypothetical protein
4998 c1 cds 5003156 5005051 - BALIOE_24960 hypothetical protein
4999 c1 cds 5005284 5005760 - BALIOE_24965 hypothetical protein
5000 c1 cds 5005855 5006628 + BALIOE_24970 hypothetical protein
5001 c1 cds 5006668 5007732 + BALIOE_24975 hypothetical protein
5002 c1 cds 5007742 5008413 + BALIOE_24980 hypothetical protein
5003 c1 cds 5008456 5009046 + BALIOE_24985 hypothetical protein
5004 c1 cds 5009233 5009505 + BALIOE_24990 hypothetical protein
5005 c1 cds 5009578 5010213 + BALIOE_24995 hypothetical protein
5006 c1 cds 5010215 5010640 - BALIOE_25000 hypothetical protein
5007 c1 cds 5010643 5010771 - BALIOE_25005 hypothetical protein
5008 c1 cds 5010878 5012254 + BALIOE_25010 hypothetical protein
5009 c1 cds 5012251 5013576 + BALIOE_25015 hypothetical protein
5010 c1 cds 5013573 5014862 - BALIOE_25020 hypothetical protein
5011 c1 cds 5014874 5016463 - BALIOE_25025 hypothetical protein
5012 c1 rRNA 5017080 5018621 + BALIOE_25030 16S_rrna 16S ribosomal RNA GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
5013 c1 tRNA 5018707 5018782 + BALIOE_25035 Glu_trna tRNA-Glu SO:0000259
5014 c1 cds 5022207 5022650 - BALIOE_25040 hypothetical protein
5015 c1 cds 5022807 5023736 + BALIOE_25045 hypothetical protein
5016 c1 cds 5024005 5025606 + BALIOE_25050 hypothetical protein
5017 c1 cds 5025636 5026940 + BALIOE_25055 hypothetical protein
5018 c1 ncRNA 5026967 5027044 + BALIOE_25060 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5019 c1 cds 5027124 5028860 + BALIOE_25065 hypothetical protein
5020 c1 cds 5028829 5031015 - BALIOE_25070 hypothetical protein
5021 c1 cds 5031332 5032156 - BALIOE_25075 hypothetical protein
5022 c1 cds 5032356 5036039 + BALIOE_25080 hypothetical protein
5023 c1 cds 5036259 5037890 + BALIOE_25085 hypothetical protein
5024 c1 cds 5037981 5038670 - BALIOE_25090 hypothetical protein
5025 c1 cds 5039053 5040282 - BALIOE_25095 hypothetical protein
5026 c1 cds 5040334 5040987 - BALIOE_25100 hypothetical protein
5027 c1 cds 5041220 5041750 - BALIOE_25105 hypothetical protein
5028 c1 cds 5042191 5044281 + BALIOE_25110 hypothetical protein
5029 c1 cds 5044352 5045284 + BALIOE_25115 hypothetical protein
5030 c1 cds 5045287 5045508 + BALIOE_25120 hypothetical protein
5031 c1 cds 5045521 5045775 + BALIOE_25125 hypothetical protein
5032 c1 cds 5045777 5046058 + BALIOE_25130 hypothetical protein
5033 c1 cds 5046055 5046327 + BALIOE_25135 hypothetical protein
5034 c1 cds 5046332 5046625 + BALIOE_25140 hypothetical protein
5035 c1 cds 5046637 5047167 + BALIOE_25145 hypothetical protein
5036 c1 cds 5047265 5047807 + BALIOE_25150 hypothetical protein
5037 c1 cds 5047811 5048344 + BALIOE_25155 hypothetical protein
5038 c1 cds 5048344 5048859 + BALIOE_25160 hypothetical protein
5039 c1 cds 5048863 5049414 + BALIOE_25165 hypothetical protein
5040 c1 cds 5049411 5049596 + BALIOE_25170 hypothetical protein
5041 c1 cds 5049635 5049967 + BALIOE_25175 hypothetical protein
5042 c1 cds 5049960 5050157 + BALIOE_25180 hypothetical protein
5043 c1 cds 5050147 5050443 + BALIOE_25185 hypothetical protein
5044 c1 cds 5050440 5050949 + BALIOE_25190 hypothetical protein
5045 c1 cds 5051019 5051444 + BALIOE_25195 hypothetical protein
5046 c1 cds 5051516 5052016 + BALIOE_25200 hypothetical protein
5047 c1 cds 5051979 5052479 + BALIOE_25205 hypothetical protein
5048 c1 cds 5052691 5052918 + BALIOE_25210 hypothetical protein
5049 c1 cds 5052899 5053207 + BALIOE_25215 hypothetical protein
5050 c1 cds 5053204 5053494 + BALIOE_25220 hypothetical protein
5051 c1 cds 5053497 5054078 + BALIOE_25225 hypothetical protein
5052 c1 cds 5054078 5055742 + BALIOE_25230 hypothetical protein
5053 c1 cds 5055742 5057331 + BALIOE_25235 hypothetical protein
5054 c1 tRNA 5058640 5058720 - BALIOE_25240 tRNA-Xxx
5055 c1 cds 5058759 5059232 + BALIOE_25245 hypothetical protein
5056 c1 cds 5059409 5060533 + BALIOE_25250 hypothetical protein
5057 c1 cds 5060533 5061480 + BALIOE_25255 hypothetical protein
5058 c1 cds 5061524 5061910 + BALIOE_25260 hypothetical protein
5059 c1 cds 5061907 5062326 + BALIOE_25265 hypothetical protein
5060 c1 cds 5062323 5062883 + BALIOE_25270 hypothetical protein
5061 c1 cds 5062884 5063129 + BALIOE_25275 hypothetical protein
5062 c1 cds 5063126 5064628 + BALIOE_25280 hypothetical protein
5063 c1 cds 5064637 5065002 + BALIOE_25285 hypothetical protein
5064 c1 cds 5065017 5065493 + BALIOE_25290 hypothetical protein
5065 c1 cds 5065620 5067695 + BALIOE_25295 hypothetical protein
5066 c1 cds 5067682 5069031 + BALIOE_25300 hypothetical protein
5067 c1 cds 5069015 5070139 + BALIOE_25305 hypothetical protein
5068 c1 cds 5070129 5070743 + BALIOE_25310 hypothetical protein
5069 c1 cds 5070736 5071173 + BALIOE_25315 hypothetical protein
5070 c1 cds 5071173 5072255 + BALIOE_25320 hypothetical protein
5071 c1 cds 5072246 5072806 + BALIOE_25325 hypothetical protein
5072 c1 cds 5072806 5073717 + BALIOE_25330 hypothetical protein
5073 c1 cds 5073752 5074273 - BALIOE_25335 hypothetical protein
5074 c1 cds 5074778 5075338 + BALIOE_25340 hypothetical protein
5075 c1 cds 5075438 5077477 + BALIOE_25345 hypothetical protein
5076 c1 cds 5077624 5077806 + BALIOE_25350 hypothetical protein
5077 c1 cds 5077842 5078087 + BALIOE_25355 hypothetical protein
5078 c1 cds 5078126 5078590 - BALIOE_25360 hypothetical protein
5079 c1 cds 5078859 5079596 + BALIOE_25365 hypothetical protein
5080 c1 cds 5079720 5079917 - BALIOE_25370 hypothetical protein
5081 c1 cds 5079928 5080725 - BALIOE_25375 hypothetical protein
5082 c1 cds 5080791 5081285 - BALIOE_25380 hypothetical protein
5083 c1 cds 5081285 5081692 - BALIOE_25385 hypothetical protein
5084 c1 cds 5081702 5082508 - BALIOE_25390 hypothetical protein
5085 c1 cds 5082578 5083525 - BALIOE_25395 hypothetical protein
5086 c1 cds 5083873 5084745 + BALIOE_25400 hypothetical protein
5087 c1 cds 5084746 5085018 - BALIOE_25405 hypothetical protein
5088 c1 cds 5085271 5086620 - BALIOE_25410 hypothetical protein
5089 c1 cds 5087145 5088794 + BALIOE_25415 hypothetical protein
5090 c1 ncRNA 5088824 5088895 + BALIOE_25420 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5091 c1 cds 5089307 5089549 + BALIOE_25425 hypothetical protein
5092 c1 cds 5089663 5090301 + BALIOE_25430 hypothetical protein
5093 c1 cds 5090298 5091035 + BALIOE_25435 hypothetical protein
5094 c1 cds 5091035 5093131 + BALIOE_25440 hypothetical protein
5095 c1 cds 5093726 5094136 + BALIOE_25445 hypothetical protein
5096 c1 cds 5094180 5095655 - BALIOE_25450 hypothetical protein
5097 c1 cds 5096027 5096917 - BALIOE_25455 hypothetical protein
5098 c1 cds 5096932 5098476 - BALIOE_25460 hypothetical protein
5099 c1 ncRNA 5098496 5098566 + BALIOE_25465 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5100 c1 cds 5098630 5099820 - BALIOE_25470 hypothetical protein
5101 c1 cds 5100185 5101300 + BALIOE_25475 hypothetical protein
5102 c1 cds 5101372 5102712 + BALIOE_25480 hypothetical protein
5103 c1 cds 5102863 5103783 + BALIOE_25485 hypothetical protein
5104 c1 cds 5104012 5105592 + BALIOE_25490 hypothetical protein
5105 c1 cds 5105815 5106312 + BALIOE_25495 hypothetical protein
5106 c1 cds 5106325 5107197 + BALIOE_25500 hypothetical protein
5107 c1 cds 5107352 5109775 - BALIOE_25505 hypothetical protein
5108 c1 cds 5109946 5110314 + BALIOE_25510 hypothetical protein
5109 c1 cds 5110424 5111032 + BALIOE_25515 hypothetical protein
5110 c1 cds 5111105 5112430 + BALIOE_25520 hypothetical protein
5111 c1 cds 5112546 5112755 + BALIOE_25525 hypothetical protein
5112 c1 cds 5112797 5113312 - BALIOE_25530 hypothetical protein
5113 c1 cds 5113631 5114527 + BALIOE_25535 hypothetical protein
5114 c1 cds 5114950 5115987 + BALIOE_25540 hypothetical protein
5115 c1 cds 5116121 5116363 + BALIOE_25545 hypothetical protein
5116 c1 cds 5116529 5117512 - BALIOE_25550 hypothetical protein
5117 c1 cds 5117595 5119010 + BALIOE_25555 hypothetical protein
5118 c1 cds 5119063 5120142 + BALIOE_25560 hypothetical protein
5119 c1 cds 5120395 5121588 + BALIOE_25565 hypothetical protein
5120 c1 cds 5121927 5122286 - BALIOE_25570 hypothetical protein
5121 c1 cds 5122687 5123400 + BALIOE_25575 hypothetical protein
5122 c1 cds 5123511 5123927 + BALIOE_25580 hypothetical protein
5123 c1 cds 5123931 5124287 + BALIOE_25585 hypothetical protein
5124 c1 cds 5124322 5127144 - BALIOE_25590 hypothetical protein
5125 c1 cds 5127399 5127935 + BALIOE_25595 hypothetical protein
5126 c1 cds 5128034 5128315 - BALIOE_25600 hypothetical protein
5127 c1 cds 5128744 5130330 + BALIOE_25605 hypothetical protein
5128 c1 cds 5130333 5130656 - BALIOE_25610 hypothetical protein
5129 c1 cds 5130742 5131206 + BALIOE_25615 hypothetical protein
5130 c1 cds 5131752 5133101 + BALIOE_25620 hypothetical protein
5131 c1 cds 5133252 5134901 + BALIOE_25625 hypothetical protein
5132 c1 cds 5135055 5136347 - BALIOE_25630 hypothetical protein
5133 c1 cds 5136528 5138177 - BALIOE_25635 hypothetical protein
5134 c1 cds 5138174 5138488 - BALIOE_25640 hypothetical protein
5135 c1 ncRNA 5138580 5138651 + BALIOE_25645 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5136 c1 cds 5138689 5140647 - BALIOE_25650 hypothetical protein
5137 c1 cds 5141040 5142476 + BALIOE_25655 hypothetical protein
5138 c1 cds 5142521 5143087 + BALIOE_25660 hypothetical protein
5139 c1 cds 5143084 5143755 + BALIOE_25665 hypothetical protein
5140 c1 cds 5143752 5144708 + BALIOE_25670 hypothetical protein
5141 c1 cds 5144824 5146446 + BALIOE_25675 hypothetical protein
5142 c1 cds 5146439 5146822 + BALIOE_25680 hypothetical protein
5143 c1 cds 5146819 5147415 + BALIOE_25685 hypothetical protein
5144 c1 cds 5147757 5149070 + BALIOE_25690 hypothetical protein
5145 c1 ncRNA 5149173 5149243 + BALIOE_25695 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5146 c1 cds 5149248 5149937 - BALIOE_25700 hypothetical protein
5147 c1 cds 5150031 5151710 - BALIOE_25705 hypothetical protein
5148 c1 cds 5151759 5152178 - BALIOE_25710 hypothetical protein
5149 c1 cds 5152376 5153842 - BALIOE_25715 hypothetical protein
5150 c1 cds 5153839 5155890 - BALIOE_25720 hypothetical protein
5151 c1 cds 5155890 5156921 - BALIOE_25725 hypothetical protein
5152 c1 cds 5156940 5157215 - BALIOE_25730 hypothetical protein
5153 c1 cds 5157424 5159409 - BALIOE_25735 hypothetical protein
5154 c1 cds 5159700 5160407 + BALIOE_25740 hypothetical protein
5155 c1 cds 5160404 5161405 - BALIOE_25745 hypothetical protein
5156 c1 cds 5161402 5162262 - BALIOE_25750 hypothetical protein
5157 c1 cds 5162277 5162960 - BALIOE_25755 hypothetical protein
5158 c1 cds 5163015 5163956 - BALIOE_25760 hypothetical protein
5159 c1 cds 5163975 5164949 - BALIOE_25765 hypothetical protein
5160 c1 cds 5164946 5166466 - BALIOE_25770 hypothetical protein
5161 c1 cds 5166580 5168850 + BALIOE_25775 hypothetical protein
5162 c1 cds 5168919 5169248 + BALIOE_25780 hypothetical protein
5163 c1 cds 5169325 5170083 - BALIOE_25785 hypothetical protein
5164 c1 cds 5170085 5170510 - BALIOE_25790 hypothetical protein
5165 c1 cds 5170507 5171064 - BALIOE_25795 hypothetical protein
5166 c1 cds 5171064 5172200 - BALIOE_25800 hypothetical protein
5167 c1 cds 5172197 5172877 - BALIOE_25805 hypothetical protein
5168 c1 cds 5172988 5173746 - BALIOE_25810 hypothetical protein
5169 c1 cds 5173743 5174588 - BALIOE_25815 hypothetical protein
5170 c1 cds 5174581 5175645 - BALIOE_25820 hypothetical protein
5171 c1 cds 5175645 5176229 - BALIOE_25825 hypothetical protein
5172 c1 cds 5176226 5176678 - BALIOE_25830 hypothetical protein
5173 c1 cds 5176679 5177404 - BALIOE_25835 hypothetical protein
5174 c1 cds 5177425 5178204 - BALIOE_25840 hypothetical protein
5175 c1 ncRNA 5178223 5178303 + BALIOE_25845 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5176 c1 cds 5178310 5179326 - BALIOE_25850 hypothetical protein
5177 c1 cds 5179351 5180139 - BALIOE_25855 hypothetical protein
5178 c1 cds 5180272 5180715 - BALIOE_25860 hypothetical protein
5179 c1 ncRNA 5180780 5180856 - BALIOE_25865 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5180 c1 ncRNA 5180880 5180956 - BALIOE_25870 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5181 c1 cds 5180974 5181309 - BALIOE_25875 hypothetical protein
5182 c1 cds 5181711 5183939 + BALIOE_25880 hypothetical protein
5183 c1 cds 5183936 5184814 + BALIOE_25885 hypothetical protein
5184 c1 cds 5185078 5186580 + BALIOE_25890 hypothetical protein
5185 c1 cds 5186692 5186781 + BALIOE_25895 hypothetical protein
5186 c1 cds 5186757 5187857 - BALIOE_25900 hypothetical protein
5187 c1 cds 5187858 5188526 - BALIOE_25905 hypothetical protein
5188 c1 cds 5188523 5190166 - BALIOE_25910 hypothetical protein
5189 c1 cds 5190270 5191607 - BALIOE_25915 hypothetical protein
5190 c1 cds 5191744 5192505 - BALIOE_25920 hypothetical protein
5191 c1 cds 5192830 5195100 - BALIOE_25925 hypothetical protein
5192 c1 cds 5195296 5196204 - BALIOE_25930 hypothetical protein
5193 c1 cds 5196487 5197842 + BALIOE_25935 hypothetical protein
5194 c1 cds 5197957 5199366 + BALIOE_25940 hypothetical protein
5195 c1 cds 5199505 5200134 - BALIOE_25945 hypothetical protein
5196 c1 cds 5200257 5201903 - BALIOE_25950 hypothetical protein
5197 c1 cds 5201981 5203321 - BALIOE_25955 hypothetical protein
5198 c1 cds 5203892 5204611 - BALIOE_25960 hypothetical protein
5199 c1 cds 5204608 5206239 - BALIOE_25965 hypothetical protein
5200 c1 cds 5206420 5206650 + BALIOE_25970 hypothetical protein
5201 c1 cds 5206662 5206934 + BALIOE_25975 hypothetical protein
5202 c1 cds 5207161 5207457 + BALIOE_25980 hypothetical protein
5203 c1 cds 5207485 5207658 + BALIOE_25985 hypothetical protein
5204 c1 cds 5207777 5209294 - BALIOE_25990 hypothetical protein
5205 c1 cds 5209531 5210988 - BALIOE_25995 hypothetical protein
5206 c1 cds 5211047 5213194 - BALIOE_26000 hypothetical protein
5207 c1 cds 5213274 5214608 - BALIOE_26005 hypothetical protein
5208 c1 cds 5214974 5216512 - BALIOE_26010 hypothetical protein
5209 c1 tRNA 5217129 5217204 - BALIOE_26015 Phe_trna tRNA-Phe SO:0000267
5210 c1 cds 5217311 5217886 - BALIOE_26020 hypothetical protein
5211 c1 cds 5217923 5219620 - BALIOE_26025 hypothetical protein
5212 c1 cds 5219596 5219934 - BALIOE_26030 hypothetical protein
5213 c1 cds 5220050 5221351 - BALIOE_26035 hypothetical protein
5214 c1 cds 5221469 5222905 - BALIOE_26040 hypothetical protein
5215 c1 cds 5223242 5223718 + BALIOE_26045 hypothetical protein
5216 c1 cds 5223734 5224990 - BALIOE_26050 hypothetical protein
5217 c1 cds 5225266 5225559 + BALIOE_26055 hypothetical protein
5218 c1 cds 5225603 5227249 + BALIOE_26060 hypothetical protein
5219 c1 cds 5227387 5227740 + BALIOE_26065 hypothetical protein
5220 c1 cds 5227933 5228802 - BALIOE_26070 hypothetical protein
5221 c1 cds 5229037 5230065 - BALIOE_26075 hypothetical protein
5222 c1 cds 5230107 5230673 + BALIOE_26080 hypothetical protein
5223 c1 cds 5230725 5230850 + BALIOE_26085 hypothetical protein
5224 c1 cds 5230961 5231107 + BALIOE_26090 hypothetical protein
5225 c1 cds 5231283 5231600 + BALIOE_26095 hypothetical protein
5226 c1 cds 5231597 5232130 - BALIOE_26100 hypothetical protein
5227 c1 cds 5232218 5233351 - BALIOE_26105 hypothetical protein
5228 c1 cds 5233414 5233773 - BALIOE_26110 hypothetical protein
5229 c1 cds 5233784 5234179 - BALIOE_26115 hypothetical protein
5230 c1 cds 5234190 5234924 - BALIOE_26120 hypothetical protein
5231 c1 cds 5234917 5236725 - BALIOE_26125 hypothetical protein
5232 c1 cds 5237050 5238027 + BALIOE_26130 hypothetical protein
5233 c1 cds 5238291 5239748 + BALIOE_26135 hypothetical protein
5234 c1 cds 5239899 5243222 - BALIOE_26140 hypothetical protein
5235 c1 cds 5243244 5244212 - BALIOE_26145 hypothetical protein
5236 c1 cds 5244309 5245361 - BALIOE_26150 hypothetical protein
5237 c1 cds 5245456 5246001 + BALIOE_26155 hypothetical protein
5238 c1 tRNA 5246212 5246287 + BALIOE_26160 Gly_trna tRNA-Gly SO:0000260
5239 c1 tRNA 5246324 5246399 + BALIOE_26165 Gly_trna tRNA-Gly SO:0000260
5240 c1 tRNA 5246435 5246510 + BALIOE_26170 Gly_trna tRNA-Gly SO:0000260
5241 c1 cds 5246780 5247919 - BALIOE_26175 hypothetical protein
5242 c1 cds 5247933 5249465 + BALIOE_26180 hypothetical protein
5243 c1 cds 5249437 5249898 + BALIOE_26185 hypothetical protein
5244 c1 cds 5249917 5251254 + BALIOE_26190 hypothetical protein
5245 c1 cds 5251264 5253111 + BALIOE_26195 hypothetical protein
5246 c1 cds 5253104 5254054 + BALIOE_26200 hypothetical protein
5247 c1 cds 5254140 5254448 + BALIOE_26205 hypothetical protein
5248 c1 cds 5254525 5255805 + BALIOE_26210 hypothetical protein
5249 c1 cds 5255891 5257150 + BALIOE_26215 hypothetical protein
5250 c1 cds 5257153 5258157 + BALIOE_26220 hypothetical protein
5251 c1 cds 5258239 5258436 + BALIOE_26225 hypothetical protein
5252 c1 cds 5258540 5259838 + BALIOE_26230 hypothetical protein
5253 c1 cds 5260043 5260468 + BALIOE_26235 hypothetical protein
5254 c1 cds 5260507 5262948 + BALIOE_26240 hypothetical protein
5255 c1 cds 5263129 5263860 + BALIOE_26245 hypothetical protein
5256 c1 cds 5263987 5264388 + BALIOE_26250 hypothetical protein
5257 c1 cds 5264407 5265105 + BALIOE_26255 hypothetical protein
5258 c1 cds 5265156 5265815 + BALIOE_26260 hypothetical protein
5259 c1 cds 5265833 5266231 + BALIOE_26265 hypothetical protein
5260 c1 cds 5266241 5266879 + BALIOE_26270 hypothetical protein
5261 c1 cds 5266882 5268045 + BALIOE_26275 hypothetical protein
5262 c1 cds 5268129 5269754 + BALIOE_26280 hypothetical protein
5263 c1 cds 5269871 5270146 - BALIOE_26285 hypothetical protein
5264 c1 cds 5270295 5270624 - BALIOE_26290 hypothetical protein
5265 c1 cds 5270806 5271555 + BALIOE_26295 hypothetical protein
5266 c1 cds 5271552 5272307 - BALIOE_26300 hypothetical protein
5267 c1 cds 5272415 5273479 - BALIOE_26305 hypothetical protein
5268 c1 cds 5273834 5275231 + BALIOE_26310 hypothetical protein
5269 c1 cds 5275247 5275552 + BALIOE_26315 hypothetical protein
5270 c1 cds 5275562 5276026 + BALIOE_26320 hypothetical protein
5271 c1 cds 5276040 5276690 + BALIOE_26325 hypothetical protein
5272 c1 cds 5276700 5277554 + BALIOE_26330 hypothetical protein
5273 c1 cds 5277554 5278240 + BALIOE_26335 hypothetical protein
5274 c1 cds 5278369 5278644 - BALIOE_26340 hypothetical protein
5275 c1 cds 5278971 5279366 + BALIOE_26345 hypothetical protein
5276 c1 cds 5279373 5279687 + BALIOE_26350 hypothetical protein
5277 c1 cds 5279692 5279919 + BALIOE_26355 hypothetical protein
5278 c1 cds 5279961 5280410 + BALIOE_26360 hypothetical protein
5279 c1 cds 5280481 5281038 - BALIOE_26365 hypothetical protein
5280 c1 cds 5281898 5282329 - BALIOE_26370 hypothetical protein
5281 c1 cds 5282397 5283545 + BALIOE_26375 hypothetical protein
5282 c1 cds 5283680 5284318 - BALIOE_26380 hypothetical protein
5283 c1 cds 5284536 5285156 + BALIOE_26385 hypothetical protein
5284 c1 cds 5285465 5286877 + BALIOE_26390 hypothetical protein
5285 c1 cds 5286922 5287584 - BALIOE_26395 hypothetical protein
5286 c1 cds 5287692 5288657 - BALIOE_26400 hypothetical protein
5287 c1 cds 5288765 5289625 - BALIOE_26405 hypothetical protein
5288 c1 cds 5289714 5290094 + BALIOE_26410 hypothetical protein
5289 c1 cds 5290212 5292155 - BALIOE_26415 hypothetical protein
5290 c1 cds 5292345 5293085 + BALIOE_26420 hypothetical protein
5291 c1 cds 5293297 5294235 + BALIOE_26425 hypothetical protein
5292 c1 cds 5294298 5294852 - BALIOE_26430 hypothetical protein
5293 c1 cds 5295177 5295383 + BALIOE_26435 hypothetical protein
5294 c1 cds 5295479 5296822 - BALIOE_26440 hypothetical protein
5295 c1 cds 5297145 5297783 - BALIOE_26445 hypothetical protein
5296 c1 cds 5297989 5299722 + BALIOE_26450 hypothetical protein
5297 c1 cds 5299719 5303498 + BALIOE_26455 hypothetical protein
5298 c1 cds 5303501 5303842 + BALIOE_26460 hypothetical protein
5299 c1 cds 5304054 5304305 + BALIOE_26465 hypothetical protein
5300 c1 cds 5304335 5304649 + BALIOE_26470 hypothetical protein
5301 c1 cds 5304729 5305259 - BALIOE_26475 hypothetical protein
5302 c1 cds 5305569 5306525 + BALIOE_26480 hypothetical protein
5303 c1 ncRNA 5306554 5306632 + BALIOE_26485 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5304 c1 cds 5306665 5308167 + BALIOE_26490 hypothetical protein
5305 c1 cds 5308181 5309203 + BALIOE_26495 hypothetical protein
5306 c1 cds 5309190 5310185 + BALIOE_26500 hypothetical protein
5307 c1 cds 5310218 5311216 - BALIOE_26505 hypothetical protein
5308 c1 cds 5311392 5312765 + BALIOE_26510 hypothetical protein
5309 c1 ncRNA 5312795 5312872 + BALIOE_26515 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5310 c1 cds 5312921 5313472 - BALIOE_26520 hypothetical protein
5311 c1 cds 5313566 5314918 + BALIOE_26525 hypothetical protein
5312 c1 cds 5315102 5315488 + BALIOE_26530 hypothetical protein
5313 c1 cds 5315533 5315997 - BALIOE_26535 hypothetical protein
5314 c1 ncRNA 5316101 5316171 + BALIOE_26540 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5315 c1 cds 5316187 5318325 - BALIOE_26545 hypothetical protein
5316 c1 cds 5318719 5320374 - BALIOE_26550 hypothetical protein
5317 c1 cds 5320424 5321845 - BALIOE_26555 hypothetical protein
5318 c1 cds 5321964 5322911 - BALIOE_26560 hypothetical protein
5319 c1 cds 5323290 5325986 + BALIOE_26565 hypothetical protein
5320 c1 cds 5326192 5326578 - BALIOE_26570 hypothetical protein
5321 c1 cds 5326651 5327112 - BALIOE_26575 hypothetical protein
5322 c1 cds 5327125 5328060 - BALIOE_26580 hypothetical protein
5323 c1 cds 5328479 5328874 - BALIOE_26585 hypothetical protein
5324 c1 cds 5329005 5329718 - BALIOE_26590 hypothetical protein
5325 c1 cds 5329789 5330382 + BALIOE_26595 hypothetical protein
5326 c1 cds 5330527 5330979 + BALIOE_26600 hypothetical protein
5327 c1 cds 5331102 5332874 + BALIOE_26605 hypothetical protein
5328 c1 cds 5332931 5333935 - BALIOE_26610 hypothetical protein
5329 c1 cds 5334097 5334513 + BALIOE_26615 hypothetical protein
5330 c1 cds 5334559 5335062 - BALIOE_26620 hypothetical protein
5331 c1 cds 5335255 5336451 + BALIOE_26625 hypothetical protein
5332 c1 cds 5336506 5339361 - BALIOE_26630 hypothetical protein
5333 c1 cds 5339361 5339804 - BALIOE_26635 hypothetical protein
5334 c1 ncRNA 5339912 5339987 + BALIOE_26640 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5335 c1 ncRNA 5340008 5340083 + BALIOE_26645 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5336 c1 cds 5340158 5341669 - BALIOE_26650 hypothetical protein
5337 c1 cds 5341936 5343036 + BALIOE_26655 hypothetical protein
5338 c1 cds 5343036 5344118 + BALIOE_26660 hypothetical protein
5339 c1 cds 5344279 5345781 - BALIOE_26665 hypothetical protein
5340 c1 cds 5345911 5346930 - BALIOE_26670 hypothetical protein
5341 c1 tRNA 5347126 5347210 + BALIOE_26675 Leu_trna tRNA-Leu SO:0000264
5342 c1 cds 5347301 5349250 + BALIOE_26680 hypothetical protein
5343 c1 cds 5349450 5349776 + BALIOE_26685 hypothetical protein
5344 c1 cds 5349776 5350663 + BALIOE_26690 hypothetical protein
5345 c1 cds 5350846 5351223 - BALIOE_26695 hypothetical protein
5346 c1 cds 5351345 5351677 - BALIOE_26700 hypothetical protein
5347 c1 cds 5352681 5353148 - BALIOE_26705 hypothetical protein
5348 c1 cds 5353341 5353910 + BALIOE_26710 hypothetical protein
5349 c1 cds 5354109 5355425 - BALIOE_26715 hypothetical protein
5350 c1 cds 5355577 5356350 - BALIOE_26720 hypothetical protein
5351 c1 cds 5356473 5356931 + BALIOE_26725 hypothetical protein
5352 c1 cds 5357647 5358474 + BALIOE_26730 hypothetical protein
5353 c1 cds 5358934 5359785 - BALIOE_26735 hypothetical protein
5354 c1 cds 5359772 5360080 - BALIOE_26740 hypothetical protein
5355 c1 cds 5360326 5361429 - BALIOE_26745 hypothetical protein
5356 c1 cds 5361433 5362140 - BALIOE_26750 hypothetical protein
5357 c1 cds 5362147 5363799 - BALIOE_26755 hypothetical protein
5358 c1 cds 5364011 5367370 + BALIOE_26760 hypothetical protein
5359 c1 cds 5367370 5373684 + BALIOE_26765 hypothetical protein
5360 c1 cds 5373908 5376766 + BALIOE_26770 hypothetical protein
5361 c1 cds 5376769 5381703 + BALIOE_26775 hypothetical protein
5362 c1 cds 5381703 5388044 + BALIOE_26780 hypothetical protein
5363 c1 cds 5388041 5390155 + BALIOE_26785 hypothetical protein
5364 c1 cds 5391108 5391353 - BALIOE_26790 hypothetical protein
5365 c1 cds 5391649 5392629 - BALIOE_26795 hypothetical protein
5366 c1 cds 5392694 5393800 - BALIOE_26800 hypothetical protein
5367 c1 cds 5393820 5394536 - BALIOE_26805 hypothetical protein
5368 c1 cds 5395992 5396594 + BALIOE_26810 hypothetical protein
5369 c1 cds 5397072 5397668 + BALIOE_26815 hypothetical protein
5370 c1 cds 5398133 5398681 + BALIOE_26820 hypothetical protein
5371 c1 cds 5398788 5399285 + BALIOE_26825 hypothetical protein
5372 c1 cds 5399322 5400047 + BALIOE_26830 hypothetical protein
5373 c1 cds 5400114 5402750 + BALIOE_26835 hypothetical protein
5374 c1 cds 5402760 5403290 + BALIOE_26840 hypothetical protein
5375 c1 cds 5403303 5403806 + BALIOE_26845 hypothetical protein
5376 c1 cds 5403826 5404728 + BALIOE_26850 hypothetical protein
5377 c1 cds 5404902 5406245 - BALIOE_26855 hypothetical protein
5378 c1 cds 5406585 5407769 + BALIOE_26860 hypothetical protein
5379 c1 cds 5407850 5409310 + BALIOE_26865 hypothetical protein
5380 c1 cds 5409332 5409526 - BALIOE_26870 hypothetical protein
5381 c1 cds 5409573 5410298 + BALIOE_26875 hypothetical protein
5382 c1 cds 5410439 5411269 - BALIOE_26880 hypothetical protein
5383 c1 cds 5411523 5411624 + BALIOE_26885 hypothetical protein
5384 c1 cds 5411942 5412334 + BALIOE_26890 hypothetical protein
5385 c1 cds 5412327 5413055 - BALIOE_26895 hypothetical protein
5386 c1 cds 5413303 5414475 - BALIOE_26900 hypothetical protein
5387 c1 cds 5414488 5414949 - BALIOE_26905 hypothetical protein
5388 c1 cds 5414946 5415629 - BALIOE_26910 hypothetical protein
5389 c1 cds 5415770 5416255 - BALIOE_26915 hypothetical protein
5390 c1 cds 5416586 5421688 - BALIOE_26920 hypothetical protein
5391 c1 cds 5422038 5423216 - BALIOE_26925 hypothetical protein
5392 c1 cds 5423284 5424126 - BALIOE_26930 hypothetical protein
5393 c1 cds 5424392 5426599 - BALIOE_26935 hypothetical protein
5394 c1 cds 5426911 5427177 - BALIOE_26940 hypothetical protein
5395 c1 cds 5427174 5427941 - BALIOE_26945 hypothetical protein
5396 c1 cds 5427951 5429102 - BALIOE_26950 hypothetical protein
5397 c1 cds 5429218 5430489 - BALIOE_26955 hypothetical protein
5398 c1 cds 5430530 5431762 - BALIOE_26960 hypothetical protein
5399 c1 cds 5432229 5433011 + BALIOE_26965 hypothetical protein
5400 c1 cds 5432986 5433186 + BALIOE_26970 hypothetical protein
5401 c1 cds 5433429 5434841 - BALIOE_26975 hypothetical protein
5402 c1 cds 5435018 5435182 + BALIOE_26980 hypothetical protein
5403 c1 cds 5435279 5436160 + BALIOE_26985 hypothetical protein
5404 c1 cds 5436208 5437371 + BALIOE_26990 hypothetical protein
5405 c1 cds 5437418 5437759 - BALIOE_26995 hypothetical protein
5406 c1 cds 5437980 5439734 - BALIOE_27000 hypothetical protein
5407 c1 cds 5439734 5441203 - BALIOE_27005 hypothetical protein
5408 c1 cds 5441270 5443702 - BALIOE_27010 hypothetical protein
5409 c1 cds 5443980 5444264 + BALIOE_27015 hypothetical protein
5410 c1 cds 5444273 5445631 + BALIOE_27020 hypothetical protein
5411 c1 cds 5445700 5446656 - BALIOE_27025 hypothetical protein
5412 c1 cds 5446667 5446870 - BALIOE_27030 hypothetical protein
5413 c1 cds 5446920 5449070 - BALIOE_27035 hypothetical protein
5414 c1 cds 5449363 5449905 - BALIOE_27040 hypothetical protein
5415 c1 cds 5450134 5451798 + BALIOE_27045 hypothetical protein
5416 c1 cds 5451847 5453208 - BALIOE_27050 hypothetical protein
5417 c1 cds 5453423 5454337 - BALIOE_27055 hypothetical protein
5418 c1 cds 5454476 5455498 + BALIOE_27060 hypothetical protein
5419 c1 cds 5455635 5457926 - BALIOE_27065 hypothetical protein
5420 c1 cds 5458180 5458674 - BALIOE_27070 hypothetical protein
5421 c1 cds 5458723 5459460 - BALIOE_27075 hypothetical protein
5422 c1 cds 5459463 5460002 - BALIOE_27080 hypothetical protein
5423 c1 cds 5460109 5460582 - BALIOE_27085 hypothetical protein
5424 c1 cds 5460573 5461343 - BALIOE_27090 hypothetical protein
5425 c1 cds 5461964 5462689 + BALIOE_27095 hypothetical protein
5426 c1 cds 5462647 5463324 + BALIOE_27100 hypothetical protein
5427 c1 cds 5463362 5464150 - BALIOE_27105 hypothetical protein
5428 c1 cds 5464291 5464527 + BALIOE_27110 hypothetical protein
5429 c1 tRNA 5464566 5464652 - BALIOE_27115 Leu_trna tRNA-Leu SO:0000264
5430 c1 cds 5464842 5465873 - BALIOE_27120 hypothetical protein
5431 c1 cds 5465976 5466389 + BALIOE_27125 hypothetical protein
5432 c1 cds 5466358 5466804 + BALIOE_27130 hypothetical protein
5433 c1 cds 5466819 5467496 + BALIOE_27135 hypothetical protein
5434 c1 cds 5467587 5469176 + BALIOE_27140 hypothetical protein
5435 c1 cds 5469569 5470174 + BALIOE_27145 hypothetical protein
5436 c1 cds 5470301 5470462 + BALIOE_27150 hypothetical protein
5437 c1 cds 5470584 5471657 + BALIOE_27155 hypothetical protein
5438 c1 cds 5471654 5472436 + BALIOE_27160 hypothetical protein
5439 c1 ncRNA 5472533 5472611 + BALIOE_27165 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5440 c1 ncRNA 5472533 5472611 - BALIOE_27170 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5441 c1 cds 5472650 5473513 - BALIOE_27175 hypothetical protein
5442 c1 cds 5473485 5473730 - BALIOE_27180 hypothetical protein
5443 c1 cds 5473766 5475034 - BALIOE_27185 hypothetical protein
5444 c1 cds 5475292 5476071 + BALIOE_27190 hypothetical protein
5445 c1 cds 5476198 5477520 + BALIOE_27195 hypothetical protein
5446 c1 cds 5477572 5478795 + BALIOE_27200 hypothetical protein
5447 c1 cds 5478852 5479571 + BALIOE_27205 hypothetical protein
5448 c1 cds 5479732 5479995 - BALIOE_27210 hypothetical protein
5449 c1 cds 5480027 5481715 - BALIOE_27215 hypothetical protein
5450 c1 cds 5481821 5482789 + BALIOE_27220 hypothetical protein
5451 c1 cds 5482838 5484220 + BALIOE_27225 hypothetical protein
5452 c1 cds 5484241 5485473 + BALIOE_27230 hypothetical protein
5453 c1 cds 5485507 5485674 + BALIOE_27235 hypothetical protein
5454 c1 ncRNA 5485624 5485702 + BALIOE_27240 naRNA4 Nucleoid-associated noncoding RNA 4 (CssrE) RFAM:RF02564, SO:0000655
5455 c1 cds 5485781 5487448 - BALIOE_27245 hypothetical protein
5456 c1 cds 5487659 5489596 + BALIOE_27250 hypothetical protein
5457 c1 cds 5489716 5490012 + BALIOE_27255 hypothetical protein
5458 c1 cds 5490159 5490671 - BALIOE_27260 hypothetical protein
5459 c1 cds 5490723 5491370 + BALIOE_27265 hypothetical protein
5460 c1 cds 5491367 5492236 - BALIOE_27270 hypothetical protein
5461 c1 cds 5492447 5492920 + BALIOE_27275 hypothetical protein
5462 c1 cds 5492933 5493622 + BALIOE_27280 hypothetical protein
5463 c1 cds 5493622 5495046 + BALIOE_27285 hypothetical protein
5464 c1 cds 5495104 5496456 + BALIOE_27290 hypothetical protein
5465 c1 cds 5496516 5497232 - BALIOE_27295 hypothetical protein
5466 c1 cds 5497868 5498554 + BALIOE_27300 hypothetical protein
5467 p2 cds 1 141 - BALIOE_27305 hypothetical protein
5468 p2 cds 413 736 + BALIOE_27310 hypothetical protein
5469 p2 cds 971 1351 - BALIOE_27315 hypothetical protein
5470 p2 cds 1348 2388 - BALIOE_27320 mock1 mock hypothetical user protein 1 EC:0.0.0.0, USERDB:MOCK1