view test-data/TEST_4/TEST_4.tsv @ 0:4d315de96666 draft

"planemo upload for repository https://github.com/mesocentre-clermont-auvergne/galaxy-tools/tree/master/tools/bakta commit bf30715c881a622947d3d099d7a22e323e2ceef3-dirty"
author pimarin
date Wed, 18 May 2022 11:13:45 +0000
parents
children ca9e2125c5de
line wrap: on
line source

#Annotated with Bakta (v1.4.0): https://github.com/oschwengers/bakta
#Database (v3.0): https://doi.org/10.5281/zenodo.4247252
#Sequence Id	Type	Start	Stop	Strand	Locus Tag	Gene	Product	DbXrefs
c1	cds	3	98	+	BALIOE_00005		hypothetical protein	
c1	ncRNA-region	215	328	+			Threonine operon leader	RFAM:RF00506, SO:0000140
c1	cds	354	2816	+	BALIOE_00010		hypothetical protein	
c1	cds	2818	3750	+	BALIOE_00015		hypothetical protein	
c1	cds	3751	5037	+	BALIOE_00020		hypothetical protein	
c1	cds	5251	5547	+	BALIOE_00025		hypothetical protein	
c1	cds	5700	6476	-	BALIOE_00030		hypothetical protein	
c1	cds	6546	7976	-	BALIOE_00035		hypothetical protein	
c1	cds	8255	9208	+	BALIOE_00040		hypothetical protein	
c1	cds	9323	9910	+	BALIOE_00045		hypothetical protein	
c1	cds	9945	10511	-	BALIOE_00050		hypothetical protein	
c1	cds	10660	11373	-	BALIOE_00055		hypothetical protein	
c1	cds	11399	11803	-	BALIOE_00060		hypothetical protein	
c1	cds	12180	14096	+	BALIOE_00065		hypothetical protein	
c1	cds	14185	15315	+	BALIOE_00070		hypothetical protein	
c1	cds	15419	15628	-	BALIOE_00075		hypothetical protein	
c1	cds	16157	17323	+	BALIOE_00080		hypothetical protein	
c1	cds	17389	18288	+	BALIOE_00085		hypothetical protein	
c1	cds	18326	18751	-	BALIOE_00090		hypothetical protein	
c1	cds	18960	19286	-	BALIOE_00095		hypothetical protein	
c1	cds	19299	21749	-	BALIOE_00100		hypothetical protein	
c1	cds	21762	22445	-	BALIOE_00105		hypothetical protein	
c1	cds	22495	23028	-	BALIOE_00110		hypothetical protein	
c1	cds	23330	24751	-	BALIOE_00115		hypothetical protein	
c1	cds	25221	25484	-	BALIOE_00120		hypothetical protein	
c1	cds	25819	26760	+	BALIOE_00125		hypothetical protein	
c1	cds	26803	29619	+	BALIOE_00130		hypothetical protein	
c1	cds	29619	30113	+	BALIOE_00135		hypothetical protein	
c1	cds	30201	30650	+	BALIOE_00140		hypothetical protein	
c1	cds	30652	31602	+	BALIOE_00145		hypothetical protein	
c1	cds	31668	32582	+	BALIOE_00150		hypothetical protein	
c1	cds	32749	33570	+	BALIOE_00155		hypothetical protein	
c1	cds	34026	35174	+	BALIOE_00160		hypothetical protein	
c1	cds	35192	38413	+	BALIOE_00165		hypothetical protein	
c1	cds	38421	38639	-	BALIOE_00170		hypothetical protein	
c1	cds	38674	39069	+	BALIOE_00175		hypothetical protein	
c1	cds	39188	39778	-	BALIOE_00180		hypothetical protein	
c1	cds	39784	40569	-	BALIOE_00185		hypothetical protein	
c1	cds	40678	42231	-	BALIOE_00190		hypothetical protein	
c1	cds	42305	43522	-	BALIOE_00195		hypothetical protein	
c1	cds	43651	44793	-	BALIOE_00200		hypothetical protein	
c1	cds	44824	46338	-	BALIOE_00205		hypothetical protein	
c1	crispr	46595	46726	?			CRISPR array with 3 repeats of length 17, consensus sequence TTTTCAATATTGGTGAT and spacer length 41	SO:0001459
c1	cds	46817	47587	+	BALIOE_00210		hypothetical protein	
c1	cds	47602	48543	+	BALIOE_00215		hypothetical protein	
c1	cds	48594	49880	+	BALIOE_00220		hypothetical protein	
c1	cds	49877	50164	+	BALIOE_00225		hypothetical protein	
c1	cds	50222	51553	+	BALIOE_00230		hypothetical protein	
c1	cds	51661	52191	+	BALIOE_00235		hypothetical protein	
c1	cds	52184	54046	+	BALIOE_00240		hypothetical protein	
c1	cds	54127	54717	+	BALIOE_00245		hypothetical protein	
c1	cds	54803	55036	+	BALIOE_00250		hypothetical protein	
c1	cds	55039	55353	+	BALIOE_00255		hypothetical protein	
c1	cds	55350	56198	-	BALIOE_00260		hypothetical protein	
c1	cds	56205	56582	-	BALIOE_00265		hypothetical protein	
c1	cds	56585	57406	-	BALIOE_00270		hypothetical protein	
c1	cds	57403	58392	-	BALIOE_00275		hypothetical protein	
c1	cds	58392	59678	-	BALIOE_00280		hypothetical protein	
c1	cds	59731	62085	-	BALIOE_00285		hypothetical protein	
c1	cds	62340	63155	+	BALIOE_00290		hypothetical protein	
c1	cds	63450	64202	+	BALIOE_00295		hypothetical protein	
c1	cds	64620	65279	-	BALIOE_00300		hypothetical protein	
c1	cds	65291	68197	-	BALIOE_00305		hypothetical protein	
c1	cds	68361	70712	-	BALIOE_00310		hypothetical protein	
c1	cds	70787	71482	-	BALIOE_00315		hypothetical protein	
c1	cds	71682	73184	-	BALIOE_00320		hypothetical protein	
c1	cds	73195	74895	-	BALIOE_00325		hypothetical protein	
c1	cds	75234	76112	+	BALIOE_00330		hypothetical protein	
c1	cds	76198	76962	+	BALIOE_00335		hypothetical protein	
c1	cds	77049	77747	-	BALIOE_00340		hypothetical protein	
c1	cds	77731	79341	-	BALIOE_00345		hypothetical protein	
c1	cds	79317	80300	-	BALIOE_00350		hypothetical protein	
c1	cds	80672	81241	+	BALIOE_00355		hypothetical protein	
c1	cds	81207	81314	+	BALIOE_00360		hypothetical protein	
c1	cds	81470	83128	-	BALIOE_00365		hypothetical protein	
c1	cds	83456	84061	-	BALIOE_00370		hypothetical protein	
c1	cds	84072	85472	-	BALIOE_00375		hypothetical protein	
c1	cds	85475	86566	-	BALIOE_00380		hypothetical protein	
c1	cds	86566	88137	-	BALIOE_00385		hypothetical protein	
c1	cds	88974	89918	+	BALIOE_00390		hypothetical protein	
c1	cds	90236	91960	+	BALIOE_00395		hypothetical protein	
c1	cds	91963	92454	+	BALIOE_00400		hypothetical protein	
c1	cds	92634	93638	+	BALIOE_00405		hypothetical protein	
c1	cds	94240	94698	+	BALIOE_00410		hypothetical protein	
c1	cds	94700	95641	+	BALIOE_00415		hypothetical protein	
c1	cds	95638	96003	+	BALIOE_00420		hypothetical protein	
c1	cds	96019	97785	+	BALIOE_00425		hypothetical protein	
c1	cds	97772	99259	+	BALIOE_00430		hypothetical protein	
c1	cds	99256	100614	+	BALIOE_00435		hypothetical protein	
c1	cds	100608	101690	+	BALIOE_00440		hypothetical protein	
c1	cds	101693	103009	+	BALIOE_00445		hypothetical protein	
c1	cds	103009	104253	+	BALIOE_00450		hypothetical protein	
c1	cds	104250	105317	+	BALIOE_00455		hypothetical protein	
c1	cds	105371	106846	+	BALIOE_00460		hypothetical protein	
c1	cds	106839	107759	+	BALIOE_00465		hypothetical protein	
c1	cds	107761	108591	+	BALIOE_00470		hypothetical protein	
c1	cds	108588	109850	+	BALIOE_00475		hypothetical protein	
c1	cds	109911	111062	+	BALIOE_00480		hypothetical protein	
c1	cds	111163	112080	+	BALIOE_00485		hypothetical protein	
c1	cds	112236	112823	+	BALIOE_00490		hypothetical protein	
c1	cds	112885	115590	+	BALIOE_00495		hypothetical protein	
c1	cds	115650	116048	+	BALIOE_00500		hypothetical protein	
c1	ncRNA	116039	116116	+	BALIOE_00505	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	116139	116336	-	BALIOE_00510		hypothetical protein	
c1	cds	116346	117089	-	BALIOE_00515		hypothetical protein	
c1	cds	117089	117709	-	BALIOE_00520		hypothetical protein	
c1	cds	117934	118977	+	BALIOE_00525		hypothetical protein	
c1	cds	119012	120214	-	BALIOE_00530		hypothetical protein	
c1	cds	120204	121589	-	BALIOE_00535		hypothetical protein	
c1	cds	121599	122039	-	BALIOE_00540		hypothetical protein	
c1	cds	122242	123135	-	BALIOE_00545		hypothetical protein	
c1	cds	123223	123774	+	BALIOE_00550		hypothetical protein	
c1	cds	123771	124625	+	BALIOE_00555		hypothetical protein	
c1	cds	124668	126038	-	BALIOE_00560		hypothetical protein	
c1	cds	126582	127346	+	BALIOE_00565		hypothetical protein	
c1	cds	127507	130170	+	BALIOE_00570		hypothetical protein	
c1	cds	130185	132077	+	BALIOE_00575		hypothetical protein	
c1	cds	132285	133709	+	BALIOE_00580		hypothetical protein	
c1	cds	133780	135633	-	BALIOE_00585		hypothetical protein	
c1	cds	135988	138585	+	BALIOE_00590		hypothetical protein	
c1	cds	138761	139123	+	BALIOE_00595		hypothetical protein	
c1	cds	139161	139955	-	BALIOE_00600		hypothetical protein	
c1	cds	139971	140837	-	BALIOE_00605		hypothetical protein	
c1	cds	140943	141251	-	BALIOE_00610		hypothetical protein	
c1	cds	141456	143006	+	BALIOE_00615		hypothetical protein	
c1	cds	143208	145598	-	BALIOE_00620		hypothetical protein	
c1	cds	145804	146340	+	BALIOE_00625		hypothetical protein	
c1	cds	146381	147043	-	BALIOE_00630		hypothetical protein	
c1	cds	147152	148078	+	BALIOE_00635		hypothetical protein	
c1	cds	148078	148845	+	BALIOE_00640		hypothetical protein	
c1	cds	148950	149390	+	BALIOE_00645		hypothetical protein	
c1	cds	149454	150683	+	BALIOE_00650		hypothetical protein	
c1	cds	150687	151067	-	BALIOE_00655		hypothetical protein	
c1	cds	151341	152237	+	BALIOE_00660		hypothetical protein	
c1	cds	152536	153387	-	BALIOE_00665		hypothetical protein	
c1	cds	153399	154193	-	BALIOE_00670		hypothetical protein	
c1	cds	154328	155437	-	BALIOE_00675		hypothetical protein	
c1	cds	155449	156039	-	BALIOE_00680		hypothetical protein	
c1	cds	156060	156665	-	BALIOE_00685		hypothetical protein	
c1	cds	156680	157228	-	BALIOE_00690		hypothetical protein	
c1	cds	157242	159842	-	BALIOE_00695		hypothetical protein	
c1	cds	159884	160609	-	BALIOE_00700		hypothetical protein	
c1	cds	160696	161292	-	BALIOE_00705		hypothetical protein	
c1	cds	161573	162055	-	BALIOE_00710		hypothetical protein	
c1	cds	162052	163416	-	BALIOE_00715		hypothetical protein	
c1	cds	163509	164435	-	BALIOE_00720		hypothetical protein	
c1	cds	164472	164927	-	BALIOE_00725		hypothetical protein	
c1	cds	165105	165809	-	BALIOE_00730		hypothetical protein	
c1	cds	165824	166354	-	BALIOE_00735		hypothetical protein	
c1	cds	166428	168857	+	BALIOE_00740		hypothetical protein	
c1	cds	169053	171587	+	BALIOE_00745		hypothetical protein	
c1	cds	171807	174050	+	BALIOE_00750		hypothetical protein	
c1	cds	174101	174898	+	BALIOE_00755		hypothetical protein	
c1	cds	174898	175788	+	BALIOE_00760		hypothetical protein	
c1	cds	175785	177767	+	BALIOE_00765		hypothetical protein	
c1	cds	177802	179082	-	BALIOE_00770		hypothetical protein	
c1	cds	179307	180728	+	BALIOE_00775		hypothetical protein	
c1	cds	180810	181154	+	BALIOE_00780		hypothetical protein	
c1	cds	181201	181824	-	BALIOE_00785		hypothetical protein	
c1	cds	181862	182662	-	BALIOE_00790		hypothetical protein	
c1	cds	182655	183353	-	BALIOE_00795		hypothetical protein	
c1	cds	183437	184954	+	BALIOE_00800		hypothetical protein	
c1	cds	185084	186508	+	BALIOE_00805		hypothetical protein	
c1	cds	186663	187820	+	BALIOE_00810		hypothetical protein	
c1	cds	187909	188295	-	BALIOE_00815		hypothetical protein	
c1	cds	188610	189434	-	BALIOE_00820		hypothetical protein	
c1	cds	189465	192137	-	BALIOE_00825		hypothetical protein	
c1	cds	192199	192993	-	BALIOE_00830		hypothetical protein	
c1	cds	193361	194086	+	BALIOE_00835		hypothetical protein	
c1	cds	194344	195195	+	BALIOE_00840		hypothetical protein	
c1	cds	195342	196067	+	BALIOE_00845		hypothetical protein	
c1	cds	196217	196774	+	BALIOE_00850		hypothetical protein	
c1	cds	196866	198062	+	BALIOE_00855		hypothetical protein	
c1	cds	198251	199009	+	BALIOE_00860		hypothetical protein	
c1	cds	199009	199161	+	BALIOE_00865		hypothetical protein	
c1	cds	199130	199879	+	BALIOE_00870		hypothetical protein	
c1	cds	199891	201243	+	BALIOE_00875		hypothetical protein	
c1	cds	201273	203705	+	BALIOE_00880		hypothetical protein	
c1	cds	203826	204311	+	BALIOE_00885		hypothetical protein	
c1	cds	204315	205340	+	BALIOE_00890		hypothetical protein	
c1	cds	205445	205900	+	BALIOE_00895		hypothetical protein	
c1	cds	205904	206692	+	BALIOE_00900		hypothetical protein	
c1	cds	206692	207840	+	BALIOE_00905		hypothetical protein	
c1	cds	207837	208433	+	BALIOE_00910		hypothetical protein	
c1	cds	208470	211952	+	BALIOE_00915		hypothetical protein	
c1	cds	211965	212924	+	BALIOE_00920		hypothetical protein	
c1	cds	213023	215164	+	BALIOE_00925		hypothetical protein	
c1	cds	215221	215610	+	BALIOE_00930		hypothetical protein	
c1	cds	215675	216970	+	BALIOE_00935		hypothetical protein	
c1	cds	217023	217283	-	BALIOE_00940		hypothetical protein	
c1	cds	217270	217470	-	BALIOE_00945		hypothetical protein	
c1	cds	217636	218094	+	BALIOE_00950		hypothetical protein	
c1	cds	218178	218588	+	BALIOE_00955		hypothetical protein	
c1	cds	218602	219312	+	BALIOE_00960		hypothetical protein	
c1	ncRNA	219391	219467	+	BALIOE_00965	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	219512	220336	-	BALIOE_00970		hypothetical protein	
c1	cds	220389	222107	-	BALIOE_00975		hypothetical protein	
c1	cds	222218	222925	-	BALIOE_00980		hypothetical protein	
c1	cds	222922	223326	-	BALIOE_00985		hypothetical protein	
c1	cds	223444	224259	-	BALIOE_00990		hypothetical protein	
c1	cds	224299	224952	-	BALIOE_00995		hypothetical protein	
c1	cds	224945	225976	-	BALIOE_01000		hypothetical protein	
c1	cds	226164	226739	+	BALIOE_01005		hypothetical protein	
c1	rRNA	227103	228644	+	BALIOE_01010	16S_rrna	16S ribosomal RNA	GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
c1	tRNA	228713	228789	+	BALIOE_01015	Ile_trna	tRNA-Ile	SO:0000263
c1	tRNA	228832	228907	+	BALIOE_01020	Ala_trna	tRNA-Ala	SO:0000254
c1	tRNA	232258	232334	+	BALIOE_01025	Asp_trna	tRNA-Asp	SO:0000256
c1	cds	232497	233300	+	BALIOE_01030		hypothetical protein	
c1	cds	233297	234211	-	BALIOE_01035		hypothetical protein	
c1	cds	234473	235252	+	BALIOE_01040		hypothetical protein	
c1	cds	235330	236100	+	BALIOE_01045		hypothetical protein	
c1	cds	236148	237368	-	BALIOE_01050		hypothetical protein	
c1	cds	237578	238333	-	BALIOE_01055		hypothetical protein	
c1	cds	238367	239089	+	BALIOE_01060		hypothetical protein	
c1	cds	239086	239553	-	BALIOE_01065		hypothetical protein	
c1	cds	239609	240349	+	BALIOE_01070		hypothetical protein	
c1	tRNA	240482	240558	+	BALIOE_01075	Asp_trna	tRNA-Asp	SO:0000256
c1	cds	240887	241687	+	BALIOE_01080		hypothetical protein	
c1	cds	241872	242168	-	BALIOE_01085		hypothetical protein	
c1	cds	242165	242614	-	BALIOE_01090		hypothetical protein	
c1	cds	242617	243213	-	BALIOE_01095		hypothetical protein	
c1	cds	243292	243513	-	BALIOE_01100		hypothetical protein	
c1	cds	243534	244013	-	BALIOE_01105		hypothetical protein	
c1	cds	243979	245388	-	BALIOE_01110		hypothetical protein	
c1	cds	245399	248833	-	BALIOE_01115		hypothetical protein	
c1	cds	248970	249764	-	BALIOE_01120		hypothetical protein	
c1	cds	249761	250381	-	BALIOE_01125		hypothetical protein	
c1	cds	250386	251129	-	BALIOE_01130		hypothetical protein	
c1	cds	251126	253897	-	BALIOE_01135		hypothetical protein	
c1	cds	253906	254667	-	BALIOE_01140		hypothetical protein	
c1	cds	254672	256003	-	BALIOE_01145		hypothetical protein	
c1	cds	256006	256530	-	BALIOE_01150		hypothetical protein	
c1	cds	256527	257807	-	BALIOE_01155		hypothetical protein	
c1	cds	257832	258914	-	BALIOE_01160		hypothetical protein	
c1	cds	258878	260728	-	BALIOE_01165		hypothetical protein	
c1	cds	260732	261145	-	BALIOE_01170		hypothetical protein	
c1	cds	261236	262627	-	BALIOE_01175		hypothetical protein	
c1	cds	262678	262902	-	BALIOE_01180		hypothetical protein	
c1	cds	262937	263437	-	BALIOE_01185		hypothetical protein	
c1	cds	264134	264652	+	BALIOE_01190		hypothetical protein	
c1	cds	264862	267003	+	BALIOE_01195		hypothetical protein	
c1	cds	267079	271293	+	BALIOE_01200		hypothetical protein	
c1	cds	271362	271907	+	BALIOE_01205		hypothetical protein	
c1	cds	272653	273789	+	BALIOE_01210		hypothetical protein	
c1	cds	273792	275552	+	BALIOE_01215		hypothetical protein	
c1	cds	275536	275706	+	BALIOE_01220		hypothetical protein	
c1	cds	275754	276017	+	BALIOE_01225		hypothetical protein	
c1	cds	276198	277370	+	BALIOE_01230		hypothetical protein	
c1	cds	277488	278258	-	BALIOE_01235		hypothetical protein	
c1	cds	278439	278885	+	BALIOE_01240		hypothetical protein	
c1	cds	278928	281372	-	BALIOE_01245		hypothetical protein	
c1	cds	281612	282190	+	BALIOE_01250		hypothetical protein	
c1	cds	282295	283062	+	BALIOE_01255		hypothetical protein	
c1	cds	283033	283773	-	BALIOE_01260		hypothetical protein	
c1	cds	284208	284468	-	BALIOE_01265		hypothetical protein	
c1	cds	284654	285427	+	BALIOE_01270		hypothetical protein	
c1	ncRNA	285427	285504	+	BALIOE_01275	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	285603	285899	+	BALIOE_01280		hypothetical protein	
c1	cds	286245	287984	-	BALIOE_01285		hypothetical protein	
c1	cds	288079	288714	+	BALIOE_01290		hypothetical protein	
c1	cds	288785	289840	+	BALIOE_01295		hypothetical protein	
c1	cds	289892	290185	+	BALIOE_01300		hypothetical protein	
c1	cds	290188	290586	+	BALIOE_01305		hypothetical protein	
c1	cds	290671	291048	+	BALIOE_01310		hypothetical protein	
c1	cds	291355	291621	+	BALIOE_01315		hypothetical protein	
c1	cds	291590	292090	+	BALIOE_01320		hypothetical protein	
c1	cds	292147	293604	-	BALIOE_01325		hypothetical protein	
c1	cds	293865	294323	+	BALIOE_01330		hypothetical protein	
c1	cds	294415	295659	+	BALIOE_01335		hypothetical protein	
c1	cds	295717	296118	+	BALIOE_01340		hypothetical protein	
c1	cds	296157	297212	-	BALIOE_01345		hypothetical protein	
c1	cds	297500	298603	+	BALIOE_01350		hypothetical protein	
c1	cds	298615	299868	+	BALIOE_01355		hypothetical protein	
c1	tRNA	299983	300058	+	BALIOE_01360	Thr_trna	tRNA-Thr	SO:0000270
c1	cds	300073	301047	-	BALIOE_01365		hypothetical protein	
c1	cds	301423	301812	-	BALIOE_01370		hypothetical protein	
c1	cds	301940	302653	-	BALIOE_01375		hypothetical protein	
c1	cds	302754	302954	+	BALIOE_01380		hypothetical protein	
c1	cds	303073	303366	+	BALIOE_01385		hypothetical protein	
c1	cds	303399	304007	+	BALIOE_01390		hypothetical protein	
c1	cds	303947	304321	+	BALIOE_01395		hypothetical protein	
c1	cds	304318	304629	+	BALIOE_01400		hypothetical protein	
c1	cds	304629	305423	+	BALIOE_01405		hypothetical protein	
c1	cds	305423	306016	+	BALIOE_01410		hypothetical protein	
c1	cds	305988	306431	-	BALIOE_01415		hypothetical protein	
c1	cds	306452	306862	-	BALIOE_01420		hypothetical protein	
c1	cds	306892	307446	+	BALIOE_01425		hypothetical protein	
c1	cds	307504	308277	-	BALIOE_01430		hypothetical protein	
c1	tRNA	308435	308518	+	BALIOE_01435		tRNA-Xxx	
c1	cds	309101	309844	+	BALIOE_01440		hypothetical protein	
c1	cds	309886	310239	-	BALIOE_01445		hypothetical protein	
c1	cds	310807	311988	+	BALIOE_01450		hypothetical protein	
c1	cds	311992	312408	+	BALIOE_01455		hypothetical protein	
c1	cds	312381	312998	+	BALIOE_01460		hypothetical protein	
c1	cds	312998	313456	+	BALIOE_01465		hypothetical protein	
c1	cds	313449	314081	+	BALIOE_01470		hypothetical protein	
c1	cds	314112	314702	+	BALIOE_01475		hypothetical protein	
c1	cds	314702	315268	+	BALIOE_01480		hypothetical protein	
c1	cds	315678	315950	-	BALIOE_01485		hypothetical protein	
c1	cds	315956	316507	-	BALIOE_01490		hypothetical protein	
c1	cds	316504	317256	-	BALIOE_01495		hypothetical protein	
c1	cds	318190	318450	+	BALIOE_01500		hypothetical protein	
c1	cds	318447	319004	+	BALIOE_01505		hypothetical protein	
c1	cds	319001	319222	+	BALIOE_01510		hypothetical protein	
c1	cds	319222	319545	+	BALIOE_01515		hypothetical protein	
c1	cds	319559	321892	+	BALIOE_01520		hypothetical protein	
c1	cds	322025	322981	-	BALIOE_01525		hypothetical protein	
c1	cds	323657	324556	-	BALIOE_01530		hypothetical protein	
c1	cds	324655	325377	+	BALIOE_01535		hypothetical protein	
c1	cds	325544	325822	+	BALIOE_01540		hypothetical protein	
c1	cds	326525	327427	-	BALIOE_01545		hypothetical protein	
c1	cds	327673	328731	+	BALIOE_01550		hypothetical protein	
c1	cds	328873	330000	+	BALIOE_01555		hypothetical protein	
c1	cds	330179	331135	-	BALIOE_01560		hypothetical protein	
c1	cds	331145	333343	-	BALIOE_01565		hypothetical protein	
c1	cds	333340	334296	-	BALIOE_01570		hypothetical protein	
c1	cds	334293	334982	-	BALIOE_01575		hypothetical protein	
c1	cds	335400	336014	+	BALIOE_01580		hypothetical protein	
c1	cds	336904	337614	-	BALIOE_01585		hypothetical protein	
c1	cds	337583	339226	-	BALIOE_01590		hypothetical protein	
c1	cds	339216	341741	-	BALIOE_01595		hypothetical protein	
c1	cds	341767	342435	-	BALIOE_01600		hypothetical protein	
c1	cds	342493	343080	-	BALIOE_01605		hypothetical protein	
c1	cds	343155	343697	-	BALIOE_01610		hypothetical protein	
c1	cds	344522	344713	+	BALIOE_01615		hypothetical protein	
c1	cds	344783	344923	-	BALIOE_01620		hypothetical protein	
c1	cds	344923	345189	-	BALIOE_01625		hypothetical protein	
c1	cds	345450	345830	+	BALIOE_01630		hypothetical protein	
c1	cds	345827	346174	+	BALIOE_01635		hypothetical protein	
c1	cds	346224	347762	+	BALIOE_01640		hypothetical protein	
c1	cds	348574	349716	-	BALIOE_01645		hypothetical protein	
c1	cds	349951	350871	-	BALIOE_01650		hypothetical protein	
c1	cds	351028	351954	+	BALIOE_01655		hypothetical protein	
c1	cds	352242	352598	-	BALIOE_01660		hypothetical protein	
c1	cds	352791	353366	-	BALIOE_01665		hypothetical protein	
c1	cds	353932	358185	+	BALIOE_01670		hypothetical protein	
c1	cds	358306	359163	-	BALIOE_01675		hypothetical protein	
c1	cds	359412	360281	+	BALIOE_01680		hypothetical protein	
c1	cds	360441	361034	-	BALIOE_01685		hypothetical protein	
c1	cds	361391	362716	-	BALIOE_01690		hypothetical protein	
c1	cds	362942	363796	+	BALIOE_01695		hypothetical protein	
c1	cds	364323	365042	+	BALIOE_01700		hypothetical protein	
c1	cds	365053	366480	+	BALIOE_01705		hypothetical protein	
c1	cds	366473	367168	+	BALIOE_01710		hypothetical protein	
c1	cds	367663	368079	-	BALIOE_01715		hypothetical protein	
c1	cds	368261	368473	-	BALIOE_01720		hypothetical protein	
c1	cds	368427	369521	-	BALIOE_01725		hypothetical protein	
c1	cds	369563	370324	-	BALIOE_01730		hypothetical protein	
c1	cds	370341	370481	-	BALIOE_01735		hypothetical protein	
c1	cds	371105	371272	-	BALIOE_01740		hypothetical protein	
c1	cds	372408	372542	+	BALIOE_01745		hypothetical protein	
c1	cds	372971	373222	+	BALIOE_01750		hypothetical protein	
c1	cds	373224	374912	-	BALIOE_01755		hypothetical protein	
c1	cds	374926	376398	-	BALIOE_01760		hypothetical protein	
c1	cds	376412	376999	-	BALIOE_01765		hypothetical protein	
c1	cds	377128	379161	+	BALIOE_01770		hypothetical protein	
c1	cds	379735	383718	+	BALIOE_01775		hypothetical protein	
c1	cds	383860	384948	+	BALIOE_01780		hypothetical protein	
c1	cds	384990	385250	-	BALIOE_01785		hypothetical protein	
c1	cds	385211	385921	-	BALIOE_01790		hypothetical protein	
c1	cds	386013	386315	-	BALIOE_01795		hypothetical protein	
c1	cds	386778	387383	+	BALIOE_01800		hypothetical protein	
c1	cds	387423	388286	+	BALIOE_01805		hypothetical protein	
c1	cds	388276	389823	+	BALIOE_01810		hypothetical protein	
c1	cds	389823	391241	+	BALIOE_01815		hypothetical protein	
c1	cds	391267	391587	+	BALIOE_01820		hypothetical protein	
c1	ncRNA	391309	391378	-	BALIOE_01825	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	391402	391471	-	BALIOE_01830	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	391495	391564	-	BALIOE_01835	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	391587	391656	-	BALIOE_01840	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	391756	392706	+	BALIOE_01845		hypothetical protein	
c1	cds	392716	394098	+	BALIOE_01850		hypothetical protein	
c1	cds	394397	394807	+	BALIOE_01855		hypothetical protein	
c1	cds	395058	396044	+	BALIOE_01860		hypothetical protein	
c1	cds	396093	396353	+	BALIOE_01865		hypothetical protein	
c1	cds	396399	397577	+	BALIOE_01870		hypothetical protein	
c1	cds	397570	398541	+	BALIOE_01875		hypothetical protein	
c1	cds	398538	399494	+	BALIOE_01880		hypothetical protein	
c1	cds	399581	400630	+	BALIOE_01885		hypothetical protein	
c1	cds	400873	401688	+	BALIOE_01890		hypothetical protein	
c1	cds	402366	402998	-	BALIOE_01895		hypothetical protein	
c1	cds	403184	403459	+	BALIOE_01900		hypothetical protein	
c1	cds	403557	405143	-	BALIOE_01905		hypothetical protein	
c1	cds	405382	406272	+	BALIOE_01910		hypothetical protein	
c1	cds	406428	407597	+	BALIOE_01915		hypothetical protein	
c1	cds	407631	409082	+	BALIOE_01920		hypothetical protein	
c1	cds	409122	411008	+	BALIOE_01925		hypothetical protein	
c1	ncRNA	411107	411183	+	BALIOE_01930	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	411295	411371	+	BALIOE_01935	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	411389	411465	+	BALIOE_01940	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	411483	411558	+	BALIOE_01945	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	411576	411652	+	BALIOE_01950	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	411670	411746	+	BALIOE_01955	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	411902	413161	+	BALIOE_01960		hypothetical protein	
c1	cds	413151	414434	+	BALIOE_01965		hypothetical protein	
c1	cds	414567	415466	-	BALIOE_01970		hypothetical protein	
c1	cds	415576	416235	+	BALIOE_01975		hypothetical protein	
c1	cds	416266	416736	+	BALIOE_01980		hypothetical protein	
c1	cds	416742	417923	+	BALIOE_01985		hypothetical protein	
c1	cds	418026	418637	-	BALIOE_01990		hypothetical protein	
c1	cds	418703	419956	-	BALIOE_01995		hypothetical protein	
c1	cds	420008	423082	-	BALIOE_02000		hypothetical protein	
c1	cds	423205	424296	-	BALIOE_02005		hypothetical protein	
c1	cds	424324	425277	-	BALIOE_02010		hypothetical protein	
c1	cds	425297	426073	-	BALIOE_02015		hypothetical protein	
c1	cds	426188	427135	-	BALIOE_02020		hypothetical protein	
c1	cds	427212	428876	+	BALIOE_02025		hypothetical protein	
c1	cds	428878	429822	+	BALIOE_02030		hypothetical protein	
c1	cds	429840	430706	+	BALIOE_02035		hypothetical protein	
c1	cds	430716	431525	+	BALIOE_02040		hypothetical protein	
c1	cds	431522	432472	+	BALIOE_02045		hypothetical protein	
c1	cds	432469	433482	+	BALIOE_02050		hypothetical protein	
c1	cds	433658	434869	+	BALIOE_02055		hypothetical protein	
c1	cds	434971	435510	+	BALIOE_02060		hypothetical protein	
c1	cds	435635	436468	-	BALIOE_02065		hypothetical protein	
c1	cds	436561	437670	-	BALIOE_02070		hypothetical protein	
c1	cds	437705	437980	-	BALIOE_02075		hypothetical protein	
c1	cds	438140	439186	-	BALIOE_02080		hypothetical protein	
c1	cds	439198	441276	-	BALIOE_02085		hypothetical protein	
c1	cds	441345	442376	-	BALIOE_02090		hypothetical protein	
c1	cds	442373	443677	-	BALIOE_02095		hypothetical protein	
c1	cds	443762	445303	-	BALIOE_02100		hypothetical protein	
c1	cds	445303	445932	-	BALIOE_02105		hypothetical protein	
c1	cds	446235	447197	+	BALIOE_02110		hypothetical protein	
c1	cds	447210	447977	+	BALIOE_02115		hypothetical protein	
c1	cds	447974	448801	+	BALIOE_02120		hypothetical protein	
c1	cds	448798	449649	+	BALIOE_02125		hypothetical protein	
c1	cds	449756	450730	-	BALIOE_02130		hypothetical protein	
c1	cds	451256	454198	+	BALIOE_02135		hypothetical protein	
c1	cds	454286	454909	+	BALIOE_02140		hypothetical protein	
c1	cds	454910	456067	-	BALIOE_02145		hypothetical protein	
c1	cds	456419	457639	+	BALIOE_02150		hypothetical protein	
c1	cds	457652	458746	+	BALIOE_02155		hypothetical protein	
c1	cds	458805	459113	-	BALIOE_02160		hypothetical protein	
c1	cds	459373	459585	+	BALIOE_02165		hypothetical protein	
c1	cds	459609	460703	-	BALIOE_02170		hypothetical protein	
c1	cds	461166	461426	+	BALIOE_02175		hypothetical protein	
c1	cds	461527	462942	+	BALIOE_02180		hypothetical protein	
c1	cds	463061	463381	+	BALIOE_02185		hypothetical protein	
c1	cds	463483	464598	+	BALIOE_02190		hypothetical protein	
c1	cds	464615	465424	-	BALIOE_02195		hypothetical protein	
c1	cds	465544	466002	+	BALIOE_02200		hypothetical protein	
c1	cds	466185	466709	+	BALIOE_02205		hypothetical protein	
c1	cds	466759	466950	+	BALIOE_02210		hypothetical protein	
c1	cds	467208	467885	+	BALIOE_02215		hypothetical protein	
c1	cds	467957	468241	+	BALIOE_02220		hypothetical protein	
c1	cds	468385	470664	+	BALIOE_02225		hypothetical protein	
c1	cds	470661	471110	+	BALIOE_02230		hypothetical protein	
c1	cds	471195	472172	-	BALIOE_02235		hypothetical protein	
c1	cds	472231	473139	+	BALIOE_02240		hypothetical protein	
c1	cds	473282	474550	-	BALIOE_02245		hypothetical protein	
c1	cds	474592	477735	-	BALIOE_02250		hypothetical protein	
c1	cds	477732	478934	-	BALIOE_02255		hypothetical protein	
c1	cds	479124	479813	+	BALIOE_02260		hypothetical protein	
c1	cds	479871	481166	+	BALIOE_02265		hypothetical protein	
c1	cds	481573	482892	+	BALIOE_02270		hypothetical protein	
c1	cds	482968	484341	+	BALIOE_02275		hypothetical protein	
c1	cds	484497	486314	+	BALIOE_02280		hypothetical protein	
c1	cds	486502	487947	+	BALIOE_02285		hypothetical protein	
c1	cds	487968	488549	-	BALIOE_02290		hypothetical protein	
c1	cds	488642	489712	+	BALIOE_02295		hypothetical protein	
c1	cds	489767	490894	+	BALIOE_02300		hypothetical protein	
c1	cds	490917	491249	+	BALIOE_02305		hypothetical protein	
c1	cds	491310	493124	+	BALIOE_02310		hypothetical protein	
c1	cds	493135	494106	+	BALIOE_02315		hypothetical protein	
c1	cds	494257	494499	+	BALIOE_02320		hypothetical protein	
c1	cds	494492	494773	+	BALIOE_02325		hypothetical protein	
c1	cds	494861	495208	+	BALIOE_02330		hypothetical protein	
c1	cds	495385	496269	-	BALIOE_02335		hypothetical protein	
c1	cds	496568	497107	-	BALIOE_02340		hypothetical protein	
c1	cds	497258	497707	+	BALIOE_02345		hypothetical protein	
c1	cds	497711	498814	+	BALIOE_02350		hypothetical protein	
c1	cds	498903	499373	+	BALIOE_02355		hypothetical protein	
c1	cds	499393	499812	+	BALIOE_02360		hypothetical protein	
c1	cds	499890	500867	+	BALIOE_02365		hypothetical protein	
c1	cds	500845	501360	+	BALIOE_02370		hypothetical protein	
c1	cds	501538	503109	-	BALIOE_02375		hypothetical protein	
c1	cds	503340	504314	-	BALIOE_02380		hypothetical protein	
c1	cds	504369	506231	-	BALIOE_02385		hypothetical protein	
c1	cds	506256	507155	-	BALIOE_02390		hypothetical protein	
c1	cds	507155	507397	-	BALIOE_02395		hypothetical protein	
c1	cds	507603	509051	+	BALIOE_02400		hypothetical protein	
c1	cds	509105	509695	-	BALIOE_02405		hypothetical protein	
c1	cds	509658	510569	-	BALIOE_02410		hypothetical protein	
c1	cds	510737	511228	+	BALIOE_02415		hypothetical protein	
c1	cds	511356	512720	-	BALIOE_02420		hypothetical protein	
c1	cds	512869	513759	-	BALIOE_02425		hypothetical protein	
c1	cds	513771	514100	-	BALIOE_02430		hypothetical protein	
c1	cds	514100	514714	-	BALIOE_02435		hypothetical protein	
c1	cds	514704	516695	-	BALIOE_02440		hypothetical protein	
c1	cds	516717	517664	-	BALIOE_02445		hypothetical protein	
c1	cds	518124	519599	-	BALIOE_02450		hypothetical protein	
c1	cds	519643	520221	-	BALIOE_02455		hypothetical protein	
c1	cds	520529	520843	+	BALIOE_02460		hypothetical protein	
c1	cds	521187	522485	+	BALIOE_02465		hypothetical protein	
c1	cds	522730	523353	+	BALIOE_02470		hypothetical protein	
c1	cds	523479	524753	+	BALIOE_02475		hypothetical protein	
c1	cds	524941	527295	+	BALIOE_02480		hypothetical protein	
c1	cds	527504	527776	+	BALIOE_02485		hypothetical protein	
c1	cds	527968	529839	+	BALIOE_02490		hypothetical protein	
c1	cds	529990	530361	+	BALIOE_02495		hypothetical protein	
c1	cds	530467	530865	+	BALIOE_02500		hypothetical protein	
c1	cds	530917	531612	-	BALIOE_02505		hypothetical protein	
c1	cds	531677	533377	-	BALIOE_02510		hypothetical protein	
c1	cds	533477	534295	+	BALIOE_02515		hypothetical protein	
c1	cds	534447	534905	+	BALIOE_02520		hypothetical protein	
c1	cds	534935	536707	+	BALIOE_02525		hypothetical protein	
c1	cds	536700	538481	+	BALIOE_02530		hypothetical protein	
c1	cds	538662	539000	+	BALIOE_02535		hypothetical protein	
c1	cds	539030	540316	+	BALIOE_02540		hypothetical protein	
c1	cds	540365	541225	-	BALIOE_02545		hypothetical protein	
c1	cds	541443	542015	+	BALIOE_02550		hypothetical protein	
c1	cds	542048	542359	-	BALIOE_02555		hypothetical protein	
c1	cds	542738	543091	+	BALIOE_02560		hypothetical protein	
c1	cds	543133	544683	-	BALIOE_02565		hypothetical protein	
c1	cds	544847	545317	-	BALIOE_02570		hypothetical protein	
c1	cds	545433	545984	-	BALIOE_02575		hypothetical protein	
c1	cds	546156	546374	-	BALIOE_02580		hypothetical protein	
c1	cds	546400	546774	-	BALIOE_02585		hypothetical protein	
c1	cds	547320	550469	-	BALIOE_02590		hypothetical protein	
c1	cds	550492	551685	-	BALIOE_02595		hypothetical protein	
c1	cds	551827	552474	+	BALIOE_02600		hypothetical protein	
c1	cds	552602	555964	+	BALIOE_02605		hypothetical protein	
c1	cds	556003	556167	-	BALIOE_02610		hypothetical protein	
c1	cds	556181	556708	-	BALIOE_02615		hypothetical protein	
c1	cds	556778	557155	+	BALIOE_02620		hypothetical protein	
c1	cds	557308	557859	+	BALIOE_02625		hypothetical protein	
c1	cds	557988	559919	+	BALIOE_02630		hypothetical protein	
c1	cds	559972	560301	+	BALIOE_02635		hypothetical protein	
c1	cds	560301	560906	+	BALIOE_02640		hypothetical protein	
c1	cds	561016	562890	+	BALIOE_02645		hypothetical protein	
c1	cds	563011	563715	+	BALIOE_02650		hypothetical protein	
c1	cds	563847	564809	+	BALIOE_02655		hypothetical protein	
c1	cds	564806	565765	-	BALIOE_02660		hypothetical protein	
c1	cds	565917	567221	+	BALIOE_02665		hypothetical protein	
c1	ncRNA	567239	567316	+	BALIOE_02670	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	567354	569030	-	BALIOE_02675		hypothetical protein	
c1	cds	569267	570487	-	BALIOE_02680		hypothetical protein	
c1	cds	570514	570708	+	BALIOE_02685		hypothetical protein	
c1	cds	570705	572357	+	BALIOE_02690		hypothetical protein	
c1	cds	572394	572873	-	BALIOE_02695		hypothetical protein	
c1	cds	573077	573871	-	BALIOE_02700		hypothetical protein	
c1	cds	573955	574350	+	BALIOE_02705		hypothetical protein	
c1	ncRNA	574376	574453	+	BALIOE_02710	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	574376	574453	-	BALIOE_02715	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	574565	577069	-	BALIOE_02720		hypothetical protein	
c1	cds	577331	578263	+	BALIOE_02725		hypothetical protein	
c1	cds	578266	579558	+	BALIOE_02730		hypothetical protein	
c1	cds	579896	581251	+	BALIOE_02735		hypothetical protein	
c1	cds	581354	585739	+	BALIOE_02740		hypothetical protein	
c1	cds	585947	601822	+	BALIOE_02745		hypothetical protein	
c1	cds	601826	603988	+	BALIOE_02750		hypothetical protein	
c1	cds	603985	605160	+	BALIOE_02755		hypothetical protein	
c1	cds	605157	605564	+	BALIOE_02760		hypothetical protein	
c1	cds	605568	605771	-	BALIOE_02765		hypothetical protein	
c1	cds	605768	606190	-	BALIOE_02770		hypothetical protein	
c1	cds	606275	607291	-	BALIOE_02775		hypothetical protein	
c1	cds	607658	608020	+	BALIOE_02780		hypothetical protein	
c1	ncRNA	608071	608148	-	BALIOE_02785	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	608199	608657	-	BALIOE_02790		hypothetical protein	
c1	cds	608654	609571	-	BALIOE_02795		hypothetical protein	
c1	cds	609717	610394	+	BALIOE_02800		hypothetical protein	
c1	cds	610381	611160	+	BALIOE_02805		hypothetical protein	
c1	cds	611223	612077	-	BALIOE_02810		hypothetical protein	
c1	cds	612138	612947	-	BALIOE_02815		hypothetical protein	
c1	cds	612937	613530	-	BALIOE_02820		hypothetical protein	
c1	cds	613531	614217	+	BALIOE_02825		hypothetical protein	
c1	cds	614214	616628	+	BALIOE_02830		hypothetical protein	
c1	cds	617058	621254	+	BALIOE_02835		hypothetical protein	
c1	cds	621235	621495	+	BALIOE_02840		hypothetical protein	
c1	cds	622239	622610	-	BALIOE_02845		hypothetical protein	
c1	cds	622726	623820	-	BALIOE_02850		hypothetical protein	
c1	cds	623889	624815	-	BALIOE_02855		hypothetical protein	
c1	cds	625045	625527	+	BALIOE_02860		hypothetical protein	
c1	cds	625605	626420	+	BALIOE_02865		hypothetical protein	
c1	cds	626510	628291	+	BALIOE_02870		hypothetical protein	
c1	cds	628304	629080	+	BALIOE_02875		hypothetical protein	
c1	cds	629181	630059	+	BALIOE_02880		hypothetical protein	
c1	cds	630228	631619	+	BALIOE_02885		hypothetical protein	
c1	cds	631656	632546	+	BALIOE_02890		hypothetical protein	
c1	cds	632553	633017	+	BALIOE_02895		Allantoinase	SO:0001217, UniRef:UniRef50_A0A091C0K5, UniRef:UniRef90_A0A376X1Z1
c1	cds	633074	634375	+	BALIOE_02900		hypothetical protein	
c1	cds	634397	635542	+	BALIOE_02905		hypothetical protein	
c1	cds	635770	636555	-	BALIOE_02910		hypothetical protein	
c1	cds	636566	637801	-	BALIOE_02915		hypothetical protein	
c1	cds	637823	638872	-	BALIOE_02920		hypothetical protein	
c1	cds	639189	640856	+	BALIOE_02925		hypothetical protein	
c1	cds	640866	642125	+	BALIOE_02930		hypothetical protein	
c1	cds	642136	642951	+	BALIOE_02935		hypothetical protein	
c1	cds	642948	643841	+	BALIOE_02940		hypothetical protein	
c1	cds	643980	645047	-	BALIOE_02945		hypothetical protein	
c1	cds	645044	645553	-	BALIOE_02950		hypothetical protein	
c1	cds	645671	646393	-	BALIOE_02955		hypothetical protein	
c1	cds	646396	646890	-	BALIOE_02960		hypothetical protein	
c1	cds	647064	648449	+	BALIOE_02965		hypothetical protein	
c1	cds	648485	649006	-	BALIOE_02970		hypothetical protein	
c1	cds	649114	649326	-	BALIOE_02975		hypothetical protein	
c1	cds	649328	650194	-	BALIOE_02980		hypothetical protein	
c1	cds	650665	651207	+	BALIOE_02985		hypothetical protein	
c1	cds	651427	652119	+	BALIOE_02990		hypothetical protein	
c1	cds	652150	654759	+	BALIOE_02995		hypothetical protein	
c1	cds	654772	655779	+	BALIOE_03000		hypothetical protein	
c1	cds	655790	656305	+	BALIOE_03005		hypothetical protein	
c1	cds	656308	656940	-	BALIOE_03010		hypothetical protein	
c1	tRNA	657183	657259	+	BALIOE_03015	Arg_trna	tRNA-Arg	SO:0001036
c1	cds	657305	658066	-	BALIOE_03020		hypothetical protein	
c1	cds	658249	659139	-	BALIOE_03025		hypothetical protein	
c1	cds	659140	662112	-	BALIOE_03030		hypothetical protein	
c1	cds	662099	664336	-	BALIOE_03035		hypothetical protein	
c1	cds	664602	665738	-	BALIOE_03040		hypothetical protein	
c1	cds	665953	666174	-	BALIOE_03045		hypothetical protein	
c1	cds	666201	667535	-	BALIOE_03050		hypothetical protein	
c1	cds	667704	668111	-	BALIOE_03055		hypothetical protein	
c1	cds	668129	672979	-	BALIOE_03060		hypothetical protein	
c1	cds	672999	673460	-	BALIOE_03065		hypothetical protein	
c1	cds	673488	675389	-	BALIOE_03070		hypothetical protein	
c1	cds	675983	677431	-	BALIOE_03075		hypothetical protein	
c1	cds	677421	678104	-	BALIOE_03080		hypothetical protein	
c1	cds	678261	679643	+	BALIOE_03085		hypothetical protein	
c1	cds	679667	679999	+	BALIOE_03090		hypothetical protein	
c1	cds	680015	681238	+	BALIOE_03095		hypothetical protein	
c1	cds	681250	684387	+	BALIOE_03100		hypothetical protein	
c1	cds	684489	685865	+	BALIOE_03105		hypothetical protein	
c1	cds	685933	687180	-	BALIOE_03110		hypothetical protein	
c1	cds	687288	687941	-	BALIOE_03115		hypothetical protein	
c1	cds	688035	688403	-	BALIOE_03120		hypothetical protein	
c1	cds	688468	688668	-	BALIOE_03125		hypothetical protein	
c1	cds	688782	689900	-	BALIOE_03130		hypothetical protein	
c1	cds	690339	690491	+	BALIOE_03135		hypothetical protein	
c1	cds	690842	690994	+	BALIOE_03140		hypothetical protein	
c1	cds	691116	691859	-	BALIOE_03145		hypothetical protein	
c1	cds	691911	694151	-	BALIOE_03150		hypothetical protein	
c1	cds	694394	695596	+	BALIOE_03155		hypothetical protein	
c1	cds	695599	695817	+	BALIOE_03160		hypothetical protein	
c1	cds	695814	699695	+	BALIOE_03165		hypothetical protein	
c1	cds	699911	701044	+	BALIOE_03170		hypothetical protein	
c1	cds	701041	701856	-	BALIOE_03175		hypothetical protein	
c1	cds	701853	702845	-	BALIOE_03180		hypothetical protein	
c1	cds	702842	703846	-	BALIOE_03185		hypothetical protein	
c1	cds	703957	705207	+	BALIOE_03190		hypothetical protein	
c1	cds	705211	706167	-	BALIOE_03195		hypothetical protein	
c1	cds	706356	707531	+	BALIOE_03200		hypothetical protein	
c1	cds	707541	709151	+	BALIOE_03205		hypothetical protein	
c1	cds	709165	710022	+	BALIOE_03210		hypothetical protein	
c1	cds	710022	710768	+	BALIOE_03215		hypothetical protein	
c1	cds	710771	711184	+	BALIOE_03220		hypothetical protein	
c1	cds	711365	713470	+	BALIOE_03225		hypothetical protein	
c1	cds	713652	713849	+	BALIOE_03230		hypothetical protein	
c1	cds	713859	714947	-	BALIOE_03235		hypothetical protein	
c1	cds	715056	716216	+	BALIOE_03240		hypothetical protein	
c1	cds	716217	716846	-	BALIOE_03245		hypothetical protein	
c1	cds	716819	718039	-	BALIOE_03250		hypothetical protein	
c1	cds	718186	719088	-	BALIOE_03255		hypothetical protein	
c1	cds	719298	720044	-	BALIOE_03260		hypothetical protein	
c1	cds	720416	720979	+	BALIOE_03265		hypothetical protein	PFAM:PF10417.10
c1	cds	721078	722673	+	BALIOE_03270		hypothetical protein	
c1	cds	722794	723222	-	BALIOE_03275		hypothetical protein	
c1	cds	723443	724681	+	BALIOE_03280		hypothetical protein	
c1	cds	724685	724774	-	BALIOE_03285		hypothetical protein	
c1	cds	724912	725322	-	BALIOE_03290		hypothetical protein	
c1	cds	725552	726358	-	BALIOE_03295		hypothetical protein	
c1	cds	726472	727935	-	BALIOE_03300		hypothetical protein	
c1	cds	727986	728864	-	BALIOE_03305		hypothetical protein	
c1	cds	728839	729390	-	BALIOE_03310		hypothetical protein	
c1	cds	729394	730926	-	BALIOE_03315		hypothetical protein	
c1	cds	730937	731845	-	BALIOE_03320		hypothetical protein	
c1	cds	731842	732138	-	BALIOE_03325		hypothetical protein	
c1	cds	732153	733211	-	BALIOE_03330		hypothetical protein	
c1	cds	733591	735249	+	BALIOE_03335		hypothetical protein	
c1	cds	735218	735898	+	BALIOE_03340		hypothetical protein	
c1	cds	735939	737324	-	BALIOE_03345		hypothetical protein	
c1	cds	737913	738473	+	BALIOE_03350		hypothetical protein	
c1	cds	738648	738857	+	BALIOE_03355		hypothetical protein	
c1	cds	738911	739294	-	BALIOE_03360		hypothetical protein	
c1	cds	739387	740175	+	BALIOE_03365		hypothetical protein	
c1	cds	740304	740507	+	BALIOE_03370		hypothetical protein	
c1	cds	740608	741573	-	BALIOE_03375		hypothetical protein	
c1	cds	741782	742735	-	BALIOE_03380		hypothetical protein	
c1	cds	742995	743636	-	BALIOE_03385		hypothetical protein	
c1	cds	743737	744000	-	BALIOE_03390		hypothetical protein	
c1	cds	744110	745321	-	BALIOE_03395		hypothetical protein	
c1	cds	745461	746549	-	BALIOE_03400		hypothetical protein	
c1	cds	746560	747672	-	BALIOE_03405		hypothetical protein	
c1	cds	747675	749576	-	BALIOE_03410		hypothetical protein	
c1	cds	749607	750074	-	BALIOE_03415		hypothetical protein	
c1	cds	750078	750395	-	BALIOE_03420		hypothetical protein	
c1	cds	750655	751266	-	BALIOE_03425		hypothetical protein	
c1	cds	751290	751931	-	BALIOE_03430		hypothetical protein	
c1	cds	751933	752964	-	BALIOE_03435		hypothetical protein	
c1	cds	752964	753545	-	BALIOE_03440		hypothetical protein	
c1	cds	753560	756142	-	BALIOE_03445		hypothetical protein	
c1	cds	756378	756860	+	BALIOE_03450		hypothetical protein	
c1	cds	756930	757517	-	BALIOE_03455		hypothetical protein	
c1	cds	757752	757907	-	BALIOE_03460		hypothetical protein	
c1	cds	758072	758779	+	BALIOE_03465		hypothetical protein	
c1	cds	758776	760203	+	BALIOE_03470		hypothetical protein	
c1	cds	760213	760767	-	BALIOE_03475		hypothetical protein	
c1	cds	760869	761576	+	BALIOE_03480		hypothetical protein	
c1	cds	761573	762025	+	BALIOE_03485		hypothetical protein	
c1	cds	762188	763024	+	BALIOE_03490		hypothetical protein	
c1	cds	763084	764754	-	BALIOE_03495		hypothetical protein	
c1	cds	764838	765773	-	BALIOE_03500		hypothetical protein	
c1	cds	765891	766616	-	BALIOE_03505		hypothetical protein	
c1	cds	766616	767290	-	BALIOE_03510		hypothetical protein	
c1	cds	767290	768030	-	BALIOE_03515		hypothetical protein	
c1	cds	768200	769108	-	BALIOE_03520		hypothetical protein	
c1	cds	769505	771043	-	BALIOE_03525		hypothetical protein	
c1	cds	771068	771946	-	BALIOE_03530		hypothetical protein	
c1	cds	772036	772503	-	BALIOE_03535		hypothetical protein	
c1	cds	772500	773579	-	BALIOE_03540		hypothetical protein	
c1	cds	773693	775117	-	BALIOE_03545		hypothetical protein	
c1	cds	775263	776438	+	BALIOE_03550		hypothetical protein	
c1	tRNA	776592	776666	-	BALIOE_03555	Gln_trna	tRNA-Gln	SO:0000261
c1	tRNA	776704	776778	-	BALIOE_03560	Gln_trna	tRNA-Gln	SO:0000261
c1	tRNA	776827	776903	-	BALIOE_03565	Met_trna	tRNA-Met	SO:0000266
c1	tRNA	776919	776993	-	BALIOE_03570	Gln_trna	tRNA-Gln	SO:0000261
c1	tRNA	777028	777102	-	BALIOE_03575	Gln_trna	tRNA-Gln	SO:0000261
c1	tRNA	777126	777210	-	BALIOE_03580	Leu_trna	tRNA-Leu	SO:0000264
c1	tRNA	777221	777297	-	BALIOE_03585	Met_trna	tRNA-Met	SO:0000266
c1	cds	777677	779341	-	BALIOE_03590		hypothetical protein	
c1	cds	779598	780350	-	BALIOE_03595		hypothetical protein	
c1	cds	780398	781618	-	BALIOE_03600		hypothetical protein	
c1	cds	781627	782775	-	BALIOE_03605		hypothetical protein	
c1	cds	782835	783635	-	BALIOE_03610		hypothetical protein	
c1	cds	783968	785914	+	BALIOE_03615		hypothetical protein	
c1	cds	786117	787781	+	BALIOE_03620		hypothetical protein	
c1	cds	788360	788839	+	BALIOE_03625		hypothetical protein	
c1	cds	788857	789765	+	BALIOE_03630		hypothetical protein	
c1	cds	789815	790141	+	BALIOE_03635		hypothetical protein	
c1	cds	790225	790671	-	BALIOE_03640		hypothetical protein	
c1	cds	790960	791490	-	BALIOE_03645		hypothetical protein	
c1	cds	791630	791992	-	BALIOE_03650		hypothetical protein	
c1	cds	792063	792827	-	BALIOE_03655		hypothetical protein	
c1	cds	793012	793557	+	BALIOE_03660		hypothetical protein	
c1	cds	793583	795223	+	BALIOE_03665		hypothetical protein	
c1	cds	795280	796599	-	BALIOE_03670		hypothetical protein	
c1	cds	796596	798794	-	BALIOE_03675		hypothetical protein	
c1	cds	799105	799209	-	BALIOE_03680		hypothetical protein	
c1	cds	799484	800161	-	BALIOE_03685		hypothetical protein	
c1	cds	800158	802842	-	BALIOE_03690		hypothetical protein	
c1	cds	802835	803407	-	BALIOE_03695		hypothetical protein	
c1	cds	803416	805464	-	BALIOE_03700		hypothetical protein	
c1	cds	805487	807160	-	BALIOE_03705		hypothetical protein	
c1	cds	807562	807768	+	BALIOE_03710		hypothetical protein	
c1	cds	808010	812209	+	BALIOE_03715		hypothetical protein	
c1	cds	812234	812776	+	BALIOE_03720		hypothetical protein	
c1	cds	814426	815499	+	BALIOE_03725		hypothetical protein	
c1	cds	815648	816157	+	BALIOE_03730		hypothetical protein	
c1	cds	816154	817572	+	BALIOE_03735		hypothetical protein	
c1	cds	817722	819203	-	BALIOE_03740		hypothetical protein	
c1	cds	819474	820217	+	BALIOE_03745		hypothetical protein	
c1	cds	820240	820896	+	BALIOE_03750		hypothetical protein	
c1	cds	820890	821822	+	BALIOE_03755		hypothetical protein	
c1	cds	821812	822546	+	BALIOE_03760		hypothetical protein	
c1	cds	822582	823373	+	BALIOE_03765		hypothetical protein	
c1	cds	823370	824416	-	BALIOE_03770		hypothetical protein	
c1	cds	824565	825626	-	BALIOE_03775		hypothetical protein	
c1	cds	825623	826354	-	BALIOE_03780		hypothetical protein	
c1	cds	826369	826518	-	BALIOE_03785		hypothetical protein	
c1	cds	826657	828819	-	BALIOE_03790		hypothetical protein	
c1	cds	828878	829444	-	BALIOE_03795		hypothetical protein	
c1	cds	829831	831114	-	BALIOE_03800		hypothetical protein	
c1	cds	831320	831427	-	BALIOE_03805		hypothetical protein	
c1	cds	831808	832212	+	BALIOE_03810		hypothetical protein	
c1	cds	832206	832553	+	BALIOE_03815		hypothetical protein	
c1	cds	832553	834319	+	BALIOE_03820		hypothetical protein	
c1	cds	834335	835051	+	BALIOE_03825		hypothetical protein	
c1	ncRNA	835058	835128	-	BALIOE_03830	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	835352	838153	+	BALIOE_03835		hypothetical protein	
c1	cds	838168	839385	+	BALIOE_03840		hypothetical protein	
c1	cds	839479	840645	+	BALIOE_03845		hypothetical protein	
c1	cds	840645	841514	+	BALIOE_03850		hypothetical protein	
c1	cds	842181	843086	+	BALIOE_03855		hypothetical protein	
c1	cds	843120	843722	-	BALIOE_03860		hypothetical protein	
c1	cds	843732	845384	-	BALIOE_03865		hypothetical protein	
c1	cds	845492	846772	-	BALIOE_03870		hypothetical protein	
c1	cds	846933	847250	-	BALIOE_03875		hypothetical protein	
c1	cds	847247	848617	-	BALIOE_03880		hypothetical protein	
c1	cds	848621	849862	-	BALIOE_03885		hypothetical protein	
c1	cds	849862	851307	-	BALIOE_03890		hypothetical protein	
c1	cds	851326	852714	-	BALIOE_03895		hypothetical protein	
c1	cds	852714	853163	-	BALIOE_03900		hypothetical protein	
c1	cds	853711	854133	-	BALIOE_03905		hypothetical protein	
c1	cds	854215	855159	-	BALIOE_03910		hypothetical protein	
c1	cds	855965	857533	+	BALIOE_03915		hypothetical protein	
c1	cds	857549	858688	+	BALIOE_03920		hypothetical protein	
c1	cds	858703	858816	+	BALIOE_03925		hypothetical protein	
c1	cds	858816	859109	+	BALIOE_03930		hypothetical protein	
c1	cds	859259	859663	+	BALIOE_03935		hypothetical protein	
c1	cds	859660	860352	+	BALIOE_03940		hypothetical protein	
c1	cds	860356	860784	+	BALIOE_03945		hypothetical protein	
c1	cds	860849	862033	+	BALIOE_03950		hypothetical protein	
c1	cds	862166	863458	+	BALIOE_03955		hypothetical protein	
c1	cds	863493	864014	+	BALIOE_03960		hypothetical protein	
c1	cds	864024	864815	+	BALIOE_03965		hypothetical protein	
c1	tRNA	864980	865055	+	BALIOE_03970	Lys_trna	tRNA-Lys	SO:0000265
c1	tRNA	865091	865166	+	BALIOE_03975	Val_trna	tRNA-Val	SO:0000273
c1	tRNA	865169	865244	+	BALIOE_03980	Lys_trna	tRNA-Lys	SO:0000265
c1	tRNA	865296	865371	+	BALIOE_03985	Val_trna	tRNA-Val	SO:0000273
c1	tRNA	865375	865450	+	BALIOE_03990	Lys_trna	tRNA-Lys	SO:0000265
c1	tRNA	865597	865672	+	BALIOE_03995	Lys_trna	tRNA-Lys	SO:0000265
c1	cds	865950	866993	+	BALIOE_04000		hypothetical protein	
c1	cds	867031	867750	+	BALIOE_04005		hypothetical protein	
c1	cds	867747	868688	-	BALIOE_04010		hypothetical protein	
c1	cds	868802	869182	-	BALIOE_04015		hypothetical protein	
c1	cds	869498	870550	+	BALIOE_04020		hypothetical protein	
c1	cds	870716	871468	-	BALIOE_04025		hypothetical protein	
c1	cds	871670	872710	-	BALIOE_04030		hypothetical protein	
c1	cds	872704	873852	-	BALIOE_04035		hypothetical protein	
c1	cds	873856	874902	-	BALIOE_04040		hypothetical protein	
c1	cds	874912	875928	-	BALIOE_04045		hypothetical protein	
c1	cds	876190	877662	-	BALIOE_04050		hypothetical protein	
c1	cds	877730	878518	-	BALIOE_04055		hypothetical protein	
c1	cds	878647	878796	+	BALIOE_04060		hypothetical protein	
c1	cds	878963	879736	+	BALIOE_04065		hypothetical protein	
c1	cds	879736	880425	+	BALIOE_04070		hypothetical protein	
c1	cds	880428	881486	+	BALIOE_04075		hypothetical protein	
c1	cds	881487	882305	-	BALIOE_04080		hypothetical protein	
c1	cds	882460	883455	+	BALIOE_04085		hypothetical protein	
c1	cds	883496	884449	-	BALIOE_04090		hypothetical protein	
c1	cds	884633	885685	+	BALIOE_04095		hypothetical protein	
c1	cds	885761	887194	+	BALIOE_04100		hypothetical protein	
c1	cds	887377	889638	+	BALIOE_04105		hypothetical protein	
c1	cds	889779	891062	-	BALIOE_04110		hypothetical protein	
c1	cds	891197	891967	-	BALIOE_04115		hypothetical protein	
c1	cds	892499	892666	-	BALIOE_04120		hypothetical protein	
c1	cds	892909	893511	+	BALIOE_04125		hypothetical protein	
c1	cds	893722	893943	-	BALIOE_04130		hypothetical protein	
c1	cds	894042	894257	-	BALIOE_04135		hypothetical protein	
c1	cds	894334	894525	-	BALIOE_04140		hypothetical protein	
c1	cds	894498	894680	-	BALIOE_04145		hypothetical protein	
c1	cds	894677	895357	-	BALIOE_04150		hypothetical protein	
c1	cds	895354	896001	-	BALIOE_04155		hypothetical protein	
c1	cds	896394	897017	+	BALIOE_04160		hypothetical protein	
c1	cds	897014	897679	+	BALIOE_04165		hypothetical protein	
c1	cds	897891	898850	-	BALIOE_04170		hypothetical protein	
c1	cds	899325	900014	+	BALIOE_04175		hypothetical protein	
c1	cds	900198	900941	+	BALIOE_04180		hypothetical protein	
c1	cds	900880	901005	-	BALIOE_04185		hypothetical protein	
c1	cds	901807	902022	+	BALIOE_04190		hypothetical protein	
c1	cds	902022	902519	+	BALIOE_04195		hypothetical protein	
c1	cds	902516	902983	+	BALIOE_04200		hypothetical protein	
c1	cds	902971	903123	+	BALIOE_04205		hypothetical protein	
c1	cds	903798	904289	+	BALIOE_04210		hypothetical protein	
c1	cds	904289	906391	+	BALIOE_04215		hypothetical protein	
c1	cds	906388	906600	+	BALIOE_04220		hypothetical protein	
c1	cds	906600	907652	+	BALIOE_04225		hypothetical protein	
c1	cds	907747	908109	+	BALIOE_04230		hypothetical protein	
c1	cds	908054	910081	+	BALIOE_04235		hypothetical protein	
c1	cds	910168	910491	+	BALIOE_04240		hypothetical protein	
c1	cds	910484	910759	+	BALIOE_04245		hypothetical protein	
c1	cds	910771	911349	+	BALIOE_04250		hypothetical protein	
c1	cds	911346	911747	+	BALIOE_04255		hypothetical protein	
c1	cds	911758	912501	+	BALIOE_04260		hypothetical protein	
c1	cds	912562	912948	+	BALIOE_04265		hypothetical protein	
c1	cds	912957	913286	+	BALIOE_04270		hypothetical protein	
c1	cds	913258	916323	+	BALIOE_04275		hypothetical protein	
c1	cds	916323	916652	+	BALIOE_04280		hypothetical protein	
c1	cds	916662	917360	+	BALIOE_04285		hypothetical protein	
c1	cds	917366	918109	+	BALIOE_04290		hypothetical protein	
c1	cds	918142	918654	+	BALIOE_04295		hypothetical protein	
c1	cds	918715	922128	+	BALIOE_04300		hypothetical protein	
c1	cds	922199	922798	+	BALIOE_04305		hypothetical protein	
c1	cds	922858	924174	+	BALIOE_04310		hypothetical protein	
c1	cds	924176	924445	+	BALIOE_04315		hypothetical protein	
c1	cds	924622	925602	+	BALIOE_04320		hypothetical protein	
c1	cds	925636	926655	+	BALIOE_04325		hypothetical protein	
c1	cds	927756	928364	+	BALIOE_04330		hypothetical protein	
c1	cds	928399	928533	+	BALIOE_04335		hypothetical protein	
c1	cds	928595	929293	+	BALIOE_04340		hypothetical protein	
c1	cds	929800	930276	-	BALIOE_04345		hypothetical protein	
c1	cds	930335	931624	-	BALIOE_04350		hypothetical protein	
c1	cds	931711	932751	+	BALIOE_04355		hypothetical protein	
c1	cds	932748	933902	+	BALIOE_04360		hypothetical protein	
c1	cds	933889	934644	+	BALIOE_04365		hypothetical protein	
c1	cds	934637	935314	+	BALIOE_04370		hypothetical protein	
c1	cds	935893	937914	+	BALIOE_04375		hypothetical protein	
c1	cds	938105	939013	-	BALIOE_04380		hypothetical protein	
c1	cds	939410	940399	+	BALIOE_04385		hypothetical protein	
c1	cds	940421	940933	+	BALIOE_04390		hypothetical protein	
c1	cds	940936	941421	+	BALIOE_04395		hypothetical protein	
c1	cds	941414	941659	+	BALIOE_04400		hypothetical protein	
c1	cds	941661	942113	+	BALIOE_04405		hypothetical protein	
c1	cds	942249	942953	+	BALIOE_04410		hypothetical protein	
c1	cds	943161	943874	+	BALIOE_04415		hypothetical protein	
c1	cds	943910	944866	-	BALIOE_04420		hypothetical protein	
c1	cds	944866	946107	-	BALIOE_04425		hypothetical protein	
c1	cds	946104	946865	-	BALIOE_04430		hypothetical protein	
c1	cds	946998	947408	+	BALIOE_04435		hypothetical protein	
c1	cds	947370	948476	-	BALIOE_04440		hypothetical protein	
c1	cds	948487	949620	-	BALIOE_04445		hypothetical protein	
c1	cds	949613	951349	-	BALIOE_04450		hypothetical protein	
c1	cds	951342	952337	-	BALIOE_04455		hypothetical protein	
c1	cds	952340	953011	-	BALIOE_04460		hypothetical protein	
c1	cds	953240	954607	+	BALIOE_04465		hypothetical protein	
c1	cds	955215	957227	+	BALIOE_04470		hypothetical protein	
c1	cds	957511	959661	+	BALIOE_04475		hypothetical protein	
c1	cds	959689	960651	+	BALIOE_04480		hypothetical protein	
c1	cds	960792	961877	+	BALIOE_04485		hypothetical protein	
c1	ncRNA	962029	962099	-	BALIOE_04490	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	962106	962366	-	BALIOE_04495		hypothetical protein	
c1	cds	962631	962897	-	BALIOE_04500		hypothetical protein	
c1	cds	962973	963656	-	BALIOE_04505		hypothetical protein	
c1	cds	963701	965983	-	BALIOE_04510		hypothetical protein	
c1	cds	966248	966508	-	BALIOE_04515		hypothetical protein	
c1	cds	966784	967710	+	BALIOE_04520		hypothetical protein	
c1	cds	967707	969932	-	BALIOE_04525		hypothetical protein	
c1	cds	970049	970771	-	BALIOE_04530		hypothetical protein	
c1	cds	970768	971427	-	BALIOE_04535		hypothetical protein	
c1	cds	971565	972311	-	BALIOE_04540		hypothetical protein	
c1	cds	972715	973218	-	BALIOE_04545		hypothetical protein	
c1	cds	973517	974404	-	BALIOE_04550		hypothetical protein	
c1	cds	974757	975272	+	BALIOE_04555		hypothetical protein	
c1	cds	975321	976904	-	BALIOE_04560		hypothetical protein	
c1	cds	977176	977304	-	BALIOE_04565		hypothetical protein	
c1	cds	977490	977957	+	BALIOE_04570		hypothetical protein	
c1	cds	977954	979072	+	BALIOE_04575		hypothetical protein	
c1	cds	979130	980050	-	BALIOE_04580		hypothetical protein	
c1	cds	980269	981861	+	BALIOE_04585		hypothetical protein	
c1	cds	982029	983294	-	BALIOE_04590		hypothetical protein	
c1	cds	983446	984261	-	BALIOE_04595		hypothetical protein	
c1	cds	984407	986206	-	BALIOE_04600		hypothetical protein	
c1	cds	986284	986838	-	BALIOE_04605		hypothetical protein	
c1	cds	986844	987743	-	BALIOE_04610		hypothetical protein	
c1	cds	987874	988536	+	BALIOE_04615		hypothetical protein	
c1	ncRNA	988625	988702	+	BALIOE_04620	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	988715	989464	-	BALIOE_04625		hypothetical protein	
c1	cds	989464	990699	-	BALIOE_04630		hypothetical protein	
c1	cds	990903	991250	+	BALIOE_04635		hypothetical protein	
c1	cds	991263	991868	+	BALIOE_04640		hypothetical protein	
c1	cds	991855	993726	+	BALIOE_04645		hypothetical protein	
c1	cds	993746	995284	+	BALIOE_04650		hypothetical protein	
c1	cds	995302	996222	+	BALIOE_04655		hypothetical protein	
c1	cds	996225	997136	+	BALIOE_04660		hypothetical protein	
c1	cds	997314	999662	+	BALIOE_04665		hypothetical protein	
c1	cds	999670	1000998	+	BALIOE_04670		hypothetical protein	
c1	cds	1001068	1001397	-	BALIOE_04675		hypothetical protein	
c1	cds	1001387	1001773	-	BALIOE_04680		hypothetical protein	
c1	cds	1001999	1003324	-	BALIOE_04685		hypothetical protein	
c1	cds	1003537	1003920	+	BALIOE_04690		hypothetical protein	
c1	cds	1004031	1005146	+	BALIOE_04695		hypothetical protein	
c1	cds	1005143	1005769	-	BALIOE_04700		hypothetical protein	
c1	cds	1006015	1007217	+	BALIOE_04705		hypothetical protein	
c1	cds	1007264	1008022	-	BALIOE_04710		hypothetical protein	
c1	cds	1008080	1008676	-	BALIOE_04715		hypothetical protein	
c1	cds	1008961	1010193	+	BALIOE_04720		hypothetical protein	
c1	cds	1010234	1010512	-	BALIOE_04725		hypothetical protein	
c1	cds	1010604	1011419	-	BALIOE_04730		hypothetical protein	
c1	cds	1011419	1012627	-	BALIOE_04735		hypothetical protein	
c1	cds	1012711	1013247	+	BALIOE_04740		hypothetical protein	
c1	cds	1013422	1015107	-	BALIOE_04745		hypothetical protein	
c1	cds	1015377	1015754	+	BALIOE_04750		hypothetical protein	
c1	cds	1015784	1016041	-	BALIOE_04755		hypothetical protein	
c1	cds	1016201	1016488	+	BALIOE_04760		hypothetical protein	
c1	cds	1016472	1017194	+	BALIOE_04765		hypothetical protein	
c1	cds	1017255	1018157	+	BALIOE_04770		hypothetical protein	
c1	cds	1018245	1018721	+	BALIOE_04775		hypothetical protein	
c1	cds	1019072	1020184	+	BALIOE_04780		hypothetical protein	
c1	cds	1020279	1021412	+	BALIOE_04785		hypothetical protein	
c1	cds	1021422	1022375	+	BALIOE_04790		hypothetical protein	
c1	cds	1022372	1023217	+	BALIOE_04795		hypothetical protein	
c1	cds	1023277	1023765	+	BALIOE_04800		hypothetical protein	
c1	cds	1023806	1024933	+	BALIOE_04805		hypothetical protein	
c1	cds	1025231	1026556	+	BALIOE_04810		hypothetical protein	
c1	cds	1026578	1026898	+	BALIOE_04815		hypothetical protein	
c1	cds	1026910	1028391	+	BALIOE_04820		hypothetical protein	
c1	cds	1028442	1029173	-	BALIOE_04825		hypothetical protein	
c1	cds	1029327	1029464	-	BALIOE_04830		hypothetical protein	
c1	ncRNA	1029351	1029431	+	BALIOE_04835	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	1029464	1030132	-	BALIOE_04840		hypothetical protein	
c1	cds	1030132	1030848	-	BALIOE_04845		hypothetical protein	
c1	cds	1030855	1031586	-	BALIOE_04850		hypothetical protein	
c1	cds	1031604	1032332	-	BALIOE_04855		hypothetical protein	
c1	cds	1032550	1033065	-	BALIOE_04860		hypothetical protein	
c1	cds	1033689	1034930	+	BALIOE_04865		hypothetical protein	
c1	cds	1035205	1035495	+	BALIOE_04870		hypothetical protein	
c1	cds	1035706	1036029	+	BALIOE_04875		hypothetical protein	
c1	cds	1036026	1036856	+	BALIOE_04880		hypothetical protein	
c1	cds	1036853	1037866	-	BALIOE_04885		hypothetical protein	
c1	cds	1037965	1039395	-	BALIOE_04890		hypothetical protein	
c1	cds	1039406	1040407	-	BALIOE_04895		hypothetical protein	
c1	cds	1040444	1042162	-	BALIOE_04900		hypothetical protein	
c1	cds	1042295	1043263	-	BALIOE_04905		hypothetical protein	
c1	cds	1043275	1044927	-	BALIOE_04910		hypothetical protein	
c1	cds	1045071	1045970	-	BALIOE_04915		hypothetical protein	
c1	cds	1046428	1047123	-	BALIOE_04920		hypothetical protein	
c1	cds	1047549	1049207	+	BALIOE_04925		hypothetical protein	
c1	cds	1049204	1050196	-	BALIOE_04930		hypothetical protein	
c1	cds	1050311	1051426	+	BALIOE_04935		hypothetical protein	
c1	cds	1051423	1053369	+	BALIOE_04940		hypothetical protein	
c1	cds	1053442	1053666	-	BALIOE_04945		hypothetical protein	
c1	cds	1053989	1054309	+	BALIOE_04950		hypothetical protein	
c1	cds	1054340	1056616	+	BALIOE_04955		hypothetical protein	
c1	tRNA	1056962	1057049	-	BALIOE_04960	Ser_trna	tRNA-Ser	SO:0000269
c1	cds	1057303	1057521	-	BALIOE_04965		hypothetical protein	
c1	cds	1057806	1058510	-	BALIOE_04970		hypothetical protein	
c1	cds	1058552	1060273	-	BALIOE_04975		hypothetical protein	
c1	cds	1060274	1062040	-	BALIOE_04980		hypothetical protein	
c1	cds	1062163	1063128	-	BALIOE_04985		hypothetical protein	
c1	cds	1063673	1064167	+	BALIOE_04990		hypothetical protein	
c1	cds	1064302	1068330	+	BALIOE_04995		hypothetical protein	
c1	cds	1068485	1069096	+	BALIOE_05000		hypothetical protein	
c1	cds	1069107	1070450	+	BALIOE_05005		hypothetical protein	
c1	cds	1070541	1071833	+	BALIOE_05010		hypothetical protein	
c1	cds	1072072	1074516	+	BALIOE_05015		hypothetical protein	
c1	cds	1074527	1075144	+	BALIOE_05020		hypothetical protein	
c1	cds	1075146	1076009	+	BALIOE_05025		hypothetical protein	
c1	cds	1076045	1076671	-	BALIOE_05030		hypothetical protein	
c1	cds	1076986	1078134	+	BALIOE_05035		hypothetical protein	
c1	cds	1078344	1079774	+	BALIOE_05040		hypothetical protein	
c1	cds	1079984	1080724	-	BALIOE_05045		hypothetical protein	
c1	cds	1080916	1083198	-	BALIOE_05050		hypothetical protein	
c1	cds	1083253	1084110	-	BALIOE_05055		hypothetical protein	
c1	cds	1084516	1086276	-	BALIOE_05060		hypothetical protein	
c1	cds	1086406	1087098	+	BALIOE_05065		hypothetical protein	
c1	cds	1087297	1088385	+	BALIOE_05070		hypothetical protein	
c1	cds	1088456	1089739	+	BALIOE_05075		hypothetical protein	
c1	cds	1089908	1090672	+	BALIOE_05080		hypothetical protein	
c1	cds	1090845	1091528	+	BALIOE_05085		hypothetical protein	
c1	cds	1091639	1093312	+	BALIOE_05090		hypothetical protein	
c1	cds	1093472	1093756	+	BALIOE_05095		hypothetical protein	
c1	cds	1093963	1096227	+	BALIOE_05100		hypothetical protein	
c1	cds	1096264	1098012	+	BALIOE_05105		hypothetical protein	
c1	cds	1098009	1098995	+	BALIOE_05110		hypothetical protein	
c1	cds	1099032	1100264	+	BALIOE_05115		hypothetical protein	
c1	cds	1100316	1100498	+	BALIOE_05120		hypothetical protein	
c1	cds	1100495	1101241	+	BALIOE_05125		hypothetical protein	
c1	cds	1101395	1102288	+	BALIOE_05130		hypothetical protein	
c1	cds	1102265	1103044	-	BALIOE_05135		hypothetical protein	
c1	cds	1103180	1103965	+	BALIOE_05140		hypothetical protein	
c1	cds	1103962	1105284	+	BALIOE_05145		hypothetical protein	
c1	cds	1105265	1105969	+	BALIOE_05150		hypothetical protein	
c1	cds	1105969	1110429	+	BALIOE_05155		hypothetical protein	
c1	cds	1110690	1112537	+	BALIOE_05160		hypothetical protein	
c1	cds	1112718	1113266	+	BALIOE_05165		hypothetical protein	
c1	cds	1113293	1113940	+	BALIOE_05170		hypothetical protein	
c1	cds	1113991	1115181	-	BALIOE_05175		hypothetical protein	
c1	cds	1115366	1116454	-	BALIOE_05180		hypothetical protein	
c1	cds	1117057	1118457	-	BALIOE_05185		hypothetical protein	
c1	cds	1118626	1119828	-	BALIOE_05190		hypothetical protein	
c1	cds	1120094	1122706	+	BALIOE_05195		hypothetical protein	
c1	cds	1122749	1123516	-	BALIOE_05200		hypothetical protein	
c1	cds	1123513	1124304	-	BALIOE_05205		hypothetical protein	
c1	cds	1124316	1125461	-	BALIOE_05210		hypothetical protein	
c1	cds	1125458	1126417	-	BALIOE_05215		hypothetical protein	
c1	cds	1126410	1126985	-	BALIOE_05220		hypothetical protein	
c1	cds	1127341	1127880	+	BALIOE_05225		hypothetical protein	
c1	cds	1127963	1128664	+	BALIOE_05230		hypothetical protein	
c1	cds	1128689	1129291	+	BALIOE_05235		hypothetical protein	
c1	cds	1129327	1131288	+	BALIOE_05240		hypothetical protein	
c1	cds	1131279	1132259	+	BALIOE_05245		hypothetical protein	
c1	cds	1132428	1132904	+	BALIOE_05250		hypothetical protein	
c1	cds	1132864	1133427	+	BALIOE_05255		hypothetical protein	
c1	cds	1133441	1133962	+	BALIOE_05260		hypothetical protein	
c1	cds	1134240	1135250	+	BALIOE_05265		hypothetical protein	
c1	cds	1135424	1135966	+	BALIOE_05270		hypothetical protein	
c1	cds	1135963	1137072	-	BALIOE_05275		hypothetical protein	
c1	cds	1137316	1139424	+	BALIOE_05280		hypothetical protein	
c1	cds	1139436	1141343	+	BALIOE_05285		hypothetical protein	
c1	cds	1141473	1142726	+	BALIOE_05290		hypothetical protein	
c1	cds	1142731	1144371	+	BALIOE_05295		hypothetical protein	
c1	cds	1144368	1144931	+	BALIOE_05300		hypothetical protein	
c1	cds	1145187	1145354	+	BALIOE_05305		hypothetical protein	
c1	cds	1145424	1146050	-	BALIOE_05310		hypothetical protein	
c1	cds	1146011	1147771	-	BALIOE_05315		hypothetical protein	
c1	cds	1147957	1148409	+	BALIOE_05320		hypothetical protein	
c1	cds	1148485	1149525	-	BALIOE_05325		hypothetical protein	
c1	cds	1149882	1150391	-	BALIOE_05330		hypothetical protein	
c1	cds	1150610	1151239	+	BALIOE_05335		hypothetical protein	
c1	cds	1151202	1153364	-	BALIOE_05340		hypothetical protein	
c1	cds	1153374	1153820	-	BALIOE_05345		hypothetical protein	
c1	cds	1153943	1155997	+	BALIOE_05350		hypothetical protein	
c1	cds	1156029	1156487	-	BALIOE_05355		hypothetical protein	
c1	cds	1156583	1157245	-	BALIOE_05360		hypothetical protein	
c1	cds	1157418	1157831	+	BALIOE_05365		hypothetical protein	
c1	cds	1157876	1158193	-	BALIOE_05370		hypothetical protein	
c1	cds	1158251	1159426	-	BALIOE_05375		hypothetical protein	
c1	cds	1159536	1159814	+	BALIOE_05380		hypothetical protein	
c1	cds	1159811	1160140	-	BALIOE_05385		hypothetical protein	
c1	cds	1160231	1160890	-	BALIOE_05390		hypothetical protein	
c1	tRNA	1161097	1161186	-	BALIOE_05395	Ser_trna	(pseudo) tRNA-Ser	SO:0000269
c1	cds	1161298	1162317	-	BALIOE_05400		hypothetical protein	
c1	cds	1162295	1162537	-	BALIOE_05405		hypothetical protein	
c1	cds	1162605	1165076	-	BALIOE_05410		hypothetical protein	
c1	cds	1165170	1165361	-	BALIOE_05415		hypothetical protein	
c1	cds	1165358	1165546	-	BALIOE_05420		hypothetical protein	
c1	cds	1166120	1166305	+	BALIOE_05425		hypothetical protein	
c1	cds	1166492	1166881	-	BALIOE_05430		hypothetical protein	
c1	cds	1166893	1167021	-	BALIOE_05435		hypothetical protein	
c1	cds	1167023	1167178	-	BALIOE_05440		hypothetical protein	
c1	cds	1167743	1167934	-	BALIOE_05445		hypothetical protein	
c1	cds	1167962	1168363	-	BALIOE_05450		hypothetical protein	
c1	cds	1168472	1168744	+	BALIOE_05455		hypothetical protein	
c1	cds	1168728	1169153	+	BALIOE_05460		hypothetical protein	
c1	cds	1169360	1169815	-	BALIOE_05465		hypothetical protein	
c1	cds	1169894	1170985	+	BALIOE_05470		hypothetical protein	
c1	cds	1170992	1171738	+	BALIOE_05475		hypothetical protein	
c1	cds	1171760	1172530	+	BALIOE_05480		hypothetical protein	
c1	cds	1172546	1172959	+	BALIOE_05485		hypothetical protein	
c1	cds	1173311	1174084	-	BALIOE_05490		hypothetical protein	
c1	cds	1174450	1174587	-	BALIOE_05495		hypothetical protein	
c1	cds	1174632	1174844	+	BALIOE_05500		hypothetical protein	
c1	cds	1175292	1176341	+	BALIOE_05505		hypothetical protein	
c1	cds	1176354	1176725	+	BALIOE_05510		hypothetical protein	
c1	cds	1176715	1177086	+	BALIOE_05515		hypothetical protein	
c1	cds	1177238	1178056	+	BALIOE_05520		hypothetical protein	
c1	cds	1178343	1178582	+	BALIOE_05525		hypothetical protein	
c1	cds	1178646	1178786	-	BALIOE_05530		hypothetical protein	
c1	cds	1178803	1179390	+	BALIOE_05535		hypothetical protein	
c1	tRNA	1179419	1179494	+	BALIOE_05540	Ile2_trna	tRNA-Ile2	SO:0000263
c1	tRNA	1179502	1179578	+	BALIOE_05545	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	1179592	1179668	+	BALIOE_05550	Arg_trna	tRNA-Arg	SO:0001036
c1	cds	1180158	1182008	+	BALIOE_05555		hypothetical protein	
c1	cds	1182184	1182510	+	BALIOE_05560		hypothetical protein	
c1	cds	1182510	1183160	+	BALIOE_05565		hypothetical protein	
c1	cds	1183365	1183679	-	BALIOE_05570		hypothetical protein	
c1	cds	1184145	1184669	-	BALIOE_05575		hypothetical protein	
c1	cds	1184614	1184727	-	BALIOE_05580		hypothetical protein	
c1	cds	1184948	1185481	-	BALIOE_05585		hypothetical protein	
c1	cds	1185641	1185913	+	BALIOE_05590		hypothetical protein	
c1	cds	1186169	1186375	-	BALIOE_05595		hypothetical protein	
c1	cds	1187126	1187401	+	BALIOE_05600		hypothetical protein	
c1	cds	1187477	1187857	+	BALIOE_05605		hypothetical protein	
c1	cds	1187854	1188201	+	BALIOE_05610		hypothetical protein	
c1	cds	1188251	1189789	+	BALIOE_05615		hypothetical protein	
c1	cds	1189823	1189939	-	BALIOE_05620		hypothetical protein	
c1	cds	1190017	1191981	+	BALIOE_05625		hypothetical protein	
c1	cds	1191965	1192171	+	BALIOE_05630		hypothetical protein	
c1	cds	1192168	1193760	+	BALIOE_05635		hypothetical protein	
c1	cds	1193750	1195255	+	BALIOE_05640		hypothetical protein	
c1	cds	1195292	1195639	+	BALIOE_05645		hypothetical protein	
c1	cds	1195697	1195963	+	BALIOE_05650		hypothetical protein	
c1	cds	1196056	1196685	+	BALIOE_05655		hypothetical protein	
c1	cds	1196699	1197130	+	BALIOE_05660		hypothetical protein	
c1	cds	1197157	1197570	+	BALIOE_05665		hypothetical protein	
c1	cds	1197551	1200130	+	BALIOE_05670		hypothetical protein	
c1	cds	1200127	1200456	+	BALIOE_05675		hypothetical protein	
c1	cds	1200456	1201154	+	BALIOE_05680		hypothetical protein	
c1	cds	1201165	1201908	+	BALIOE_05685		hypothetical protein	
c1	cds	1201905	1202486	+	BALIOE_05690		hypothetical protein	
c1	cds	1202677	1203204	-	BALIOE_05695		hypothetical protein	
c1	cds	1203338	1206811	+	BALIOE_05700		hypothetical protein	
c1	cds	1206879	1207478	+	BALIOE_05705		hypothetical protein	
c1	cds	1207543	1208856	+	BALIOE_05710		hypothetical protein	
c1	cds	1208858	1209127	+	BALIOE_05715		hypothetical protein	
c1	cds	1209252	1209962	-	BALIOE_05720		hypothetical protein	
c1	cds	1210601	1210783	-	BALIOE_05725		hypothetical protein	
c1	tRNA	1210888	1210975	-	BALIOE_05730	Ser_trna	tRNA-Ser	SO:0000269
c1	cds	1211401	1212519	+	BALIOE_05735		hypothetical protein	
c1	cds	1212516	1214309	+	BALIOE_05740		hypothetical protein	
c1	cds	1214328	1215035	+	BALIOE_05745		hypothetical protein	
c1	cds	1215032	1215619	+	BALIOE_05750		hypothetical protein	
c1	cds	1215616	1216014	+	BALIOE_05755		hypothetical protein	
c1	cds	1216011	1216868	+	BALIOE_05760		hypothetical protein	
c1	cds	1217002	1218546	+	BALIOE_05765		hypothetical protein	
c1	cds	1218558	1219694	+	BALIOE_05770		hypothetical protein	
c1	cds	1219879	1221183	+	BALIOE_05775		hypothetical protein	
c1	cds	1221303	1223483	-	BALIOE_05780		hypothetical protein	
c1	cds	1223503	1223949	-	BALIOE_05785		hypothetical protein	
c1	cds	1223937	1225076	-	BALIOE_05790		hypothetical protein	
c1	cds	1225122	1227218	-	BALIOE_05795		hypothetical protein	
c1	cds	1227218	1227964	-	BALIOE_05800		hypothetical protein	
c1	cds	1227961	1228605	-	BALIOE_05805		hypothetical protein	
c1	cds	1228712	1229017	-	BALIOE_05810		hypothetical protein	
c1	cds	1229957	1230169	+	BALIOE_05815		hypothetical protein	
c1	cds	1230784	1231857	-	BALIOE_05820		hypothetical protein	
c1	cds	1231929	1234628	-	BALIOE_05825		hypothetical protein	
c1	cds	1234756	1235784	+	BALIOE_05830		hypothetical protein	
c1	cds	1235757	1236449	-	BALIOE_05835		hypothetical protein	
c1	cds	1236579	1237751	+	BALIOE_05840		hypothetical protein	
c1	cds	1237751	1240297	+	BALIOE_05845		hypothetical protein	
c1	cds	1240294	1240893	+	BALIOE_05850		hypothetical protein	
c1	ncRNA	1240905	1240985	-	BALIOE_05855	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	1241047	1241352	-	BALIOE_05860		hypothetical protein	
c1	cds	1241352	1242272	-	BALIOE_05865		hypothetical protein	
c1	cds	1242532	1243431	+	BALIOE_05870		hypothetical protein	
c1	cds	1243541	1243789	+	BALIOE_05875		hypothetical protein	
c1	cds	1244080	1245321	+	BALIOE_05880		hypothetical protein	
c1	cds	1245359	1245586	-	BALIOE_05885		hypothetical protein	
c1	cds	1245607	1246185	-	BALIOE_05890		hypothetical protein	
c1	cds	1246182	1247492	-	BALIOE_05895		hypothetical protein	
c1	cds	1247545	1247829	-	BALIOE_05900		hypothetical protein	
c1	cds	1247915	1248214	-	BALIOE_05905		hypothetical protein	
c1	cds	1248286	1248570	-	BALIOE_05910		hypothetical protein	
c1	cds	1248563	1249186	-	BALIOE_05915		hypothetical protein	
c1	cds	1249190	1249477	-	BALIOE_05920		hypothetical protein	
c1	cds	1249479	1249697	-	BALIOE_05925		hypothetical protein	
c1	cds	1249699	1249914	-	BALIOE_05930		hypothetical protein	
c1	cds	1249916	1250104	-	BALIOE_05935		hypothetical protein	
c1	cds	1250256	1251029	-	BALIOE_05940		hypothetical protein	
c1	cds	1251026	1251247	-	BALIOE_05945		hypothetical protein	
c1	cds	1251346	1251561	-	BALIOE_05950		hypothetical protein	
c1	cds	1251638	1251829	-	BALIOE_05955		hypothetical protein	
c1	cds	1251802	1251984	-	BALIOE_05960		hypothetical protein	
c1	cds	1251981	1252661	-	BALIOE_05965		hypothetical protein	
c1	cds	1252658	1253443	-	BALIOE_05970		hypothetical protein	
c1	cds	1253449	1253745	-	BALIOE_05975		hypothetical protein	
c1	cds	1253820	1253963	-	BALIOE_05980		hypothetical protein	
c1	cds	1253932	1254096	-	BALIOE_05985		hypothetical protein	
c1	cds	1254169	1254537	-	BALIOE_05990		hypothetical protein	
c1	cds	1254720	1254971	-	BALIOE_05995		hypothetical protein	
c1	cds	1255030	1255302	-	BALIOE_06000		hypothetical protein	
c1	cds	1255280	1255462	-	BALIOE_06005		hypothetical protein	
c1	cds	1256031	1256552	-	BALIOE_06010		hypothetical protein	
c1	cds	1257054	1257707	-	BALIOE_06015		hypothetical protein	
c1	cds	1257825	1258040	+	BALIOE_06020		hypothetical protein	
c1	cds	1258182	1258478	+	BALIOE_06025		hypothetical protein	
c1	cds	1258511	1258657	+	BALIOE_06030		hypothetical protein	
c1	cds	1258650	1259549	+	BALIOE_06035		hypothetical protein	
c1	cds	1259539	1260975	+	BALIOE_06040		hypothetical protein	
c1	cds	1260975	1261244	+	BALIOE_06045		hypothetical protein	
c1	cds	1261315	1261593	+	BALIOE_06050		hypothetical protein	
c1	cds	1261726	1261941	+	BALIOE_06055		hypothetical protein	
c1	cds	1261952	1262188	+	BALIOE_06060		hypothetical protein	
c1	cds	1262145	1262591	+	BALIOE_06065		hypothetical protein	
c1	cds	1262588	1263115	+	BALIOE_06070		hypothetical protein	
c1	cds	1263569	1264303	+	BALIOE_06075		hypothetical protein	
c1	cds	1264378	1265100	+	BALIOE_06080		hypothetical protein	
c1	cds	1265100	1265705	+	BALIOE_06085		hypothetical protein	
c1	cds	1265702	1265896	+	BALIOE_06090		hypothetical protein	
c1	cds	1265889	1266323	+	BALIOE_06095		hypothetical protein	
c1	tRNA	1266765	1266840	+	BALIOE_06100	Ile2_trna	tRNA-Ile2	SO:0000263
c1	tRNA	1266850	1266926	+	BALIOE_06105	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	1266940	1267016	+	BALIOE_06110	Arg_trna	tRNA-Arg	SO:0001036
c1	cds	1267107	1268066	+	BALIOE_06115		hypothetical protein	
c1	cds	1268078	1268347	+	BALIOE_06120		hypothetical protein	
c1	cds	1268834	1270738	+	BALIOE_06125		hypothetical protein	
c1	cds	1270545	1271432	-	BALIOE_06130		hypothetical protein	
c1	cds	1271432	1271758	-	BALIOE_06135		hypothetical protein	
c1	cds	1271816	1272085	+	BALIOE_06140		hypothetical protein	
c1	cds	1272220	1272399	+	BALIOE_06145		hypothetical protein	
c1	cds	1272440	1272712	+	BALIOE_06150		hypothetical protein	
c1	cds	1272789	1273004	+	BALIOE_06155		hypothetical protein	
c1	cds	1273009	1273542	+	BALIOE_06160		hypothetical protein	
c1	cds	1273813	1274382	+	BALIOE_06165		hypothetical protein	
c1	cds	1274382	1274528	+	BALIOE_06170		hypothetical protein	
c1	cds	1274536	1275000	+	BALIOE_06175		hypothetical protein	
c1	cds	1275032	1275325	-	BALIOE_06180		hypothetical protein	
c1	cds	1275475	1275678	+	BALIOE_06185		hypothetical protein	
c1	cds	1275734	1276540	+	BALIOE_06190		hypothetical protein	
c1	cds	1276521	1278227	+	BALIOE_06195		hypothetical protein	
c1	cds	1278227	1280371	+	BALIOE_06200		hypothetical protein	
c1	cds	1280529	1281536	+	BALIOE_06205		hypothetical protein	
c1	cds	1281560	1282774	+	BALIOE_06210		hypothetical protein	
c1	cds	1282830	1283219	+	BALIOE_06215		hypothetical protein	
c1	cds	1283269	1283730	+	BALIOE_06220		hypothetical protein	
c1	cds	1283714	1284277	+	BALIOE_06225		hypothetical protein	
c1	cds	1284277	1284927	+	BALIOE_06230		hypothetical protein	
c1	cds	1284924	1286861	+	BALIOE_06235		hypothetical protein	
c1	cds	1286863	1287132	+	BALIOE_06240		hypothetical protein	
c1	cds	1287272	1287460	+	BALIOE_06245		hypothetical protein	
c1	cds	1287755	1289380	+	BALIOE_06250		hypothetical protein	
c1	cds	1289377	1290645	+	BALIOE_06255		hypothetical protein	
c1	cds	1290660	1290938	+	BALIOE_06260		hypothetical protein	
c1	cds	1290944	1291561	+	BALIOE_06265		hypothetical protein	
c1	cds	1291652	1292386	+	BALIOE_06270		hypothetical protein	
c1	cds	1292619	1292759	+	BALIOE_06275		hypothetical protein	
c1	cds	1292816	1293217	+	BALIOE_06280		hypothetical protein	
c1	cds	1293311	1293967	+	BALIOE_06285		hypothetical protein	
c1	cds	1293970	1294416	+	BALIOE_06290		hypothetical protein	
c1	cds	1294426	1294677	+	BALIOE_06295		hypothetical protein	
c1	cds	1294688	1295953	+	BALIOE_06300		hypothetical protein	
c1	cds	1296023	1304404	+	BALIOE_06305		hypothetical protein	
c1	cds	1304527	1304622	+	BALIOE_06310		hypothetical protein	
c1	cds	1304955	1305299	-	BALIOE_06315		hypothetical protein	
c1	cds	1305419	1305631	-	BALIOE_06320		hypothetical protein	
c1	cds	1305865	1306260	-	BALIOE_06325		hypothetical protein	
c1	cds	1306260	1306919	-	BALIOE_06330		hypothetical protein	
c1	cds	1306940	1307158	-	BALIOE_06335		hypothetical protein	
c1	cds	1307145	1307429	-	BALIOE_06340		hypothetical protein	
c1	cds	1307426	1307647	-	BALIOE_06345		hypothetical protein	
c1	cds	1307695	1308324	-	BALIOE_06350		hypothetical protein	
c1	cds	1309283	1309390	+	BALIOE_06355		hypothetical protein	
c1	cds	1309473	1310801	-	BALIOE_06360		hypothetical protein	
c1	cds	1310822	1311316	-	BALIOE_06365		hypothetical protein	
c1	cds	1311327	1311917	-	BALIOE_06370		hypothetical protein	
c1	cds	1311927	1312727	-	BALIOE_06375		hypothetical protein	
c1	cds	1312735	1313121	-	BALIOE_06380		hypothetical protein	
c1	cds	1313133	1313828	-	BALIOE_06385		hypothetical protein	
c1	cds	1313825	1314916	-	BALIOE_06390		hypothetical protein	
c1	cds	1315204	1315842	+	BALIOE_06395		hypothetical protein	
c1	cds	1315882	1319844	-	BALIOE_06400		hypothetical protein	
c1	cds	1319899	1320108	+	BALIOE_06405		hypothetical protein	
c1	cds	1320267	1321775	+	BALIOE_06410		hypothetical protein	
c1	cds	1321924	1323267	-	BALIOE_06415		hypothetical protein	
c1	cds	1324267	1324413	-	BALIOE_06420		hypothetical protein	
c1	cds	1324449	1325279	+	BALIOE_06425		hypothetical protein	
c1	cds	1325337	1326464	+	BALIOE_06430		hypothetical protein	
c1	cds	1326470	1327741	+	BALIOE_06435		hypothetical protein	
c1	cds	1328085	1329149	+	BALIOE_06440		hypothetical protein	
c1	cds	1329199	1329612	-	BALIOE_06445		hypothetical protein	
c1	cds	1329614	1330939	-	BALIOE_06450		hypothetical protein	
c1	cds	1330932	1332950	-	BALIOE_06455		hypothetical protein	
c1	cds	1332959	1335382	-	BALIOE_06460		hypothetical protein	
c1	cds	1335969	1337327	+	BALIOE_06465		hypothetical protein	
c1	cds	1337425	1339035	+	BALIOE_06470		hypothetical protein	
c1	cds	1339137	1339628	-	BALIOE_06475		hypothetical protein	
c1	cds	1339633	1340445	-	BALIOE_06480		hypothetical protein	
c1	cds	1341133	1341915	+	BALIOE_06485		hypothetical protein	
c1	cds	1342061	1342750	-	BALIOE_06490		hypothetical protein	
c1	cds	1342747	1344081	-	BALIOE_06495		hypothetical protein	
c1	cds	1344097	1346619	-	BALIOE_06500		hypothetical protein	
c1	cds	1346672	1347373	-	BALIOE_06505		hypothetical protein	
c1	cds	1347459	1348019	-	BALIOE_06510		hypothetical protein	
c1	cds	1348062	1348685	-	BALIOE_06515		hypothetical protein	
c1	cds	1348954	1349064	-	BALIOE_06520		hypothetical protein	
c1	cds	1350076	1353888	+	BALIOE_06525		hypothetical protein	
c1	cds	1353977	1355596	+	BALIOE_06530		hypothetical protein	
c1	cds	1355612	1355980	+	BALIOE_06535		hypothetical protein	
c1	cds	1355994	1356755	+	BALIOE_06540		hypothetical protein	
c1	cds	1356759	1357307	+	BALIOE_06545		hypothetical protein	
c1	cds	1357329	1357610	+	BALIOE_06550		hypothetical protein	
c1	cds	1357646	1358806	+	BALIOE_06555		hypothetical protein	
c1	cds	1358880	1361438	+	BALIOE_06560		hypothetical protein	
c1	cds	1361443	1362666	+	BALIOE_06565		hypothetical protein	
c1	cds	1362663	1363616	+	BALIOE_06570		hypothetical protein	
c1	cds	1363627	1364334	+	BALIOE_06575		hypothetical protein	
c1	cds	1364318	1364974	+	BALIOE_06580		hypothetical protein	
c1	cds	1364975	1366285	+	BALIOE_06585		hypothetical protein	
c1	cds	1366294	1367082	+	BALIOE_06590		hypothetical protein	
c1	cds	1367079	1368467	+	BALIOE_06595		hypothetical protein	
c1	cds	1368481	1369422	+	BALIOE_06600		hypothetical protein	
c1	cds	1369419	1370405	+	BALIOE_06605		hypothetical protein	
c1	cds	1370772	1371974	+	BALIOE_06610		hypothetical protein	
c1	cds	1372161	1373978	-	BALIOE_06615		hypothetical protein	
c1	cds	1376029	1377414	+	BALIOE_06620		hypothetical protein	
c1	cds	1378235	1378798	+	BALIOE_06625		hypothetical protein	
c1	cds	1378953	1381313	+	BALIOE_06630		hypothetical protein	
c1	cds	1381475	1381744	-	BALIOE_06635		hypothetical protein	
c1	cds	1382070	1383608	-	BALIOE_06640		hypothetical protein	
c1	cds	1383658	1384005	-	BALIOE_06645		hypothetical protein	
c1	cds	1384002	1384382	-	BALIOE_06650		hypothetical protein	
c1	cds	1384458	1384769	-	BALIOE_06655		hypothetical protein	
c1	cds	1384909	1385727	+	BALIOE_06660		hypothetical protein	
c1	cds	1385840	1386379	+	BALIOE_06665		hypothetical protein	
c1	cds	1386427	1386678	-	BALIOE_06670		hypothetical protein	
c1	cds	1386702	1386992	-	BALIOE_06675		hypothetical protein	
c1	cds	1387678	1388037	+	BALIOE_06680		hypothetical protein	
c1	cds	1388130	1389749	-	BALIOE_06685		hypothetical protein	
c1	cds	1389974	1390249	-	BALIOE_06690		hypothetical protein	
c1	cds	1390630	1391328	+	BALIOE_06695		hypothetical protein	
c1	cds	1391419	1391721	+	BALIOE_06700		hypothetical protein	
c1	cds	1391730	1392050	+	BALIOE_06705		hypothetical protein	
c1	cds	1392043	1393746	+	BALIOE_06710		hypothetical protein	
c1	cds	1393756	1394220	+	BALIOE_06715		hypothetical protein	
c1	cds	1394221	1394895	+	BALIOE_06720		hypothetical protein	
c1	cds	1394907	1395524	+	BALIOE_06725		hypothetical protein	
c1	cds	1395780	1396121	-	BALIOE_06730		hypothetical protein	
c1	cds	1396183	1396311	-	BALIOE_06735		hypothetical protein	
c1	cds	1396736	1396999	+	BALIOE_06740		hypothetical protein	
c1	cds	1397301	1397441	+	BALIOE_06745		hypothetical protein	
c1	cds	1398313	1398984	-	BALIOE_06750		hypothetical protein	
c1	cds	1400517	1401002	-	BALIOE_06755		hypothetical protein	
c1	cds	1401322	1401747	+	BALIOE_06760		hypothetical protein	
c1	cds	1401744	1402094	+	BALIOE_06765		hypothetical protein	
c1	cds	1402125	1403738	+	BALIOE_06770		hypothetical protein	
c1	cds	1403742	1404599	-	BALIOE_06775		hypothetical protein	
c1	cds	1404681	1405022	-	BALIOE_06780		hypothetical protein	
c1	cds	1405009	1405338	-	BALIOE_06785		hypothetical protein	
c1	cds	1405599	1406066	-	BALIOE_06790		hypothetical protein	
c1	cds	1406084	1407292	-	BALIOE_06795		hypothetical protein	
c1	cds	1407303	1408259	-	BALIOE_06800		hypothetical protein	
c1	cds	1408259	1409338	-	BALIOE_06805		hypothetical protein	
c1	cds	1409340	1410113	-	BALIOE_06810		hypothetical protein	
c1	cds	1410106	1411248	-	BALIOE_06815		hypothetical protein	
c1	cds	1411258	1412316	-	BALIOE_06820		hypothetical protein	
c1	cds	1412639	1413220	+	BALIOE_06825		hypothetical protein	
c1	cds	1413220	1414377	+	BALIOE_06830		hypothetical protein	
c1	cds	1414400	1414855	+	BALIOE_06835		hypothetical protein	
c1	cds	1414878	1415918	+	BALIOE_06840		hypothetical protein	
c1	cds	1415967	1416545	+	BALIOE_06845		hypothetical protein	
c1	cds	1416614	1417189	+	BALIOE_06850		hypothetical protein	
c1	cds	1417611	1417919	+	BALIOE_06855		hypothetical protein	
c1	cds	1418511	1420601	-	BALIOE_06860		hypothetical protein	
c1	cds	1422054	1422272	+	BALIOE_06865		hypothetical protein	
c1	cds	1423550	1423678	-	BALIOE_06870		hypothetical protein	
c1	cds	1424021	1424215	-	BALIOE_06875		hypothetical protein	
c1	cds	1424267	1424446	-	BALIOE_06880		hypothetical protein	
c1	cds	1424535	1424807	+	BALIOE_06885		hypothetical protein	
c1	cds	1425372	1425569	+	BALIOE_06890		hypothetical protein	
c1	cds	1426299	1427423	+	BALIOE_06895		hypothetical protein	
c1	cds	1427842	1428135	-	BALIOE_06900		hypothetical protein	
c1	cds	1428777	1429235	-	BALIOE_06905		hypothetical protein	
c1	cds	1429693	1430202	+	BALIOE_06910		hypothetical protein	
c1	cds	1430291	1430914	+	BALIOE_06915		hypothetical protein	
c1	cds	1431010	1431243	+	BALIOE_06920		hypothetical protein	
c1	cds	1431296	1431487	-	BALIOE_06925		hypothetical protein	
c1	cds	1432081	1432968	-	BALIOE_06930		hypothetical protein	
c1	cds	1432968	1433294	-	BALIOE_06935		hypothetical protein	
c1	cds	1433475	1434521	+	BALIOE_06940		hypothetical protein	
c1	cds	1434762	1435277	+	BALIOE_06945		hypothetical protein	
c1	cds	1435274	1437442	+	BALIOE_06950		hypothetical protein	
c1	cds	1437943	1439175	+	BALIOE_06955		hypothetical protein	
c1	cds	1439160	1439798	+	BALIOE_06960		hypothetical protein	
c1	cds	1440167	1440811	+	BALIOE_06965		hypothetical protein	
c1	cds	1441127	1441627	+	BALIOE_06970		hypothetical protein	
c1	cds	1441509	1441757	-	BALIOE_06975		hypothetical protein	
c1	cds	1441811	1442236	+	BALIOE_06980		hypothetical protein	
c1	cds	1442233	1442322	+	BALIOE_06985		hypothetical protein	
c1	cds	1442536	1442718	-	BALIOE_06990		hypothetical protein	
c1	cds	1443047	1443919	+	BALIOE_06995		hypothetical protein	
c1	cds	1444291	1447140	+	BALIOE_07000		hypothetical protein	
c1	cds	1447251	1449635	+	BALIOE_07005		hypothetical protein	
c1	cds	1449632	1450537	+	BALIOE_07010		hypothetical protein	
c1	cds	1450534	1451604	+	BALIOE_07015		hypothetical protein	
c1	cds	1451944	1452762	+	BALIOE_07020		hypothetical protein	
c1	cds	1452853	1453338	+	BALIOE_07025		hypothetical protein	
c1	cds	1453354	1453830	+	BALIOE_07030		hypothetical protein	
c1	cds	1453893	1454114	+	BALIOE_07035		hypothetical protein	
c1	cds	1454114	1454227	+	BALIOE_07040		hypothetical protein	
c1	cds	1454277	1454651	+	BALIOE_07045		hypothetical protein	
c1	cds	1454698	1455072	+	BALIOE_07050		hypothetical protein	
c1	cds	1455069	1455560	+	BALIOE_07055		hypothetical protein	
c1	cds	1455572	1455769	+	BALIOE_07060		hypothetical protein	
c1	cds	1455854	1456696	+	BALIOE_07065		hypothetical protein	
c1	tRNA	1456846	1456933	-	BALIOE_07070	Ser_trna	tRNA-Ser	SO:0000269
c1	cds	1457167	1458105	+	BALIOE_07075		hypothetical protein	
c1	cds	1458160	1458897	+	BALIOE_07080		hypothetical protein	
c1	cds	1458921	1459475	+	BALIOE_07085		hypothetical protein	
c1	cds	1459547	1460068	+	BALIOE_07090		hypothetical protein	
c1	cds	1460132	1460965	-	BALIOE_07095		hypothetical protein	
c1	cds	1460992	1461408	-	BALIOE_07100		hypothetical protein	
c1	cds	1461433	1461822	-	BALIOE_07105		hypothetical protein	
c1	cds	1461827	1462477	-	BALIOE_07110		hypothetical protein	
c1	cds	1463231	1463686	+	BALIOE_07115		hypothetical protein	
c1	cds	1463727	1464185	+	BALIOE_07120		hypothetical protein	
c1	cds	1464244	1464576	+	BALIOE_07125		hypothetical protein	
c1	cds	1464697	1465008	+	BALIOE_07130		hypothetical protein	
c1	cds	1465103	1465636	+	BALIOE_07135		hypothetical protein	
c1	cds	1465578	1467059	+	BALIOE_07140		hypothetical protein	
c1	cds	1467067	1468224	-	BALIOE_07145		hypothetical protein	
c1	cds	1468650	1470152	+	BALIOE_07150		hypothetical protein	
c1	cds	1470175	1472688	+	BALIOE_07155		hypothetical protein	
c1	cds	1472861	1473088	+	BALIOE_07160		hypothetical protein	
c1	cds	1473089	1473463	-	BALIOE_07165		hypothetical protein	
c1	cds	1473546	1474517	-	BALIOE_07170		hypothetical protein	
c1	cds	1474944	1475864	-	BALIOE_07175		hypothetical protein	
c1	cds	1476089	1477141	+	BALIOE_07180		hypothetical protein	
c1	cds	1477183	1477758	-	BALIOE_07185		hypothetical protein	
c1	cds	1477762	1478328	-	BALIOE_07190		hypothetical protein	
c1	cds	1478589	1478702	-	BALIOE_07195		hypothetical protein	
c1	cds	1478750	1479868	-	BALIOE_07200		hypothetical protein	
c1	cds	1479983	1480237	-	BALIOE_07205		hypothetical protein	
c1	cds	1480527	1480772	-	BALIOE_07210		hypothetical protein	
c1	cds	1480846	1481892	-	BALIOE_07215		hypothetical protein	
c1	cds	1481998	1482558	-	BALIOE_07220		hypothetical protein	
c1	cds	1482692	1483339	-	BALIOE_07225		hypothetical protein	
c1	cds	1483403	1484611	-	BALIOE_07230		hypothetical protein	
c1	cds	1484847	1485431	+	BALIOE_07235		hypothetical protein	
c1	cds	1485442	1486089	+	BALIOE_07240		hypothetical protein	
c1	cds	1486091	1487014	+	BALIOE_07245		hypothetical protein	
c1	cds	1487124	1488659	+	BALIOE_07250		hypothetical protein	
c1	cds	1488699	1489115	-	BALIOE_07255		hypothetical protein	
c1	cds	1489120	1489413	-	BALIOE_07260		hypothetical protein	
c1	cds	1489489	1490148	-	BALIOE_07265		hypothetical protein	
c1	cds	1490303	1490719	+	BALIOE_07270		hypothetical protein	
c1	cds	1490723	1491127	+	BALIOE_07275		hypothetical protein	
c1	cds	1491139	1491834	+	BALIOE_07280		hypothetical protein	
c1	cds	1491859	1493064	+	BALIOE_07285		hypothetical protein	
c1	cds	1493084	1493839	+	BALIOE_07290		hypothetical protein	
c1	cds	1493977	1494759	+	BALIOE_07295		hypothetical protein	
c1	cds	1494812	1495510	+	BALIOE_07300		hypothetical protein	
c1	cds	1495522	1496619	+	BALIOE_07305		hypothetical protein	
c1	cds	1496619	1497560	+	BALIOE_07310		hypothetical protein	
c1	cds	1497626	1499269	+	BALIOE_07315		hypothetical protein	
c1	cds	1499281	1500234	+	BALIOE_07320		hypothetical protein	
c1	cds	1500429	1503614	-	BALIOE_07325		hypothetical protein	
c1	cds	1504187	1505146	+	BALIOE_07330		hypothetical protein	
c1	cds	1505247	1505870	-	BALIOE_07335		hypothetical protein	
c1	cds	1506030	1506551	+	BALIOE_07340		hypothetical protein	
c1	cds	1506603	1506776	+	BALIOE_07345		hypothetical protein	
c1	cds	1506887	1507927	+	BALIOE_07350		hypothetical protein	
c1	cds	1507995	1508948	+	BALIOE_07355		hypothetical protein	
c1	cds	1508964	1509893	+	BALIOE_07360		hypothetical protein	
c1	cds	1509906	1510640	+	BALIOE_07365		hypothetical protein	
c1	cds	1510851	1511087	+	BALIOE_07370		hypothetical protein	
c1	cds	1511175	1512416	+	BALIOE_07375		hypothetical protein	
c1	cds	1512536	1513345	+	BALIOE_07380		hypothetical protein	
c1	cds	1513348	1514370	+	BALIOE_07385		hypothetical protein	
c1	cds	1514360	1515001	+	BALIOE_07390		hypothetical protein	
c1	cds	1514998	1516002	+	BALIOE_07395		hypothetical protein	
c1	cds	1516013	1516810	+	BALIOE_07400		hypothetical protein	
c1	cds	1517105	1518538	+	BALIOE_07405		hypothetical protein	
c1	cds	1518598	1520787	-	BALIOE_07410		hypothetical protein	
c1	cds	1521133	1521492	+	BALIOE_07415		hypothetical protein	
c1	cds	1521495	1521872	+	BALIOE_07420		hypothetical protein	
c1	cds	1521886	1522527	+	BALIOE_07425		hypothetical protein	
c1	cds	1522508	1523332	+	BALIOE_07430		hypothetical protein	
c1	cds	1523343	1524368	+	BALIOE_07435		hypothetical protein	
c1	cds	1524391	1524933	+	BALIOE_07440		hypothetical protein	
c1	cds	1525333	1526637	+	BALIOE_07445		hypothetical protein	
c1	cds	1526864	1527403	+	BALIOE_07450		hypothetical protein	
c1	cds	1527465	1528160	-	BALIOE_07455		hypothetical protein	
c1	cds	1528338	1528595	+	BALIOE_07460		hypothetical protein	
c1	cds	1528678	1529637	-	BALIOE_07465		hypothetical protein	
c1	cds	1529784	1533278	-	BALIOE_07470		hypothetical protein	
c1	cds	1533358	1534431	-	BALIOE_07475		hypothetical protein	
c1	cds	1534693	1535892	+	BALIOE_07480		hypothetical protein	
c1	cds	1535885	1536586	+	BALIOE_07485		hypothetical protein	
c1	cds	1536592	1537830	+	BALIOE_07490		hypothetical protein	
c1	cds	1537859	1538770	+	BALIOE_07495		hypothetical protein	
c1	cds	1538786	1539607	+	BALIOE_07500		hypothetical protein	
c1	cds	1539763	1540809	-	BALIOE_07505		hypothetical protein	
c1	cds	1540806	1541600	-	BALIOE_07510		hypothetical protein	
c1	cds	1541767	1542885	-	BALIOE_07515		hypothetical protein	
c1	cds	1542854	1543123	-	BALIOE_07520		hypothetical protein	
c1	cds	1543185	1543529	-	BALIOE_07525		hypothetical protein	
c1	cds	1543707	1544222	+	BALIOE_07530		hypothetical protein	
c1	cds	1544337	1544567	-	BALIOE_07535		hypothetical protein	
c1	cds	1544805	1545281	-	BALIOE_07540		hypothetical protein	
c1	cds	1545406	1545729	+	BALIOE_07545		hypothetical protein	
c1	cds	1545713	1546138	+	BALIOE_07550		hypothetical protein	
c1	cds	1546207	1547244	+	BALIOE_07555		hypothetical protein	
c1	cds	1547276	1547698	+	BALIOE_07560		hypothetical protein	
c1	cds	1547732	1548448	+	BALIOE_07565		hypothetical protein	
c1	cds	1548445	1548762	+	BALIOE_07570		hypothetical protein	
c1	cds	1548759	1549061	+	BALIOE_07575		hypothetical protein	
c1	cds	1549051	1549368	+	BALIOE_07580		hypothetical protein	
c1	cds	1549322	1549639	+	BALIOE_07585		hypothetical protein	
c1	cds	1549626	1550063	+	BALIOE_07590		hypothetical protein	
c1	cds	1550065	1550256	+	BALIOE_07595		hypothetical protein	
c1	cds	1550259	1550846	+	BALIOE_07600		hypothetical protein	
c1	cds	1550962	1551066	+	BALIOE_07605		hypothetical protein	
c1	cds	1551255	1551467	+	BALIOE_07610		hypothetical protein	
c1	cds	1551915	1552964	+	BALIOE_07615		hypothetical protein	
c1	cds	1552977	1553351	+	BALIOE_07620		hypothetical protein	
c1	cds	1553348	1554169	+	BALIOE_07625		hypothetical protein	
c1	cds	1554623	1554769	+	BALIOE_07630		hypothetical protein	
c1	cds	1554766	1554933	+	BALIOE_07635		hypothetical protein	
c1	cds	1555248	1557185	+	BALIOE_07640		hypothetical protein	
c1	cds	1557333	1557515	+	BALIOE_07645		hypothetical protein	
c1	cds	1557553	1557822	+	BALIOE_07650		hypothetical protein	
c1	cds	1557898	1558113	+	BALIOE_07655		hypothetical protein	
c1	cds	1558118	1558462	+	BALIOE_07660		hypothetical protein	
c1	cds	1558513	1559046	+	BALIOE_07665		hypothetical protein	
c1	cds	1559317	1559886	+	BALIOE_07670		hypothetical protein	
c1	cds	1559886	1560032	+	BALIOE_07675		hypothetical protein	
c1	cds	1560040	1560507	+	BALIOE_07680		hypothetical protein	
c1	cds	1560531	1560755	+	BALIOE_07685		hypothetical protein	
c1	cds	1561112	1561252	+	BALIOE_07690		hypothetical protein	
c1	cds	1561475	1561564	+	BALIOE_07695		hypothetical protein	
c1	cds	1561609	1561974	+	BALIOE_07700		hypothetical protein	
c1	cds	1562264	1562827	+	BALIOE_07705		hypothetical protein	
c1	cds	1562824	1564485	+	BALIOE_07710		hypothetical protein	
c1	cds	1564549	1566486	+	BALIOE_07715		hypothetical protein	
c1	cds	1566531	1566752	+	BALIOE_07720		hypothetical protein	
c1	cds	1566698	1569199	+	BALIOE_07725		hypothetical protein	
c1	cds	1569279	1569605	+	BALIOE_07730		hypothetical protein	
c1	cds	1569615	1569965	+	BALIOE_07735		hypothetical protein	
c1	cds	1569962	1570408	+	BALIOE_07740		hypothetical protein	
c1	cds	1570405	1570749	+	BALIOE_07745		hypothetical protein	
c1	cds	1570808	1571524	+	BALIOE_07750		hypothetical protein	
c1	cds	1571530	1571904	+	BALIOE_07755		hypothetical protein	
c1	cds	1572000	1572209	+	BALIOE_07760		hypothetical protein	
c1	cds	1572262	1575504	+	BALIOE_07765		hypothetical protein	
c1	cds	1575497	1575838	+	BALIOE_07770		hypothetical protein	
c1	cds	1575838	1576536	+	BALIOE_07775		hypothetical protein	
c1	cds	1577330	1578208	+	BALIOE_07780		hypothetical protein	
c1	cds	1578262	1578999	+	BALIOE_07785		hypothetical protein	
c1	cds	1578996	1579181	+	BALIOE_07790		hypothetical protein	
c1	cds	1579194	1579283	+	BALIOE_07795		hypothetical protein	
c1	cds	1579303	1581651	+	BALIOE_07800		hypothetical protein	
c1	cds	1582242	1585643	+	BALIOE_07805		hypothetical protein	
c1	cds	1585812	1586261	+	BALIOE_07810		hypothetical protein	
c1	cds	1586186	1587091	-	BALIOE_07815		hypothetical protein	
c1	cds	1587253	1587414	-	BALIOE_07820		hypothetical protein	
c1	cds	1587425	1587724	+	BALIOE_07825		hypothetical protein	
c1	cds	1587866	1588099	+	BALIOE_07830		hypothetical protein	
c1	cds	1588288	1589649	-	BALIOE_07835		hypothetical protein	
c1	cds	1590013	1590876	-	BALIOE_07840		hypothetical protein	
c1	cds	1590860	1591996	-	BALIOE_07845		hypothetical protein	
c1	cds	1592246	1593472	+	BALIOE_07850		hypothetical protein	
c1	cds	1593521	1594642	-	BALIOE_07855		hypothetical protein	
c1	cds	1594891	1596120	+	BALIOE_07860		hypothetical protein	
c1	cds	1596731	1597474	+	BALIOE_07865		hypothetical protein	
c1	cds	1597500	1597697	+	BALIOE_07870		hypothetical protein	
c1	cds	1597690	1597875	+	BALIOE_07875		hypothetical protein	
c1	cds	1597875	1598066	+	BALIOE_07880		hypothetical protein	
c1	cds	1598056	1598298	+	BALIOE_07885		hypothetical protein	
c1	cds	1598304	1598603	+	BALIOE_07890		hypothetical protein	
c1	cds	1598600	1600732	+	BALIOE_07895		hypothetical protein	
c1	cds	1601103	1601354	+	BALIOE_07900		hypothetical protein	
c1	cds	1601351	1601761	+	BALIOE_07905		hypothetical protein	
c1	cds	1601772	1602044	+	BALIOE_07910		hypothetical protein	
c1	cds	1602169	1602393	+	BALIOE_07915		hypothetical protein	
c1	cds	1602686	1603843	+	BALIOE_07920		hypothetical protein	
c1	cds	1603883	1604455	+	BALIOE_07925		hypothetical protein	
c1	cds	1604493	1605668	+	BALIOE_07930		hypothetical protein	
c1	cds	1605665	1606003	+	BALIOE_07935		hypothetical protein	
c1	cds	1606000	1606296	+	BALIOE_07940		hypothetical protein	
c1	cds	1606296	1606736	+	BALIOE_07945		hypothetical protein	
c1	cds	1607026	1607382	+	BALIOE_07950		hypothetical protein	
c1	cds	1607366	1609027	+	BALIOE_07955		hypothetical protein	
c1	cds	1609041	1609322	+	BALIOE_07960		hypothetical protein	
c1	cds	1610179	1611639	-	BALIOE_07965		hypothetical protein	
c1	cds	1611639	1612310	-	BALIOE_07970		hypothetical protein	
c1	cds	1612479	1613849	-	BALIOE_07975		hypothetical protein	
c1	cds	1613853	1614494	-	BALIOE_07980		hypothetical protein	
c1	cds	1614530	1615636	-	BALIOE_07985		hypothetical protein	
c1	cds	1615690	1616151	-	BALIOE_07990		hypothetical protein	
c1	cds	1616161	1616814	-	BALIOE_07995		hypothetical protein	
c1	cds	1616986	1618236	+	BALIOE_08000		hypothetical protein	
c1	cds	1618350	1619492	-	BALIOE_08005		hypothetical protein	
c1	cds	1619482	1619718	-	BALIOE_08010		hypothetical protein	
c1	cds	1619822	1620646	+	BALIOE_08015		hypothetical protein	
c1	cds	1620643	1621344	+	BALIOE_08020		hypothetical protein	
c1	cds	1621341	1621643	+	BALIOE_08025		hypothetical protein	
c1	cds	1621711	1622043	+	BALIOE_08030		hypothetical protein	
c1	cds	1622288	1623814	+	BALIOE_08035		hypothetical protein	
c1	cds	1624316	1624771	+	BALIOE_08040		hypothetical protein	
c1	cds	1624771	1624941	+	BALIOE_08045		hypothetical protein	
c1	cds	1624934	1625224	+	BALIOE_08050		hypothetical protein	
c1	cds	1625221	1625583	+	BALIOE_08055		hypothetical protein	
c1	cds	1625580	1625720	+	BALIOE_08060		hypothetical protein	
c1	cds	1625717	1626406	+	BALIOE_08065		hypothetical protein	
c1	cds	1626728	1627033	+	BALIOE_08070		hypothetical protein	
c1	cds	1627020	1627496	+	BALIOE_08075		hypothetical protein	
c1	cds	1627493	1627954	+	BALIOE_08080		hypothetical protein	
c1	cds	1627986	1628279	-	BALIOE_08085		hypothetical protein	
c1	cds	1628571	1628981	-	BALIOE_08090		hypothetical protein	
c1	cds	1629267	1629473	+	BALIOE_08095		hypothetical protein	
c1	cds	1630221	1630766	+	BALIOE_08100		hypothetical protein	
c1	cds	1630741	1632666	+	BALIOE_08105		hypothetical protein	
c1	cds	1632663	1632869	+	BALIOE_08110		hypothetical protein	
c1	cds	1632866	1634467	+	BALIOE_08115		hypothetical protein	
c1	cds	1634448	1635767	+	BALIOE_08120		hypothetical protein	
c1	cds	1635777	1636109	+	BALIOE_08125		hypothetical protein	
c1	cds	1636165	1637190	+	BALIOE_08130		hypothetical protein	
c1	cds	1637232	1637630	+	BALIOE_08135		hypothetical protein	
c1	cds	1637642	1637995	+	BALIOE_08140		hypothetical protein	
c1	cds	1638007	1638585	+	BALIOE_08145		hypothetical protein	
c1	cds	1638582	1638977	+	BALIOE_08150		hypothetical protein	
c1	cds	1638985	1639725	+	BALIOE_08155		hypothetical protein	
c1	cds	1639741	1640163	+	BALIOE_08160		hypothetical protein	
c1	cds	1640145	1640579	+	BALIOE_08165		hypothetical protein	
c1	cds	1640572	1643121	+	BALIOE_08170		hypothetical protein	
c1	cds	1643118	1643447	+	BALIOE_08175		hypothetical protein	
c1	cds	1643447	1644145	+	BALIOE_08180		hypothetical protein	
c1	cds	1644151	1644894	+	BALIOE_08185		hypothetical protein	
c1	cds	1644891	1645463	+	BALIOE_08190		hypothetical protein	
c1	cds	1645524	1648922	+	BALIOE_08195		hypothetical protein	
c1	cds	1648989	1649588	+	BALIOE_08200		hypothetical protein	
c1	cds	1649653	1652568	+	BALIOE_08205		hypothetical protein	
c1	cds	1652568	1653149	+	BALIOE_08210		hypothetical protein	
c1	cds	1653269	1654159	-	BALIOE_08215		hypothetical protein	
c1	cds	1654178	1654684	-	BALIOE_08220		hypothetical protein	
c1	cds	1654721	1655221	-	BALIOE_08225		hypothetical protein	
c1	cds	1655300	1655482	-	BALIOE_08230		hypothetical protein	
c1	cds	1655980	1656648	-	BALIOE_08235		hypothetical protein	
c1	cds	1656705	1656953	+	BALIOE_08240		hypothetical protein	
c1	cds	1657029	1657409	+	BALIOE_08245		hypothetical protein	
c1	cds	1657406	1657753	+	BALIOE_08250		hypothetical protein	
c1	cds	1657803	1659341	+	BALIOE_08255		hypothetical protein	
c1	cds	1659644	1661128	-	BALIOE_08260		hypothetical protein	
c1	cds	1661315	1662268	-	BALIOE_08265		hypothetical protein	
c1	cds	1662767	1663351	+	BALIOE_08270		hypothetical protein	
c1	cds	1663525	1663851	+	BALIOE_08275		hypothetical protein	
c1	cds	1663851	1664738	+	BALIOE_08280		hypothetical protein	
c1	cds	1664822	1665532	+	BALIOE_08285		hypothetical protein	
c1	cds	1665904	1666170	-	BALIOE_08290		hypothetical protein	
c1	cds	1666174	1666986	-	BALIOE_08295		hypothetical protein	
c1	cds	1667010	1667705	-	BALIOE_08300		hypothetical protein	
c1	cds	1668225	1668593	+	BALIOE_08305		hypothetical protein	
c1	cds	1668696	1669097	-	BALIOE_08310		hypothetical protein	
c1	cds	1669168	1669326	+	BALIOE_08315		hypothetical protein	
c1	cds	1669338	1669631	+	BALIOE_08320		hypothetical protein	
c1	cds	1669703	1670362	+	BALIOE_08325		hypothetical protein	
c1	cds	1670454	1670900	+	BALIOE_08330		hypothetical protein	
c1	cds	1671107	1672018	-	BALIOE_08335		hypothetical protein	
c1	cds	1672391	1672810	+	BALIOE_08340		hypothetical protein	
c1	cds	1672810	1674078	+	BALIOE_08345		hypothetical protein	
c1	cds	1674124	1674654	-	BALIOE_08350		hypothetical protein	
c1	cds	1674800	1676341	-	BALIOE_08355		hypothetical protein	
c1	cds	1676563	1677282	+	BALIOE_08360		hypothetical protein	
c1	cds	1677334	1678866	-	BALIOE_08365		hypothetical protein	
c1	cds	1679229	1680527	+	BALIOE_08370		hypothetical protein	
c1	cds	1680537	1681607	+	BALIOE_08375		hypothetical protein	
c1	cds	1681999	1683735	-	BALIOE_08380		hypothetical protein	
c1	cds	1683831	1684745	-	BALIOE_08385		hypothetical protein	
c1	cds	1684845	1685456	+	BALIOE_08390		hypothetical protein	
c1	cds	1685644	1686531	-	BALIOE_08395		hypothetical protein	
c1	cds	1686531	1686857	-	BALIOE_08400		hypothetical protein	
c1	cds	1686909	1687505	-	BALIOE_08405		hypothetical protein	
c1	cds	1687706	1687960	+	BALIOE_08410		hypothetical protein	
c1	cds	1688010	1689980	-	BALIOE_08415		hypothetical protein	
c1	cds	1690006	1690860	-	BALIOE_08420		hypothetical protein	
c1	cds	1691025	1691669	-	BALIOE_08425		hypothetical protein	
c1	cds	1691679	1692437	-	BALIOE_08430		hypothetical protein	
c1	cds	1692434	1693414	-	BALIOE_08435		hypothetical protein	
c1	cds	1693414	1694436	-	BALIOE_08440		hypothetical protein	
c1	cds	1694544	1694744	-	BALIOE_08445		hypothetical protein	
c1	cds	1694772	1696229	-	BALIOE_08450		hypothetical protein	
c1	cds	1696776	1698194	-	BALIOE_08455		hypothetical protein	
c1	cds	1698205	1698837	-	BALIOE_08460		hypothetical protein	
c1	cds	1698848	1699918	-	BALIOE_08465		hypothetical protein	
c1	cds	1700253	1701896	-	BALIOE_08470		hypothetical protein	
c1	cds	1702740	1703831	-	BALIOE_08475		hypothetical protein	
c1	cds	1703948	1704532	-	BALIOE_08480		hypothetical protein	
c1	cds	1704810	1705088	+	BALIOE_08485		hypothetical protein	
c1	cds	1705143	1706795	-	BALIOE_08490		hypothetical protein	
c1	cds	1706947	1707960	-	BALIOE_08495		hypothetical protein	
c1	cds	1708045	1708896	-	BALIOE_08500		hypothetical protein	
c1	cds	1708896	1709519	-	BALIOE_08505		hypothetical protein	
c1	cds	1709733	1710989	+	BALIOE_08510		hypothetical protein	
c1	cds	1711031	1712113	+	BALIOE_08515		hypothetical protein	
c1	cds	1712113	1712946	+	BALIOE_08520		hypothetical protein	
c1	cds	1712943	1713335	+	BALIOE_08525		hypothetical protein	
c1	cds	1713339	1714148	+	BALIOE_08530		hypothetical protein	
c1	cds	1714184	1715038	+	BALIOE_08535		hypothetical protein	
c1	cds	1715186	1715293	-	BALIOE_08540		hypothetical protein	
c1	cds	1715722	1715829	-	BALIOE_08545		hypothetical protein	
c1	cds	1716228	1717328	-	BALIOE_08550		hypothetical protein	
c1	cds	1717598	1717828	+	BALIOE_08555		hypothetical protein	
c1	cds	1717965	1718684	+	BALIOE_08560		hypothetical protein	
c1	cds	1718728	1719081	-	BALIOE_08565		hypothetical protein	
c1	cds	1719231	1720661	+	BALIOE_08570		hypothetical protein	
c1	cds	1720662	1721312	-	BALIOE_08575		hypothetical protein	
c1	cds	1721305	1723101	-	BALIOE_08580		hypothetical protein	
c1	cds	1723127	1723345	+	BALIOE_08585		hypothetical protein	
c1	cds	1723440	1724831	+	BALIOE_08590		hypothetical protein	
c1	cds	1725224	1728967	+	BALIOE_08595		hypothetical protein	
c1	cds	1728964	1730502	+	BALIOE_08600		hypothetical protein	
c1	cds	1730499	1731209	+	BALIOE_08605		hypothetical protein	
c1	cds	1731209	1731886	+	BALIOE_08610		hypothetical protein	
c1	tRNA	1732426	1732510	-	BALIOE_08615	Tyr_trna	tRNA-Tyr	SO:0000272
c1	tRNA	1732720	1732804	-	BALIOE_08620	Tyr_trna	tRNA-Tyr	SO:0000272
c1	cds	1732964	1733806	-	BALIOE_08625		hypothetical protein	
c1	cds	1733856	1734314	-	BALIOE_08630		hypothetical protein	
c1	cds	1734388	1735332	+	BALIOE_08635		hypothetical protein	
c1	cds	1735424	1736437	+	BALIOE_08640		hypothetical protein	
c1	cds	1736639	1737547	+	BALIOE_08645		hypothetical protein	
c1	cds	1737691	1738104	-	BALIOE_08650		hypothetical protein	
c1	cds	1738708	1739325	+	BALIOE_08655		hypothetical protein	
c1	cds	1739626	1742301	-	BALIOE_08660		hypothetical protein	
c1	cds	1742778	1743425	+	BALIOE_08665		hypothetical protein	
c1	cds	1743452	1743607	+	BALIOE_08670		hypothetical protein	
c1	cds	1743583	1743744	-	BALIOE_08675		hypothetical protein	
c1	cds	1744118	1745794	+	BALIOE_08680		hypothetical protein	
c1	cds	1745880	1746800	+	BALIOE_08685		hypothetical protein	
c1	cds	1746815	1747723	+	BALIOE_08690		hypothetical protein	
c1	cds	1747735	1748748	+	BALIOE_08695		hypothetical protein	
c1	cds	1748745	1749749	+	BALIOE_08700		hypothetical protein	
c1	cds	1749802	1750131	-	BALIOE_08705		hypothetical protein	
c1	cds	1750166	1751626	-	BALIOE_08710		hypothetical protein	
c1	cds	1751997	1753250	-	BALIOE_08715		hypothetical protein	
c1	cds	1753551	1753847	-	BALIOE_08720		hypothetical protein	
c1	cds	1754071	1754790	+	BALIOE_08725		hypothetical protein	
c1	cds	1754830	1755228	-	BALIOE_08730		hypothetical protein	
c1	cds	1755333	1755872	-	BALIOE_08735		hypothetical protein	
c1	cds	1755902	1756645	-	BALIOE_08740		hypothetical protein	
c1	cds	1757002	1757640	+	BALIOE_08745		hypothetical protein	
c1	cds	1757686	1758816	-	BALIOE_08750		hypothetical protein	
c1	cds	1759107	1761578	-	BALIOE_08755		hypothetical protein	
c1	cds	1761671	1761862	-	BALIOE_08760		hypothetical protein	
c1	cds	1761859	1762047	-	BALIOE_08765		hypothetical protein	
c1	cds	1762521	1762754	+	BALIOE_08770		hypothetical protein	
c1	cds	1762732	1763139	-	BALIOE_08775		hypothetical protein	
c1	cds	1763162	1763380	-	BALIOE_08780		hypothetical protein	
c1	cds	1763453	1763752	-	BALIOE_08785		hypothetical protein	
c1	cds	1764016	1764423	-	BALIOE_08790		hypothetical protein	
c1	cds	1764500	1764727	+	BALIOE_08795		hypothetical protein	
c1	cds	1764711	1765262	+	BALIOE_08800		hypothetical protein	
c1	cds	1765234	1766274	+	BALIOE_08805		hypothetical protein	
c1	cds	1766306	1766728	+	BALIOE_08810		hypothetical protein	
c1	cds	1766915	1767496	+	BALIOE_08815		hypothetical protein	
c1	cds	1767493	1767657	+	BALIOE_08820		hypothetical protein	
c1	cds	1768356	1769114	+	BALIOE_08825		hypothetical protein	
c1	cds	1769393	1769605	+	BALIOE_08830		hypothetical protein	
c1	cds	1769826	1770083	+	BALIOE_08835		hypothetical protein	
c1	cds	1770153	1770431	+	BALIOE_08840		hypothetical protein	
c1	cds	1770433	1771479	+	BALIOE_08845		hypothetical protein	
c1	cds	1771492	1771851	+	BALIOE_08850		hypothetical protein	
c1	cds	1771860	1772390	+	BALIOE_08855		hypothetical protein	
c1	cds	1772632	1772829	+	BALIOE_08860		hypothetical protein	
c1	cds	1772980	1774038	+	BALIOE_08865		hypothetical protein	
c1	tRNA	1774079	1774154	+	BALIOE_08870	Ile2_trna	tRNA-Ile2	SO:0000263
c1	tRNA	1774235	1774311	+	BALIOE_08875	Arg_trna	tRNA-Arg	SO:0001036
c1	cds	1774835	1776688	+	BALIOE_08880		hypothetical protein	
c1	cds	1776838	1777053	+	BALIOE_08885		hypothetical protein	
c1	cds	1777058	1777402	+	BALIOE_08890		hypothetical protein	
c1	cds	1777453	1777986	+	BALIOE_08895		hypothetical protein	
c1	cds	1778257	1778826	+	BALIOE_08900		hypothetical protein	
c1	cds	1778826	1778972	+	BALIOE_08905		hypothetical protein	
c1	cds	1778980	1779447	+	BALIOE_08910		hypothetical protein	
c1	cds	1779810	1780037	-	BALIOE_08915		hypothetical protein	
c1	cds	1780079	1780444	+	BALIOE_08920		hypothetical protein	
c1	cds	1780734	1781297	+	BALIOE_08925		hypothetical protein	
c1	cds	1781294	1782955	+	BALIOE_08930		hypothetical protein	
c1	cds	1783019	1784956	+	BALIOE_08935		hypothetical protein	
c1	cds	1785001	1785222	+	BALIOE_08940		hypothetical protein	
c1	cds	1785168	1787747	+	BALIOE_08945		hypothetical protein	
c1	cds	1787750	1788076	+	BALIOE_08950		hypothetical protein	
c1	cds	1788086	1788436	+	BALIOE_08955		hypothetical protein	
c1	cds	1788433	1788879	+	BALIOE_08960		hypothetical protein	
c1	cds	1788876	1789220	+	BALIOE_08965		hypothetical protein	
c1	cds	1789279	1789995	+	BALIOE_08970		hypothetical protein	
c1	cds	1790001	1790375	+	BALIOE_08975		hypothetical protein	
c1	cds	1790471	1790680	+	BALIOE_08980		hypothetical protein	
c1	cds	1790733	1793813	+	BALIOE_08985		hypothetical protein	
c1	cds	1793806	1794147	+	BALIOE_08990		hypothetical protein	
c1	cds	1794147	1794584	+	BALIOE_08995		hypothetical protein	
c1	cds	1794772	1798248	+	BALIOE_09000		hypothetical protein	
c1	cds	1798316	1798915	+	BALIOE_09005		hypothetical protein	
c1	cds	1799067	1800380	+	BALIOE_09010		hypothetical protein	
c1	cds	1800382	1800651	+	BALIOE_09015		hypothetical protein	
c1	cds	1801003	1801338	+	BALIOE_09020		hypothetical protein	
c1	cds	1801678	1803003	-	BALIOE_09025		hypothetical protein	
c1	cds	1803664	1804356	-	BALIOE_09030		hypothetical protein	
c1	cds	1804830	1805741	+	BALIOE_09035		hypothetical protein	
c1	cds	1805807	1806376	+	BALIOE_09040		hypothetical protein	
c1	cds	1806423	1806680	-	BALIOE_09045		hypothetical protein	
c1	cds	1806710	1807057	-	BALIOE_09050		hypothetical protein	
c1	cds	1807342	1808880	-	BALIOE_09055		hypothetical protein	
c1	cds	1808930	1809277	-	BALIOE_09060		hypothetical protein	
c1	cds	1809274	1809654	-	BALIOE_09065		hypothetical protein	
c1	cds	1809959	1810228	+	BALIOE_09070		hypothetical protein	
c1	cds	1810983	1811630	-	BALIOE_09075		hypothetical protein	
c1	cds	1811814	1812404	+	BALIOE_09080		hypothetical protein	
c1	cds	1814052	1814561	+	BALIOE_09085		hypothetical protein	
c1	cds	1815875	1816381	-	BALIOE_09090		hypothetical protein	
c1	cds	1816427	1816927	-	BALIOE_09095		hypothetical protein	
c1	cds	1817013	1817192	-	BALIOE_09100		hypothetical protein	
c1	cds	1817573	1818379	-	BALIOE_09105		hypothetical protein	
c1	cds	1818379	1819572	-	BALIOE_09110		hypothetical protein	
c1	cds	1819584	1820942	-	BALIOE_09115		hypothetical protein	
c1	cds	1820946	1822541	-	BALIOE_09120		hypothetical protein	
c1	cds	1822541	1824103	-	BALIOE_09125		hypothetical protein	
c1	cds	1824377	1825258	+	BALIOE_09130		hypothetical protein	
c1	cds	1825255	1825875	+	BALIOE_09135		hypothetical protein	
c1	cds	1825903	1827486	+	BALIOE_09140		hypothetical protein	
c1	cds	1827699	1828571	+	BALIOE_09145		hypothetical protein	
c1	cds	1828611	1829201	-	BALIOE_09150		hypothetical protein	
c1	cds	1829198	1829956	-	BALIOE_09155		hypothetical protein	
c1	cds	1830176	1831225	+	BALIOE_09160		hypothetical protein	
c1	cds	1831261	1831512	-	BALIOE_09165		hypothetical protein	
c1	cds	1831892	1834489	+	BALIOE_09170		hypothetical protein	
c1	cds	1834699	1835673	+	BALIOE_09175		hypothetical protein	
c1	cds	1836004	1836132	+	BALIOE_09180		hypothetical protein	
c1	cds	1836135	1836302	+	BALIOE_09185		hypothetical protein	
c1	cds	1836675	1839350	+	BALIOE_09190		hypothetical protein	
c1	cds	1839414	1840004	-	BALIOE_09195		hypothetical protein	
c1	cds	1840174	1840938	+	BALIOE_09200		hypothetical protein	
c1	cds	1841087	1841395	+	BALIOE_09205		hypothetical protein	
c1	cds	1841402	1842571	+	BALIOE_09210		hypothetical protein	
c1	cds	1842704	1843501	+	BALIOE_09215		hypothetical protein	
c1	cds	1843501	1843827	+	BALIOE_09220		hypothetical protein	
c1	cds	1843953	1844171	-	BALIOE_09225		hypothetical protein	
c1	cds	1844440	1845189	-	BALIOE_09230		hypothetical protein	
c1	cds	1845279	1845452	-	BALIOE_09235		hypothetical protein	
c1	cds	1845600	1847585	-	BALIOE_09240		hypothetical protein	
c1	cds	1847820	1849754	-	BALIOE_09245		hypothetical protein	
c1	cds	1849822	1850949	-	BALIOE_09250		hypothetical protein	
c1	cds	1851093	1851881	-	BALIOE_09255		hypothetical protein	
c1	cds	1852359	1852925	+	BALIOE_09260		hypothetical protein	
c1	cds	1853074	1854195	+	BALIOE_09265		hypothetical protein	
c1	cds	1854195	1857278	+	BALIOE_09270		hypothetical protein	
c1	cds	1857301	1858674	+	BALIOE_09275		hypothetical protein	
c1	cds	1858683	1859846	+	BALIOE_09280		hypothetical protein	
c1	cds	1859898	1860704	-	BALIOE_09285		hypothetical protein	
c1	cds	1860706	1861698	-	BALIOE_09290		hypothetical protein	
c1	cds	1861698	1862588	-	BALIOE_09295		hypothetical protein	
c1	cds	1862575	1863540	-	BALIOE_09300		hypothetical protein	
c1	cds	1863537	1865180	-	BALIOE_09305		hypothetical protein	
c1	cds	1865493	1865738	-	BALIOE_09310		hypothetical protein	
c1	cds	1865872	1867257	-	BALIOE_09315		hypothetical protein	
c1	cds	1867560	1868978	-	BALIOE_09320		hypothetical protein	
c1	cds	1869190	1869954	+	BALIOE_09325		hypothetical protein	
c1	cds	1869981	1870538	+	BALIOE_09330		hypothetical protein	
c1	cds	1870688	1872175	+	BALIOE_09335		hypothetical protein	
c1	cds	1872177	1873457	+	BALIOE_09340		hypothetical protein	
c1	cds	1873495	1874760	+	BALIOE_09345		hypothetical protein	
c1	cds	1874891	1875868	-	BALIOE_09350		hypothetical protein	
c1	cds	1876035	1876703	+	BALIOE_09355		hypothetical protein	
c1	cds	1876757	1876981	+	BALIOE_09360		hypothetical protein	
c1	cds	1876981	1877340	+	BALIOE_09365		hypothetical protein	
c1	cds	1877349	1877570	+	BALIOE_09370		hypothetical protein	
c1	cds	1877645	1877959	+	BALIOE_09375		hypothetical protein	
c1	cds	1878169	1878543	+	BALIOE_09380		hypothetical protein	
c1	cds	1878543	1879847	+	BALIOE_09385		hypothetical protein	
c1	cds	1879861	1880490	+	BALIOE_09390		hypothetical protein	
c1	cds	1880539	1881153	+	BALIOE_09395		hypothetical protein	
c1	cds	1881174	1882055	+	BALIOE_09400		hypothetical protein	
c1	cds	1882042	1882884	+	BALIOE_09405		hypothetical protein	
c1	cds	1882915	1883967	+	BALIOE_09410		hypothetical protein	
c1	cds	1883985	1884773	+	BALIOE_09415		hypothetical protein	
c1	cds	1884783	1885838	+	BALIOE_09420		hypothetical protein	
c1	cds	1885835	1888102	+	BALIOE_09425		hypothetical protein	
c1	cds	1888099	1888758	+	BALIOE_09430		hypothetical protein	
c1	cds	1888772	1889854	+	BALIOE_09435		hypothetical protein	
c1	cds	1889899	1890804	+	BALIOE_09440		hypothetical protein	
c1	cds	1890915	1891913	-	BALIOE_09445		hypothetical protein	
c1	cds	1892068	1893465	+	BALIOE_09450		hypothetical protein	
c1	cds	1893462	1894523	+	BALIOE_09455		hypothetical protein	
c1	cds	1894671	1896212	+	BALIOE_09460		hypothetical protein	
c1	cds	1896256	1896762	-	BALIOE_09465		hypothetical protein	
c1	cds	1896881	1897846	+	BALIOE_09470		hypothetical protein	
c1	cds	1897821	1898549	-	BALIOE_09475		hypothetical protein	
c1	cds	1898840	1899478	-	BALIOE_09480		hypothetical protein	
c1	cds	1899499	1900122	-	BALIOE_09485		hypothetical protein	
c1	cds	1900061	1900429	-	BALIOE_09490		hypothetical protein	
c1	cds	1900429	1901349	-	BALIOE_09495		hypothetical protein	
c1	cds	1901487	1902386	+	BALIOE_09500		hypothetical protein	
c1	cds	1902722	1904335	+	BALIOE_09505		hypothetical protein	
c1	cds	1904386	1905417	-	BALIOE_09510		hypothetical protein	
c1	cds	1905661	1905918	+	BALIOE_09515		hypothetical protein	
c1	cds	1905968	1906918	-	BALIOE_09520		hypothetical protein	
c1	cds	1907070	1907822	-	BALIOE_09525		hypothetical protein	
c1	cds	1908017	1908532	-	BALIOE_09530		hypothetical protein	
c1	cds	1908543	1909235	-	BALIOE_09535		hypothetical protein	
c1	cds	1909346	1910233	-	BALIOE_09540		hypothetical protein	
c1	cds	1910233	1910559	-	BALIOE_09545		hypothetical protein	
c1	cds	1910585	1911382	-	BALIOE_09550		hypothetical protein	
c1	cds	1911419	1912864	-	BALIOE_09555		hypothetical protein	
c1	cds	1912864	1914174	-	BALIOE_09560		hypothetical protein	
c1	cds	1914350	1915258	+	BALIOE_09565		hypothetical protein	
c1	cds	1915588	1916151	+	BALIOE_09570		hypothetical protein	
c1	cds	1916172	1917404	-	BALIOE_09575		hypothetical protein	
c1	cds	1917659	1918642	+	BALIOE_09580		hypothetical protein	
c1	cds	1918917	1919087	+	BALIOE_09585		hypothetical protein	
c1	cds	1919120	1920493	+	BALIOE_09590		hypothetical protein	
c1	cds	1920622	1921557	-	BALIOE_09595		hypothetical protein	
c1	cds	1921609	1922844	-	BALIOE_09600		hypothetical protein	
c1	cds	1922846	1923061	-	BALIOE_09605		hypothetical protein	
c1	cds	1923161	1923349	-	BALIOE_09610		hypothetical protein	
c1	cds	1923592	1924401	-	BALIOE_09615		hypothetical protein	
c1	cds	1924394	1926994	-	BALIOE_09620		hypothetical protein	
c1	cds	1927096	1927371	-	BALIOE_09625		hypothetical protein	
c1	cds	1927446	1927616	-	BALIOE_09630		hypothetical protein	
c1	cds	1927616	1927837	-	BALIOE_09635		hypothetical protein	
c1	cds	1928156	1928767	+	BALIOE_09640		hypothetical protein	
c1	cds	1928764	1928919	-	BALIOE_09645		hypothetical protein	
c1	cds	1928930	1929064	-	BALIOE_09650		hypothetical protein	
c1	cds	1929352	1929771	-	BALIOE_09655		hypothetical protein	
c1	cds	1929851	1930105	+	BALIOE_09660		hypothetical protein	
c1	cds	1930102	1930524	+	BALIOE_09665		hypothetical protein	
c1	cds	1930602	1931390	+	BALIOE_09670		hypothetical protein	
c1	cds	1931397	1932143	+	BALIOE_09675		hypothetical protein	
c1	cds	1932166	1932927	+	BALIOE_09680		hypothetical protein	
c1	cds	1932943	1933365	+	BALIOE_09685		hypothetical protein	
c1	cds	1933471	1933683	+	BALIOE_09690		hypothetical protein	
c1	cds	1933935	1934198	+	BALIOE_09695		hypothetical protein	
c1	cds	1934209	1934370	+	BALIOE_09700		hypothetical protein	
c1	cds	1935126	1936277	+	BALIOE_09705		hypothetical protein	
c1	cds	1936245	1937234	-	BALIOE_09710		hypothetical protein	
c1	cds	1937234	1938625	-	BALIOE_09715		hypothetical protein	
c1	cds	1939125	1939724	+	BALIOE_09720		hypothetical protein	
c1	cds	1939724	1940014	+	BALIOE_09725		hypothetical protein	
c1	cds	1940011	1940565	+	BALIOE_09730		hypothetical protein	
c1	tRNA	1940705	1940780	+	BALIOE_09735	Ile2_trna	tRNA-Ile2	SO:0000263
c1	tRNA	1940881	1940957	+	BALIOE_09740	Arg_trna	tRNA-Arg	SO:0001036
c1	cds	1941127	1941558	+	BALIOE_09745		hypothetical protein	
c1	cds	1941371	1941889	-	BALIOE_09750		hypothetical protein	
c1	cds	1942133	1943986	+	BALIOE_09755		hypothetical protein	
c1	cds	1944136	1944351	+	BALIOE_09760		hypothetical protein	
c1	cds	1944356	1944700	+	BALIOE_09765		hypothetical protein	
c1	cds	1944751	1945284	+	BALIOE_09770		hypothetical protein	
c1	cds	1945555	1946124	+	BALIOE_09775		hypothetical protein	
c1	cds	1946124	1946270	+	BALIOE_09780		hypothetical protein	
c1	cds	1946278	1946745	+	BALIOE_09785		hypothetical protein	
c1	cds	1947108	1947335	-	BALIOE_09790		hypothetical protein	
c1	cds	1947377	1947742	+	BALIOE_09795		hypothetical protein	
c1	cds	1948032	1948595	+	BALIOE_09800		hypothetical protein	
c1	cds	1948592	1950253	+	BALIOE_09805		hypothetical protein	
c1	cds	1950317	1952254	+	BALIOE_09810		hypothetical protein	
c1	cds	1952299	1952520	+	BALIOE_09815		hypothetical protein	
c1	cds	1952466	1953830	+	BALIOE_09820		hypothetical protein	
c1	cds	1953827	1955050	+	BALIOE_09825		hypothetical protein	
c1	cds	1955047	1955373	+	BALIOE_09830		hypothetical protein	
c1	cds	1955383	1955733	+	BALIOE_09835		hypothetical protein	
c1	cds	1955730	1956176	+	BALIOE_09840		hypothetical protein	
c1	cds	1956173	1956517	+	BALIOE_09845		hypothetical protein	
c1	cds	1956586	1957302	+	BALIOE_09850		hypothetical protein	
c1	cds	1957308	1957682	+	BALIOE_09855		hypothetical protein	
c1	cds	1957778	1957987	+	BALIOE_09860		hypothetical protein	
c1	cds	1958039	1961119	+	BALIOE_09865		hypothetical protein	
c1	cds	1961112	1961453	+	BALIOE_09870		hypothetical protein	
c1	cds	1961453	1962151	+	BALIOE_09875		hypothetical protein	
c1	cds	1962162	1962905	+	BALIOE_09880		hypothetical protein	
c1	cds	1962902	1963483	+	BALIOE_09885		hypothetical protein	
c1	cds	1963674	1964201	-	BALIOE_09890		hypothetical protein	
c1	cds	1964335	1967832	+	BALIOE_09895		hypothetical protein	
c1	cds	1967903	1968502	+	BALIOE_09900		hypothetical protein	
c1	cds	1968567	1969880	+	BALIOE_09905		hypothetical protein	
c1	cds	1969882	1970151	+	BALIOE_09910		hypothetical protein	
c1	cds	1970264	1970839	+	BALIOE_09915		hypothetical protein	
c1	cds	1970912	1971541	+	BALIOE_09920		hypothetical protein	
c1	cds	1971623	1972264	+	BALIOE_09925		hypothetical protein	
c1	cds	1972845	1973279	-	BALIOE_09930		hypothetical protein	
c1	cds	1973420	1974187	-	BALIOE_09935		hypothetical protein	
c1	cds	1974162	1974533	-	BALIOE_09940		hypothetical protein	
c1	cds	1974899	1978423	-	BALIOE_09945		hypothetical protein	
c1	cds	1978697	1978963	+	BALIOE_09950		hypothetical protein	
c1	cds	1978960	1979382	-	BALIOE_09955		hypothetical protein	
c1	cds	1979493	1980482	-	BALIOE_09960		hypothetical protein	
c1	cds	1980690	1983329	+	BALIOE_09965		hypothetical protein	
c1	cds	1983326	1983511	+	BALIOE_09970		hypothetical protein	
c1	cds	1983519	1983842	+	BALIOE_09975		hypothetical protein	
c1	cds	1984256	1987291	+	BALIOE_09980		hypothetical protein	
c1	cds	1987511	1989970	+	BALIOE_09985		hypothetical protein	
c1	cds	1990190	1991050	+	BALIOE_09990		hypothetical protein	
c1	cds	1991114	1993420	+	BALIOE_09995		hypothetical protein	
c1	cds	1993591	1994196	+	BALIOE_10000		hypothetical protein	
c1	cds	1994196	1995092	+	BALIOE_10005		hypothetical protein	
c1	cds	1995108	1996865	+	BALIOE_10010		hypothetical protein	
c1	cds	1996855	1998171	+	BALIOE_10015		hypothetical protein	
c1	cds	1998222	1998827	-	BALIOE_10020		hypothetical protein	
c1	cds	1999028	2002930	+	BALIOE_10025		hypothetical protein	
c1	cds	2003076	2003501	+	BALIOE_10030		hypothetical protein	
c1	cds	2003506	2003844	+	BALIOE_10035		hypothetical protein	
c1	cds	2003831	2004262	+	BALIOE_10040		hypothetical protein	
c1	cds	2004387	2004764	+	BALIOE_10045		hypothetical protein	
c1	cds	2004880	2005680	+	BALIOE_10050		hypothetical protein	
c1	cds	2005877	2007316	+	BALIOE_10055		hypothetical protein	
c1	cds	2007358	2008359	-	BALIOE_10060		hypothetical protein	
c1	cds	2008548	2009078	+	BALIOE_10065		hypothetical protein	
c1	cds	2009323	2009496	+	BALIOE_10070		hypothetical protein	
c1	cds	2009608	2009775	-	BALIOE_10075		hypothetical protein	
c1	cds	2010116	2011756	+	BALIOE_10080		hypothetical protein	
c1	cds	2011794	2012717	-	BALIOE_10085		hypothetical protein	
c1	cds	2012934	2014277	+	BALIOE_10090		hypothetical protein	
c1	cds	2014538	2016157	+	BALIOE_10095		hypothetical protein	
c1	cds	2016297	2016521	+	BALIOE_10100		hypothetical protein	
c1	cds	2016584	2016880	+	BALIOE_10105		hypothetical protein	
c1	cds	2017115	2018095	-	BALIOE_10110		hypothetical protein	
c1	cds	2018219	2019211	+	BALIOE_10115		hypothetical protein	
c1	cds	2019208	2019801	+	BALIOE_10120		hypothetical protein	
c1	cds	2020105	2020773	+	BALIOE_10125		hypothetical protein	
c1	cds	2020808	2021980	-	BALIOE_10130		hypothetical protein	
c1	cds	2022072	2022608	+	BALIOE_10135		hypothetical protein	
c1	cds	2022639	2024642	+	BALIOE_10140		hypothetical protein	
c1	cds	2024734	2024904	-	BALIOE_10145		hypothetical protein	
c1	cds	2025186	2025362	+	BALIOE_10150		hypothetical protein	
c1	cds	2025387	2025824	+	BALIOE_10155		hypothetical protein	
c1	cds	2025903	2027309	+	BALIOE_10160		hypothetical protein	
c1	cds	2027554	2028699	+	BALIOE_10165		hypothetical protein	
c1	cds	2028717	2029730	+	BALIOE_10170		hypothetical protein	
c1	cds	2029731	2030672	+	BALIOE_10175		hypothetical protein	
c1	cds	2030662	2031456	+	BALIOE_10180		hypothetical protein	
c1	cds	2031478	2032902	+	BALIOE_10185		hypothetical protein	
c1	cds	2033289	2033462	+	BALIOE_10190		hypothetical protein	
c1	cds	2033548	2033781	+	BALIOE_10195		hypothetical protein	
c1	cds	2033782	2034231	-	BALIOE_10200		hypothetical protein	
c1	cds	2034228	2034746	-	BALIOE_10205		hypothetical protein	
c1	cds	2034927	2035964	+	BALIOE_10210		hypothetical protein	
c1	cds	2036162	2036827	+	BALIOE_10215		hypothetical protein	
c1	cds	2036863	2038965	-	BALIOE_10220		hypothetical protein	
c1	cds	2039207	2040268	+	BALIOE_10225		hypothetical protein	
c1	cds	2040383	2041882	-	BALIOE_10230		hypothetical protein	
c1	cds	2042149	2042766	+	BALIOE_10235		hypothetical protein	
c1	cds	2042842	2043054	+	BALIOE_10240		hypothetical protein	
c1	cds	2043875	2045983	+	BALIOE_10245		hypothetical protein	
c1	cds	2046050	2050252	+	BALIOE_10250		hypothetical protein	
c1	cds	2050264	2050449	+	BALIOE_10255		hypothetical protein	
c1	cds	2050449	2050658	+	BALIOE_10260		hypothetical protein	
c1	cds	2051166	2051345	+	BALIOE_10265		hypothetical protein	
c1	cds	2051445	2052056	+	BALIOE_10270		hypothetical protein	
c1	cds	2052425	2052652	+	BALIOE_10275		hypothetical protein	
c1	cds	2052656	2053099	-	BALIOE_10280		hypothetical protein	
c1	cds	2053103	2053225	-	BALIOE_10285		hypothetical protein	
c1	cds	2053398	2054132	+	BALIOE_10290		hypothetical protein	
c1	cds	2054132	2054242	+	BALIOE_10295		hypothetical protein	
c1	cds	2054338	2055231	-	BALIOE_10300		hypothetical protein	
c1	cds	2055310	2055990	-	BALIOE_10305		hypothetical protein	
c1	cds	2055987	2056682	-	BALIOE_10310		hypothetical protein	
c1	cds	2056682	2058226	-	BALIOE_10315		hypothetical protein	
c1	cds	2058223	2061963	-	BALIOE_10320		hypothetical protein	
c1	cds	2062045	2063433	-	BALIOE_10325		hypothetical protein	
c1	cds	2063739	2064998	-	BALIOE_10330		hypothetical protein	
c1	cds	2065061	2065693	-	BALIOE_10335		hypothetical protein	
c1	cds	2065816	2066319	-	BALIOE_10340		hypothetical protein	
c1	cds	2066488	2067588	-	BALIOE_10345		hypothetical protein	
c1	cds	2067847	2068671	-	BALIOE_10350		hypothetical protein	
c1	cds	2068960	2069547	+	BALIOE_10355		hypothetical protein	
c1	cds	2069596	2072007	+	BALIOE_10360		hypothetical protein	
c1	cds	2072020	2072904	+	BALIOE_10365		hypothetical protein	
c1	cds	2072897	2073550	+	BALIOE_10370		hypothetical protein	
c1	cds	2073778	2074062	-	BALIOE_10375		hypothetical protein	
c1	cds	2074208	2075218	-	BALIOE_10380		hypothetical protein	
c1	cds	2075352	2077049	-	BALIOE_10385		hypothetical protein	
c1	cds	2077206	2077343	-	BALIOE_10390		hypothetical protein	
c1	cds	2077445	2077660	-	BALIOE_10395		hypothetical protein	
c1	cds	2078005	2078436	+	BALIOE_10400		hypothetical protein	
c1	cds	2078492	2079418	-	BALIOE_10405		hypothetical protein	
c1	cds	2079411	2080397	-	BALIOE_10410		hypothetical protein	
c1	cds	2080394	2081290	-	BALIOE_10415		hypothetical protein	
c1	cds	2081287	2082267	-	BALIOE_10420		hypothetical protein	
c1	cds	2082310	2083860	-	BALIOE_10425		hypothetical protein	
c1	cds	2083874	2084455	-	BALIOE_10430		hypothetical protein	
c1	cds	2084713	2085864	-	BALIOE_10435		hypothetical protein	
c1	cds	2085861	2087102	-	BALIOE_10440		hypothetical protein	
c1	cds	2087127	2088509	-	BALIOE_10445		hypothetical protein	
c1	cds	2088886	2090205	-	BALIOE_10450		hypothetical protein	
c1	cds	2090336	2091871	-	BALIOE_10455		hypothetical protein	
c1	cds	2092027	2093427	-	BALIOE_10460		hypothetical protein	
c1	cds	2093788	2096571	-	BALIOE_10465		hypothetical protein	
c1	cds	2096628	2099000	-	BALIOE_10470		hypothetical protein	
c1	cds	2099038	2100696	-	BALIOE_10475		hypothetical protein	
c1	cds	2101014	2102171	-	BALIOE_10480		hypothetical protein	
c1	cds	2102223	2103905	-	BALIOE_10485		hypothetical protein	
c1	cds	2104309	2105070	-	BALIOE_10490		hypothetical protein	
c1	cds	2105144	2105341	-	BALIOE_10495		hypothetical protein	
c1	cds	2105589	2107868	-	BALIOE_10500		hypothetical protein	
c1	cds	2108202	2109116	-	BALIOE_10505		hypothetical protein	
c1	cds	2109176	2109679	-	BALIOE_10510		hypothetical protein	
c1	cds	2109692	2110222	-	BALIOE_10515		hypothetical protein	
c1	cds	2110236	2112887	-	BALIOE_10520		hypothetical protein	
c1	cds	2112929	2113639	-	BALIOE_10525		hypothetical protein	
c1	cds	2114000	2114563	-	BALIOE_10530		hypothetical protein	
c1	cds	2115537	2116559	-	BALIOE_10535		hypothetical protein	
c1	cds	2116717	2118117	-	BALIOE_10540		hypothetical protein	
c1	cds	2118114	2122145	-	BALIOE_10545		hypothetical protein	
c1	cds	2122676	2124268	-	BALIOE_10550		hypothetical protein	
c1	cds	2124347	2125300	-	BALIOE_10555		hypothetical protein	
c1	cds	2125549	2127084	+	BALIOE_10560		hypothetical protein	
c1	cds	2127078	2128106	+	BALIOE_10565		hypothetical protein	
c1	cds	2128106	2129098	+	BALIOE_10570		hypothetical protein	
c1	cds	2129110	2130132	+	BALIOE_10575		hypothetical protein	
c1	cds	2130159	2131034	+	BALIOE_10580		hypothetical protein	
c1	cds	2131058	2131348	+	BALIOE_10585		hypothetical protein	
c1	cds	2131405	2132163	+	BALIOE_10590		hypothetical protein	
c1	cds	2132167	2133081	-	BALIOE_10595		hypothetical protein	
c1	cds	2133278	2134729	-	BALIOE_10600		hypothetical protein	
c1	cds	2134956	2136374	-	BALIOE_10605		hypothetical protein	
c1	cds	2136513	2136872	-	BALIOE_10610		hypothetical protein	
c1	cds	2136872	2137798	-	BALIOE_10615		hypothetical protein	
c1	cds	2137862	2139250	-	BALIOE_10620		hypothetical protein	
c1	cds	2139351	2140232	+	BALIOE_10625		hypothetical protein	
c1	cds	2140310	2141098	+	BALIOE_10630		hypothetical protein	
c1	cds	2141177	2141425	+	BALIOE_10635		hypothetical protein	
c1	cds	2141576	2142766	+	BALIOE_10640		hypothetical protein	
c1	cds	2142791	2143456	-	BALIOE_10645		hypothetical protein	
c1	cds	2143668	2144102	+	BALIOE_10650		hypothetical protein	
c1	cds	2144122	2144505	+	BALIOE_10655		hypothetical protein	
c1	cds	2144537	2144755	+	BALIOE_10660		hypothetical protein	
c1	cds	2144786	2145685	-	BALIOE_10665		hypothetical protein	
c1	cds	2145880	2147067	+	BALIOE_10670		hypothetical protein	
c1	cds	2147108	2147503	-	BALIOE_10675		hypothetical protein	
c1	cds	2147598	2148569	+	BALIOE_10680		hypothetical protein	
c1	cds	2148677	2148772	+	BALIOE_10685		hypothetical protein	
c1	cds	2148991	2149881	-	BALIOE_10690		hypothetical protein	
c1	cds	2150136	2150528	-	BALIOE_10695		hypothetical protein	
c1	cds	2150804	2151322	+	BALIOE_10700		hypothetical protein	
c1	cds	2151367	2153412	-	BALIOE_10705		hypothetical protein	
c1	cds	2153549	2154295	+	BALIOE_10710		hypothetical protein	
c1	cds	2154384	2155070	+	BALIOE_10715		hypothetical protein	
c1	cds	2155247	2155450	+	BALIOE_10720		hypothetical protein	
c1	cds	2155486	2156946	-	BALIOE_10725		hypothetical protein	
c1	cds	2157035	2158318	-	BALIOE_10730		hypothetical protein	
c1	cds	2158378	2158692	+	BALIOE_10735		hypothetical protein	
c1	cds	2158854	2159495	-	BALIOE_10740		hypothetical protein	
c1	cds	2159577	2160206	-	BALIOE_10745		hypothetical protein	
c1	cds	2160279	2160854	-	BALIOE_10750		hypothetical protein	
c1	cds	2160968	2161237	-	BALIOE_10755		hypothetical protein	
c1	cds	2161239	2161517	-	BALIOE_10760		hypothetical protein	
c1	cds	2161651	2162460	-	BALIOE_10765		hypothetical protein	
c1	cds	2162525	2163124	-	BALIOE_10770		hypothetical protein	
c1	cds	2163192	2166671	-	BALIOE_10775		hypothetical protein	
c1	cds	2166912	2167490	-	BALIOE_10780		hypothetical protein	
c1	cds	2167487	2168230	-	BALIOE_10785		hypothetical protein	
c1	cds	2168241	2168939	-	BALIOE_10790		hypothetical protein	
c1	cds	2168939	2169268	-	BALIOE_10795		hypothetical protein	
c1	cds	2169265	2171877	-	BALIOE_10800		hypothetical protein	
c1	cds	2171858	2172271	-	BALIOE_10805		hypothetical protein	
c1	cds	2172298	2172720	-	BALIOE_10810		hypothetical protein	
c1	cds	2172734	2173486	-	BALIOE_10815		hypothetical protein	
c1	cds	2173494	2173889	-	BALIOE_10820		hypothetical protein	
c1	cds	2173886	2174419	-	BALIOE_10825		hypothetical protein	
c1	cds	2174434	2174787	-	BALIOE_10830		hypothetical protein	
c1	cds	2174799	2175197	-	BALIOE_10835		hypothetical protein	
c1	cds	2175239	2176264	-	BALIOE_10840		hypothetical protein	
c1	cds	2176320	2176652	-	BALIOE_10845		hypothetical protein	
c1	cds	2176662	2177981	-	BALIOE_10850		hypothetical protein	
c1	cds	2177962	2179563	-	BALIOE_10855		hypothetical protein	
c1	cds	2179560	2179766	-	BALIOE_10860		hypothetical protein	
c1	cds	2179763	2181688	-	BALIOE_10865		hypothetical protein	
c1	cds	2181663	2182208	-	BALIOE_10870		hypothetical protein	
c1	cds	2182901	2183215	-	BALIOE_10875		hypothetical protein	
c1	cds	2183679	2184137	-	BALIOE_10880		hypothetical protein	
c1	cds	2184149	2184295	-	BALIOE_10885		hypothetical protein	
c1	cds	2184295	2184864	-	BALIOE_10890		hypothetical protein	
c1	cds	2185135	2185668	-	BALIOE_10895		hypothetical protein	
c1	cds	2185719	2186063	-	BALIOE_10900		hypothetical protein	
c1	cds	2186068	2186274	-	BALIOE_10905		hypothetical protein	
c1	cds	2186722	2188572	-	BALIOE_10910		hypothetical protein	
c1	cds	2188886	2189053	-	BALIOE_10915		hypothetical protein	
c1	cds	2189050	2189481	-	BALIOE_10920		hypothetical protein	
c1	tRNA	2189651	2189727	-	BALIOE_10925	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	2189828	2189903	-	BALIOE_10930	Ile2_trna	tRNA-Ile2	SO:0000263
c1	cds	2189932	2190519	-	BALIOE_10935		hypothetical protein	
c1	cds	2190781	2190978	-	BALIOE_10940		hypothetical protein	
c1	cds	2191203	2191757	-	BALIOE_10945		hypothetical protein	
c1	cds	2191820	2192125	-	BALIOE_10950		hypothetical protein	
c1	cds	2192138	2193187	-	BALIOE_10955		hypothetical protein	
c1	cds	2193189	2193461	-	BALIOE_10960		hypothetical protein	
c1	cds	2193583	2193927	-	BALIOE_10965		hypothetical protein	
c1	cds	2194047	2194259	-	BALIOE_10970		hypothetical protein	
c1	cds	2194493	2195050	-	BALIOE_10975		hypothetical protein	
c1	cds	2195398	2195709	-	BALIOE_10980		hypothetical protein	
c1	cds	2195702	2195929	-	BALIOE_10985		hypothetical protein	
c1	cds	2195926	2196207	-	BALIOE_10990		hypothetical protein	
c1	cds	2196240	2196956	-	BALIOE_10995		hypothetical protein	
c1	cds	2196990	2197451	-	BALIOE_11000		hypothetical protein	
c1	cds	2197444	2198487	-	BALIOE_11005		hypothetical protein	
c1	cds	2198556	2198981	-	BALIOE_11010		hypothetical protein	
c1	cds	2198965	2199207	-	BALIOE_11015		hypothetical protein	
c1	cds	2199599	2199937	+	BALIOE_11020		hypothetical protein	
c1	cds	2200149	2200382	+	BALIOE_11025		hypothetical protein	
c1	cds	2200394	2201032	+	BALIOE_11030		hypothetical protein	
c1	cds	2201033	2201242	-	BALIOE_11035		hypothetical protein	
c1	cds	2201807	2201995	+	BALIOE_11040		hypothetical protein	
c1	cds	2201992	2202180	+	BALIOE_11045		hypothetical protein	
c1	cds	2202273	2203517	+	BALIOE_11050		hypothetical protein	
c1	cds	2203514	2204050	+	BALIOE_11055		hypothetical protein	
c1	cds	2204156	2204410	+	BALIOE_11060		hypothetical protein	
c1	cds	2204413	2205300	-	BALIOE_11065		hypothetical protein	
c1	cds	2205300	2205626	-	BALIOE_11070		hypothetical protein	
c1	cds	2205833	2206702	-	BALIOE_11075		hypothetical protein	
c1	cds	2206746	2207126	+	BALIOE_11080		hypothetical protein	
c1	cds	2207123	2207470	+	BALIOE_11085		hypothetical protein	
c1	cds	2207520	2209058	+	BALIOE_11090		hypothetical protein	
c1	cds	2209069	2209491	-	BALIOE_11095		hypothetical protein	
c1	cds	2209641	2210291	-	BALIOE_11100		hypothetical protein	
c1	cds	2210565	2210711	-	BALIOE_11105		hypothetical protein	
c1	cds	2211002	2211511	-	BALIOE_11110		hypothetical protein	
c1	cds	2211691	2211960	-	BALIOE_11115		hypothetical protein	
c1	cds	2211962	2213185	-	BALIOE_11120		hypothetical protein	
c1	cds	2213250	2213849	-	BALIOE_11125		hypothetical protein	
c1	cds	2213917	2214132	-	BALIOE_11130		hypothetical protein	
c1	cds	2214135	2216264	-	BALIOE_11135		hypothetical protein	
c1	cds	2216216	2217391	-	BALIOE_11140		hypothetical protein	
c1	cds	2217733	2218314	-	BALIOE_11145		hypothetical protein	
c1	cds	2218311	2219054	-	BALIOE_11150		hypothetical protein	
c1	cds	2219065	2219763	-	BALIOE_11155		hypothetical protein	
c1	cds	2219763	2220104	-	BALIOE_11160		hypothetical protein	
c1	cds	2220097	2223339	-	BALIOE_11165		hypothetical protein	
c1	cds	2223387	2223596	-	BALIOE_11170		hypothetical protein	
c1	cds	2223692	2224066	-	BALIOE_11175		hypothetical protein	
c1	cds	2224081	2224797	-	BALIOE_11180		hypothetical protein	
c1	cds	2224863	2225207	-	BALIOE_11185		hypothetical protein	
c1	cds	2225204	2225650	-	BALIOE_11190		hypothetical protein	
c1	cds	2225647	2225997	-	BALIOE_11195		hypothetical protein	
c1	cds	2226007	2226333	-	BALIOE_11200		hypothetical protein	
c1	cds	2226336	2228915	-	BALIOE_11205		hypothetical protein	
c1	cds	2228861	2229082	-	BALIOE_11210		hypothetical protein	
c1	cds	2229127	2231064	-	BALIOE_11215		hypothetical protein	
c1	cds	2231128	2232789	-	BALIOE_11220		hypothetical protein	
c1	cds	2232786	2233349	-	BALIOE_11225		hypothetical protein	
c1	cds	2233639	2234004	-	BALIOE_11230		hypothetical protein	
c1	cds	2234046	2234273	+	BALIOE_11235		hypothetical protein	
c1	cds	2234636	2235103	-	BALIOE_11240		hypothetical protein	
c1	cds	2235111	2235257	-	BALIOE_11245		hypothetical protein	
c1	cds	2235257	2235826	-	BALIOE_11250		hypothetical protein	
c1	cds	2236097	2236630	-	BALIOE_11255		hypothetical protein	
c1	cds	2236681	2237025	-	BALIOE_11260		hypothetical protein	
c1	cds	2237030	2237236	-	BALIOE_11265		hypothetical protein	
c1	cds	2237685	2239535	-	BALIOE_11270		hypothetical protein	
c1	cds	2239850	2240017	-	BALIOE_11275		hypothetical protein	
c1	cds	2240014	2240442	-	BALIOE_11280		hypothetical protein	
c1	tRNA	2240622	2240698	-	BALIOE_11285	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	2240712	2240788	-	BALIOE_11290	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	2240796	2240871	-	BALIOE_11295	Ile2_trna	tRNA-Ile2	SO:0000263
c1	cds	2241082	2241771	-	BALIOE_11300		hypothetical protein	
c1	cds	2241768	2242127	-	BALIOE_11305		hypothetical protein	
c1	cds	2242140	2243189	-	BALIOE_11310		hypothetical protein	
c1	cds	2243637	2243849	-	BALIOE_11315		hypothetical protein	
c1	cds	2243894	2244049	+	BALIOE_11320		hypothetical protein	
c1	cds	2244038	2244142	-	BALIOE_11325		hypothetical protein	
c1	cds	2244258	2244842	-	BALIOE_11330		hypothetical protein	
c1	cds	2244899	2245294	-	BALIOE_11335		hypothetical protein	
c1	cds	2245310	2245978	-	BALIOE_11340		hypothetical protein	
c1	cds	2246105	2246845	-	BALIOE_11345		hypothetical protein	
c1	cds	2246852	2247814	-	BALIOE_11350		hypothetical protein	
c1	cds	2247837	2248262	-	BALIOE_11355		hypothetical protein	
c1	cds	2248259	2248561	-	BALIOE_11360		hypothetical protein	
c1	cds	2248659	2249030	+	BALIOE_11365		hypothetical protein	
c1	cds	2249051	2249242	+	BALIOE_11370		hypothetical protein	
c1	cds	2249244	2249522	+	BALIOE_11375		hypothetical protein	
c1	cds	2249953	2250153	-	BALIOE_11380		hypothetical protein	
c1	cds	2250246	2250464	+	BALIOE_11385		hypothetical protein	
c1	cds	2250468	2250632	-	BALIOE_11390		hypothetical protein	
c1	cds	2251033	2251221	+	BALIOE_11395		hypothetical protein	
c1	cds	2251218	2251409	+	BALIOE_11400		hypothetical protein	
c1	cds	2251502	2253973	+	BALIOE_11405		hypothetical protein	
c1	cds	2254061	2254297	+	BALIOE_11410		hypothetical protein	
c1	cds	2254332	2254487	+	BALIOE_11415		hypothetical protein	
c1	cds	2254988	2255080	-	BALIOE_11420		hypothetical protein	
c1	cds	2255286	2255612	-	BALIOE_11425		hypothetical protein	
c1	cds	2255747	2256088	+	BALIOE_11430		hypothetical protein	
c1	cds	2256123	2256683	+	BALIOE_11435		hypothetical protein	
c1	cds	2256686	2257432	-	BALIOE_11440		hypothetical protein	
c1	cds	2257504	2257809	+	BALIOE_11445		hypothetical protein	
c1	cds	2258008	2260434	+	BALIOE_11450		hypothetical protein	
c1	cds	2260522	2262918	+	BALIOE_11455		hypothetical protein	
c1	cds	2262929	2263546	+	BALIOE_11460		hypothetical protein	
c1	cds	2263548	2264402	+	BALIOE_11465		hypothetical protein	
c1	cds	2264445	2265059	+	BALIOE_11470		hypothetical protein	
c1	cds	2265253	2266509	+	BALIOE_11475		hypothetical protein	
c1	cds	2266462	2267157	-	BALIOE_11480		hypothetical protein	
c1	cds	2267282	2268502	-	BALIOE_11485		hypothetical protein	
c1	cds	2268637	2269530	-	BALIOE_11490		hypothetical protein	
c1	cds	2269637	2270890	+	BALIOE_11495		hypothetical protein	
c1	cds	2271314	2271622	+	BALIOE_11500		hypothetical protein	
c1	cds	2271898	2272719	+	BALIOE_11505		hypothetical protein	
c1	cds	2272758	2273087	-	BALIOE_11510		hypothetical protein	
c1	cds	2273074	2273439	-	BALIOE_11515		hypothetical protein	
c1	cds	2273851	2274885	+	BALIOE_11520		hypothetical protein	
c1	cds	2274910	2276298	-	BALIOE_11525		hypothetical protein	
c1	cds	2276309	2277841	-	BALIOE_11530		hypothetical protein	
c1	cds	2278365	2279309	+	BALIOE_11535		hypothetical protein	
c1	cds	2279495	2280877	+	BALIOE_11540		hypothetical protein	
c1	cds	2280914	2281636	+	BALIOE_11545		hypothetical protein	
c1	cds	2281633	2281968	-	BALIOE_11550		hypothetical protein	
c1	cds	2282097	2282816	+	BALIOE_11555		hypothetical protein	
c1	cds	2282820	2284121	+	BALIOE_11560		hypothetical protein	
c1	cds	2284197	2285126	+	BALIOE_11565		hypothetical protein	
c1	cds	2285123	2286526	-	BALIOE_11570		hypothetical protein	
c1	cds	2286669	2288315	-	BALIOE_11575		hypothetical protein	
c1	cds	2288514	2289689	+	BALIOE_11580		hypothetical protein	
c1	cds	2289790	2291298	+	BALIOE_11585		hypothetical protein	
c1	cds	2291343	2291564	-	BALIOE_11590		hypothetical protein	
c1	cds	2291579	2292607	-	BALIOE_11595		hypothetical protein	
c1	cds	2292646	2294019	-	BALIOE_11600		hypothetical protein	
c1	cds	2294016	2295122	-	BALIOE_11605		hypothetical protein	
c1	cds	2295116	2295829	-	BALIOE_11610		hypothetical protein	
c1	cds	2296220	2296810	-	BALIOE_11615		hypothetical protein	
c1	cds	2297039	2297806	-	BALIOE_11620		hypothetical protein	
c1	cds	2297918	2298946	-	BALIOE_11625		hypothetical protein	
c1	cds	2299121	2300713	+	BALIOE_11630		hypothetical protein	
c1	cds	2300723	2301895	+	BALIOE_11635		hypothetical protein	
c1	cds	2301999	2303000	+	BALIOE_11640		hypothetical protein	
c1	cds	2303036	2304076	-	BALIOE_11645		hypothetical protein	
c1	cds	2304319	2304444	+	BALIOE_11650		hypothetical protein	
c1	cds	2304717	2304932	+	BALIOE_11655		hypothetical protein	
c1	cds	2305018	2305458	+	BALIOE_11660		hypothetical protein	
c1	cds	2305535	2306116	+	BALIOE_11665		hypothetical protein	
c1	cds	2306116	2306694	+	BALIOE_11670		hypothetical protein	
c1	cds	2306687	2309005	+	BALIOE_11675		hypothetical protein	
c1	cds	2309006	2310064	+	BALIOE_11680		hypothetical protein	
c1	cds	2310068	2310688	+	BALIOE_11685		hypothetical protein	
c1	cds	2310692	2311387	+	BALIOE_11690		hypothetical protein	
c1	cds	2311387	2312022	+	BALIOE_11695		hypothetical protein	
c1	cds	2312150	2312350	+	BALIOE_11700		hypothetical protein	
c1	cds	2312633	2314135	+	BALIOE_11705		hypothetical protein	
c1	cds	2314241	2314846	+	BALIOE_11710		hypothetical protein	
c1	cds	2314890	2315750	-	BALIOE_11715		hypothetical protein	
c1	cds	2315812	2317086	-	BALIOE_11720		hypothetical protein	
c1	cds	2317215	2317871	-	BALIOE_11725		hypothetical protein	
c1	cds	2317930	2318253	-	BALIOE_11730		hypothetical protein	
c1	cds	2318357	2319466	-	BALIOE_11735		hypothetical protein	
c1	cds	2319739	2320206	+	BALIOE_11740		hypothetical protein	
c1	cds	2320253	2320687	-	BALIOE_11745		hypothetical protein	
c1	cds	2320888	2321124	+	BALIOE_11750		hypothetical protein	
c1	cds	2321127	2321984	+	BALIOE_11755		hypothetical protein	
c1	cds	2321984	2323996	+	BALIOE_11760		hypothetical protein	
c1	cds	2323997	2324518	-	BALIOE_11765		hypothetical protein	
c1	cds	2324707	2325495	-	BALIOE_11770		hypothetical protein	
c1	cds	2325544	2325783	-	BALIOE_11775		hypothetical protein	
c1	cds	2325886	2326485	+	BALIOE_11780		hypothetical protein	
c1	cds	2326522	2327619	+	BALIOE_11785		hypothetical protein	
c1	cds	2327700	2328107	+	BALIOE_11790		hypothetical protein	
c1	cds	2328210	2328857	+	BALIOE_11795		hypothetical protein	
c1	cds	2328950	2333566	+	BALIOE_11800		hypothetical protein	
c1	cds	2333617	2333964	-	BALIOE_11805		hypothetical protein	
c1	cds	2334299	2335114	+	BALIOE_11810		hypothetical protein	
c1	cds	2335242	2335823	+	BALIOE_11815		hypothetical protein	
c1	cds	2335969	2337138	-	BALIOE_11820		hypothetical protein	
c1	cds	2337304	2337393	-	BALIOE_11825		hypothetical protein	
c1	cds	2337692	2338717	+	BALIOE_11830		hypothetical protein	
c1	cds	2338714	2339646	-	BALIOE_11835		hypothetical protein	
c1	cds	2339759	2340970	+	BALIOE_11840		hypothetical protein	
c1	cds	2341261	2342409	+	BALIOE_11845		hypothetical protein	
c1	cds	2342449	2343090	-	BALIOE_11850		hypothetical protein	
c1	cds	2343305	2344678	+	BALIOE_11855		hypothetical protein	
c1	cds	2344719	2345975	-	BALIOE_11860		hypothetical protein	
c1	tRNA	2346283	2346359	+	BALIOE_11865	Val_trna	tRNA-Val	SO:0000273
c1	tRNA	2346364	2346440	+	BALIOE_11870	Val_trna	tRNA-Val	SO:0000273
c1	cds	2346548	2346853	+	BALIOE_11875		hypothetical protein	
c1	cds	2346979	2348583	+	BALIOE_11880		hypothetical protein	
c1	cds	2348595	2349359	-	BALIOE_11885		hypothetical protein	
c1	cds	2349411	2350196	-	BALIOE_11890		hypothetical protein	
c1	cds	2350193	2350861	-	BALIOE_11895		hypothetical protein	
c1	cds	2350925	2351563	-	BALIOE_11900		hypothetical protein	
c1	cds	2351576	2353678	-	BALIOE_11905		hypothetical protein	
c1	cds	2353699	2354325	-	BALIOE_11910		hypothetical protein	
c1	cds	2354781	2354990	-	BALIOE_11915		hypothetical protein	
c1	cds	2355547	2356959	+	BALIOE_11920		hypothetical protein	
c1	cds	2357270	2357506	+	BALIOE_11925		hypothetical protein	
c1	cds	2357569	2358573	-	BALIOE_11930		hypothetical protein	
c1	cds	2358722	2359138	-	BALIOE_11935		hypothetical protein	
c1	cds	2359151	2360371	-	BALIOE_11940		hypothetical protein	
c1	cds	2360368	2361639	-	BALIOE_11945		hypothetical protein	
c1	cds	2361614	2362360	-	BALIOE_11950		hypothetical protein	
c1	cds	2362370	2363857	-	BALIOE_11955		hypothetical protein	
c1	cds	2363866	2364234	-	BALIOE_11960		hypothetical protein	
c1	cds	2364783	2364971	-	BALIOE_11965		hypothetical protein	
c1	cds	2365071	2365481	-	BALIOE_11970		hypothetical protein	
c1	cds	2365478	2368534	-	BALIOE_11975		hypothetical protein	
c1	cds	2368923	2370035	+	BALIOE_11980		hypothetical protein	
c1	cds	2370464	2370820	+	BALIOE_11985		hypothetical protein	
c1	cds	2370920	2372134	+	BALIOE_11990		hypothetical protein	
c1	cds	2372361	2373626	+	BALIOE_11995		hypothetical protein	
c1	cds	2373638	2374504	+	BALIOE_12000		hypothetical protein	
c1	cds	2374535	2375293	+	BALIOE_12005		hypothetical protein	
c1	cds	2375438	2377033	+	BALIOE_12010		hypothetical protein	
c1	cds	2377047	2378198	+	BALIOE_12015		hypothetical protein	
c1	cds	2378241	2379152	-	BALIOE_12020		hypothetical protein	
c1	cds	2379255	2379431	-	BALIOE_12025		hypothetical protein	
c1	cds	2379468	2380232	+	BALIOE_12030		hypothetical protein	
c1	cds	2380252	2381190	+	BALIOE_12035		hypothetical protein	
c1	cds	2381246	2382535	+	BALIOE_12040		hypothetical protein	
c1	cds	2382532	2382825	+	BALIOE_12045		hypothetical protein	
c1	cds	2382882	2384528	+	BALIOE_12050		hypothetical protein	
c1	cds	2384585	2386963	-	BALIOE_12055		hypothetical protein	
c1	cds	2387296	2388129	+	BALIOE_12060		hypothetical protein	
c1	cds	2388286	2389332	+	BALIOE_12065		hypothetical protein	
c1	cds	2389464	2389655	+	BALIOE_12070		hypothetical protein	
c1	cds	2389659	2391095	-	BALIOE_12075		hypothetical protein	
c1	cds	2391158	2391871	-	BALIOE_12080		hypothetical protein	
c1	cds	2392118	2392582	-	BALIOE_12085		hypothetical protein	
c1	cds	2392660	2393409	-	BALIOE_12090		hypothetical protein	
c1	cds	2393409	2393960	-	BALIOE_12095		hypothetical protein	
c1	cds	2394023	2395003	-	BALIOE_12100		hypothetical protein	
c1	cds	2395104	2395403	-	BALIOE_12105		hypothetical protein	
c1	cds	2395408	2397795	-	BALIOE_12110		hypothetical protein	
c1	cds	2397810	2398793	-	BALIOE_12115		hypothetical protein	
c1	cds	2399243	2399599	-	BALIOE_12120		hypothetical protein	
c1	cds	2399652	2399849	-	BALIOE_12125		hypothetical protein	
c1	cds	2399946	2400380	-	BALIOE_12130		hypothetical protein	
c1	cds	2400492	2402420	-	BALIOE_12135		hypothetical protein	
c1	cds	2402943	2404841	+	BALIOE_12140		hypothetical protein	
c1	cds	2405016	2405123	+	BALIOE_12145		hypothetical protein	
c1	cds	2405176	2405934	-	BALIOE_12150		hypothetical protein	
c1	cds	2406221	2407150	+	BALIOE_12155		hypothetical protein	
c1	cds	2407251	2407541	+	BALIOE_12160		hypothetical protein	
c1	cds	2407647	2408507	+	BALIOE_12165		hypothetical protein	
c1	cds	2408548	2409084	-	BALIOE_12170		hypothetical protein	
c1	cds	2409231	2409899	+	BALIOE_12175		hypothetical protein	
c1	cds	2410062	2410652	+	BALIOE_12180		hypothetical protein	
c1	cds	2410785	2412176	+	BALIOE_12185		hypothetical protein	
c1	cds	2412227	2412982	-	BALIOE_12190		hypothetical protein	
c1	cds	2413271	2413534	-	BALIOE_12195		hypothetical protein	
c1	cds	2413717	2415978	+	BALIOE_12200		hypothetical protein	
c1	cds	2416025	2416783	-	BALIOE_12205		hypothetical protein	
c1	cds	2416796	2418148	-	BALIOE_12210		hypothetical protein	
c1	cds	2418254	2419093	-	BALIOE_12215		hypothetical protein	
c1	cds	2419104	2419454	-	BALIOE_12220		hypothetical protein	
c1	cds	2419505	2420863	-	BALIOE_12225		hypothetical protein	
c1	cds	2420948	2421268	-	BALIOE_12230		hypothetical protein	
c1	cds	2421568	2421906	-	BALIOE_12235		hypothetical protein	
c1	cds	2422108	2422935	+	BALIOE_12240		hypothetical protein	
c1	cds	2423165	2424052	+	BALIOE_12245		hypothetical protein	
c1	cds	2424012	2424587	-	BALIOE_12250		hypothetical protein	
c1	cds	2424790	2425275	-	BALIOE_12255		hypothetical protein	
c1	cds	2425604	2426572	-	BALIOE_12260		hypothetical protein	
c1	cds	2426565	2427908	-	BALIOE_12265		hypothetical protein	
c1	cds	2427905	2429383	-	BALIOE_12270		hypothetical protein	
c1	cds	2429380	2430414	-	BALIOE_12275		hypothetical protein	
c1	cds	2430411	2431631	-	BALIOE_12280		hypothetical protein	
c1	cds	2432077	2432883	+	BALIOE_12285		hypothetical protein	
c1	cds	2433050	2433760	+	BALIOE_12290		hypothetical protein	
c1	cds	2433765	2434442	+	BALIOE_12295		hypothetical protein	
c1	cds	2434457	2435164	+	BALIOE_12300		hypothetical protein	
c1	cds	2435164	2435712	+	BALIOE_12305		hypothetical protein	
c1	cds	2435722	2436888	+	BALIOE_12310		hypothetical protein	
c1	cds	2436861	2438396	+	BALIOE_12315		hypothetical protein	
c1	cds	2438396	2439049	+	BALIOE_12320		hypothetical protein	
c1	cds	2439116	2440423	+	BALIOE_12325		hypothetical protein	
c1	cds	2440432	2441052	-	BALIOE_12330		hypothetical protein	
c1	cds	2441139	2441546	+	BALIOE_12335		hypothetical protein	
c1	cds	2441512	2441784	-	BALIOE_12340		hypothetical protein	
c1	cds	2442020	2443363	+	BALIOE_12345		hypothetical protein	
c1	cds	2443480	2444520	-	BALIOE_12350		hypothetical protein	
c1	cds	2444648	2446609	-	BALIOE_12355		hypothetical protein	
c1	cds	2446614	2447657	-	BALIOE_12360		hypothetical protein	
c1	cds	2447774	2448325	-	BALIOE_12365		hypothetical protein	
c1	cds	2448486	2450342	+	BALIOE_12370		hypothetical protein	
c1	cds	2450458	2451168	+	BALIOE_12375		hypothetical protein	
c1	cds	2451300	2452316	+	BALIOE_12380		hypothetical protein	
c1	cds	2452327	2452968	+	BALIOE_12385		hypothetical protein	
c1	cds	2453061	2454221	-	BALIOE_12390		hypothetical protein	
c1	cds	2454374	2454700	+	BALIOE_12395		hypothetical protein	
c1	cds	2454700	2455587	+	BALIOE_12400		hypothetical protein	
c1	cds	2455562	2455732	-	BALIOE_12405		hypothetical protein	
c1	cds	2455850	2456608	-	BALIOE_12410		hypothetical protein	
c1	cds	2456745	2457725	-	BALIOE_12415		hypothetical protein	
c1	cds	2457735	2458667	-	BALIOE_12420		hypothetical protein	
c1	cds	2458672	2459508	-	BALIOE_12425		hypothetical protein	
c1	cds	2459529	2460572	-	BALIOE_12430		hypothetical protein	
c1	cds	2460589	2461968	-	BALIOE_12435		hypothetical protein	
c1	cds	2461995	2463071	-	BALIOE_12440		hypothetical protein	
c1	cds	2463441	2463713	-	BALIOE_12445		hypothetical protein	
c1	cds	2463755	2464168	-	BALIOE_12450		hypothetical protein	
c1	cds	2464510	2465505	+	BALIOE_12455		hypothetical protein	
c1	cds	2465589	2466473	+	BALIOE_12460		hypothetical protein	
c1	cds	2466524	2467378	-	BALIOE_12465		hypothetical protein	
c1	cds	2467468	2468214	-	BALIOE_12470		hypothetical protein	
c1	cds	2468650	2470584	+	BALIOE_12475		hypothetical protein	
c1	cds	2470697	2471980	+	BALIOE_12480		hypothetical protein	
c1	cds	2472259	2473602	+	BALIOE_12485		hypothetical protein	
c1	cds	2473783	2475273	+	BALIOE_12490		hypothetical protein	
c1	cds	2475316	2475819	+	BALIOE_12495		hypothetical protein	
c1	cds	2476094	2476540	+	BALIOE_12500		hypothetical protein	
c1	cds	2476497	2477315	-	BALIOE_12505		hypothetical protein	
c1	cds	2477415	2478596	+	BALIOE_12510		hypothetical protein	
c1	cds	2478651	2478998	+	BALIOE_12515		hypothetical protein	
c1	cds	2479020	2479274	-	BALIOE_12520		hypothetical protein	
c1	cds	2479457	2480305	+	BALIOE_12525		hypothetical protein	
c1	cds	2480749	2480997	-	BALIOE_12530		hypothetical protein	
c1	cds	2481144	2481326	-	BALIOE_12535		hypothetical protein	
c1	cds	2481330	2481689	-	BALIOE_12540		hypothetical protein	
c1	cds	2481862	2482500	-	BALIOE_12545		hypothetical protein	
c1	cds	2482627	2483550	-	BALIOE_12550		hypothetical protein	
c1	cds	2483653	2484738	+	BALIOE_12555		hypothetical protein	
c1	cds	2484989	2486599	+	BALIOE_12560		hypothetical protein	
c1	cds	2486631	2487755	+	BALIOE_12565		hypothetical protein	
c1	cds	2487811	2488776	+	BALIOE_12570		hypothetical protein	
c1	cds	2488830	2489945	-	BALIOE_12575		hypothetical protein	
c1	cds	2490027	2491778	-	BALIOE_12580		hypothetical protein	
c1	cds	2491917	2492498	-	BALIOE_12585		hypothetical protein	
c1	cds	2492538	2493233	-	BALIOE_12590		hypothetical protein	
c1	cds	2493291	2495201	-	BALIOE_12595		hypothetical protein	
c1	cds	2495330	2495677	+	BALIOE_12600		hypothetical protein	
c1	cds	2496099	2496398	+	BALIOE_12605		hypothetical protein	
c1	cds	2496518	2496697	-	BALIOE_12610		hypothetical protein	
c1	cds	2496771	2498132	+	BALIOE_12615		hypothetical protein	
c1	cds	2498136	2498714	+	BALIOE_12620		hypothetical protein	
c1	cds	2498898	2500262	+	BALIOE_12625		hypothetical protein	
c1	cds	2500393	2501991	+	BALIOE_12630		hypothetical protein	
c1	cds	2501995	2503551	-	BALIOE_12635		hypothetical protein	
c1	cds	2504014	2504985	+	BALIOE_12640		hypothetical protein	
c1	cds	2505048	2505848	+	BALIOE_12645		hypothetical protein	
c1	cds	2505861	2506712	+	BALIOE_12650		hypothetical protein	
c1	cds	2506767	2507225	+	BALIOE_12655		hypothetical protein	
c1	cds	2507536	2507658	+	BALIOE_12660		hypothetical protein	
c1	cds	2507655	2508221	+	BALIOE_12665		hypothetical protein	
c1	cds	2508218	2509027	-	BALIOE_12670		hypothetical protein	
c1	cds	2509193	2509402	-	BALIOE_12675		hypothetical protein	
c1	cds	2510227	2510514	-	BALIOE_12680		hypothetical protein	
c1	cds	2510892	2511131	+	BALIOE_12685		hypothetical protein	
c1	cds	2511275	2512066	-	BALIOE_12690		hypothetical protein	
c1	cds	2512243	2513616	+	BALIOE_12695		hypothetical protein	
c1	cds	2513662	2514543	-	BALIOE_12700		hypothetical protein	
c1	cds	2514735	2516783	-	BALIOE_12705		hypothetical protein	
c1	cds	2516803	2517501	-	BALIOE_12710		hypothetical protein	
c1	cds	2517598	2518149	-	BALIOE_12715		hypothetical protein	
c1	cds	2518225	2519508	+	BALIOE_12720		hypothetical protein	
c1	cds	2519477	2522110	+	BALIOE_12725		hypothetical protein	
c1	cds	2522110	2523630	+	BALIOE_12730		hypothetical protein	
c1	cds	2523748	2523984	+	BALIOE_12735		hypothetical protein	
c1	cds	2524005	2524280	+	BALIOE_12740		hypothetical protein	
c1	cds	2524281	2524937	-	BALIOE_12745		hypothetical protein	
c1	cds	2525333	2525674	-	BALIOE_12750		hypothetical protein	
c1	cds	2525687	2526559	-	BALIOE_12755		hypothetical protein	
c1	cds	2526563	2526937	-	BALIOE_12760		hypothetical protein	
c1	cds	2527076	2527306	+	BALIOE_12765		hypothetical protein	
c1	cds	2527408	2528064	+	BALIOE_12770		hypothetical protein	
c1	cds	2528088	2528750	+	BALIOE_12775		hypothetical protein	
c1	cds	2528747	2530807	-	BALIOE_12780		hypothetical protein	
c1	cds	2531016	2531675	-	BALIOE_12785		hypothetical protein	
c1	cds	2531735	2531845	+	BALIOE_12790		hypothetical protein	
c1	cds	2531882	2532088	+	BALIOE_12795		hypothetical protein	
c1	cds	2532002	2532358	-	BALIOE_12800		hypothetical protein	
c1	cds	2532425	2532715	-	BALIOE_12805		hypothetical protein	
c1	cds	2532849	2534027	+	BALIOE_12810		hypothetical protein	
c1	cds	2534083	2534724	-	BALIOE_12815		hypothetical protein	
c1	cds	2534761	2536572	-	BALIOE_12820		hypothetical protein	
c1	cds	2536807	2538282	-	BALIOE_12825		hypothetical protein	
c1	cds	2538448	2538597	-	BALIOE_12830		hypothetical protein	
c1	cds	2538620	2539489	+	BALIOE_12835		hypothetical protein	
c1	cds	2539617	2541059	+	BALIOE_12840		hypothetical protein	
c1	cds	2541190	2542161	-	BALIOE_12845		hypothetical protein	
c1	cds	2542281	2543603	-	BALIOE_12850		hypothetical protein	
c1	cds	2543619	2544605	-	BALIOE_12855		hypothetical protein	
c1	cds	2544630	2545385	+	BALIOE_12860		hypothetical protein	
c1	cds	2545382	2546167	+	BALIOE_12865		hypothetical protein	
c1	ncRNA	2546239	2546314	-	BALIOE_12870	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	2546413	2547423	-	BALIOE_12875		hypothetical protein	
c1	cds	2547432	2548043	-	BALIOE_12880		hypothetical protein	
c1	cds	2548318	2548920	+	BALIOE_12885		hypothetical protein	
c1	cds	2548922	2549443	-	BALIOE_12890		hypothetical protein	
c1	cds	2549478	2550218	-	BALIOE_12895		hypothetical protein	
c1	cds	2550247	2550756	-	BALIOE_12900		hypothetical protein	
c1	cds	2550817	2552589	-	BALIOE_12905		hypothetical protein	
c1	cds	2552899	2553465	+	BALIOE_12910		hypothetical protein	
c1	cds	2553462	2554280	+	BALIOE_12915		hypothetical protein	
c1	cds	2554333	2554728	+	BALIOE_12920		hypothetical protein	
c1	cds	2554769	2555512	+	BALIOE_12925		hypothetical protein	
c1	cds	2555509	2556480	+	BALIOE_12930		hypothetical protein	
c1	cds	2556645	2559074	-	BALIOE_12935		hypothetical protein	
c1	cds	2559099	2560199	-	BALIOE_12940		hypothetical protein	
c1	cds	2560587	2561333	-	BALIOE_12945		hypothetical protein	
c1	cds	2561347	2561913	-	BALIOE_12950		hypothetical protein	
c1	cds	2562129	2563862	+	BALIOE_12955		hypothetical protein	
c1	cds	2564039	2564527	+	BALIOE_12960		hypothetical protein	
c1	cds	2564647	2565042	-	BALIOE_12965		hypothetical protein	
c1	cds	2565039	2567117	-	BALIOE_12970		hypothetical protein	
c1	cds	2567110	2568258	-	BALIOE_12975		hypothetical protein	
c1	cds	2568460	2569104	-	BALIOE_12980		hypothetical protein	
c1	cds	2569115	2569504	-	BALIOE_12985		hypothetical protein	
c1	cds	2569519	2570568	-	BALIOE_12990		hypothetical protein	
c1	cds	2570571	2571431	-	BALIOE_12995		hypothetical protein	
c1	cds	2571450	2573051	-	BALIOE_13000		hypothetical protein	
c1	cds	2573097	2574758	-	BALIOE_13005		hypothetical protein	
c1	cds	2574901	2575404	-	BALIOE_13010		hypothetical protein	
c1	cds	2575425	2577389	-	BALIOE_13015		hypothetical protein	
c1	cds	2577394	2578320	-	BALIOE_13020		hypothetical protein	
c1	cds	2578317	2579204	-	BALIOE_13025		hypothetical protein	
c1	cds	2579331	2579909	-	BALIOE_13030		hypothetical protein	
c1	cds	2579912	2580262	-	BALIOE_13035		hypothetical protein	
c1	cds	2581042	2581470	+	BALIOE_13040		hypothetical protein	
c1	cds	2581477	2582901	-	BALIOE_13045		hypothetical protein	
c1	cds	2582876	2583676	-	BALIOE_13050		hypothetical protein	
c1	cds	2583843	2584550	-	BALIOE_13055		hypothetical protein	
c1	cds	2584569	2584829	-	BALIOE_13060		hypothetical protein	
c1	cds	2584844	2586358	-	BALIOE_13065		hypothetical protein	
c1	cds	2586428	2587417	-	BALIOE_13070		hypothetical protein	
c1	cds	2588214	2588717	+	BALIOE_13075		hypothetical protein	
c1	cds	2588797	2589048	-	BALIOE_13080		hypothetical protein	
c1	cds	2589511	2589834	+	BALIOE_13085		hypothetical protein	
c1	cds	2590005	2590502	+	BALIOE_13090		hypothetical protein	
c1	cds	2590539	2590778	-	BALIOE_13095		hypothetical protein	
c1	cds	2590970	2592181	+	BALIOE_13100		hypothetical protein	
c1	cds	2592243	2592908	-	BALIOE_13105		hypothetical protein	
c1	cds	2593265	2594266	-	BALIOE_13110		hypothetical protein	
c1	cds	2594272	2594619	-	BALIOE_13115		hypothetical protein	
c1	cds	2594649	2595299	-	BALIOE_13120		hypothetical protein	
c1	cds	2595315	2595719	-	BALIOE_13125		hypothetical protein	
c1	cds	2596018	2596221	+	BALIOE_13130		hypothetical protein	
c1	cds	2596243	2596593	+	BALIOE_13135		hypothetical protein	
c1	cds	2596604	2596882	+	BALIOE_13140		hypothetical protein	
c1	cds	2596894	2597136	+	BALIOE_13145		hypothetical protein	
c1	cds	2597133	2597246	+	BALIOE_13150		hypothetical protein	
c1	cds	2597339	2597755	+	BALIOE_13155		hypothetical protein	
c1	cds	2597779	2597982	+	BALIOE_13160		hypothetical protein	
c1	cds	2597979	2598245	+	BALIOE_13165		hypothetical protein	
c1	cds	2598242	2598541	+	BALIOE_13170		hypothetical protein	
c1	cds	2598864	2599094	+	BALIOE_13175		hypothetical protein	
c1	cds	2599167	2599532	+	BALIOE_13180		hypothetical protein	
c1	cds	2599539	2602361	+	BALIOE_13185		hypothetical protein	
c1	cds	2602438	2603397	+	BALIOE_13190		hypothetical protein	
c1	cds	2603402	2603716	+	BALIOE_13195		hypothetical protein	
c1	cds	2603736	2604425	-	BALIOE_13200		hypothetical protein	
c1	cds	2604425	2604751	-	BALIOE_13205		hypothetical protein	
c1	cds	2604922	2605338	+	BALIOE_13210		hypothetical protein	
c1	cds	2605382	2605954	-	BALIOE_13215		hypothetical protein	
c1	cds	2606111	2606599	-	BALIOE_13220		hypothetical protein	
c1	cds	2606612	2607313	-	BALIOE_13225		hypothetical protein	
c1	cds	2607325	2609415	-	BALIOE_13230		hypothetical protein	
c1	cds	2609566	2609931	-	BALIOE_13235		hypothetical protein	
c1	cds	2609986	2610498	-	BALIOE_13240		hypothetical protein	
c1	cds	2610498	2611682	-	BALIOE_13245		hypothetical protein	
c1	cds	2611840	2612163	+	BALIOE_13250		hypothetical protein	
c1	cds	2612114	2613145	-	BALIOE_13255		hypothetical protein	
c1	tRNA	2614224	2614310	-	BALIOE_13260	Leu_trna	tRNA-Leu	SO:0000264
c1	tRNA	2614323	2614396	-	BALIOE_13265	Cys_trna	tRNA-Cys	SO:0000258
c1	tRNA	2614450	2614525	-	BALIOE_13270	Gly_trna	tRNA-Gly	SO:0000260
c1	cds	2614677	2615225	-	BALIOE_13275		hypothetical protein	
c1	cds	2615282	2617114	-	BALIOE_13280		hypothetical protein	
c1	cds	2617111	2617767	-	BALIOE_13285		hypothetical protein	
c1	cds	2618226	2618450	+	BALIOE_13290		hypothetical protein	
c1	cds	2618518	2619240	-	BALIOE_13295		hypothetical protein	
c1	cds	2619470	2620222	-	BALIOE_13300		hypothetical protein	
c1	cds	2620219	2620887	-	BALIOE_13305		hypothetical protein	
c1	cds	2620902	2621381	-	BALIOE_13310		hypothetical protein	
c1	cds	2621387	2621887	-	BALIOE_13315		hypothetical protein	
c1	cds	2621992	2622849	-	BALIOE_13320		hypothetical protein	
c1	cds	2622880	2623431	-	BALIOE_13325		hypothetical protein	
c1	cds	2623477	2624196	-	BALIOE_13330		hypothetical protein	
c1	cds	2624516	2626273	-	BALIOE_13335		hypothetical protein	
c1	cds	2626539	2627936	+	BALIOE_13340		hypothetical protein	
c1	cds	2627961	2628371	+	BALIOE_13345		hypothetical protein	
c1	cds	2628371	2628736	+	BALIOE_13350		hypothetical protein	
c1	cds	2628814	2630301	+	BALIOE_13355		hypothetical protein	
c1	cds	2630335	2630748	-	BALIOE_13360		hypothetical protein	
c1	cds	2630935	2632140	+	BALIOE_13365		hypothetical protein	
c1	cds	2632137	2632370	+	BALIOE_13370		hypothetical protein	
c1	cds	2632479	2633147	+	BALIOE_13375		hypothetical protein	
c1	cds	2633258	2633737	+	BALIOE_13380		hypothetical protein	
c1	cds	2633875	2635014	-	BALIOE_13385		hypothetical protein	
c1	cds	2635833	2636972	-	BALIOE_13390		hypothetical protein	
c1	cds	2637321	2637635	-	BALIOE_13395		hypothetical protein	
c1	cds	2637850	2639508	+	BALIOE_13400		hypothetical protein	
c1	cds	2639501	2640496	+	BALIOE_13405		hypothetical protein	
c1	cds	2640489	2641175	+	BALIOE_13410		hypothetical protein	
c1	cds	2641237	2642610	+	BALIOE_13415		hypothetical protein	
c1	cds	2642629	2643072	+	BALIOE_13420		hypothetical protein	
c1	cds	2643069	2644196	+	BALIOE_13425		hypothetical protein	
c1	cds	2644301	2644765	+	BALIOE_13430		hypothetical protein	
c1	cds	2644770	2645774	+	BALIOE_13435		hypothetical protein	
c1	cds	2645771	2646184	+	BALIOE_13440		hypothetical protein	
c1	cds	2646187	2646552	+	BALIOE_13445		hypothetical protein	
c1	cds	2646552	2647289	+	BALIOE_13450		hypothetical protein	
c1	cds	2647299	2647568	+	BALIOE_13455		hypothetical protein	
c1	cds	2647576	2648361	+	BALIOE_13460		hypothetical protein	
c1	cds	2648651	2649274	+	BALIOE_13465		hypothetical protein	
c1	cds	2649318	2649506	-	BALIOE_13470		hypothetical protein	
c1	cds	2649669	2649896	+	BALIOE_13475		hypothetical protein	
c1	cds	2650194	2651009	+	BALIOE_13480		hypothetical protein	
c1	cds	2651006	2652700	-	BALIOE_13485		hypothetical protein	
c1	cds	2652871	2653053	-	BALIOE_13490		hypothetical protein	
c1	cds	2653132	2654049	-	BALIOE_13495		hypothetical protein	
c1	cds	2654222	2655142	+	BALIOE_13500		hypothetical protein	
c1	cds	2655131	2655601	-	BALIOE_13505		hypothetical protein	
c1	cds	2655582	2657000	-	BALIOE_13510		hypothetical protein	
c1	cds	2657067	2657762	-	BALIOE_13515		hypothetical protein	
c1	cds	2658733	2659377	+	BALIOE_13520		hypothetical protein	
c1	cds	2659344	2659919	+	BALIOE_13525		hypothetical protein	
c1	cds	2660511	2661362	+	BALIOE_13530		hypothetical protein	
c1	cds	2661470	2662828	-	BALIOE_13535		hypothetical protein	
c1	cds	2662828	2663610	-	BALIOE_13540		hypothetical protein	
c1	cds	2663632	2664045	+	BALIOE_13545		hypothetical protein	
c1	cds	2664153	2665157	+	BALIOE_13550		hypothetical protein	
c1	cds	2665158	2665793	+	BALIOE_13555		hypothetical protein	
c1	cds	2666029	2666700	+	BALIOE_13560		hypothetical protein	
c1	cds	2667043	2667573	+	BALIOE_13565		hypothetical protein	
c1	tRNA	2668144	2668233	-	BALIOE_13570		(pseudo) tRNA-Xxx	
c1	cds	2668284	2668502	+	BALIOE_13575		hypothetical protein	
c1	cds	2668710	2669363	+	BALIOE_13580		hypothetical protein	
c1	cds	2669688	2670701	+	BALIOE_13585		hypothetical protein	
c1	cds	2670827	2671096	-	BALIOE_13590		hypothetical protein	
c1	cds	2671098	2672411	-	BALIOE_13595		hypothetical protein	
c1	cds	2672476	2673075	-	BALIOE_13600		hypothetical protein	
c1	cds	2673143	2675494	-	BALIOE_13605		hypothetical protein	
c1	cds	2675446	2676621	-	BALIOE_13610		hypothetical protein	
c1	cds	2676862	2677440	-	BALIOE_13615		hypothetical protein	
c1	cds	2677437	2678180	-	BALIOE_13620		hypothetical protein	
c1	cds	2678191	2678889	-	BALIOE_13625		hypothetical protein	
c1	cds	2678889	2679218	-	BALIOE_13630		hypothetical protein	
c1	cds	2679215	2679979	-	BALIOE_13635		hypothetical protein	
c1	cds	2679931	2681793	-	BALIOE_13640		hypothetical protein	
c1	cds	2681774	2682187	-	BALIOE_13645		hypothetical protein	
c1	cds	2682214	2682645	-	BALIOE_13650		hypothetical protein	
c1	cds	2682659	2683288	-	BALIOE_13655		hypothetical protein	
c1	cds	2683381	2683647	-	BALIOE_13660		hypothetical protein	
c1	cds	2683705	2684052	-	BALIOE_13665		hypothetical protein	
c1	cds	2684089	2685594	-	BALIOE_13670		hypothetical protein	
c1	cds	2685584	2687176	-	BALIOE_13675		hypothetical protein	
c1	cds	2687173	2687379	-	BALIOE_13680		hypothetical protein	
c1	cds	2687363	2689291	-	BALIOE_13685		hypothetical protein	
c1	cds	2689263	2689772	-	BALIOE_13690		hypothetical protein	
c1	cds	2690473	2690787	-	BALIOE_13695		hypothetical protein	
c1	cds	2691252	2691719	-	BALIOE_13700		hypothetical protein	
c1	cds	2691727	2691858	-	BALIOE_13705		hypothetical protein	
c1	cds	2691871	2692053	-	BALIOE_13710		hypothetical protein	
c1	cds	2692209	2692742	-	BALIOE_13715		hypothetical protein	
c1	cds	2692793	2693137	-	BALIOE_13720		hypothetical protein	
c1	cds	2693142	2693348	-	BALIOE_13725		hypothetical protein	
c1	cds	2693668	2693994	+	BALIOE_13730		hypothetical protein	
c1	cds	2693994	2694881	+	BALIOE_13735		hypothetical protein	
c1	cds	2694963	2696813	-	BALIOE_13740		hypothetical protein	
c1	cds	2697127	2697294	-	BALIOE_13745		hypothetical protein	
c1	cds	2697291	2697719	-	BALIOE_13750		hypothetical protein	
c1	tRNA	2697893	2697969	-	BALIOE_13755	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	2697983	2698059	-	BALIOE_13760	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	2698067	2698142	-	BALIOE_13765	Ile2_trna	tRNA-Ile2	SO:0000263
c1	cds	2698353	2699042	-	BALIOE_13770		hypothetical protein	
c1	cds	2699039	2699398	-	BALIOE_13775		hypothetical protein	
c1	cds	2699411	2700460	-	BALIOE_13780		hypothetical protein	
c1	cds	2700908	2701120	-	BALIOE_13785		hypothetical protein	
c1	cds	2701307	2701411	-	BALIOE_13790		hypothetical protein	
c1	cds	2701521	2702084	-	BALIOE_13795		hypothetical protein	
c1	cds	2702211	2702522	-	BALIOE_13800		hypothetical protein	
c1	cds	2702519	2702671	-	BALIOE_13805		hypothetical protein	
c1	cds	2702704	2703060	-	BALIOE_13810		hypothetical protein	
c1	cds	2703057	2703281	-	BALIOE_13815		hypothetical protein	
c1	cds	2703303	2704001	-	BALIOE_13820		hypothetical protein	
c1	cds	2704036	2704458	-	BALIOE_13825		hypothetical protein	
c1	cds	2704490	2705527	-	BALIOE_13830		hypothetical protein	
c1	cds	2705596	2706021	-	BALIOE_13835		hypothetical protein	
c1	cds	2706018	2706245	-	BALIOE_13840		hypothetical protein	
c1	cds	2706343	2706987	+	BALIOE_13845		hypothetical protein	
c1	cds	2707262	2707414	+	BALIOE_13850		hypothetical protein	
c1	cds	2707895	2708083	+	BALIOE_13855		hypothetical protein	
c1	cds	2708080	2708268	+	BALIOE_13860		hypothetical protein	
c1	cds	2708364	2710835	+	BALIOE_13865		hypothetical protein	
c1	cds	2710894	2711097	+	BALIOE_13870		hypothetical protein	
c1	cds	2711097	2712119	+	BALIOE_13875		hypothetical protein	
c1	tRNA	2712172	2712261	-	BALIOE_13880	Ser_trna	tRNA-Ser	SO:0000269
c1	cds	2712355	2713152	+	BALIOE_13885		hypothetical protein	
c1	tRNA	2713253	2713328	+	BALIOE_13890	Asn_trna	tRNA-Asn	SO:0000257
c1	cds	2713452	2713601	+	BALIOE_13895		hypothetical protein	
c1	cds	2713615	2717622	+	BALIOE_13900		hypothetical protein	
c1	cds	2717588	2721625	+	BALIOE_13905		hypothetical protein	
c1	cds	2721887	2722939	-	BALIOE_13910		hypothetical protein	
c1	cds	2723253	2724569	+	BALIOE_13915		hypothetical protein	
c1	cds	2724671	2726125	+	BALIOE_13920		hypothetical protein	
c1	cds	2726468	2727184	+	BALIOE_13925		hypothetical protein	
c1	tRNA	2727634	2727709	-	BALIOE_13930	Asn_trna	tRNA-Asn	SO:0000257
c1	cds	2728158	2729264	-	BALIOE_13935		hypothetical protein	
c1	tRNA	2729458	2729533	+	BALIOE_13940	Asn_trna	tRNA-Asn	SO:0000257
c1	cds	2729571	2730521	-	BALIOE_13945		hypothetical protein	
c1	cds	2730623	2731540	-	BALIOE_13950		hypothetical protein	
c1	tRNA	2731866	2731941	+	BALIOE_13955	Asn_trna	tRNA-Asn	SO:0000257
c1	cds	2731997	2732932	-	BALIOE_13960		hypothetical protein	
c1	cds	2732994	2734073	-	BALIOE_13965		hypothetical protein	
c1	cds	2734085	2734828	-	BALIOE_13970		hypothetical protein	
c1	cds	2734825	2735367	-	BALIOE_13975		hypothetical protein	
c1	cds	2735732	2736112	+	BALIOE_13980		hypothetical protein	
c1	cds	2736109	2736456	+	BALIOE_13985		hypothetical protein	
c1	cds	2736506	2738044	+	BALIOE_13990		hypothetical protein	
c1	cds	2739492	2741639	+	BALIOE_13995		hypothetical protein	
c1	cds	2741627	2741755	+	BALIOE_14000		hypothetical protein	
c1	cds	2742011	2742337	+	BALIOE_14005		hypothetical protein	
c1	cds	2742337	2743224	+	BALIOE_14010		hypothetical protein	
c1	cds	2743190	2744089	+	BALIOE_14015		hypothetical protein	
c1	cds	2744086	2744991	+	BALIOE_14020		hypothetical protein	
c1	cds	2744988	2746058	+	BALIOE_14025		hypothetical protein	
c1	cds	2746194	2746877	+	BALIOE_14030		hypothetical protein	
c1	cds	2746893	2747303	+	BALIOE_14035		hypothetical protein	
c1	cds	2747524	2748345	+	BALIOE_14040		hypothetical protein	
c1	cds	2748427	2748906	+	BALIOE_14045		hypothetical protein	
c1	cds	2748921	2749397	+	BALIOE_14050		hypothetical protein	
c1	cds	2749460	2749681	+	BALIOE_14055		hypothetical protein	
c1	cds	2749755	2750123	+	BALIOE_14060		hypothetical protein	
c1	cds	2750212	2750475	+	BALIOE_14065		hypothetical protein	
c1	cds	2750582	2750776	+	BALIOE_14070		hypothetical protein	
c1	cds	2751674	2752003	-	BALIOE_14075		hypothetical protein	
c1	cds	2752175	2753233	-	BALIOE_14080		hypothetical protein	
c1	cds	2753432	2753905	-	BALIOE_14085		hypothetical protein	
c1	cds	2754024	2755190	-	BALIOE_14090		hypothetical protein	
c1	cds	2755399	2756826	+	BALIOE_14095		hypothetical protein	
c1	cds	2756869	2757096	-	BALIOE_14100		hypothetical protein	
c1	cds	2757110	2758114	-	BALIOE_14105		hypothetical protein	
c1	cds	2758347	2759705	-	BALIOE_14110		hypothetical protein	
c1	cds	2759972	2760922	-	BALIOE_14115		hypothetical protein	
c1	cds	2760947	2761771	-	BALIOE_14120		hypothetical protein	
c1	cds	2762393	2763292	+	BALIOE_14125		hypothetical protein	
c1	cds	2763298	2764602	+	BALIOE_14130		hypothetical protein	
c1	cds	2764599	2765669	+	BALIOE_14135		hypothetical protein	
c1	cds	2765669	2766736	+	BALIOE_14140		hypothetical protein	
c1	cds	2766736	2767326	+	BALIOE_14145		hypothetical protein	
c1	cds	2767326	2768063	+	BALIOE_14150		hypothetical protein	
c1	cds	2768045	2768821	+	BALIOE_14155		hypothetical protein	
c1	cds	2768815	2769426	+	BALIOE_14160		hypothetical protein	
c1	cds	2769523	2770500	-	BALIOE_14165		hypothetical protein	
c1	cds	2770646	2771812	-	BALIOE_14170		hypothetical protein	
c1	cds	2772061	2773467	-	BALIOE_14175		hypothetical protein	
c1	cds	2773668	2774333	-	BALIOE_14180		hypothetical protein	
c1	cds	2775596	2776966	-	BALIOE_14185		hypothetical protein	
c1	cds	2776970	2778418	-	BALIOE_14190		hypothetical protein	
c1	cds	2778400	2778909	-	BALIOE_14195		hypothetical protein	
c1	cds	2778912	2779877	-	BALIOE_14200		hypothetical protein	
c1	cds	2779880	2780998	-	BALIOE_14205		hypothetical protein	
c1	cds	2781018	2782232	-	BALIOE_14210		hypothetical protein	
c1	cds	2782257	2783351	-	BALIOE_14215		hypothetical protein	
c1	cds	2783354	2784745	-	BALIOE_14220		hypothetical protein	
c1	cds	2784732	2785478	-	BALIOE_14225		hypothetical protein	
c1	cds	2785447	2786631	-	BALIOE_14230		hypothetical protein	
c1	cds	2786628	2787410	-	BALIOE_14235		hypothetical protein	
c1	cds	2787729	2788622	-	BALIOE_14240		hypothetical protein	
c1	cds	2788865	2789860	-	BALIOE_14245		hypothetical protein	
c1	cds	2790018	2791412	-	BALIOE_14250		hypothetical protein	
c1	cds	2791423	2792643	-	BALIOE_14255		hypothetical protein	
c1	cds	2792640	2793920	-	BALIOE_14260		hypothetical protein	
c1	cds	2794100	2795578	-	BALIOE_14265		hypothetical protein	
c1	cds	2795580	2796974	-	BALIOE_14270		hypothetical protein	
c1	cds	2797029	2798399	-	BALIOE_14275		hypothetical protein	
c1	cds	2798592	2800028	-	BALIOE_14280		hypothetical protein	
c1	cds	2800031	2801254	-	BALIOE_14285		hypothetical protein	
c1	cds	2801251	2801733	-	BALIOE_14290		hypothetical protein	
c1	cds	2801733	2802698	-	BALIOE_14295		hypothetical protein	
c1	cds	2802701	2803822	-	BALIOE_14300		hypothetical protein	
c1	cds	2803851	2804399	-	BALIOE_14305		hypothetical protein	
c1	cds	2804415	2805161	-	BALIOE_14310		hypothetical protein	
c1	cds	2805172	2806389	-	BALIOE_14315		hypothetical protein	
c1	cds	2806364	2807581	-	BALIOE_14320		hypothetical protein	
c1	cds	2807578	2808066	-	BALIOE_14325		hypothetical protein	
c1	cds	2808069	2808908	-	BALIOE_14330		hypothetical protein	
c1	cds	2809001	2811163	-	BALIOE_14335		hypothetical protein	
c1	cds	2811166	2811609	-	BALIOE_14340		hypothetical protein	
c1	cds	2811615	2812754	-	BALIOE_14345		hypothetical protein	
c1	cds	2813413	2814996	+	BALIOE_14350		hypothetical protein	
c1	cds	2815071	2815409	+	BALIOE_14355		hypothetical protein	
c1	cds	2815399	2815689	+	BALIOE_14360		hypothetical protein	
c1	cds	2815742	2817595	-	BALIOE_14365		hypothetical protein	
c1	cds	2817617	2818198	-	BALIOE_14370		hypothetical protein	
c1	cds	2818290	2818931	-	BALIOE_14375		hypothetical protein	
c1	cds	2819249	2819782	+	BALIOE_14380		hypothetical protein	
c1	cds	2819760	2822567	+	BALIOE_14385		hypothetical protein	
c1	cds	2822668	2823516	-	BALIOE_14390		hypothetical protein	
c1	cds	2823698	2825002	+	BALIOE_14395		hypothetical protein	
c1	cds	2825015	2826955	-	BALIOE_14400		hypothetical protein	
c1	cds	2826952	2827632	-	BALIOE_14405		hypothetical protein	
c1	cds	2827710	2828369	-	BALIOE_14410		hypothetical protein	
c1	cds	2829585	2830832	+	BALIOE_14415		hypothetical protein	
c1	cds	2830832	2833954	+	BALIOE_14420		hypothetical protein	
c1	cds	2833955	2837032	+	BALIOE_14425		hypothetical protein	
c1	cds	2837033	2838448	+	BALIOE_14430		hypothetical protein	
c1	cds	2838445	2839848	+	BALIOE_14435		hypothetical protein	
c1	cds	2839845	2840567	+	BALIOE_14440		hypothetical protein	
c1	cds	2840758	2841090	+	BALIOE_14445		hypothetical protein	
c1	cds	2841238	2842599	+	BALIOE_14450		hypothetical protein	
c1	cds	2842929	2843246	-	BALIOE_14455		hypothetical protein	
c1	cds	2843652	2844551	+	BALIOE_14460		hypothetical protein	
c1	cds	2844633	2845412	-	BALIOE_14465		hypothetical protein	
c1	cds	2845512	2846552	-	BALIOE_14470		hypothetical protein	
c1	cds	2846600	2847955	-	BALIOE_14475		hypothetical protein	
c1	cds	2847959	2848243	-	BALIOE_14480		hypothetical protein	
c1	cds	2848274	2848726	-	BALIOE_14485		hypothetical protein	
c1	cds	2848736	2849998	-	BALIOE_14490		hypothetical protein	
c1	cds	2850027	2850881	-	BALIOE_14495		hypothetical protein	
c1	ncRNA	2851088	2851158	-	BALIOE_14500	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	2851180	2852232	-	BALIOE_14505		hypothetical protein	
c1	cds	2852489	2853766	+	BALIOE_14510		hypothetical protein	
c1	cds	2853763	2854767	+	BALIOE_14515		hypothetical protein	
c1	cds	2854764	2855729	+	BALIOE_14520		hypothetical protein	
c1	cds	2855703	2856449	-	BALIOE_14525		hypothetical protein	
c1	cds	2856501	2857319	-	BALIOE_14530		hypothetical protein	
c1	cds	2857384	2858184	-	BALIOE_14535		hypothetical protein	
c1	cds	2858181	2858969	-	BALIOE_14540		hypothetical protein	
c1	cds	2859303	2859542	+	BALIOE_14545		hypothetical protein	
c1	cds	2860593	2860940	+	BALIOE_14550		hypothetical protein	
c1	cds	2860950	2861264	+	BALIOE_14555		hypothetical protein	
c1	cds	2861374	2861646	-	BALIOE_14560		hypothetical protein	
c1	cds	2861767	2862606	+	BALIOE_14565		hypothetical protein	
c1	cds	2862824	2863162	+	BALIOE_14570		hypothetical protein	
c1	cds	2863244	2864278	-	BALIOE_14575		hypothetical protein	
c1	cds	2864289	2866769	-	BALIOE_14580		hypothetical protein	
c1	cds	2866785	2867459	-	BALIOE_14585		hypothetical protein	
c1	cds	2867547	2868089	-	BALIOE_14590		hypothetical protein	
c1	cds	2868381	2868662	-	BALIOE_14595		hypothetical protein	
c1	cds	2868924	2870033	-	BALIOE_14600		hypothetical protein	
c1	cds	2870165	2872198	+	BALIOE_14605		hypothetical protein	
c1	cds	2872339	2873067	+	BALIOE_14610		hypothetical protein	
c1	cds	2873257	2876148	+	BALIOE_14615		hypothetical protein	
c1	cds	2876161	2877441	+	BALIOE_14620		hypothetical protein	
c1	cds	2877407	2879146	+	BALIOE_14625		hypothetical protein	
c1	cds	2879156	2882785	+	BALIOE_14630		hypothetical protein	
c1	cds	2882847	2883164	+	BALIOE_14635		hypothetical protein	
c1	cds	2883274	2883363	-	BALIOE_14640		hypothetical protein	
c1	cds	2884405	2885493	+	BALIOE_14645		hypothetical protein	
c1	cds	2885504	2887033	+	BALIOE_14650		hypothetical protein	
c1	cds	2887052	2887783	+	BALIOE_14655		hypothetical protein	
c1	cds	2887776	2888912	+	BALIOE_14660		hypothetical protein	
c1	cds	2888909	2891146	+	BALIOE_14665		hypothetical protein	
c1	cds	2890953	2891840	-	BALIOE_14670		hypothetical protein	
c1	cds	2891840	2892166	-	BALIOE_14675		hypothetical protein	
c1	cds	2892350	2892811	+	BALIOE_14680		hypothetical protein	
c1	cds	2892853	2893323	-	BALIOE_14685		hypothetical protein	
c1	cds	2893370	2894089	-	BALIOE_14690		hypothetical protein	
c1	cds	2894086	2895771	-	BALIOE_14695		hypothetical protein	
c1	cds	2896286	2896534	+	BALIOE_14700		hypothetical protein	
c1	cds	2896902	2897171	-	BALIOE_14705		hypothetical protein	
c1	cds	2897173	2898486	-	BALIOE_14710		hypothetical protein	
c1	cds	2898551	2899150	-	BALIOE_14715		hypothetical protein	
c1	cds	2899218	2901563	-	BALIOE_14720		hypothetical protein	
c1	cds	2901515	2902690	-	BALIOE_14725		hypothetical protein	
c1	cds	2902931	2903509	-	BALIOE_14730		hypothetical protein	
c1	cds	2903506	2904249	-	BALIOE_14735		hypothetical protein	
c1	cds	2904260	2904958	-	BALIOE_14740		hypothetical protein	
c1	cds	2904958	2905287	-	BALIOE_14745		hypothetical protein	
c1	cds	2905284	2907929	-	BALIOE_14750		hypothetical protein	
c1	cds	2907973	2908281	-	BALIOE_14755		hypothetical protein	
c1	cds	2908308	2908730	-	BALIOE_14760		hypothetical protein	
c1	cds	2908744	2909496	-	BALIOE_14765		hypothetical protein	
c1	cds	2909504	2909902	-	BALIOE_14770		hypothetical protein	
c1	cds	2909915	2910538	-	BALIOE_14775		hypothetical protein	
c1	cds	2910541	2910822	-	BALIOE_14780		hypothetical protein	
c1	cds	2910815	2911141	-	BALIOE_14785		hypothetical protein	
c1	cds	2911229	2912269	-	BALIOE_14790		hypothetical protein	
c1	cds	2912391	2912717	+	BALIOE_14795		hypothetical protein	
c1	cds	2912717	2913604	+	BALIOE_14800		hypothetical protein	
c1	cds	2913607	2914566	-	BALIOE_14805		hypothetical protein	
c1	cds	2914511	2916013	-	BALIOE_14810		hypothetical protein	
c1	cds	2916013	2916225	-	BALIOE_14815		hypothetical protein	
c1	cds	2916222	2918345	-	BALIOE_14820		hypothetical protein	
c1	cds	2918342	2918818	-	BALIOE_14825		hypothetical protein	
c1	cds	2919273	2919740	-	BALIOE_14830		hypothetical protein	
c1	cds	2919748	2919894	-	BALIOE_14835		hypothetical protein	
c1	cds	2919894	2920463	-	BALIOE_14840		hypothetical protein	
c1	cds	2920734	2921267	-	BALIOE_14845		hypothetical protein	
c1	cds	2921272	2921487	-	BALIOE_14850		hypothetical protein	
c1	cds	2921565	2921810	-	BALIOE_14855		hypothetical protein	
c1	cds	2921851	2922030	-	BALIOE_14860		hypothetical protein	
c1	cds	2922168	2924114	-	BALIOE_14865		hypothetical protein	
c1	cds	2924625	2924894	-	BALIOE_14870		hypothetical protein	
c1	cds	2924904	2925851	-	BALIOE_14875		hypothetical protein	
c1	cds	2926358	2926840	-	BALIOE_14880		hypothetical protein	
c1	cds	2926785	2926979	-	BALIOE_14885		hypothetical protein	
c1	cds	2926976	2927581	-	BALIOE_14890		hypothetical protein	
c1	cds	2927574	2927783	-	BALIOE_14895		hypothetical protein	
c1	cds	2927743	2928144	-	BALIOE_14900		hypothetical protein	
c1	cds	2928320	2928847	-	BALIOE_14905		hypothetical protein	
c1	cds	2928844	2929290	-	BALIOE_14910		hypothetical protein	
c1	cds	2929247	2929483	-	BALIOE_14915		hypothetical protein	
c1	cds	2929494	2929709	-	BALIOE_14920		hypothetical protein	
c1	cds	2929842	2930120	-	BALIOE_14925		hypothetical protein	
c1	cds	2930191	2930481	-	BALIOE_14930		hypothetical protein	
c1	cds	2930478	2931179	-	BALIOE_14935		hypothetical protein	
c1	cds	2931176	2932114	-	BALIOE_14940		hypothetical protein	
c1	cds	2932147	2932443	-	BALIOE_14945		hypothetical protein	
c1	cds	2932558	2932776	-	BALIOE_14950		hypothetical protein	
c1	cds	2932894	2933532	+	BALIOE_14955		hypothetical protein	
c1	cds	2933655	2933936	+	BALIOE_14960		hypothetical protein	
c1	cds	2933943	2934494	+	BALIOE_14965		hypothetical protein	
c1	cds	2935007	2935279	+	BALIOE_14970		hypothetical protein	
c1	cds	2935296	2935877	-	BALIOE_14975		hypothetical protein	
c1	cds	2936138	2936506	+	BALIOE_14980		hypothetical protein	
c1	cds	2936579	2936743	+	BALIOE_14985		hypothetical protein	
c1	cds	2936712	2936855	+	BALIOE_14990		hypothetical protein	
c1	cds	2936931	2937227	+	BALIOE_14995		hypothetical protein	
c1	cds	2937233	2938018	+	BALIOE_15000		hypothetical protein	
c1	cds	2938015	2938692	+	BALIOE_15005		hypothetical protein	
c1	cds	2938692	2938874	+	BALIOE_15010		hypothetical protein	
c1	cds	2938847	2939038	+	BALIOE_15015		hypothetical protein	
c1	cds	2939115	2939330	+	BALIOE_15020		hypothetical protein	
c1	cds	2939429	2939650	+	BALIOE_15025		hypothetical protein	
c1	cds	2939647	2940594	+	BALIOE_15030		hypothetical protein	
c1	cds	2940596	2940772	+	BALIOE_15035		hypothetical protein	
c1	cds	2941106	2941462	+	BALIOE_15040		hypothetical protein	
c1	cds	2941459	2941821	+	BALIOE_15045		hypothetical protein	
c1	cds	2941909	2942151	+	BALIOE_15050		hypothetical protein	
c1	cds	2942155	2942289	+	BALIOE_15055		hypothetical protein	
c1	cds	2942308	2942562	+	BALIOE_15060		hypothetical protein	
c1	cds	2942596	2943882	+	BALIOE_15065		hypothetical protein	
c1	cds	2943957	2944604	+	BALIOE_15070		hypothetical protein	
c1	cds	2944664	2944771	+	BALIOE_15075		hypothetical protein	
c1	cds	2944752	2945483	-	BALIOE_15080		hypothetical protein	
c1	cds	2945488	2946414	-	BALIOE_15085		hypothetical protein	
c1	cds	2946407	2947564	-	BALIOE_15090		hypothetical protein	
c1	cds	2947571	2948488	-	BALIOE_15095		hypothetical protein	
c1	cds	2948740	2951007	-	BALIOE_15100		hypothetical protein	
c1	cds	2951233	2952948	+	BALIOE_15105		hypothetical protein	
c1	cds	2952986	2953918	-	BALIOE_15110		hypothetical protein	
c1	cds	2954092	2954679	-	BALIOE_15115		hypothetical protein	
c1	cds	2954849	2955427	+	BALIOE_15120		hypothetical protein	
c1	cds	2955557	2956318	-	BALIOE_15125		hypothetical protein	
c1	cds	2956371	2957897	-	BALIOE_15130		hypothetical protein	
c1	cds	2958502	2959452	-	BALIOE_15135		hypothetical protein	
c1	cds	2959612	2960805	-	BALIOE_15140		hypothetical protein	
c1	cds	2960820	2961464	-	BALIOE_15145		hypothetical protein	
c1	cds	2961473	2962174	-	BALIOE_15150		hypothetical protein	
c1	cds	2962189	2963217	-	BALIOE_15155		hypothetical protein	
c1	cds	2963229	2964587	-	BALIOE_15160		hypothetical protein	
c1	cds	2964714	2965622	+	BALIOE_15165		hypothetical protein	
c1	cds	2965753	2966151	+	BALIOE_15170		hypothetical protein	
c1	cds	2966148	2966843	+	BALIOE_15175		hypothetical protein	
c1	cds	2966973	2967857	+	BALIOE_15180		hypothetical protein	
c1	cds	2968007	2968726	+	BALIOE_15185		hypothetical protein	
c1	cds	2968729	2968968	+	BALIOE_15190		hypothetical protein	
c1	cds	2969162	2970400	+	BALIOE_15195		hypothetical protein	
c1	cds	2970394	2971629	+	BALIOE_15200		hypothetical protein	
c1	ncRNA	2971732	2971809	-	BALIOE_15205	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	2971872	2972882	-	BALIOE_15210		hypothetical protein	
c1	cds	2972898	2974418	-	BALIOE_15215		hypothetical protein	
c1	cds	2974479	2975477	-	BALIOE_15220		hypothetical protein	
c1	cds	2975756	2976796	-	BALIOE_15225		hypothetical protein	
c1	cds	2976938	2978095	-	BALIOE_15230		hypothetical protein	
c1	cds	2978112	2978780	-	BALIOE_15235		hypothetical protein	
c1	cds	2979038	2979874	+	BALIOE_15240		hypothetical protein	
c1	cds	2979906	2981885	-	BALIOE_15245		hypothetical protein	
c1	cds	2982177	2983646	-	BALIOE_15250		hypothetical protein	
c1	cds	2983851	2984732	-	BALIOE_15255		hypothetical protein	
c1	cds	2984831	2985880	+	BALIOE_15260		hypothetical protein	
c1	cds	2985954	2986811	+	BALIOE_15265		hypothetical protein	
c1	cds	2986814	2987902	+	BALIOE_15270		hypothetical protein	
c1	cds	2987958	2989208	-	BALIOE_15275		hypothetical protein	
c1	cds	2989308	2990249	-	BALIOE_15280		hypothetical protein	
c1	cds	2990379	2991077	+	BALIOE_15285		hypothetical protein	
c1	cds	2991148	2992398	-	BALIOE_15290		hypothetical protein	
c1	cds	2992492	2993430	-	BALIOE_15295		hypothetical protein	
c1	cds	2993418	2994359	-	BALIOE_15300		hypothetical protein	
c1	cds	2994783	2996474	-	BALIOE_15305		hypothetical protein	
c1	cds	2996491	2997429	-	BALIOE_15310		hypothetical protein	
c1	cds	2997429	2998559	-	BALIOE_15315		hypothetical protein	
c1	cds	2998927	3000108	+	BALIOE_15320		hypothetical protein	
c1	cds	3000105	3000359	-	BALIOE_15325		hypothetical protein	
c1	cds	3000514	3001086	+	BALIOE_15330		hypothetical protein	
c1	cds	3001300	3002775	+	BALIOE_15335		hypothetical protein	
c1	cds	3002893	3003879	+	BALIOE_15340		hypothetical protein	
c1	cds	3003918	3004631	+	BALIOE_15345		hypothetical protein	
c1	cds	3005044	3005610	+	BALIOE_15350		hypothetical protein	
c1	cds	3005791	3007347	+	BALIOE_15355		hypothetical protein	
c1	cds	3007429	3009243	+	BALIOE_15360		hypothetical protein	
c1	cds	3009244	3010338	+	BALIOE_15365		hypothetical protein	
c1	cds	3010338	3011363	+	BALIOE_15370		hypothetical protein	
c1	cds	3011365	3012954	+	BALIOE_15375		hypothetical protein	
c1	cds	3012958	3013302	-	BALIOE_15380		hypothetical protein	
c1	cds	3013635	3014825	-	BALIOE_15385		hypothetical protein	
c1	cds	3014853	3015548	-	BALIOE_15390		hypothetical protein	
c1	cds	3015697	3017457	+	BALIOE_15395		hypothetical protein	
c1	cds	3017582	3017866	+	BALIOE_15400		hypothetical protein	
c1	cds	3018005	3019012	-	BALIOE_15405		hypothetical protein	
c1	cds	3019194	3019421	+	BALIOE_15410		hypothetical protein	
c1	cds	3019441	3021201	+	BALIOE_15415		hypothetical protein	
c1	tRNA	3021276	3021352	+	BALIOE_15420	Pro_trna	tRNA-Pro	SO:0000268
c1	cds	3021453	3024044	-	BALIOE_15425		hypothetical protein	
c1	cds	3024364	3025011	+	BALIOE_15430		hypothetical protein	
c1	cds	3025046	3026098	-	BALIOE_15435		hypothetical protein	
c1	cds	3026095	3026652	-	BALIOE_15440		hypothetical protein	
c1	cds	3026649	3028592	-	BALIOE_15445		hypothetical protein	
c1	cds	3028589	3029068	-	BALIOE_15450		hypothetical protein	
c1	cds	3029065	3029274	-	BALIOE_15455		hypothetical protein	
c1	cds	3029271	3030008	-	BALIOE_15460		hypothetical protein	
c1	cds	3030050	3030712	-	BALIOE_15465		hypothetical protein	
c1	cds	3030709	3031326	-	BALIOE_15470		hypothetical protein	
c1	cds	3031345	3031947	-	BALIOE_15475		hypothetical protein	
c1	cds	3031957	3032406	-	BALIOE_15480		hypothetical protein	
c1	cds	3032403	3033266	-	BALIOE_15485		hypothetical protein	
c1	cds	3033253	3033948	-	BALIOE_15490		hypothetical protein	
c1	cds	3033955	3036441	-	BALIOE_15495		hypothetical protein	
c1	cds	3036438	3036701	-	BALIOE_15500		hypothetical protein	
c1	cds	3036691	3037185	-	BALIOE_15505		hypothetical protein	
c1	cds	3037294	3037458	+	BALIOE_15510		hypothetical protein	
c1	cds	3037592	3038080	+	BALIOE_15515		hypothetical protein	
c1	cds	3038230	3039876	-	BALIOE_15520		hypothetical protein	
c1	cds	3040094	3041737	-	BALIOE_15525		hypothetical protein	
c1	cds	3041813	3042463	-	BALIOE_15530		hypothetical protein	
c1	cds	3042463	3043527	-	BALIOE_15535		hypothetical protein	
c1	cds	3043601	3044656	-	BALIOE_15540		hypothetical protein	
c1	cds	3044768	3045871	-	BALIOE_15545		hypothetical protein	
c1	cds	3046610	3049282	+	BALIOE_15550		hypothetical protein	
c1	cds	3049299	3049949	+	BALIOE_15555		hypothetical protein	
c1	ncRNA	3049959	3050035	-	BALIOE_15560	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	3050073	3050149	-	BALIOE_15565	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	3050149	3052998	-	BALIOE_15570		hypothetical protein	
c1	cds	3053273	3054049	-	BALIOE_15575		hypothetical protein	
c1	cds	3054054	3054836	-	BALIOE_15580		hypothetical protein	
c1	cds	3054909	3055703	-	BALIOE_15585		hypothetical protein	
c1	cds	3055704	3060098	-	BALIOE_15590		hypothetical protein	
c1	cds	3060242	3060865	-	BALIOE_15595		hypothetical protein	
c1	cds	3060862	3062415	-	BALIOE_15600		hypothetical protein	
c1	cds	3062698	3065325	-	BALIOE_15605		hypothetical protein	
c1	cds	3065472	3066194	+	BALIOE_15610		hypothetical protein	
c1	cds	3066335	3070087	-	BALIOE_15615		hypothetical protein	
c1	cds	3070783	3073068	+	BALIOE_15620		hypothetical protein	
c1	ncRNA	3073125	3073188	-	BALIOE_15625	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	3073295	3074425	+	BALIOE_15630		hypothetical protein	
c1	cds	3074425	3074679	+	BALIOE_15635		hypothetical protein	
c1	cds	3074733	3075383	-	BALIOE_15640		hypothetical protein	
c1	cds	3075464	3076654	-	BALIOE_15645		hypothetical protein	
c1	cds	3076806	3077684	+	BALIOE_15650		hypothetical protein	
c1	cds	3077838	3077969	+	BALIOE_15655		hypothetical protein	
c1	cds	3078148	3079218	+	BALIOE_15660		hypothetical protein	
c1	cds	3079442	3080518	-	BALIOE_15665		hypothetical protein	
c1	cds	3080523	3081881	-	BALIOE_15670		hypothetical protein	
c1	cds	3082154	3083782	+	BALIOE_15675		hypothetical protein	
c1	cds	3083772	3085031	+	BALIOE_15680		hypothetical protein	
c1	cds	3085028	3086218	+	BALIOE_15685		hypothetical protein	
c1	cds	3086411	3087337	+	BALIOE_15690		hypothetical protein	
c1	cds	3087378	3088130	-	BALIOE_15695		hypothetical protein	
c1	cds	3088198	3088950	-	BALIOE_15700		hypothetical protein	
c1	cds	3089027	3089353	+	BALIOE_15705		hypothetical protein	
c1	cds	3089353	3090240	+	BALIOE_15710		hypothetical protein	
c1	cds	3090243	3090800	-	BALIOE_15715		hypothetical protein	
c1	cds	3090857	3092062	-	BALIOE_15720		hypothetical protein	
c1	cds	3092077	3092859	-	BALIOE_15725		hypothetical protein	
c1	cds	3093079	3094281	-	BALIOE_15730		hypothetical protein	
c1	cds	3094381	3094923	-	BALIOE_15735		hypothetical protein	
c1	cds	3095202	3095627	+	BALIOE_15740		hypothetical protein	
c1	cds	3095666	3096268	-	BALIOE_15745		hypothetical protein	
c1	cds	3096558	3097715	+	BALIOE_15750		hypothetical protein	
c1	cds	3097719	3098687	+	BALIOE_15755		hypothetical protein	
c1	cds	3098687	3100669	+	BALIOE_15760		hypothetical protein	
c1	cds	3100666	3101556	+	BALIOE_15765		hypothetical protein	
c1	cds	3101556	3103208	+	BALIOE_15770		hypothetical protein	
c1	cds	3103205	3103540	+	BALIOE_15775		hypothetical protein	
c1	cds	3103540	3103926	+	BALIOE_15780		hypothetical protein	
c1	cds	3103920	3104186	-	BALIOE_15785		hypothetical protein	
c1	cds	3104296	3105651	-	BALIOE_15790		hypothetical protein	
c1	cds	3105648	3106610	-	BALIOE_15795		hypothetical protein	
c1	cds	3106610	3107467	-	BALIOE_15800		hypothetical protein	
c1	cds	3107482	3108240	-	BALIOE_15805		hypothetical protein	
c1	cds	3108237	3109907	-	BALIOE_15810		hypothetical protein	
c1	cds	3109996	3111291	-	BALIOE_15815		hypothetical protein	
c1	cds	3111370	3111675	-	BALIOE_15820		hypothetical protein	
c1	cds	3111730	3112191	-	BALIOE_15825		hypothetical protein	
c1	cds	3112256	3113173	+	BALIOE_15830		hypothetical protein	
c1	cds	3113364	3114584	+	BALIOE_15835		hypothetical protein	
c1	cds	3115716	3116219	+	BALIOE_15840		hypothetical protein	
c1	cds	3116286	3117743	-	BALIOE_15845		hypothetical protein	
c1	cds	3117750	3119279	-	BALIOE_15850		hypothetical protein	
c1	cds	3119510	3121351	-	BALIOE_15855		hypothetical protein	
c1	cds	3121348	3121650	-	BALIOE_15860		hypothetical protein	
c1	cds	3121647	3122201	-	BALIOE_15865		hypothetical protein	
c1	cds	3122213	3122755	-	BALIOE_15870		hypothetical protein	
c1	cds	3122770	3123747	-	BALIOE_15875		hypothetical protein	
c1	cds	3123744	3126470	-	BALIOE_15880		hypothetical protein	
c1	cds	3126523	3127860	-	BALIOE_15885		hypothetical protein	
c1	cds	3127857	3128357	-	BALIOE_15890		hypothetical protein	
c1	cds	3128360	3130162	-	BALIOE_15895		hypothetical protein	
c1	cds	3130256	3130918	-	BALIOE_15900		hypothetical protein	
c1	cds	3130934	3131377	-	BALIOE_15905		hypothetical protein	
c1	cds	3131640	3131804	+	BALIOE_15910		hypothetical protein	
c1	cds	3132008	3132946	-	BALIOE_15915		hypothetical protein	
c1	cds	3133866	3135083	+	BALIOE_15920		hypothetical protein	
c1	cds	3135167	3135766	+	BALIOE_15925		hypothetical protein	
c1	cds	3135825	3137657	-	BALIOE_15930		hypothetical protein	
c1	cds	3137744	3138394	-	BALIOE_15935		hypothetical protein	
c1	cds	3138405	3138899	-	BALIOE_15940		hypothetical protein	
c1	cds	3138982	3139437	-	BALIOE_15945		hypothetical protein	
c1	cds	3139775	3140977	+	BALIOE_15950		hypothetical protein	
c1	cds	3141052	3143196	+	BALIOE_15955		hypothetical protein	
c1	cds	3143428	3144906	+	BALIOE_15960		hypothetical protein	
c1	cds	3144939	3145481	-	BALIOE_15965		hypothetical protein	
c1	cds	3145539	3146090	-	BALIOE_15970		hypothetical protein	
c1	cds	3146146	3146790	-	BALIOE_15975		hypothetical protein	
c1	cds	3146926	3147573	+	BALIOE_15980		hypothetical protein	
c1	cds	3147630	3147992	+	BALIOE_15985		hypothetical protein	
c1	cds	3148013	3148906	+	BALIOE_15990		hypothetical protein	
c1	cds	3148954	3149844	-	BALIOE_15995		hypothetical protein	
c1	cds	3150041	3150814	-	BALIOE_16000		hypothetical protein	
c1	cds	3150822	3151538	-	BALIOE_16005		hypothetical protein	
c1	cds	3151535	3152221	-	BALIOE_16010		hypothetical protein	
c1	cds	3152311	3153093	-	BALIOE_16015		hypothetical protein	
c1	cds	3153314	3154096	-	BALIOE_16020		hypothetical protein	
c1	cds	3154362	3154931	-	BALIOE_16025		hypothetical protein	
c1	cds	3155026	3156543	-	BALIOE_16030		hypothetical protein	
c1	cds	3156580	3157068	-	BALIOE_16035		hypothetical protein	
c1	ncRNA	3157285	3157355	-	BALIOE_16040	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	3157376	3157446	-	BALIOE_16045	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	3157509	3158171	-	BALIOE_16050		hypothetical protein	
c1	cds	3158161	3159429	-	BALIOE_16055		hypothetical protein	
c1	cds	3159499	3160413	-	BALIOE_16060		hypothetical protein	
c1	cds	3160569	3161228	-	BALIOE_16065		hypothetical protein	
c1	cds	3161311	3162123	-	BALIOE_16070		hypothetical protein	
c1	cds	3162123	3163136	-	BALIOE_16075		hypothetical protein	
c1	cds	3163202	3164338	-	BALIOE_16080		hypothetical protein	
c1	cds	3164437	3165432	+	BALIOE_16085		hypothetical protein	
c1	cds	3165429	3166607	-	BALIOE_16090		hypothetical protein	
c1	cds	3166882	3168102	-	BALIOE_16095		hypothetical protein	
c1	cds	3168261	3170267	+	BALIOE_16100		hypothetical protein	
c1	cds	3170388	3170666	-	BALIOE_16105		hypothetical protein	
c1	cds	3170700	3171248	-	BALIOE_16110		hypothetical protein	
c1	cds	3171248	3172057	-	BALIOE_16115		hypothetical protein	
c1	cds	3172057	3172881	-	BALIOE_16120		hypothetical protein	
c1	cds	3172885	3173970	-	BALIOE_16125		hypothetical protein	
c1	cds	3174005	3174937	-	BALIOE_16130		hypothetical protein	
c1	cds	3175103	3175654	+	BALIOE_16135		hypothetical protein	
c1	cds	3175825	3176667	-	BALIOE_16140		hypothetical protein	
c1	cds	3176669	3177190	-	BALIOE_16145		hypothetical protein	
c1	cds	3177187	3177615	-	BALIOE_16150		hypothetical protein	
c1	cds	3177654	3178154	-	BALIOE_16155		hypothetical protein	
c1	cds	3178165	3178923	-	BALIOE_16160		hypothetical protein	
c1	cds	3178946	3181585	-	BALIOE_16165		hypothetical protein	
c1	cds	3181667	3182230	-	BALIOE_16170		hypothetical protein	
c1	cds	3182876	3183361	-	BALIOE_16175		hypothetical protein	
c1	cds	3183564	3185708	-	BALIOE_16180		hypothetical protein	
c1	cds	3185708	3187018	-	BALIOE_16185		hypothetical protein	
c1	cds	3187198	3187482	-	BALIOE_16190		hypothetical protein	
c1	cds	3187854	3189194	+	BALIOE_16195		hypothetical protein	
c1	cds	3189559	3190590	+	BALIOE_16200		hypothetical protein	
c1	cds	3190985	3191740	-	BALIOE_16205		hypothetical protein	
c1	cds	3192034	3192966	+	BALIOE_16210		hypothetical protein	
c1	tRNA	3193042	3193116	+	BALIOE_16215	Arg_trna	tRNA-Arg	SO:0001036
c1	cds	3193278	3194435	+	BALIOE_16220		hypothetical protein	
c1	cds	3194610	3195746	-	BALIOE_16225		hypothetical protein	
c1	cds	3195756	3196436	-	BALIOE_16230		hypothetical protein	
c1	cds	3196423	3196890	-	BALIOE_16235		hypothetical protein	
c1	cds	3196890	3197459	-	BALIOE_16240		hypothetical protein	
c1	cds	3197490	3198137	+	BALIOE_16245		hypothetical protein	
c1	cds	3198807	3200219	-	BALIOE_16250		hypothetical protein	
c1	cds	3200406	3200582	-	BALIOE_16255		hypothetical protein	
c1	cds	3200885	3201511	+	BALIOE_16260		hypothetical protein	
c1	cds	3202109	3203356	-	BALIOE_16265		hypothetical protein	
c1	cds	3203428	3204342	-	BALIOE_16270		hypothetical protein	
c1	cds	3204558	3205991	+	BALIOE_16275		hypothetical protein	
c1	cds	3205999	3206952	-	BALIOE_16280		hypothetical protein	
c1	cds	3207237	3207455	+	BALIOE_16285		hypothetical protein	
c1	cds	3207473	3208801	+	BALIOE_16290		hypothetical protein	
c1	cds	3208909	3210447	-	BALIOE_16295		hypothetical protein	
c1	cds	3210447	3211610	-	BALIOE_16300		hypothetical protein	
c1	cds	3212026	3212640	+	BALIOE_16305		hypothetical protein	
c1	cds	3212645	3216238	+	BALIOE_16310		hypothetical protein	
c1	cds	3216294	3217172	-	BALIOE_16315		hypothetical protein	
c1	cds	3217205	3217435	-	BALIOE_16320		hypothetical protein	
c1	cds	3217509	3218453	-	BALIOE_16325		hypothetical protein	
c1	cds	3218523	3220217	-	BALIOE_16330		hypothetical protein	
c1	cds	3220271	3221521	-	BALIOE_16335		hypothetical protein	
c1	cds	3222034	3222669	-	BALIOE_16340		hypothetical protein	
c1	cds	3222965	3223240	+	BALIOE_16345		hypothetical protein	
c1	cds	3223317	3223559	-	BALIOE_16350		hypothetical protein	
c1	cds	3223912	3224832	+	BALIOE_16355		hypothetical protein	
c1	cds	3225324	3226562	-	BALIOE_16360		hypothetical protein	
c1	cds	3226939	3228636	+	BALIOE_16365		hypothetical protein	
c1	cds	3228651	3229385	+	BALIOE_16370		hypothetical protein	
c1	cds	3229398	3230255	+	BALIOE_16375		hypothetical protein	
c1	cds	3230258	3232753	-	BALIOE_16380		hypothetical protein	
c1	cds	3232778	3233815	-	BALIOE_16385		hypothetical protein	
c1	cds	3233815	3234900	-	BALIOE_16390		hypothetical protein	
c1	cds	3234915	3236162	-	BALIOE_16395		hypothetical protein	
c1	cds	3236184	3236510	-	BALIOE_16400		hypothetical protein	
c1	cds	3236729	3237694	-	BALIOE_16405		hypothetical protein	
c1	cds	3237898	3239154	+	BALIOE_16410		hypothetical protein	
c1	cds	3239269	3239595	+	BALIOE_16415		hypothetical protein	
c1	cds	3239735	3240973	-	BALIOE_16420		hypothetical protein	
c1	cds	3241309	3242511	+	BALIOE_16425		hypothetical protein	
c1	cds	3242561	3244750	-	BALIOE_16430		hypothetical protein	
c1	tRNA	3244958	3245033	-	BALIOE_16435	Ala_trna	tRNA-Ala	SO:0000254
c1	tRNA	3245073	3245148	-	BALIOE_16440	Ala_trna	tRNA-Ala	SO:0000254
c1	cds	3245369	3245728	+	BALIOE_16445		hypothetical protein	
c1	cds	3245751	3246122	+	BALIOE_16450		hypothetical protein	
c1	cds	3246162	3247310	-	BALIOE_16455		hypothetical protein	
c1	cds	3247378	3247920	+	BALIOE_16460		hypothetical protein	
c1	cds	3247921	3249336	-	BALIOE_16465		hypothetical protein	
c1	tRNA	3249595	3249670	+	BALIOE_16470	Val_trna	tRNA-Val	SO:0000273
c1	tRNA	3249715	3249790	+	BALIOE_16475	Val_trna	tRNA-Val	SO:0000273
c1	tRNA	3249837	3249912	+	BALIOE_16480	Val_trna	tRNA-Val	SO:0000273
c1	tRNA	3249917	3249992	+	BALIOE_16485	Lys_trna	tRNA-Lys	SO:0000265
c1	cds	3250112	3250453	+	BALIOE_16490		hypothetical protein	
c1	cds	3250444	3250791	-	BALIOE_16495		hypothetical protein	
c1	cds	3250816	3251370	-	BALIOE_16500		hypothetical protein	
c1	cds	3251460	3252458	+	BALIOE_16505		hypothetical protein	
c1	cds	3252455	3252673	-	BALIOE_16510		hypothetical protein	
c1	cds	3252675	3254690	-	BALIOE_16515		hypothetical protein	
c1	cds	3254761	3255759	-	BALIOE_16520		hypothetical protein	
c1	cds	3255989	3256750	+	BALIOE_16525		hypothetical protein	
c1	cds	3256935	3257906	+	BALIOE_16530		hypothetical protein	
c1	cds	3258290	3258547	+	BALIOE_16535		hypothetical protein	
c1	cds	3258592	3260319	+	BALIOE_16540		hypothetical protein	
c1	cds	3260360	3260869	+	BALIOE_16545		hypothetical protein	
c1	cds	3260912	3261763	-	BALIOE_16550		hypothetical protein	
c1	cds	3261868	3262200	+	BALIOE_16555		hypothetical protein	
c1	cds	3262238	3263149	-	BALIOE_16560		hypothetical protein	
c1	cds	3263283	3264380	-	BALIOE_16565		hypothetical protein	
c1	cds	3264370	3265245	-	BALIOE_16570		hypothetical protein	
c1	cds	3265245	3266078	-	BALIOE_16575		hypothetical protein	
c1	cds	3266078	3267094	-	BALIOE_16580		hypothetical protein	
c1	cds	3267252	3268043	-	BALIOE_16585		hypothetical protein	
c1	cds	3268172	3269029	-	BALIOE_16590		hypothetical protein	
c1	cds	3269193	3270089	+	BALIOE_16595		hypothetical protein	
c1	cds	3270093	3271517	+	BALIOE_16600		hypothetical protein	
c1	cds	3271522	3272826	+	BALIOE_16605		hypothetical protein	
c1	cds	3272884	3273783	-	BALIOE_16610		hypothetical protein	
c1	cds	3273879	3274454	-	BALIOE_16615		hypothetical protein	
c1	cds	3274515	3274964	-	BALIOE_16620		hypothetical protein	
c1	cds	3274951	3275376	-	BALIOE_16625		hypothetical protein	
c1	cds	3275590	3276459	+	BALIOE_16630		hypothetical protein	
c1	cds	3276463	3277362	+	BALIOE_16635		hypothetical protein	
c1	cds	3277368	3278420	-	BALIOE_16640		hypothetical protein	
c1	cds	3278466	3278966	-	BALIOE_16645		hypothetical protein	
c1	cds	3278979	3279638	-	BALIOE_16650		hypothetical protein	
c1	cds	3279648	3280535	-	BALIOE_16655		hypothetical protein	
c1	cds	3280556	3281917	-	BALIOE_16660		hypothetical protein	
c1	cds	3281929	3283332	-	BALIOE_16665		hypothetical protein	
c1	cds	3283329	3284555	-	BALIOE_16670		hypothetical protein	
c1	cds	3284655	3285842	-	BALIOE_16675		hypothetical protein	
c1	cds	3285832	3286668	-	BALIOE_16680		hypothetical protein	
c1	cds	3286679	3288082	-	BALIOE_16685		hypothetical protein	
c1	cds	3288094	3288381	-	BALIOE_16690		hypothetical protein	
c1	cds	3288488	3288823	-	BALIOE_16695		hypothetical protein	
c1	cds	3288820	3289836	-	BALIOE_16700		hypothetical protein	
c1	cds	3289833	3290564	-	BALIOE_16705		hypothetical protein	
c1	cds	3290561	3291262	-	BALIOE_16710		hypothetical protein	
c1	cds	3291237	3291716	-	BALIOE_16715		hypothetical protein	
c1	cds	3291729	3292064	-	BALIOE_16720		hypothetical protein	
c1	cds	3292357	3294636	-	BALIOE_16725		hypothetical protein	
c1	cds	3294925	3295875	+	BALIOE_16730		hypothetical protein	
c1	cds	3295895	3297898	+	BALIOE_16735		hypothetical protein	
c1	cds	3297993	3299036	-	BALIOE_16740		hypothetical protein	
c1	cds	3299162	3299737	-	BALIOE_16745		hypothetical protein	
c1	cds	3299805	3301784	-	BALIOE_16750		hypothetical protein	
c1	cds	3301990	3303690	+	BALIOE_16755		hypothetical protein	
c1	cds	3303854	3306967	+	BALIOE_16760		hypothetical protein	
c1	cds	3307506	3307862	+	BALIOE_16765		hypothetical protein	
c1	cds	3307866	3308993	+	BALIOE_16770		hypothetical protein	
c1	cds	3309021	3309221	+	BALIOE_16775		hypothetical protein	
c1	cds	3309302	3310000	-	BALIOE_16780		hypothetical protein	
c1	cds	3310074	3312089	-	BALIOE_16785		hypothetical protein	
c1	cds	3312104	3312967	-	BALIOE_16790		hypothetical protein	
c1	cds	3313135	3313848	-	BALIOE_16795		hypothetical protein	
c1	cds	3313920	3314150	+	BALIOE_16800		hypothetical protein	
c1	cds	3314061	3315095	-	BALIOE_16805		hypothetical protein	
c1	cds	3315112	3315990	-	BALIOE_16810		hypothetical protein	
c1	cds	3316136	3316708	+	BALIOE_16815		hypothetical protein	
c1	cds	3316708	3317178	+	BALIOE_16820		hypothetical protein	
c1	cds	3317431	3318048	+	BALIOE_16825		hypothetical protein	
c1	cds	3318048	3320066	+	BALIOE_16830		hypothetical protein	
c1	cds	3320077	3321024	+	BALIOE_16835		hypothetical protein	
c1	cds	3321041	3322480	+	BALIOE_16840		hypothetical protein	
c1	cds	3322492	3323142	+	BALIOE_16845		hypothetical protein	
c1	cds	3323162	3324727	+	BALIOE_16850		hypothetical protein	
c1	cds	3324717	3326432	+	BALIOE_16855		hypothetical protein	
c1	cds	3326442	3326987	+	BALIOE_16860		hypothetical protein	
c1	cds	3326984	3327742	+	BALIOE_16865		hypothetical protein	
c1	cds	3327735	3328148	+	BALIOE_16870		hypothetical protein	
c1	cds	3328178	3330190	+	BALIOE_16875		hypothetical protein	
c1	cds	3330212	3331060	+	BALIOE_16880		hypothetical protein	
c1	cds	3331098	3332159	-	BALIOE_16885		hypothetical protein	
c1	cds	3332372	3333835	+	BALIOE_16890		hypothetical protein	
c1	cds	3333856	3334215	+	BALIOE_16895		hypothetical protein	
c1	cds	3334353	3335099	-	BALIOE_16900		hypothetical protein	
c1	cds	3335149	3336438	-	BALIOE_16905		hypothetical protein	
c1	cds	3336524	3337150	-	BALIOE_16910		hypothetical protein	
c1	cds	3337475	3338512	+	BALIOE_16915		hypothetical protein	
c1	cds	3338512	3339150	+	BALIOE_16920		hypothetical protein	
c1	cds	3339321	3341387	+	BALIOE_16925		hypothetical protein	
c1	cds	3341392	3342933	+	BALIOE_16930		hypothetical protein	
c1	cds	3342972	3345215	-	BALIOE_16935		hypothetical protein	
c1	cds	3345397	3345549	-	BALIOE_16940		hypothetical protein	
c1	cds	3345585	3345758	+	BALIOE_16945		hypothetical protein	
c1	cds	3346072	3346587	+	BALIOE_16950		hypothetical protein	
c1	cds	3346603	3347142	+	BALIOE_16955		hypothetical protein	
c1	cds	3347235	3348812	-	BALIOE_16960		hypothetical protein	
c1	cds	3348881	3350347	-	BALIOE_16965		hypothetical protein	
c1	cds	3350509	3351879	+	BALIOE_16970		hypothetical protein	
c1	cds	3351876	3352091	-	BALIOE_16975		hypothetical protein	
c1	cds	3352160	3353632	-	BALIOE_16980		hypothetical protein	
c1	cds	3353750	3354928	-	BALIOE_16985		hypothetical protein	
c1	cds	3354939	3355559	-	BALIOE_16990		hypothetical protein	
c1	cds	3355577	3356851	-	BALIOE_16995		hypothetical protein	
c1	cds	3356962	3358080	-	BALIOE_17000		hypothetical protein	
c1	cds	3358107	3359120	-	BALIOE_17005		hypothetical protein	
c1	cds	3359405	3360559	-	BALIOE_17010		hypothetical protein	
c1	cds	3360709	3361140	-	BALIOE_17015		hypothetical protein	
c1	cds	3361281	3362135	-	BALIOE_17020		hypothetical protein	
c1	cds	3362135	3362956	-	BALIOE_17025		hypothetical protein	
c1	cds	3362949	3363578	-	BALIOE_17030		hypothetical protein	
c1	cds	3363575	3365956	-	BALIOE_17035		hypothetical protein	
c1	cds	3366120	3368432	-	BALIOE_17040		hypothetical protein	
c1	cds	3368433	3373394	-	BALIOE_17045		hypothetical protein	
c1	cds	3373601	3374446	+	BALIOE_17050		hypothetical protein	
c1	cds	3374946	3375722	-	BALIOE_17055		hypothetical protein	
c1	cds	3375865	3377148	-	BALIOE_17060		hypothetical protein	
c1	cds	3377326	3377526	-	BALIOE_17065		hypothetical protein	
c1	cds	3377538	3377873	-	BALIOE_17070		hypothetical protein	
c1	cds	3377875	3379725	-	BALIOE_17075		hypothetical protein	
c1	cds	3379742	3380257	-	BALIOE_17080		hypothetical protein	
c1	cds	3380353	3380676	-	BALIOE_17085		hypothetical protein	
c1	cds	3380693	3381079	-	BALIOE_17090		hypothetical protein	
c1	cds	3381107	3382321	-	BALIOE_17095		hypothetical protein	
c1	cds	3382433	3382921	-	BALIOE_17100		hypothetical protein	
c1	cds	3383222	3383959	-	BALIOE_17105		hypothetical protein	
c1	cds	3384078	3384881	+	BALIOE_17110		hypothetical protein	
c1	cds	3385026	3385880	+	BALIOE_17115		hypothetical protein	
c1	cds	3386071	3387351	+	BALIOE_17120		hypothetical protein	
c1	cds	3387343	3388482	-	BALIOE_17125		hypothetical protein	
c1	cds	3388642	3389532	-	BALIOE_17130		hypothetical protein	
c1	cds	3389668	3391029	+	BALIOE_17135		hypothetical protein	
c1	cds	3391026	3391544	+	BALIOE_17140		hypothetical protein	
c1	cds	3391544	3391864	+	BALIOE_17145		hypothetical protein	
c1	cds	3391861	3392673	+	BALIOE_17150		hypothetical protein	
c1	cds	3392683	3393885	+	BALIOE_17155		hypothetical protein	
c1	cds	3393982	3394404	+	BALIOE_17160		hypothetical protein	
c1	cds	3394452	3395324	-	BALIOE_17165		hypothetical protein	
c1	cds	3395336	3396163	-	BALIOE_17170		hypothetical protein	
c1	cds	3396206	3396397	-	BALIOE_17175		hypothetical protein	
c1	cds	3396463	3397461	-	BALIOE_17180		hypothetical protein	
c1	cds	3397486	3398997	-	BALIOE_17185		hypothetical protein	
c1	cds	3399020	3400003	-	BALIOE_17190		hypothetical protein	
c1	cds	3400100	3403381	-	BALIOE_17195		hypothetical protein	
c1	cds	3403499	3404692	+	BALIOE_17200		hypothetical protein	
c1	cds	3404755	3406008	-	BALIOE_17205		hypothetical protein	
c1	cds	3406336	3407526	+	BALIOE_17210		hypothetical protein	
c1	cds	3407571	3407909	-	BALIOE_17215		hypothetical protein	
c1	cds	3407970	3409304	-	BALIOE_17220		hypothetical protein	
c1	cds	3409294	3410007	-	BALIOE_17225		hypothetical protein	
c1	cds	3410172	3411554	-	BALIOE_17230		hypothetical protein	
c1	cds	3412175	3416062	-	BALIOE_17235		hypothetical protein	
c1	cds	3416319	3417875	+	BALIOE_17240		hypothetical protein	
c1	cds	3417872	3418375	-	BALIOE_17245		hypothetical protein	
c1	cds	3418433	3419068	-	BALIOE_17250		hypothetical protein	
c1	cds	3419277	3420125	+	BALIOE_17255		hypothetical protein	
c1	cds	3420181	3420441	+	BALIOE_17260		hypothetical protein	
c1	cds	3421137	3421517	-	BALIOE_17265		hypothetical protein	
c1	cds	3421517	3422248	-	BALIOE_17270		hypothetical protein	
c1	cds	3422260	3422988	-	BALIOE_17275		hypothetical protein	
c1	cds	3423000	3423905	-	BALIOE_17280		hypothetical protein	
c1	cds	3423902	3424582	-	BALIOE_17285		hypothetical protein	
c1	cds	3424855	3425829	-	BALIOE_17290		hypothetical protein	
c1	cds	3425845	3427644	-	BALIOE_17295		hypothetical protein	
c1	cds	3427842	3428321	-	BALIOE_17300		hypothetical protein	
c1	cds	3428318	3429274	-	BALIOE_17305		hypothetical protein	
c1	cds	3429274	3429912	-	BALIOE_17310		hypothetical protein	
c1	cds	3429945	3430520	-	BALIOE_17315		hypothetical protein	
c1	cds	3430928	3432550	+	BALIOE_17320		hypothetical protein	
c1	cds	3432535	3433272	-	BALIOE_17325		hypothetical protein	
c1	cds	3433404	3434738	+	BALIOE_17330		hypothetical protein	
c1	cds	3434771	3435652	-	BALIOE_17335		hypothetical protein	
c1	cds	3435755	3436342	+	BALIOE_17340		hypothetical protein	
c1	cds	3436398	3436781	-	BALIOE_17345		hypothetical protein	
c1	cds	3437086	3437775	+	BALIOE_17350		hypothetical protein	
c1	cds	3437823	3438860	-	BALIOE_17355		hypothetical protein	
c1	cds	3439067	3439486	+	BALIOE_17360		hypothetical protein	
c1	cds	3439555	3440253	+	BALIOE_17365		hypothetical protein	
c1	cds	3440285	3442945	+	BALIOE_17370		hypothetical protein	
c1	cds	3443059	3444414	+	BALIOE_17375		hypothetical protein	
c1	cds	3444511	3444783	+	BALIOE_17380		hypothetical protein	
c1	cds	3444780	3446078	-	BALIOE_17385		hypothetical protein	
c1	tRNA	3449707	3449782	-	BALIOE_17390	Glu_trna	tRNA-Glu	SO:0000259
c1	rRNA	3449868	3451409	-	BALIOE_17395	16S_rrna	16S ribosomal RNA	GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
c1	cds	3451852	3454425	-	BALIOE_17400		hypothetical protein	
c1	cds	3454555	3455286	-	BALIOE_17405		hypothetical protein	
c1	cds	3455283	3456263	-	BALIOE_17410		hypothetical protein	
c1	cds	3456398	3457135	+	BALIOE_17415		hypothetical protein	
c1	cds	3457406	3457747	+	BALIOE_17420		hypothetical protein	
c1	cds	3457997	3459157	+	BALIOE_17425		hypothetical protein	
c1	cds	3459200	3460321	-	BALIOE_17430		hypothetical protein	
c1	cds	3460332	3461402	-	BALIOE_17435		hypothetical protein	
c1	cds	3461615	3461977	+	BALIOE_17440		hypothetical protein	
c1	cds	3462127	3462645	+	BALIOE_17445		hypothetical protein	
c1	cds	3462635	3463861	+	BALIOE_17450		hypothetical protein	
c1	cds	3463877	3464359	+	BALIOE_17455		hypothetical protein	
c1	cds	3464436	3464783	-	BALIOE_17460		hypothetical protein	
c1	cds	3464825	3465592	-	BALIOE_17465		hypothetical protein	
c1	cds	3465623	3466171	-	BALIOE_17470		hypothetical protein	
c1	cds	3466190	3466438	-	BALIOE_17475		hypothetical protein	
c1	cds	3466575	3467936	-	BALIOE_17480		hypothetical protein	
c1	cds	3468028	3468894	+	BALIOE_17485		hypothetical protein	
c1	cds	3468961	3470202	+	BALIOE_17490		hypothetical protein	
c1	cds	3470257	3470850	-	BALIOE_17495		hypothetical protein	
c1	cds	3470973	3471851	+	BALIOE_17500		hypothetical protein	
c1	cds	3471937	3473598	+	BALIOE_17505		hypothetical protein	
c1	cds	3473747	3474088	+	BALIOE_17510		hypothetical protein	
c1	cds	3474150	3474440	-	BALIOE_17515		hypothetical protein	
c1	cds	3474430	3474879	-	BALIOE_17520		hypothetical protein	
c1	cds	3475038	3475520	+	BALIOE_17525		hypothetical protein	
c1	tmRNA	3475735	3476097	+	BALIOE_17530	ssrA	transfer-messenger RNA, SsrA	SO:0000584
c1	cds	3476366	3476614	+	BALIOE_17535		hypothetical protein	
c1	cds	3477116	3477706	-	BALIOE_17540		hypothetical protein	
c1	cds	3477889	3478539	+	BALIOE_17545		hypothetical protein	
c1	cds	3478618	3479676	+	BALIOE_17550		hypothetical protein	
c1	cds	3479806	3480213	-	BALIOE_17555		hypothetical protein	
c1	cds	3480389	3480658	-	BALIOE_17560		hypothetical protein	
c1	cds	3480876	3481202	+	BALIOE_17565		hypothetical protein	
c1	cds	3481202	3482089	+	BALIOE_17570		hypothetical protein	
c1	cds	3481896	3482540	-	BALIOE_17575		hypothetical protein	
c1	cds	3482590	3482937	-	BALIOE_17580		hypothetical protein	
c1	cds	3482934	3483314	-	BALIOE_17585		hypothetical protein	
c1	cds	3483390	3483620	-	BALIOE_17590		hypothetical protein	
c1	cds	3483671	3484015	-	BALIOE_17595		hypothetical protein	
c1	cds	3484020	3484235	-	BALIOE_17600		hypothetical protein	
c1	cds	3484385	3486238	-	BALIOE_17605		hypothetical protein	
c1	cds	3486479	3486808	+	BALIOE_17610		hypothetical protein	
c1	cds	3486899	3487642	-	BALIOE_17615		hypothetical protein	
c1	cds	3487895	3488518	-	BALIOE_17620		hypothetical protein	
c1	cds	3488515	3489180	-	BALIOE_17625		hypothetical protein	
c1	cds	3489177	3489788	-	BALIOE_17630		hypothetical protein	
c1	cds	3489763	3490329	-	BALIOE_17635		hypothetical protein	
c1	cds	3490322	3490438	-	BALIOE_17640		hypothetical protein	
c1	cds	3490659	3491414	+	BALIOE_17645		hypothetical protein	
c1	cds	3491450	3491752	+	BALIOE_17650		hypothetical protein	
c1	cds	3491828	3493090	-	BALIOE_17655		hypothetical protein	
c1	cds	3493486	3493899	-	BALIOE_17660		hypothetical protein	
c1	cds	3493997	3494395	-	BALIOE_17665		hypothetical protein	
c1	cds	3494396	3496027	-	BALIOE_17670		hypothetical protein	
c1	cds	3496024	3497337	-	BALIOE_17675		hypothetical protein	
c1	cds	3497339	3498544	-	BALIOE_17680		hypothetical protein	
c1	cds	3498867	3499073	-	BALIOE_17685		hypothetical protein	
c1	cds	3499173	3500024	-	BALIOE_17690		hypothetical protein	
c1	cds	3500451	3505037	-	BALIOE_17695		hypothetical protein	
c1	cds	3505973	3507322	-	BALIOE_17700		hypothetical protein	
c1	tRNA	3508074	3508149	-	BALIOE_17705	Ile2_trna	tRNA-Ile2	SO:0000263
c1	cds	3508710	3509948	+	BALIOE_17710		hypothetical protein	
c1	cds	3509955	3510962	+	BALIOE_17715		hypothetical protein	
c1	cds	3511299	3512276	+	BALIOE_17720		hypothetical protein	
c1	cds	3512296	3513564	+	BALIOE_17725		hypothetical protein	
c1	cds	3513587	3515035	+	BALIOE_17730		hypothetical protein	
c1	cds	3515049	3516329	+	BALIOE_17735		hypothetical protein	
c1	cds	3516567	3517967	+	BALIOE_17740		hypothetical protein	
c1	cds	3517988	3518650	+	BALIOE_17745		hypothetical protein	
c1	cds	3518651	3519100	-	BALIOE_17750		hypothetical protein	
c1	cds	3519184	3519342	-	BALIOE_17755		hypothetical protein	
c1	cds	3519525	3519824	+	BALIOE_17760		hypothetical protein	
c1	cds	3519834	3520352	+	BALIOE_17765		hypothetical protein	
c1	cds	3520405	3520809	-	BALIOE_17770		hypothetical protein	
c1	cds	3521477	3521926	+	BALIOE_17775		hypothetical protein	
c1	cds	3521963	3522307	-	BALIOE_17780		hypothetical protein	
c1	cds	3522459	3522788	+	BALIOE_17785		hypothetical protein	
c1	cds	3522938	3524272	-	BALIOE_17790		hypothetical protein	
c1	cds	3524360	3524791	+	BALIOE_17795		hypothetical protein	
c1	cds	3525000	3525245	+	BALIOE_17800		hypothetical protein	
c1	cds	3525242	3525652	+	BALIOE_17805		hypothetical protein	
c1	cds	3525625	3527769	+	BALIOE_17810		hypothetical protein	
c1	cds	3527779	3528738	+	BALIOE_17815		hypothetical protein	
c1	cds	3529094	3530296	+	BALIOE_17820		hypothetical protein	
c1	cds	3530289	3531353	+	BALIOE_17825		hypothetical protein	
c1	cds	3531410	3532402	+	BALIOE_17830		hypothetical protein	
c1	ncRNA	3532412	3532489	+	BALIOE_17835	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	3532594	3533778	+	BALIOE_17840		hypothetical protein	
c1	cds	3533902	3534639	+	BALIOE_17845		hypothetical protein	
c1	cds	3534629	3534964	+	BALIOE_17850		hypothetical protein	
c1	cds	3535055	3535585	+	BALIOE_17855		hypothetical protein	
c1	cds	3535712	3536884	+	BALIOE_17860		hypothetical protein	
c1	cds	3536901	3538439	+	BALIOE_17865		hypothetical protein	
c1	cds	3538503	3539018	-	BALIOE_17870		hypothetical protein	
c1	cds	3539168	3540724	-	BALIOE_17875		hypothetical protein	
c1	cds	3540797	3541225	-	BALIOE_17880		hypothetical protein	
c1	cds	3541222	3541788	-	BALIOE_17885		hypothetical protein	
c1	tRNA	3542069	3542145	-	BALIOE_17890	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	3542248	3542324	-	BALIOE_17895	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	3542387	3542463	-	BALIOE_17900	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	3542528	3542604	-	BALIOE_17905	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	3542608	3542700	-	BALIOE_17910	Ser_trna	tRNA-Ser	SO:0000269
c1	cds	3543016	3543201	-	BALIOE_17915		hypothetical protein	
c1	cds	3543436	3546066	-	BALIOE_17920		hypothetical protein	
c1	cds	3546194	3546694	-	BALIOE_17925		hypothetical protein	
c1	cds	3546762	3547823	-	BALIOE_17930		hypothetical protein	
c1	cds	3547903	3548400	-	BALIOE_17935		hypothetical protein	
c1	cds	3548545	3549735	-	BALIOE_17940		hypothetical protein	
c1	cds	3549880	3550275	+	BALIOE_17945		hypothetical protein	
c1	cds	3550439	3550645	+	BALIOE_17950		hypothetical protein	
c1	cds	3550750	3551400	+	BALIOE_17955		hypothetical protein	
c1	cds	3551411	3551782	+	BALIOE_17960		hypothetical protein	
c1	cds	3551786	3552565	+	BALIOE_17965		hypothetical protein	
c1	cds	3552671	3553030	+	BALIOE_17970		hypothetical protein	
c1	cds	3553097	3553870	+	BALIOE_17975		hypothetical protein	
c1	cds	3553863	3554828	+	BALIOE_17980		hypothetical protein	
c1	cds	3554825	3556339	-	BALIOE_17985		hypothetical protein	
c1	cds	3556526	3557761	+	BALIOE_17990		hypothetical protein	
c1	cds	3557758	3558891	+	BALIOE_17995		hypothetical protein	
c1	cds	3559019	3561271	-	BALIOE_18000		hypothetical protein	
c1	cds	3561424	3561951	-	BALIOE_18005		hypothetical protein	
c1	cds	3562100	3563113	-	BALIOE_18010		hypothetical protein	
c1	cds	3563370	3564827	+	BALIOE_18015		hypothetical protein	
c1	cds	3564836	3566260	+	BALIOE_18020		hypothetical protein	
c1	cds	3566384	3566854	-	BALIOE_18025		hypothetical protein	
c1	cds	3566847	3567257	-	BALIOE_18030		hypothetical protein	
c1	cds	3567254	3568021	-	BALIOE_18035		hypothetical protein	
c1	cds	3568021	3568563	-	BALIOE_18040		hypothetical protein	
c1	cds	3568573	3570282	-	BALIOE_18045		hypothetical protein	
c1	cds	3570300	3571223	-	BALIOE_18050		hypothetical protein	
c1	cds	3571226	3573052	-	BALIOE_18055		hypothetical protein	
c1	cds	3573049	3573660	-	BALIOE_18060		hypothetical protein	
c1	cds	3573785	3574246	-	BALIOE_18065		hypothetical protein	
c1	cds	3574458	3574808	+	BALIOE_18070		hypothetical protein	
c1	cds	3574812	3575684	+	BALIOE_18075		hypothetical protein	
c1	cds	3575675	3575947	+	BALIOE_18080		hypothetical protein	
c1	cds	3575947	3577068	+	BALIOE_18085		hypothetical protein	
c1	cds	3577065	3578075	+	BALIOE_18090		hypothetical protein	
c1	cds	3578149	3580227	+	BALIOE_18095		hypothetical protein	
c1	cds	3580264	3580617	-	BALIOE_18100		hypothetical protein	
c1	cds	3580694	3580828	-	BALIOE_18105		hypothetical protein	
c1	cds	3580904	3583465	+	BALIOE_18110		hypothetical protein	
c1	cds	3583571	3584227	+	BALIOE_18115		hypothetical protein	
c1	cds	3584268	3584504	-	BALIOE_18120		hypothetical protein	
c1	cds	3584515	3585942	-	BALIOE_18125		hypothetical protein	
c1	cds	3585942	3586535	-	BALIOE_18130		hypothetical protein	
c1	cds	3586682	3587089	+	BALIOE_18135		hypothetical protein	
c1	cds	3587209	3588201	-	BALIOE_18140		hypothetical protein	
c1	cds	3588264	3589403	-	BALIOE_18145		hypothetical protein	
c1	cds	3589543	3590169	-	BALIOE_18150		hypothetical protein	
c1	cds	3590163	3590924	-	BALIOE_18155		hypothetical protein	
c1	cds	3590905	3591954	-	BALIOE_18160		hypothetical protein	
c1	cds	3591951	3592430	-	BALIOE_18165		hypothetical protein	
c1	cds	3592430	3593140	-	BALIOE_18170		hypothetical protein	
c1	cds	3593159	3593470	-	BALIOE_18175		hypothetical protein	
c1	cds	3593664	3593987	-	BALIOE_18180		hypothetical protein	
c1	cds	3594037	3594642	-	BALIOE_18185		hypothetical protein	
c1	cds	3594642	3596069	-	BALIOE_18190		hypothetical protein	
c1	cds	3596071	3596979	-	BALIOE_18195		hypothetical protein	
c1	cds	3597231	3598268	+	BALIOE_18200		hypothetical protein	
c1	crispr	3598411	3598562	?			CRISPR array with 3 repeats of length 30, consensus sequence CGGTTTATCCCCGCTGGCGCGGGGAACACA and spacer length 31	SO:0001459
c1	cds	3598658	3598951	-	BALIOE_18205		hypothetical protein	
c1	cds	3598948	3599871	-	BALIOE_18210		hypothetical protein	
c1	cds	3599868	3600518	-	BALIOE_18215		hypothetical protein	
c1	cds	3600500	3601246	-	BALIOE_18220		hypothetical protein	
c1	cds	3601257	3602312	-	BALIOE_18225		hypothetical protein	
c1	cds	3602324	3602860	-	BALIOE_18230		hypothetical protein	
c1	cds	3602857	3604419	-	BALIOE_18235		hypothetical protein	
c1	cds	3604517	3607216	-	BALIOE_18240		hypothetical protein	
c1	cds	3607408	3607560	-	BALIOE_18245		hypothetical protein	
c1	cds	3607824	3608558	-	BALIOE_18250		hypothetical protein	
c1	cds	3608632	3610344	-	BALIOE_18255		hypothetical protein	
c1	cds	3610344	3612143	-	BALIOE_18260		hypothetical protein	
c1	cds	3612459	3612824	+	BALIOE_18265		hypothetical protein	
c1	cds	3612902	3614173	+	BALIOE_18270		hypothetical protein	
c1	cds	3614164	3614424	+	BALIOE_18275		hypothetical protein	
c1	cds	3614441	3615016	+	BALIOE_18280		hypothetical protein	
c1	cds	3615164	3615439	-	BALIOE_18285		hypothetical protein	
c1	cds	3615455	3616024	-	BALIOE_18290		hypothetical protein	
c1	cds	3616021	3616800	-	BALIOE_18295		hypothetical protein	
c1	cds	3616778	3616984	-	BALIOE_18300		hypothetical protein	
c1	cds	3616981	3618186	-	BALIOE_18305		hypothetical protein	
c1	cds	3618208	3619662	-	BALIOE_18310		hypothetical protein	
c1	cds	3619732	3620517	-	BALIOE_18315		hypothetical protein	
c1	cds	3620836	3622113	+	BALIOE_18320		hypothetical protein	
c1	cds	3622140	3623618	+	BALIOE_18325		hypothetical protein	
c1	cds	3624682	3625353	-	BALIOE_18330		hypothetical protein	
c1	cds	3625634	3626128	+	BALIOE_18335		hypothetical protein	
c1	cds	3626142	3626816	+	BALIOE_18340		hypothetical protein	
c1	cds	3627050	3628198	+	BALIOE_18345		hypothetical protein	
c1	cds	3628195	3629109	+	BALIOE_18350		hypothetical protein	
c1	cds	3629169	3630467	-	BALIOE_18355		hypothetical protein	
c1	cds	3630555	3632192	-	BALIOE_18360		hypothetical protein	
c1	cds	3632420	3633211	-	BALIOE_18365		hypothetical protein	
c1	cds	3633282	3633617	-	BALIOE_18370		hypothetical protein	
c1	cds	3633617	3633865	-	BALIOE_18375		hypothetical protein	
c1	cds	3633943	3636177	-	BALIOE_18380		hypothetical protein	
c1	cds	3636225	3637526	-	BALIOE_18385		hypothetical protein	
c1	cds	3637583	3640339	+	BALIOE_18390		hypothetical protein	
c1	cds	3640572	3641912	-	BALIOE_18395		hypothetical protein	
c1	cds	3641933	3643030	-	BALIOE_18400		hypothetical protein	
c1	cds	3643052	3643273	-	BALIOE_18405		hypothetical protein	
c1	cds	3643275	3644627	-	BALIOE_18410		hypothetical protein	
c1	cds	3645062	3645511	-	BALIOE_18415		hypothetical protein	
c1	cds	3645529	3646311	-	BALIOE_18420		hypothetical protein	
c1	cds	3646311	3646640	-	BALIOE_18425		hypothetical protein	
c1	cds	3647262	3647807	-	BALIOE_18430		hypothetical protein	
c1	cds	3647875	3648723	+	BALIOE_18435		hypothetical protein	
c1	cds	3648835	3650199	+	BALIOE_18440		hypothetical protein	
c1	cds	3650756	3652045	+	BALIOE_18445		hypothetical protein	
c1	cds	3652103	3653470	+	BALIOE_18450		hypothetical protein	
c1	cds	3653492	3654337	+	BALIOE_18455		hypothetical protein	
c1	cds	3654392	3655540	-	BALIOE_18460		hypothetical protein	
c1	cds	3655568	3656215	-	BALIOE_18465		hypothetical protein	
c1	cds	3656762	3658078	+	BALIOE_18470		hypothetical protein	
c1	cds	3658111	3659886	+	BALIOE_18475		hypothetical protein	
c1	cds	3659995	3661413	+	BALIOE_18480		hypothetical protein	
c1	cds	3661415	3661837	+	BALIOE_18485		hypothetical protein	
c1	cds	3661895	3662626	+	BALIOE_18490		hypothetical protein	
c1	cds	3662670	3663770	-	BALIOE_18495		hypothetical protein	
c1	cds	3663763	3664158	-	BALIOE_18500		hypothetical protein	
c1	cds	3664177	3665094	-	BALIOE_18505		hypothetical protein	
c1	cds	3665445	3665672	-	BALIOE_18510		hypothetical protein	
c1	cds	3665864	3667069	+	BALIOE_18515		hypothetical protein	
c1	cds	3667069	3667512	+	BALIOE_18520		hypothetical protein	
c1	cds	3667563	3668369	-	BALIOE_18525		hypothetical protein	
c1	cds	3668608	3669705	-	BALIOE_18530		hypothetical protein	
c1	tRNA	3669914	3669990	+	BALIOE_18535	fMet_trna	tRNA-fMet	SO:0000266
c1	tRNA	3670024	3670100	+	BALIOE_18540	fMet_trna	tRNA-fMet	SO:0000266
c1	tRNA	3670134	3670210	+	BALIOE_18545	fMet_trna	tRNA-fMet	SO:0000266
c1	cds	3670284	3671537	-	BALIOE_18550		hypothetical protein	
c1	cds	3671769	3673100	+	BALIOE_18555		hypothetical protein	
c1	cds	3673162	3674988	-	BALIOE_18560		hypothetical protein	
c1	cds	3674988	3678530	-	BALIOE_18565		hypothetical protein	
c1	cds	3678523	3681411	-	BALIOE_18570		hypothetical protein	
c1	cds	3681587	3684955	-	BALIOE_18575		hypothetical protein	
c1	cds	3684968	3685291	-	BALIOE_18580		hypothetical protein	
c1	cds	3685276	3685683	-	BALIOE_18585		hypothetical protein	
c1	cds	3685680	3686243	-	BALIOE_18590		hypothetical protein	
c1	cds	3686234	3686704	-	BALIOE_18595		hypothetical protein	
c1	cds	3686888	3687682	-	BALIOE_18600		hypothetical protein	
c1	cds	3687689	3688564	-	BALIOE_18605		hypothetical protein	
c1	cds	3688715	3690961	-	BALIOE_18610		hypothetical protein	
c1	cds	3690974	3691504	-	BALIOE_18615		hypothetical protein	
c1	cds	3691857	3692003	-	BALIOE_18620		hypothetical protein	
c1	cds	3692189	3692878	+	BALIOE_18625		hypothetical protein	
c1	cds	3692947	3693660	+	BALIOE_18630		hypothetical protein	
c1	cds	3693798	3694016	+	BALIOE_18635		hypothetical protein	
c1	cds	3694124	3695164	+	BALIOE_18640		hypothetical protein	
c1	cds	3695196	3696389	-	BALIOE_18645		hypothetical protein	
c1	cds	3696382	3698541	-	BALIOE_18650		hypothetical protein	
c1	cds	3699127	3700158	+	BALIOE_18655		hypothetical protein	
c1	cds	3700165	3701427	-	BALIOE_18660		hypothetical protein	
c1	cds	3701549	3702484	+	BALIOE_18665		hypothetical protein	
c1	cds	3702471	3703163	-	BALIOE_18670		hypothetical protein	
c1	cds	3703292	3704710	-	BALIOE_18675		hypothetical protein	
c1	cds	3705025	3705786	-	BALIOE_18680		hypothetical protein	
c1	cds	3705816	3706652	-	BALIOE_18685		hypothetical protein	
c1	cds	3706939	3708120	-	BALIOE_18690		hypothetical protein	
c1	cds	3708375	3709604	+	BALIOE_18695		hypothetical protein	
c1	cds	3710064	3710696	+	BALIOE_18700		hypothetical protein	
c1	cds	3710778	3710909	-	BALIOE_18705		hypothetical protein	
c1	cds	3711030	3711839	+	BALIOE_18710		hypothetical protein	
c1	cds	3711836	3712315	+	BALIOE_18715		hypothetical protein	
c1	cds	3712348	3712488	-	BALIOE_18720		hypothetical protein	
c1	cds	3712464	3712889	-	BALIOE_18725		hypothetical protein	
c1	cds	3713319	3713810	+	BALIOE_18730		hypothetical protein	
c1	cds	3714036	3714527	+	BALIOE_18735		hypothetical protein	
c1	cds	3714861	3716237	+	BALIOE_18740		hypothetical protein	
c1	cds	3716404	3716622	+	BALIOE_18745		hypothetical protein	
c1	cds	3716809	3717210	+	BALIOE_18750		hypothetical protein	
c1	cds	3717229	3717861	-	BALIOE_18755		hypothetical protein	
c1	cds	3718084	3718515	-	BALIOE_18760		hypothetical protein	
c1	cds	3718532	3718792	-	BALIOE_18765		hypothetical protein	
c1	cds	3718734	3719315	-	BALIOE_18770		hypothetical protein	
c1	cds	3719331	3720065	-	BALIOE_18775		hypothetical protein	
c1	cds	3720062	3720394	-	BALIOE_18780		hypothetical protein	
c1	cds	3720414	3720653	-	BALIOE_18785		hypothetical protein	
c1	cds	3720667	3721401	-	BALIOE_18790		hypothetical protein	
c1	cds	3722105	3722605	+	BALIOE_18795		hypothetical protein	
c1	cds	3722962	3724083	-	BALIOE_18800		hypothetical protein	
c1	cds	3724092	3724328	-	BALIOE_18805		hypothetical protein	
c1	cds	3724407	3724859	-	BALIOE_18810		hypothetical protein	
c1	cds	3724861	3725121	-	BALIOE_18815		hypothetical protein	
c1	cds	3725132	3725797	-	BALIOE_18820		hypothetical protein	
c1	cds	3725787	3726773	-	BALIOE_18825		hypothetical protein	
c1	cds	3726733	3727302	-	BALIOE_18830		hypothetical protein	
c1	cds	3727375	3727608	-	BALIOE_18835		hypothetical protein	
c1	cds	3727586	3728044	-	BALIOE_18840		hypothetical protein	
c1	cds	3728034	3729326	-	BALIOE_18845		hypothetical protein	
c1	cds	3729358	3731418	-	BALIOE_18850		hypothetical protein	
c1	cds	3731411	3732556	-	BALIOE_18855		hypothetical protein	
c1	cds	3732561	3734264	-	BALIOE_18860		hypothetical protein	
c1	cds	3734261	3735010	-	BALIOE_18865		hypothetical protein	
c1	cds	3735356	3735535	-	BALIOE_18870		hypothetical protein	
c1	cds	3735602	3736660	-	BALIOE_18875		hypothetical protein	
c1	cds	3736644	3737207	-	BALIOE_18880		hypothetical protein	
c1	tRNA	3737441	3737514	-	BALIOE_18885	Gly_trna	tRNA-Gly	SO:0000260
c1	cds	3737593	3738348	-	BALIOE_18890		hypothetical protein	
c1	cds	3738764	3741061	+	BALIOE_18895		hypothetical protein	
c1	cds	3741072	3741950	+	BALIOE_18900		hypothetical protein	
c1	cds	3741947	3742426	+	BALIOE_18905		hypothetical protein	
c1	cds	3742466	3744244	-	BALIOE_18910		hypothetical protein	
c1	cds	3744723	3745910	+	BALIOE_18915		hypothetical protein	
c1	cds	3745968	3747164	+	BALIOE_18920		hypothetical protein	
c1	cds	3747222	3748433	+	BALIOE_18925		hypothetical protein	
c1	cds	3748486	3749871	+	BALIOE_18930		hypothetical protein	
c1	cds	3749919	3750851	+	BALIOE_18935		hypothetical protein	
c1	cds	3750892	3752517	-	BALIOE_18940		hypothetical protein	
c1	cds	3752565	3753335	-	BALIOE_18945		hypothetical protein	
c1	cds	3753438	3754016	+	BALIOE_18950		hypothetical protein	
c1	cds	3754338	3757436	+	BALIOE_18955		hypothetical protein	
c1	cds	3757439	3758767	+	BALIOE_18960		hypothetical protein	
c1	cds	3758817	3759596	+	BALIOE_18965		hypothetical protein	
c1	cds	3759593	3762463	+	BALIOE_18970		hypothetical protein	
c1	cds	3762628	3764028	+	BALIOE_18975		hypothetical protein	
c1	cds	3764046	3765362	+	BALIOE_18980		hypothetical protein	
c1	cds	3765398	3766765	+	BALIOE_18985		hypothetical protein	
c1	cds	3766801	3767070	-	BALIOE_18990		hypothetical protein	
c1	cds	3767289	3769208	-	BALIOE_18995		hypothetical protein	
c1	cds	3769644	3771092	+	BALIOE_19000		hypothetical protein	
c1	cds	3771094	3771219	+	BALIOE_19005		hypothetical protein	
c1	cds	3771342	3771890	+	BALIOE_19010		hypothetical protein	
c1	cds	3771933	3773450	-	BALIOE_19015		hypothetical protein	
c1	cds	3773460	3774341	-	BALIOE_19020		hypothetical protein	
c1	cds	3774649	3776382	-	BALIOE_19025		hypothetical protein	
c1	cds	3776388	3777098	-	BALIOE_19030		hypothetical protein	
c1	cds	3777123	3778019	-	BALIOE_19035		hypothetical protein	
c1	cds	3778131	3778652	+	BALIOE_19040		hypothetical protein	
c1	cds	3778692	3779099	-	BALIOE_19045		hypothetical protein	
c1	cds	3779080	3779346	-	BALIOE_19050		hypothetical protein	
c1	cds	3779589	3780569	+	BALIOE_19055		hypothetical protein	
c1	cds	3780646	3781305	-	BALIOE_19060		hypothetical protein	
c1	cds	3781469	3781780	-	BALIOE_19065		hypothetical protein	
c1	cds	3781825	3783258	+	BALIOE_19070		hypothetical protein	
c1	cds	3783424	3786297	-	BALIOE_19075		hypothetical protein	
c1	cds	3786415	3786804	-	BALIOE_19080		hypothetical protein	
c1	cds	3786828	3787922	-	BALIOE_19085		hypothetical protein	
c1	cds	3788370	3789572	-	BALIOE_19090		hypothetical protein	
c1	cds	3789596	3790774	-	BALIOE_19095		hypothetical protein	
c1	cds	3790771	3792096	-	BALIOE_19100		hypothetical protein	
c1	cds	3792122	3792700	-	BALIOE_19105		hypothetical protein	
c1	cds	3792868	3793197	+	BALIOE_19110		hypothetical protein	
c1	cds	3793443	3794045	+	BALIOE_19115		hypothetical protein	
c1	cds	3794827	3796059	-	BALIOE_19120		hypothetical protein	
c1	cds	3796314	3796973	-	BALIOE_19125		hypothetical protein	
c1	cds	3797356	3798249	+	BALIOE_19130		hypothetical protein	
c1	cds	3798453	3800597	+	BALIOE_19135		hypothetical protein	
c1	cds	3800590	3801585	+	BALIOE_19140		hypothetical protein	
c1	cds	3801596	3802381	+	BALIOE_19145		hypothetical protein	
c1	cds	3802405	3803883	+	BALIOE_19150		hypothetical protein	
c1	cds	3803880	3804191	-	BALIOE_19155		hypothetical protein	
c1	cds	3804198	3804776	-	BALIOE_19160		hypothetical protein	
c1	cds	3804943	3805683	-	BALIOE_19165		hypothetical protein	
c1	cds	3805776	3806411	-	BALIOE_19170		hypothetical protein	
c1	cds	3806550	3807410	-	BALIOE_19175		hypothetical protein	
c1	cds	3807768	3808847	-	BALIOE_19180		hypothetical protein	
c1	cds	3809062	3810225	-	BALIOE_19185		hypothetical protein	
c1	cds	3810275	3811294	-	BALIOE_19190		hypothetical protein	
c1	cds	3811666	3812097	+	BALIOE_19195		hypothetical protein	
c1	cds	3812120	3812698	+	BALIOE_19200		hypothetical protein	
c1	cds	3812699	3813406	+	BALIOE_19205		hypothetical protein	
c1	cds	3813394	3814071	+	BALIOE_19210		hypothetical protein	
c1	cds	3814065	3814742	+	BALIOE_19215		hypothetical protein	
c1	cds	3814714	3815427	-	BALIOE_19220		hypothetical protein	
c1	cds	3815424	3815933	-	BALIOE_19225		hypothetical protein	
c1	cds	3815955	3816920	-	BALIOE_19230		hypothetical protein	
c1	cds	3816917	3818194	-	BALIOE_19235		hypothetical protein	
c1	cds	3818209	3819597	-	BALIOE_19240		hypothetical protein	
c1	cds	3819625	3820068	-	BALIOE_19245		hypothetical protein	
c1	cds	3820382	3822373	-	BALIOE_19250		hypothetical protein	
c1	cds	3822651	3823409	+	BALIOE_19255		hypothetical protein	
c1	cds	3823615	3824535	-	BALIOE_19260		hypothetical protein	
c1	cds	3824671	3825402	-	BALIOE_19265		hypothetical protein	
c1	cds	3825548	3827524	-	BALIOE_19270		hypothetical protein	
c1	cds	3828012	3828263	-	BALIOE_19275		hypothetical protein	
c1	cds	3828319	3829473	+	BALIOE_19280		hypothetical protein	
c1	cds	3829910	3831304	+	BALIOE_19285		hypothetical protein	
c1	cds	3831423	3831878	+	BALIOE_19290		hypothetical protein	
c1	cds	3831973	3832680	+	BALIOE_19295		hypothetical protein	
c1	cds	3832760	3833491	+	BALIOE_19300		hypothetical protein	
c1	cds	3833504	3834451	+	BALIOE_19305		hypothetical protein	
c1	cds	3834491	3835126	+	BALIOE_19310		hypothetical protein	
c1	cds	3835126	3835542	+	BALIOE_19315		hypothetical protein	
c1	cds	3835733	3836713	-	BALIOE_19320		hypothetical protein	
c1	cds	3836731	3837435	+	BALIOE_19325		hypothetical protein	
c1	cds	3837453	3838019	+	BALIOE_19330		hypothetical protein	
c1	cds	3838016	3838306	+	BALIOE_19335		hypothetical protein	
c1	cds	3838314	3838907	+	BALIOE_19340		hypothetical protein	
c1	cds	3838900	3840036	+	BALIOE_19345		hypothetical protein	
c1	ncRNA	3840097	3840167	-	BALIOE_19350	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	3840279	3841286	-	BALIOE_19355		hypothetical protein	
c1	cds	3841403	3842449	-	BALIOE_19360		hypothetical protein	
c1	cds	3842625	3843344	-	BALIOE_19365		hypothetical protein	
c1	cds	3843528	3843854	-	BALIOE_19370		hypothetical protein	
c1	cds	3843854	3844573	-	BALIOE_19375		hypothetical protein	
c1	cds	3844734	3845786	+	BALIOE_19380		hypothetical protein	
c1	cds	3845814	3846089	+	BALIOE_19385		hypothetical protein	
c1	cds	3846154	3847233	+	BALIOE_19390		hypothetical protein	
c1	cds	3847435	3848691	+	BALIOE_19395		hypothetical protein	
c1	cds	3848741	3850876	-	BALIOE_19400		hypothetical protein	
c1	cds	3851274	3851981	+	BALIOE_19405		hypothetical protein	
c1	tRNA	3852087	3852162	+	BALIOE_19410	Phe_trna	tRNA-Phe	SO:0000267
c1	cds	3852360	3853625	+	BALIOE_19415		hypothetical protein	
c1	cds	3853742	3854527	-	BALIOE_19420		hypothetical protein	
c1	cds	3854616	3855290	+	BALIOE_19425		hypothetical protein	
c1	cds	3855287	3855634	+	BALIOE_19430		hypothetical protein	
c1	cds	3855654	3857102	+	BALIOE_19435		hypothetical protein	
c1	cds	3857956	3858489	-	BALIOE_19440		hypothetical protein	
c1	cds	3859806	3860696	+	BALIOE_19445		hypothetical protein	
c1	cds	3861484	3863133	+	BALIOE_19450		hypothetical protein	
c1	cds	3863741	3864730	+	BALIOE_19455		hypothetical protein	
c1	cds	3864779	3865453	+	BALIOE_19460		hypothetical protein	
c1	cds	3865888	3866676	+	BALIOE_19465		hypothetical protein	
c1	cds	3867328	3868629	+	BALIOE_19470		hypothetical protein	
c1	cds	3868635	3869462	+	BALIOE_19475		hypothetical protein	
c1	cds	3869502	3870389	-	BALIOE_19480		hypothetical protein	
c1	cds	3870389	3870715	-	BALIOE_19485		hypothetical protein	
c1	cds	3870906	3871253	+	BALIOE_19490		hypothetical protein	
c1	cds	3871303	3872841	+	BALIOE_19495		hypothetical protein	
c1	cds	3873064	3873414	+	BALIOE_19500		hypothetical protein	
c1	cds	3873627	3875030	+	BALIOE_19505		hypothetical protein	
c1	cds	3875349	3875693	+	BALIOE_19510		hypothetical protein	
c1	cds	3875536	3876852	-	BALIOE_19515		hypothetical protein	
c1	cds	3877144	3879003	-	BALIOE_19520		hypothetical protein	
c1	cds	3879208	3880074	+	BALIOE_19525		hypothetical protein	
c1	ncRNA	3880105	3880181	+	BALIOE_19530	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	3880197	3880445	-	BALIOE_19535		hypothetical protein	
c1	cds	3880458	3880799	-	BALIOE_19540		hypothetical protein	
c1	cds	3880792	3881280	-	BALIOE_19545		hypothetical protein	
c1	cds	3881273	3881767	-	BALIOE_19550		hypothetical protein	
c1	cds	3881767	3883470	-	BALIOE_19555		hypothetical protein	
c1	cds	3883467	3884645	-	BALIOE_19560		hypothetical protein	
c1	cds	3884635	3885621	-	BALIOE_19565		hypothetical protein	
c1	cds	3885624	3886742	-	BALIOE_19570		hypothetical protein	
c1	cds	3886931	3887218	-	BALIOE_19575		hypothetical protein	
c1	cds	3887337	3888224	-	BALIOE_19580		hypothetical protein	
c1	cds	3888381	3889421	+	BALIOE_19585		hypothetical protein	
c1	cds	3889461	3889955	-	BALIOE_19590		hypothetical protein	
c1	cds	3890146	3891030	+	BALIOE_19595		hypothetical protein	
c1	ncRNA	3891154	3891224	-	BALIOE_19600	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	3891302	3891727	-	BALIOE_19605		hypothetical protein	
c1	cds	3891734	3892468	-	BALIOE_19610		hypothetical protein	
c1	cds	3892720	3893907	+	BALIOE_19615		hypothetical protein	
c1	cds	3894047	3894706	+	BALIOE_19620		hypothetical protein	
c1	cds	3894746	3895702	-	BALIOE_19625		hypothetical protein	
c1	cds	3895839	3897002	+	BALIOE_19630		hypothetical protein	
c1	cds	3897107	3897934	+	BALIOE_19635		hypothetical protein	
c1	cds	3898134	3898409	+	BALIOE_19640		hypothetical protein	
c1	cds	3898403	3899056	+	BALIOE_19645		hypothetical protein	
c1	cds	3899105	3899362	+	BALIOE_19650		hypothetical protein	
c1	cds	3899405	3901624	-	BALIOE_19655		hypothetical protein	
c1	cds	3901735	3903147	-	BALIOE_19660		hypothetical protein	
c1	cds	3903222	3903959	-	BALIOE_19665		hypothetical protein	
c1	cds	3904193	3906451	-	BALIOE_19670		hypothetical protein	
c1	cds	3906589	3908196	-	BALIOE_19675		hypothetical protein	
c1	cds	3908305	3908787	-	BALIOE_19680		hypothetical protein	
c1	cds	3908840	3909232	-	BALIOE_19685		hypothetical protein	
c1	cds	3909384	3910043	+	BALIOE_19690		hypothetical protein	
c1	cds	3910040	3911389	+	BALIOE_19695		hypothetical protein	
c1	cds	3911499	3912080	+	BALIOE_19700		hypothetical protein	
c1	cds	3912111	3912425	+	BALIOE_19705		hypothetical protein	
c1	cds	3912470	3913357	-	BALIOE_19710		hypothetical protein	
c1	cds	3913354	3914301	-	BALIOE_19715		hypothetical protein	
c1	cds	3914312	3915349	-	BALIOE_19720		hypothetical protein	
c1	cds	3915358	3916341	-	BALIOE_19725		hypothetical protein	
c1	cds	3916338	3917147	-	BALIOE_19730		hypothetical protein	
c1	cds	3917521	3919662	+	BALIOE_19735		hypothetical protein	
c1	cds	3919726	3921618	-	BALIOE_19740		hypothetical protein	
c1	cds	3921647	3922228	-	BALIOE_19745		hypothetical protein	
c1	cds	3922228	3923055	-	BALIOE_19750		hypothetical protein	
c1	cds	3923080	3923502	-	BALIOE_19755		hypothetical protein	
c1	cds	3923503	3924132	-	BALIOE_19760		hypothetical protein	
c1	cds	3924337	3925818	+	BALIOE_19765		hypothetical protein	
c1	cds	3925966	3926637	+	BALIOE_19770		hypothetical protein	
c1	cds	3926643	3927803	+	BALIOE_19775		hypothetical protein	
c1	cds	3927841	3928656	-	BALIOE_19780		hypothetical protein	
c1	cds	3928772	3929545	+	BALIOE_19785		hypothetical protein	
c1	cds	3929603	3929773	-	BALIOE_19790		hypothetical protein	
c1	cds	3930035	3930688	-	BALIOE_19795		hypothetical protein	
c1	cds	3931062	3931361	+	BALIOE_19800		hypothetical protein	
c1	cds	3931396	3931596	-	BALIOE_19805		hypothetical protein	
c1	cds	3931865	3932479	+	BALIOE_19810		hypothetical protein	
c1	cds	3932521	3934182	+	BALIOE_19815		hypothetical protein	
c1	cds	3934976	3936409	-	BALIOE_19820		hypothetical protein	
c1	cds	3936457	3939297	-	BALIOE_19825		hypothetical protein	
c1	cds	3939320	3940621	-	BALIOE_19830		hypothetical protein	
c1	cds	3940863	3941483	+	BALIOE_19835		hypothetical protein	
c1	cds	3941547	3942785	+	BALIOE_19840		hypothetical protein	
c1	ncRNA	3942851	3942921	-	BALIOE_19845	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	3942966	3943787	-	BALIOE_19850		hypothetical protein	
c1	cds	3943878	3944246	-	BALIOE_19855		hypothetical protein	
c1	cds	3944352	3944969	+	BALIOE_19860		hypothetical protein	
c1	cds	3944982	3945914	-	BALIOE_19865		hypothetical protein	
c1	cds	3946121	3947032	+	BALIOE_19870		hypothetical protein	
c1	cds	3947029	3947634	+	BALIOE_19875		hypothetical protein	
c1	cds	3947683	3949146	+	BALIOE_19880		hypothetical protein	
c1	cds	3949189	3950202	-	BALIOE_19885		hypothetical protein	
c1	cds	3950440	3950655	+	BALIOE_19890		hypothetical protein	
c1	cds	3950766	3952511	+	BALIOE_19895		hypothetical protein	
c1	cds	3952706	3954547	+	BALIOE_19900		hypothetical protein	
c1	cds	3954626	3955132	-	BALIOE_19905		hypothetical protein	
c1	tRNA	3955257	3955332	+	BALIOE_19910	Ile2_trna	tRNA-Ile2	SO:0000263
c1	cds	3955386	3956150	-	BALIOE_19915		hypothetical protein	
c1	cds	3956438	3957061	+	BALIOE_19920		hypothetical protein	
c1	cds	3957215	3958735	-	BALIOE_19925		hypothetical protein	
c1	cds	3959042	3960532	+	BALIOE_19930		hypothetical protein	
c1	cds	3960574	3960906	-	BALIOE_19935		hypothetical protein	
c1	cds	3961125	3962108	+	BALIOE_19940		hypothetical protein	
c1	cds	3962292	3965384	+	BALIOE_19945		hypothetical protein	
c1	cds	3965381	3965830	+	BALIOE_19950		hypothetical protein	
c1	cds	3965893	3967326	+	BALIOE_19955		hypothetical protein	
c1	cds	3967460	3968530	+	BALIOE_19960		hypothetical protein	
c1	cds	3968547	3970898	+	BALIOE_19965		hypothetical protein	
c1	ncRNA	3971060	3971141	-	BALIOE_19970	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	3971160	3971241	-	BALIOE_19975	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	3971424	3973442	+	BALIOE_19980		hypothetical protein	
c1	cds	3973487	3973903	-	BALIOE_19985		hypothetical protein	
c1	cds	3973900	3974214	-	BALIOE_19990		hypothetical protein	
c1	cds	3974498	3975634	-	BALIOE_19995		hypothetical protein	
c1	cds	3975719	3976222	+	BALIOE_20000		hypothetical protein	
c1	cds	3976299	3976991	+	BALIOE_20005		hypothetical protein	
c1	cds	3977070	3978056	+	BALIOE_20010		hypothetical protein	
c1	cds	3978340	3979305	+	BALIOE_20015		hypothetical protein	
c1	cds	3979704	3980948	+	BALIOE_20020		hypothetical protein	
c1	cds	3980953	3981504	-	BALIOE_20025		hypothetical protein	
c1	cds	3981587	3983074	-	BALIOE_20030		hypothetical protein	
c1	cds	3983089	3984501	-	BALIOE_20035		hypothetical protein	
c1	cds	3984984	3986282	+	BALIOE_20040		hypothetical protein	
c1	cds	3986412	3987188	+	BALIOE_20045		hypothetical protein	
c1	cds	3987533	3988195	+	BALIOE_20050		hypothetical protein	
c1	cds	3988199	3988582	+	BALIOE_20055		hypothetical protein	
c1	cds	3988729	3989097	+	BALIOE_20060		hypothetical protein	
c1	cds	3989135	3989440	+	BALIOE_20065		hypothetical protein	
c1	cds	3989443	3989847	+	BALIOE_20070		hypothetical protein	
c1	cds	3989837	3990136	+	BALIOE_20075		hypothetical protein	
c1	cds	3990232	3990714	+	BALIOE_20080		hypothetical protein	
c1	cds	3990784	3991770	+	BALIOE_20085		hypothetical protein	
c1	cds	3992062	3992427	+	BALIOE_20090		hypothetical protein	
c1	cds	3992668	3993024	+	BALIOE_20095		hypothetical protein	
c1	cds	3993075	3993971	-	BALIOE_20100		hypothetical protein	
c1	cds	3994076	3994777	+	BALIOE_20105		hypothetical protein	
c1	cds	3994800	3994964	+	BALIOE_20110		hypothetical protein	
c1	cds	3995098	3996408	-	BALIOE_20115		hypothetical protein	
c1	cds	3996436	3997767	-	BALIOE_20120		hypothetical protein	
c1	cds	3998042	3999406	-	BALIOE_20125		hypothetical protein	
c1	cds	3999478	3999867	-	BALIOE_20130		hypothetical protein	
c1	cds	3999881	4002175	-	BALIOE_20135		hypothetical protein	
c1	cds	4002209	4003417	-	BALIOE_20140		hypothetical protein	
c1	cds	4003443	4004774	-	BALIOE_20145		hypothetical protein	
c1	cds	4004796	4005785	-	BALIOE_20150		hypothetical protein	
c1	cds	4005884	4006822	-	BALIOE_20155		hypothetical protein	
c1	cds	4007011	4007355	+	BALIOE_20160		hypothetical protein	
c1	cds	4007611	4008150	+	BALIOE_20165		hypothetical protein	
c1	cds	4008172	4009359	+	BALIOE_20170		hypothetical protein	
c1	cds	4009988	4011133	-	BALIOE_20175		hypothetical protein	
c1	cds	4011230	4012120	-	BALIOE_20180		hypothetical protein	
c1	cds	4012150	4012920	-	BALIOE_20185		hypothetical protein	
c1	cds	4012936	4014270	-	BALIOE_20190		hypothetical protein	
c1	cds	4014645	4016216	+	BALIOE_20195		hypothetical protein	
c1	cds	4016365	4016700	+	BALIOE_20200		hypothetical protein	
c1	cds	4016700	4017164	+	BALIOE_20205		hypothetical protein	
c1	cds	4017219	4018028	-	BALIOE_20210		hypothetical protein	
c1	cds	4018277	4019557	+	BALIOE_20215		hypothetical protein	
c1	cds	4019580	4020053	+	BALIOE_20220		hypothetical protein	
c1	cds	4020064	4020843	+	BALIOE_20225		hypothetical protein	
c1	cds	4020833	4021711	+	BALIOE_20230		hypothetical protein	
c1	cds	4021729	4022163	+	BALIOE_20235		hypothetical protein	
c1	cds	4022160	4023293	+	BALIOE_20240		hypothetical protein	
c1	cds	4023644	4024798	+	BALIOE_20245		hypothetical protein	
c1	cds	4024811	4025671	+	BALIOE_20250		hypothetical protein	
c1	cds	4025838	4026314	+	BALIOE_20255		hypothetical protein	
c1	cds	4026527	4027156	+	BALIOE_20260		hypothetical protein	
c1	cds	4027146	4027937	+	BALIOE_20265		hypothetical protein	
c1	cds	4027992	4028153	+	BALIOE_20270		hypothetical protein	
c1	cds	4028184	4028693	+	BALIOE_20275		hypothetical protein	
c1	cds	4029094	4029678	+	BALIOE_20280		hypothetical protein	
c1	cds	4029779	4030453	+	BALIOE_20285		hypothetical protein	
c1	cds	4030482	4032998	+	BALIOE_20290		hypothetical protein	
c1	cds	4033009	4033362	+	BALIOE_20295		hypothetical protein	
c1	cds	4033388	4033714	+	BALIOE_20300		hypothetical protein	
c1	cds	4033714	4034601	+	BALIOE_20305		hypothetical protein	
c1	cds	4034567	4035058	+	BALIOE_20310		hypothetical protein	
c1	cds	4035101	4035961	-	BALIOE_20315		hypothetical protein	
c1	cds	4036026	4038062	+	BALIOE_20320		hypothetical protein	
c1	cds	4038020	4038415	+	BALIOE_20325		hypothetical protein	
c1	cds	4038435	4039025	+	BALIOE_20330		hypothetical protein	
c1	cds	4039035	4039610	+	BALIOE_20335		hypothetical protein	
c1	cds	4039724	4040764	-	BALIOE_20340		hypothetical protein	
c1	cds	4040837	4041472	-	BALIOE_20345		hypothetical protein	
c1	cds	4041600	4042118	+	BALIOE_20350		hypothetical protein	
c1	cds	4042098	4042541	-	BALIOE_20355		hypothetical protein	
c1	cds	4042592	4042894	+	BALIOE_20360		hypothetical protein	
c1	cds	4042881	4043384	-	BALIOE_20365		hypothetical protein	
c1	cds	4043378	4043902	-	BALIOE_20370		hypothetical protein	
c1	cds	4044111	4045106	+	BALIOE_20375		hypothetical protein	
c1	cds	4045115	4045993	+	BALIOE_20380		hypothetical protein	
c1	cds	4046074	4047081	+	BALIOE_20385		hypothetical protein	
c1	cds	4047198	4048442	-	BALIOE_20390		hypothetical protein	
c1	cds	4048596	4050485	-	BALIOE_20395		hypothetical protein	
c1	cds	4050665	4051549	-	BALIOE_20400		hypothetical protein	
c1	cds	4051658	4053793	-	BALIOE_20405		hypothetical protein	
c1	cds	4054040	4054309	-	BALIOE_20410		hypothetical protein	
c1	cds	4054458	4055402	-	BALIOE_20415		hypothetical protein	
c1	cds	4055402	4055803	-	BALIOE_20420		hypothetical protein	
c1	ncRNA	4055881	4055951	-	BALIOE_20425	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	4055968	4058640	-	BALIOE_20430		hypothetical protein	
c1	cds	4058665	4060152	-	BALIOE_20435		hypothetical protein	
c1	cds	4060180	4060632	-	BALIOE_20440		hypothetical protein	
c1	tRNA	4060839	4060915	-	BALIOE_20445	fMet_trna	tRNA-fMet	SO:0000266
c1	cds	4061263	4062606	+	BALIOE_20450		hypothetical protein	
c1	cds	4062614	4064131	-	BALIOE_20455		hypothetical protein	
c1	tRNA	4064698	4064784	-	BALIOE_20460	Leu_trna	tRNA-Leu	SO:0000264
c1	cds	4064799	4065131	-	BALIOE_20465		hypothetical protein	
c1	cds	4065359	4066696	-	BALIOE_20470		hypothetical protein	
c1	cds	4066689	4067537	-	BALIOE_20475		hypothetical protein	
c1	cds	4067627	4069570	-	BALIOE_20480		hypothetical protein	
c1	cds	4069661	4070290	-	BALIOE_20485		hypothetical protein	
c1	cds	4070416	4070709	+	BALIOE_20490		hypothetical protein	
c1	cds	4070865	4071341	-	BALIOE_20495		hypothetical protein	
c1	cds	4071589	4073022	+	BALIOE_20500		hypothetical protein	
c1	cds	4073062	4074234	-	BALIOE_20505		hypothetical protein	
c1	cds	4074250	4075215	-	BALIOE_20510		hypothetical protein	
c1	cds	4075342	4075599	-	BALIOE_20515		hypothetical protein	
c1	cds	4075620	4075931	-	BALIOE_20520		hypothetical protein	
c1	cds	4076190	4077161	+	BALIOE_20525		hypothetical protein	
c1	cds	4077390	4077668	+	BALIOE_20530		hypothetical protein	
c1	cds	4077716	4078975	-	BALIOE_20535		hypothetical protein	
c1	cds	4079030	4079299	-	BALIOE_20540		hypothetical protein	
c1	cds	4079444	4079737	-	BALIOE_20545		hypothetical protein	
c1	cds	4079737	4080372	-	BALIOE_20550		hypothetical protein	
c1	cds	4080391	4080942	-	BALIOE_20555		hypothetical protein	
c1	cds	4080947	4081729	-	BALIOE_20560		hypothetical protein	
c1	cds	4081737	4082546	-	BALIOE_20565		hypothetical protein	
c1	cds	4082756	4083733	+	BALIOE_20570		hypothetical protein	
c1	cds	4083747	4084733	+	BALIOE_20575		hypothetical protein	
c1	cds	4084754	4085320	+	BALIOE_20580		hypothetical protein	
c1	cds	4085317	4085892	+	BALIOE_20585		hypothetical protein	
c1	cds	4085861	4086418	+	BALIOE_20590		hypothetical protein	
c1	cds	4086425	4087150	+	BALIOE_20595		hypothetical protein	
c1	cds	4087198	4088631	+	BALIOE_20600		hypothetical protein	
c1	cds	4088654	4088941	+	BALIOE_20605		hypothetical protein	
c1	cds	4089059	4089550	+	BALIOE_20610		hypothetical protein	
c1	cds	4089596	4090450	+	BALIOE_20615		hypothetical protein	
c1	cds	4090447	4090719	+	BALIOE_20620		hypothetical protein	
c1	cds	4090933	4091565	+	BALIOE_20625		hypothetical protein	
c1	cds	4091562	4092290	-	BALIOE_20630		hypothetical protein	
c1	cds	4092287	4092940	-	BALIOE_20635		hypothetical protein	
c1	cds	4093170	4095506	-	BALIOE_20640		hypothetical protein	
c1	cds	4095602	4096531	-	BALIOE_20645		hypothetical protein	
c1	cds	4097112	4101665	+	BALIOE_20650		hypothetical protein	
c1	cds	4101678	4103096	+	BALIOE_20655		hypothetical protein	
c1	cds	4103280	4104329	+	BALIOE_20660		hypothetical protein	
c1	cds	4104389	4104853	-	BALIOE_20665		hypothetical protein	
c1	cds	4104850	4105725	-	BALIOE_20670		hypothetical protein	
c1	cds	4105722	4106411	-	BALIOE_20675		hypothetical protein	
c1	cds	4106459	4107949	-	BALIOE_20680		hypothetical protein	
c1	cds	4108058	4108951	-	BALIOE_20685		hypothetical protein	
c1	cds	4109073	4109864	-	BALIOE_20690		hypothetical protein	
c1	cds	4110244	4111608	+	BALIOE_20695		hypothetical protein	
c1	cds	4111643	4112140	-	BALIOE_20700		hypothetical protein	
c1	cds	4112146	4112784	-	BALIOE_20705		hypothetical protein	
c1	cds	4113179	4113571	-	BALIOE_20710		hypothetical protein	
c1	cds	4113587	4114015	-	BALIOE_20715		hypothetical protein	
c1	cds	4114234	4115361	-	BALIOE_20720		hypothetical protein	
c1	cds	4115555	4115953	+	BALIOE_20725		hypothetical protein	
c1	cds	4116107	4117474	+	BALIOE_20730		hypothetical protein	
c1	cds	4117564	4118631	+	BALIOE_20735		hypothetical protein	
c1	cds	4118695	4119633	-	BALIOE_20740		hypothetical protein	
c1	cds	4120068	4120538	+	BALIOE_20745		hypothetical protein	
c1	cds	4120903	4121166	+	BALIOE_20750		hypothetical protein	
c1	cds	4121222	4121494	-	BALIOE_20755		hypothetical protein	
c1	cds	4121586	4123553	-	BALIOE_20760		hypothetical protein	
c1	cds	4123559	4124488	-	BALIOE_20765		hypothetical protein	
c1	cds	4124496	4124699	-	BALIOE_20770		hypothetical protein	
c1	cds	4124882	4125811	+	BALIOE_20775		hypothetical protein	
c1	cds	4125945	4127390	-	BALIOE_20780		hypothetical protein	
c1	cds	4127546	4131346	-	BALIOE_20785		hypothetical protein	
c1	cds	4131414	4132883	-	BALIOE_20790		hypothetical protein	
c1	cds	4132873	4133466	-	BALIOE_20795		hypothetical protein	
c1	cds	4133475	4133963	-	BALIOE_20800		hypothetical protein	
c1	cds	4133963	4135066	-	BALIOE_20805		hypothetical protein	
c1	cds	4135132	4136175	-	BALIOE_20810		hypothetical protein	
c1	cds	4136480	4138420	-	BALIOE_20815		hypothetical protein	
c1	cds	4138572	4139546	+	BALIOE_20820		hypothetical protein	
c1	cds	4140524	4140994	+	BALIOE_20825		hypothetical protein	
c1	cds	4141005	4142354	+	BALIOE_20830		hypothetical protein	
c1	cds	4142463	4142705	+	BALIOE_20835		hypothetical protein	
c1	cds	4142695	4144146	+	BALIOE_20840		hypothetical protein	
c1	cds	4144158	4145039	+	BALIOE_20845		hypothetical protein	
c1	cds	4145368	4146333	+	BALIOE_20850		hypothetical protein	
c1	cds	4146359	4146655	+	BALIOE_20855		hypothetical protein	
c1	cds	4146740	4147624	+	BALIOE_20860		hypothetical protein	
c1	cds	4147708	4147887	+	BALIOE_20865		hypothetical protein	
c1	cds	4147890	4148552	-	BALIOE_20870		hypothetical protein	
c1	cds	4148951	4150108	+	BALIOE_20875		hypothetical protein	
c1	cds	4150120	4152006	+	BALIOE_20880		hypothetical protein	
c1	cds	4152037	4153269	+	BALIOE_20885		hypothetical protein	
c1	cds	4153120	4153416	-	BALIOE_20890		hypothetical protein	
c1	cds	4153522	4153743	+	BALIOE_20895		hypothetical protein	
c1	cds	4154174	4155199	+	BALIOE_20900		hypothetical protein	
c1	cds	4155267	4156448	+	BALIOE_20905		hypothetical protein	
c1	cds	4156458	4157561	+	BALIOE_20910		hypothetical protein	
c1	cds	4157569	4158327	+	BALIOE_20915		hypothetical protein	
c1	tRNA	4158713	4158788	-	BALIOE_20920	Thr_trna	tRNA-Thr	SO:0000270
c1	tRNA	4162099	4162174	-	BALIOE_20925	Ala_trna	tRNA-Ala	SO:0000254
c1	tRNA	4162217	4162293	-	BALIOE_20930	Ile_trna	tRNA-Ile	SO:0000263
c1	rRNA	4162362	4163903	-	BALIOE_20935	16S_rrna	16S ribosomal RNA	GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
c1	cds	4164376	4164930	+	BALIOE_20940		hypothetical protein	
c1	cds	4164906	4165163	-	BALIOE_20945		hypothetical protein	
c1	cds	4165160	4165978	-	BALIOE_20950		hypothetical protein	
c1	cds	4165983	4166555	-	BALIOE_20955		hypothetical protein	
c1	cds	4166560	4167102	-	BALIOE_20960		hypothetical protein	
c1	cds	4167131	4167604	-	BALIOE_20965		hypothetical protein	
c1	cds	4167576	4168700	-	BALIOE_20970		hypothetical protein	
c1	cds	4168830	4169339	+	BALIOE_20975		hypothetical protein	
c1	cds	4169354	4170301	+	BALIOE_20980		hypothetical protein	
c1	cds	4170347	4171636	+	BALIOE_20985		hypothetical protein	
c1	cds	4171658	4173034	+	BALIOE_20990		hypothetical protein	
c1	cds	4173164	4173574	+	BALIOE_20995		hypothetical protein	
c1	cds	4173571	4173789	-	BALIOE_21000		hypothetical protein	
c1	cds	4173845	4174270	-	BALIOE_21005		hypothetical protein	
c1	cds	4174281	4174649	-	BALIOE_21010		hypothetical protein	
c1	cds	4174756	4175139	-	BALIOE_21015		hypothetical protein	
c1	cds	4175180	4176169	-	BALIOE_21020		hypothetical protein	
c1	cds	4176195	4176815	-	BALIOE_21025		hypothetical protein	
c1	cds	4176849	4177238	-	BALIOE_21030		hypothetical protein	
c1	cds	4177255	4177611	-	BALIOE_21035		hypothetical protein	
c1	cds	4177758	4177874	-	BALIOE_21040		hypothetical protein	
c1	cds	4177906	4179237	-	BALIOE_21045		hypothetical protein	
c1	cds	4179245	4179679	-	BALIOE_21050		hypothetical protein	
c1	cds	4179683	4179862	-	BALIOE_21055		hypothetical protein	
c1	cds	4179866	4180369	-	BALIOE_21060		hypothetical protein	
c1	cds	4180384	4180737	-	BALIOE_21065		hypothetical protein	
c1	cds	4180747	4181280	-	BALIOE_21070		hypothetical protein	
c1	cds	4181293	4181685	-	BALIOE_21075		hypothetical protein	
c1	cds	4181719	4182024	-	BALIOE_21080		hypothetical protein	
c1	cds	4182039	4182578	-	BALIOE_21085		hypothetical protein	
c1	cds	4182593	4182907	-	BALIOE_21090		hypothetical protein	
c1	cds	4182918	4183289	-	BALIOE_21095		hypothetical protein	
c1	cds	4183454	4183708	-	BALIOE_21100		hypothetical protein	
c1	cds	4183708	4183899	-	BALIOE_21105		hypothetical protein	
c1	cds	4183899	4184309	-	BALIOE_21110		hypothetical protein	
c1	cds	4184322	4185023	-	BALIOE_21115		hypothetical protein	
c1	cds	4185041	4185373	-	BALIOE_21120		hypothetical protein	
c1	cds	4185388	4185666	-	BALIOE_21125		hypothetical protein	
c1	cds	4185683	4186504	-	BALIOE_21130		hypothetical protein	
c1	cds	4186522	4186824	-	BALIOE_21135		hypothetical protein	
c1	cds	4186821	4187426	-	BALIOE_21140		hypothetical protein	
c1	cds	4187437	4188066	-	BALIOE_21145		hypothetical protein	
c1	cds	4188099	4188410	-	BALIOE_21150		hypothetical protein	
c1	cds	4188789	4189256	+	BALIOE_21155		hypothetical protein	
c1	cds	4189253	4189729	-	BALIOE_21160		hypothetical protein	
c1	cds	4189802	4189996	-	BALIOE_21165		hypothetical protein	
c1	cds	4190179	4191363	-	BALIOE_21170		hypothetical protein	
c1	cds	4191434	4193548	-	BALIOE_21175		hypothetical protein	
c1	cds	4193645	4194115	-	BALIOE_21180		hypothetical protein	
c1	cds	4194212	4194586	-	BALIOE_21185		hypothetical protein	
c1	cds	4194712	4194999	-	BALIOE_21190		hypothetical protein	
c1	cds	4195007	4195366	-	BALIOE_21195		hypothetical protein	
c1	cds	4195366	4195752	-	BALIOE_21200		hypothetical protein	
c1	cds	4195752	4196474	-	BALIOE_21205		hypothetical protein	
c1	cds	4196641	4197453	-	BALIOE_21210		hypothetical protein	
c1	cds	4197674	4197892	+	BALIOE_21215		hypothetical protein	
c1	cds	4197941	4198531	-	BALIOE_21220		hypothetical protein	
c1	cds	4198626	4198826	-	BALIOE_21225		hypothetical protein	
c1	cds	4198863	4200641	-	BALIOE_21230		hypothetical protein	
c1	cds	4200641	4201192	-	BALIOE_21235		hypothetical protein	
c1	cds	4201323	4203236	+	BALIOE_21240		hypothetical protein	
c1	cds	4203236	4204258	+	BALIOE_21245		hypothetical protein	
c1	cds	4204252	4204470	+	BALIOE_21250		hypothetical protein	
c1	cds	4204524	4205393	+	BALIOE_21255		hypothetical protein	
c1	cds	4205448	4205852	-	BALIOE_21260		hypothetical protein	
c1	cds	4206154	4206786	+	BALIOE_21265		hypothetical protein	
c1	cds	4206837	4208927	+	BALIOE_21270		hypothetical protein	
c1	cds	4208994	4210214	-	BALIOE_21275		hypothetical protein	
c1	cds	4210300	4210863	-	BALIOE_21280		hypothetical protein	
c1	cds	4210895	4211497	-	BALIOE_21285		hypothetical protein	
c1	cds	4211487	4211654	-	BALIOE_21290		hypothetical protein	
c1	cds	4211759	4212331	-	BALIOE_21295		hypothetical protein	
c1	cds	4212602	4213783	+	BALIOE_21300		hypothetical protein	
c1	cds	4214045	4216588	+	BALIOE_21305		hypothetical protein	
c1	cds	4216585	4216911	+	BALIOE_21310		hypothetical protein	
c1	cds	4217037	4217843	+	BALIOE_21315		hypothetical protein	
c1	cds	4217862	4219235	+	BALIOE_21320		hypothetical protein	
c1	cds	4219490	4219657	+	BALIOE_21325		hypothetical protein	
c1	cds	4219953	4221290	+	BALIOE_21330		hypothetical protein	
c1	cds	4221311	4222333	+	BALIOE_21335		hypothetical protein	
c1	cds	4222384	4223211	+	BALIOE_21340		hypothetical protein	
c1	cds	4223211	4223543	+	BALIOE_21345		hypothetical protein	
c1	cds	4223562	4223996	+	BALIOE_21350		hypothetical protein	
c1	cds	4224096	4224827	+	BALIOE_21355		hypothetical protein	
c1	cds	4224958	4225962	-	BALIOE_21360		hypothetical protein	
c1	cds	4225955	4226713	-	BALIOE_21365		hypothetical protein	
c1	cds	4226706	4227383	-	BALIOE_21370		hypothetical protein	
c1	cds	4227401	4228237	-	BALIOE_21375		hypothetical protein	
c1	cds	4228344	4229630	-	BALIOE_21380		hypothetical protein	
c1	cds	4229722	4230810	-	BALIOE_21385		hypothetical protein	
c1	cds	4230867	4231544	-	BALIOE_21390		hypothetical protein	
c1	cds	4231789	4232997	-	BALIOE_21395		hypothetical protein	
c1	cds	4232939	4233343	-	BALIOE_21400		hypothetical protein	
c1	cds	4233333	4233773	-	BALIOE_21405		hypothetical protein	
c1	cds	4233757	4234296	-	BALIOE_21410		hypothetical protein	
c1	cds	4234280	4235074	-	BALIOE_21415		hypothetical protein	
c1	cds	4235194	4237746	+	BALIOE_21420		hypothetical protein	
c1	cds	4237911	4238471	-	BALIOE_21425		hypothetical protein	
c1	cds	4238803	4240926	+	BALIOE_21430		hypothetical protein	
c1	cds	4240991	4241659	+	BALIOE_21435		hypothetical protein	
c1	cds	4241670	4242071	+	BALIOE_21440		hypothetical protein	
c1	cds	4242096	4242974	+	BALIOE_21445		hypothetical protein	
c1	cds	4243037	4244761	-	BALIOE_21450		hypothetical protein	
c1	cds	4245140	4246762	+	BALIOE_21455		hypothetical protein	
c1	cds	4246838	4248190	-	BALIOE_21460		hypothetical protein	
c1	cds	4248187	4248906	-	BALIOE_21465		hypothetical protein	
c1	cds	4249134	4249610	+	BALIOE_21470		hypothetical protein	
c1	cds	4249707	4252028	+	BALIOE_21475		hypothetical protein	
c1	cds	4252466	4252693	+	BALIOE_21480		hypothetical protein	
c1	cds	4252710	4255031	+	BALIOE_21485		hypothetical protein	
c1	cds	4255031	4255267	+	BALIOE_21490		hypothetical protein	
c1	cds	4255470	4256348	+	BALIOE_21495		hypothetical protein	
c1	cds	4256375	4257145	-	BALIOE_21500		hypothetical protein	
c1	cds	4257183	4257866	+	BALIOE_21505		hypothetical protein	
c1	cds	4257925	4258500	+	BALIOE_21510		hypothetical protein	
c1	cds	4258861	4260177	+	BALIOE_21515		hypothetical protein	
c1	cds	4260222	4262306	-	BALIOE_21520		hypothetical protein	
c1	cds	4262316	4264709	-	BALIOE_21525		hypothetical protein	
c1	cds	4265321	4268026	+	BALIOE_21530		hypothetical protein	
c1	cds	4268093	4268371	+	BALIOE_21535		hypothetical protein	
c1	cds	4268362	4268847	+	BALIOE_21540		hypothetical protein	
c1	cds	4268897	4269925	-	BALIOE_21545		hypothetical protein	
c1	cds	4269929	4271155	-	BALIOE_21550		hypothetical protein	
c1	cds	4271343	4272941	+	BALIOE_21555		hypothetical protein	
c1	cds	4272923	4273681	-	BALIOE_21560		hypothetical protein	
c1	cds	4273698	4274528	-	BALIOE_21565		hypothetical protein	
c1	cds	4274573	4274899	-	BALIOE_21570		hypothetical protein	
c1	cds	4275089	4276594	+	BALIOE_21575		hypothetical protein	
c1	cds	4276809	4277411	-	BALIOE_21580		hypothetical protein	
c1	cds	4277411	4278403	-	BALIOE_21585		hypothetical protein	
c1	cds	4278429	4279937	-	BALIOE_21590		hypothetical protein	
c1	cds	4280062	4282509	-	BALIOE_21595		hypothetical protein	
c1	cds	4282528	4283961	-	BALIOE_21600		hypothetical protein	
c1	cds	4283961	4285256	-	BALIOE_21605		hypothetical protein	
c1	cds	4285274	4287247	-	BALIOE_21610		hypothetical protein	
c1	cds	4287244	4289430	-	BALIOE_21615		hypothetical protein	
c1	cds	4289703	4290806	-	BALIOE_21620		hypothetical protein	
c1	cds	4290998	4291591	+	BALIOE_21625		hypothetical protein	
c1	cds	4291637	4292932	-	BALIOE_21630		hypothetical protein	
c1	cds	4292991	4293965	-	BALIOE_21635		hypothetical protein	
c1	cds	4293969	4294358	-	BALIOE_21640		hypothetical protein	
c1	cds	4294355	4294963	-	BALIOE_21645		hypothetical protein	
c1	cds	4295103	4296443	-	BALIOE_21650		hypothetical protein	
c1	cds	4296447	4296974	-	BALIOE_21655		hypothetical protein	
c1	cds	4297113	4298108	-	BALIOE_21660		hypothetical protein	
c1	cds	4298332	4299027	-	BALIOE_21665		hypothetical protein	
c1	cds	4299150	4300187	-	BALIOE_21670		hypothetical protein	
c1	cds	4300521	4301009	+	BALIOE_21675		hypothetical protein	
c1	cds	4301220	4302131	+	BALIOE_21680		hypothetical protein	
c1	cds	4302080	4302496	-	BALIOE_21685		hypothetical protein	
c1	cds	4302865	4304610	-	BALIOE_21690		hypothetical protein	
c1	cds	4304730	4305170	+	BALIOE_21695		hypothetical protein	
c1	cds	4305157	4305900	-	BALIOE_21700		hypothetical protein	
c1	cds	4305897	4306967	-	BALIOE_21705		hypothetical protein	
c1	cds	4306969	4307814	-	BALIOE_21710		hypothetical protein	
c1	cds	4307811	4308698	-	BALIOE_21715		hypothetical protein	
c1	cds	4308796	4310112	-	BALIOE_21720		hypothetical protein	
c1	cds	4310472	4311218	-	BALIOE_21725		hypothetical protein	
c1	cds	4311337	4312050	-	BALIOE_21730		hypothetical protein	
c1	cds	4312052	4312819	-	BALIOE_21735		hypothetical protein	
c1	cds	4312816	4314093	-	BALIOE_21740		hypothetical protein	
c1	cds	4314090	4315016	-	BALIOE_21745		hypothetical protein	
c1	cds	4315064	4316173	-	BALIOE_21750		hypothetical protein	
c1	cds	4316597	4316980	+	BALIOE_21755		hypothetical protein	
c1	cds	4316977	4317504	-	BALIOE_21760		hypothetical protein	
c1	cds	4317511	4317777	-	BALIOE_21765		hypothetical protein	
c1	cds	4317927	4319030	-	BALIOE_21770		hypothetical protein	
c1	cds	4319301	4320155	-	BALIOE_21775		hypothetical protein	
c1	cds	4320400	4321458	-	BALIOE_21780		hypothetical protein	
c1	cds	4321451	4322119	-	BALIOE_21785		hypothetical protein	
c1	cds	4322122	4323618	-	BALIOE_21790		hypothetical protein	
c1	cds	4323768	4324364	+	BALIOE_21795		hypothetical protein	
c1	cds	4324354	4324623	+	BALIOE_21800		hypothetical protein	
c1	cds	4324626	4324985	-	BALIOE_21805		hypothetical protein	
c1	cds	4325126	4325752	+	BALIOE_21810		hypothetical protein	
c1	cds	4325826	4328024	+	BALIOE_21815		hypothetical protein	
c1	cds	4328126	4328371	-	BALIOE_21820		hypothetical protein	
c1	cds	4328592	4329257	+	BALIOE_21825		hypothetical protein	
c1	cds	4329330	4329887	+	BALIOE_21830		hypothetical protein	
c1	cds	4329891	4331141	-	BALIOE_21835		hypothetical protein	
c1	cds	4331240	4332289	+	BALIOE_21840		hypothetical protein	
c1	cds	4332681	4333058	+	BALIOE_21845		hypothetical protein	
c1	cds	4333127	4334185	+	BALIOE_21850		hypothetical protein	
c1	cds	4334226	4334948	+	BALIOE_21855		hypothetical protein	
c1	cds	4334945	4335766	+	BALIOE_21860		hypothetical protein	
c1	cds	4335741	4335998	+	BALIOE_21865		hypothetical protein	
c1	cds	4336010	4336261	+	BALIOE_21870		hypothetical protein	
c1	cds	4336266	4336847	+	BALIOE_21875		hypothetical protein	
c1	cds	4336844	4338205	+	BALIOE_21880		hypothetical protein	
c1	cds	4338192	4338545	+	BALIOE_21885		hypothetical protein	
c1	cds	4338536	4340212	+	BALIOE_21890		hypothetical protein	
c1	cds	4340216	4340638	+	BALIOE_21895		hypothetical protein	
c1	cds	4340635	4341240	+	BALIOE_21900		hypothetical protein	
c1	cds	4341209	4343527	+	BALIOE_21905		hypothetical protein	
c1	cds	4343524	4344108	+	BALIOE_21910		hypothetical protein	
c1	cds	4344110	4345279	+	BALIOE_21915		hypothetical protein	
c1	cds	4345276	4345740	+	BALIOE_21920		hypothetical protein	
c1	cds	4345740	4346471	+	BALIOE_21925		hypothetical protein	
c1	cds	4346468	4347697	+	BALIOE_21930		hypothetical protein	
c1	cds	4347699	4348286	+	BALIOE_21935		hypothetical protein	
c1	cds	4348397	4349971	+	BALIOE_21940		hypothetical protein	
c1	cds	4349971	4350915	+	BALIOE_21945		hypothetical protein	
c1	cds	4350912	4351745	+	BALIOE_21950		hypothetical protein	
c1	cds	4351745	4352509	+	BALIOE_21955		hypothetical protein	
c1	cds	4352506	4353312	+	BALIOE_21960		hypothetical protein	
c1	cds	4353318	4353719	+	BALIOE_21965		hypothetical protein	
c1	cds	4353918	4354664	+	BALIOE_21970		hypothetical protein	
c1	cds	4354689	4355162	+	BALIOE_21975		hypothetical protein	
c1	cds	4355159	4355440	+	BALIOE_21980		hypothetical protein	
c1	cds	4355517	4356875	+	BALIOE_21985		hypothetical protein	
c1	cds	4356868	4358376	+	BALIOE_21990		hypothetical protein	
c1	cds	4358366	4358635	+	BALIOE_21995		hypothetical protein	
c1	cds	4358667	4359527	+	BALIOE_22000		hypothetical protein	
c1	cds	4359577	4359936	-	BALIOE_22005		hypothetical protein	
c1	cds	4359933	4360208	-	BALIOE_22010		hypothetical protein	
c1	cds	4360281	4361405	-	BALIOE_22015		hypothetical protein	
c1	cds	4361405	4364140	-	BALIOE_22020		hypothetical protein	
c1	cds	4364137	4365204	-	BALIOE_22025		hypothetical protein	
c1	cds	4365570	4367192	-	BALIOE_22030		hypothetical protein	
c1	cds	4367454	4369064	-	BALIOE_22035		hypothetical protein	
c1	cds	4369448	4370500	+	BALIOE_22040		hypothetical protein	
c1	cds	4370527	4370682	-	BALIOE_22045		hypothetical protein	
c1	cds	4370818	4372020	-	BALIOE_22050		hypothetical protein	
c1	cds	4372252	4373751	+	BALIOE_22055		hypothetical protein	
c1	cds	4373822	4374157	-	BALIOE_22060		hypothetical protein	
c1	cds	4374548	4374982	+	BALIOE_22065		hypothetical protein	
c1	cds	4375299	4376768	+	BALIOE_22070		hypothetical protein	
c1	cds	4376817	4377569	-	BALIOE_22075		hypothetical protein	
c1	cds	4377577	4379619	-	BALIOE_22080		hypothetical protein	
c1	cds	4379822	4380664	+	BALIOE_22085		hypothetical protein	
c1	cds	4380736	4382088	+	BALIOE_22090		hypothetical protein	
c1	cds	4382253	4382426	+	BALIOE_22095		hypothetical protein	
c1	cds	4382969	4383322	+	BALIOE_22100		hypothetical protein	
c1	cds	4383376	4384665	+	BALIOE_22105		hypothetical protein	
c1	cds	4384678	4385103	+	BALIOE_22110		hypothetical protein	
c1	cds	4385730	4386845	+	BALIOE_22115		hypothetical protein	
c1	cds	4387199	4387765	+	BALIOE_22120		hypothetical protein	
c1	cds	4387921	4388451	+	BALIOE_22125		hypothetical protein	
c1	cds	4388512	4389540	-	BALIOE_22130		hypothetical protein	
c1	cds	4389589	4391571	-	BALIOE_22135		hypothetical protein	
c1	cds	4392254	4393168	+	BALIOE_22140		hypothetical protein	
c1	cds	4393188	4394525	+	BALIOE_22145		hypothetical protein	
c1	cds	4394538	4395032	+	BALIOE_22150		hypothetical protein	
c1	cds	4395032	4395655	+	BALIOE_22155		hypothetical protein	
c1	cds	4395740	4396696	+	BALIOE_22160		hypothetical protein	
c1	cds	4396693	4397463	+	BALIOE_22165		hypothetical protein	
c1	cds	4397515	4398090	-	BALIOE_22170		hypothetical protein	
c1	cds	4398226	4398564	-	BALIOE_22175		hypothetical protein	
c1	cds	4398668	4399000	-	BALIOE_22180		hypothetical protein	
c1	cds	4399255	4399827	+	BALIOE_22185		hypothetical protein	
c1	cds	4400626	4401153	+	BALIOE_22190		hypothetical protein	
c1	cds	4401154	4401432	-	BALIOE_22195		hypothetical protein	
c1	cds	4401492	4402649	+	BALIOE_22200		hypothetical protein	
c1	cds	4402674	4405787	+	BALIOE_22205		hypothetical protein	
c1	cds	4405724	4406005	-	BALIOE_22210		hypothetical protein	
c1	cds	4406150	4406878	-	BALIOE_22215		hypothetical protein	
c1	cds	4407246	4408070	-	BALIOE_22220		hypothetical protein	
c1	cds	4408441	4409841	-	BALIOE_22225		hypothetical protein	
c1	cds	4410052	4411449	-	BALIOE_22230		hypothetical protein	
c1	cds	4411854	4413503	+	BALIOE_22235		hypothetical protein	
c1	cds	4413554	4414156	-	BALIOE_22240		hypothetical protein	
c1	cds	4414604	4415575	+	BALIOE_22245		hypothetical protein	
c1	cds	4415624	4416637	+	BALIOE_22250		hypothetical protein	
c1	cds	4417049	4418371	+	BALIOE_22255		hypothetical protein	
c1	cds	4418553	4420613	-	BALIOE_22260		hypothetical protein	
c1	cds	4420683	4421450	-	BALIOE_22265		hypothetical protein	
c1	cds	4421682	4422611	+	BALIOE_22270		hypothetical protein	
c1	cds	4422707	4424203	-	BALIOE_22275		hypothetical protein	
c1	cds	4424424	4425710	-	BALIOE_22280		hypothetical protein	
c1	cds	4425893	4427842	-	BALIOE_22285		hypothetical protein	
c1	cds	4427963	4430971	-	BALIOE_22290		hypothetical protein	
c1	cds	4430926	4431426	-	BALIOE_22295		hypothetical protein	
c1	cds	4431408	4432514	-	BALIOE_22300		hypothetical protein	
c1	cds	4432521	4434842	-	BALIOE_22305		hypothetical protein	
c1	cds	4434889	4437507	-	BALIOE_22310		hypothetical protein	
c1	cds	4437504	4438040	-	BALIOE_22315		hypothetical protein	
c1	cds	4438059	4438256	-	BALIOE_22320		hypothetical protein	
c1	cds	4438268	4438456	-	BALIOE_22325		hypothetical protein	
c1	cds	4438741	4440300	+	BALIOE_22330		hypothetical protein	
c1	cds	4440297	4440488	+	BALIOE_22335		hypothetical protein	
c1	cds	4440485	4442164	+	BALIOE_22340		hypothetical protein	
c1	cds	4442251	4442358	-	BALIOE_22345		hypothetical protein	
c1	cds	4442834	4444105	+	BALIOE_22350		hypothetical protein	
c1	cds	4444135	4445139	-	BALIOE_22355		hypothetical protein	
c1	cds	4445136	4446119	-	BALIOE_22360		hypothetical protein	
c1	cds	4446130	4447032	-	BALIOE_22365		hypothetical protein	
c1	cds	4447042	4448061	-	BALIOE_22370		hypothetical protein	
c1	cds	4448212	4449819	-	BALIOE_22375		hypothetical protein	
c1	ncRNA	4450389	4450470	+	BALIOE_22380	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	tRNA	4450564	4450640	-	BALIOE_22385	Pro_trna	tRNA-Pro	SO:0000268
c1	cds	4450732	4452423	-	BALIOE_22390		hypothetical protein	
c1	cds	4452678	4453208	-	BALIOE_22395		hypothetical protein	
c1	cds	4453213	4454268	-	BALIOE_22400		hypothetical protein	
c1	cds	4454283	4455740	-	BALIOE_22405		hypothetical protein	
c1	cds	4455753	4456856	-	BALIOE_22410		hypothetical protein	
c1	cds	4456885	4457571	-	BALIOE_22415		hypothetical protein	
c1	cds	4457636	4458160	-	BALIOE_22420		hypothetical protein	
c1	cds	4458504	4459706	-	BALIOE_22425		hypothetical protein	
c1	cds	4459935	4460633	-	BALIOE_22430		hypothetical protein	
c1	cds	4460791	4461354	+	BALIOE_22435		hypothetical protein	
c1	cds	4461351	4461791	+	BALIOE_22440		hypothetical protein	
c1	cds	4461760	4464093	-	BALIOE_22445		hypothetical protein	
c1	cds	4464246	4464905	+	BALIOE_22450		hypothetical protein	
c1	cds	4465009	4465983	+	BALIOE_22455		hypothetical protein	
c1	cds	4466033	4466743	-	BALIOE_22460		hypothetical protein	
c1	cds	4467177	4467467	+	BALIOE_22465		hypothetical protein	
c1	cds	4467748	4467960	+	BALIOE_22470		hypothetical protein	
c1	cds	4468148	4468360	-	BALIOE_22475		hypothetical protein	
c1	cds	4468623	4470692	-	BALIOE_22480		hypothetical protein	
c1	cds	4470702	4471613	-	BALIOE_22485		hypothetical protein	
c1	cds	4471708	4472007	-	BALIOE_22490		hypothetical protein	
c1	cds	4472182	4473177	+	BALIOE_22495		hypothetical protein	
c1	cds	4473219	4473656	-	BALIOE_22500		hypothetical protein	
c1	cds	4473702	4474043	-	BALIOE_22505		hypothetical protein	
c1	cds	4474212	4475666	-	BALIOE_22510		hypothetical protein	
c1	cds	4475738	4477060	-	BALIOE_22515		hypothetical protein	
c1	cds	4477426	4478418	+	BALIOE_22520		hypothetical protein	
c1	cds	4478496	4480037	+	BALIOE_22525		hypothetical protein	
c1	cds	4480015	4481196	+	BALIOE_22530		hypothetical protein	
c1	cds	4481274	4482452	+	BALIOE_22535		hypothetical protein	
c1	cds	4482560	4483384	-	BALIOE_22540		hypothetical protein	
c1	cds	4483704	4485734	+	BALIOE_22545		hypothetical protein	
c1	cds	4485912	4487165	+	BALIOE_22550		hypothetical protein	
c1	cds	4487317	4487790	-	BALIOE_22555		hypothetical protein	
c1	cds	4488034	4488849	-	BALIOE_22560		hypothetical protein	
c1	cds	4489075	4490475	+	BALIOE_22565		hypothetical protein	
c1	cds	4490486	4492456	+	BALIOE_22570		hypothetical protein	
c1	cds	4492586	4493326	-	BALIOE_22575		hypothetical protein	
c1	cds	4493450	4494424	+	BALIOE_22580		hypothetical protein	
c1	cds	4494421	4495557	-	BALIOE_22585		hypothetical protein	
c1	cds	4495563	4495886	-	BALIOE_22590		hypothetical protein	
c1	cds	4496431	4497969	-	BALIOE_22595		hypothetical protein	
c1	cds	4498077	4499372	-	BALIOE_22600		hypothetical protein	
c1	cds	4499502	4500653	-	BALIOE_22605		hypothetical protein	
c1	cds	4500842	4502686	-	BALIOE_22610		hypothetical protein	
c1	cds	4502683	4504074	-	BALIOE_22615		hypothetical protein	
c1	cds	4504172	4504780	-	BALIOE_22620		hypothetical protein	
c1	cds	4505009	4509238	+	BALIOE_22625		hypothetical protein	
c1	cds	4509250	4509711	+	BALIOE_22630		hypothetical protein	
c1	cds	4511315	4512451	-	BALIOE_22635		hypothetical protein	
c1	cds	4512454	4512816	-	BALIOE_22640		hypothetical protein	
c1	cds	4513353	4515266	+	BALIOE_22645		hypothetical protein	
c1	cds	4515361	4516509	+	BALIOE_22650		hypothetical protein	
c1	cds	4516509	4517096	+	BALIOE_22655		hypothetical protein	
c1	cds	4517108	4517317	-	BALIOE_22660		hypothetical protein	
c1	cds	4517602	4517964	+	BALIOE_22665		hypothetical protein	
c1	cds	4518609	4519190	+	BALIOE_22670		hypothetical protein	
c1	cds	4519234	4524000	+	BALIOE_22675		hypothetical protein	
c1	cds	4524368	4526023	+	BALIOE_22680		hypothetical protein	
c1	cds	4526023	4526799	+	BALIOE_22685		hypothetical protein	
c1	cds	4526796	4527986	+	BALIOE_22690		hypothetical protein	
c1	cds	4528172	4528645	+	BALIOE_22695		hypothetical protein	
c1	cds	4528698	4529519	-	BALIOE_22700		hypothetical protein	
c1	cds	4529599	4530618	-	BALIOE_22705		hypothetical protein	
c1	cds	4530618	4531085	-	BALIOE_22710		hypothetical protein	
c1	cds	4531148	4531399	-	BALIOE_22715		hypothetical protein	
c1	cds	4531541	4531972	-	BALIOE_22720		hypothetical protein	
c1	cds	4532217	4533761	+	BALIOE_22725		hypothetical protein	
c1	cds	4533795	4535054	+	BALIOE_22730		hypothetical protein	
c1	cds	4535058	4536017	+	BALIOE_22735		hypothetical protein	
c1	cds	4536023	4537039	-	BALIOE_22740		hypothetical protein	
c1	cds	4537278	4538303	-	BALIOE_22745		hypothetical protein	
c1	cds	4538313	4539509	-	BALIOE_22750		hypothetical protein	
c1	cds	4539784	4540656	-	BALIOE_22755		hypothetical protein	
c1	cds	4540945	4541877	+	BALIOE_22760		hypothetical protein	
c1	cds	4541887	4542933	+	BALIOE_22765		hypothetical protein	
c1	cds	4542937	4543929	+	BALIOE_22770		hypothetical protein	
c1	cds	4543926	4545134	+	BALIOE_22775		hypothetical protein	
c1	cds	4545170	4546312	-	BALIOE_22780		hypothetical protein	
c1	cds	4546321	4547334	-	BALIOE_22785		hypothetical protein	
c1	cds	4547359	4548066	-	BALIOE_22790		hypothetical protein	
c1	cds	4548092	4549099	-	BALIOE_22795		hypothetical protein	
c1	cds	4549142	4549939	-	BALIOE_22800		hypothetical protein	
c1	cds	4549932	4551056	-	BALIOE_22805		hypothetical protein	
c1	cds	4551053	4552111	-	BALIOE_22810		hypothetical protein	
c1	cds	4552524	4553801	+	BALIOE_22815		hypothetical protein	
c1	cds	4553809	4554288	+	BALIOE_22820		hypothetical protein	
c1	cds	4554327	4555136	-	BALIOE_22825		hypothetical protein	
c1	cds	4555234	4555401	-	BALIOE_22830		hypothetical protein	
c1	cds	4555422	4555658	-	BALIOE_22835		hypothetical protein	
c1	cds	4555875	4556543	-	BALIOE_22840		hypothetical protein	
c1	cds	4556715	4557935	+	BALIOE_22845		hypothetical protein	
c1	cds	4557913	4558371	+	BALIOE_22850		hypothetical protein	
c1	cds	4558478	4559074	+	BALIOE_22855		hypothetical protein	
c1	cds	4559111	4559752	-	BALIOE_22860		hypothetical protein	
c1	cds	4559818	4560534	-	BALIOE_22865		hypothetical protein	
c1	cds	4560661	4561524	+	BALIOE_22870		hypothetical protein	
c1	cds	4561745	4562569	+	BALIOE_22875		hypothetical protein	
c1	cds	4562861	4563478	+	BALIOE_22880		hypothetical protein	
c1	cds	4563475	4565157	-	BALIOE_22885		hypothetical protein	
c1	cds	4565415	4566038	+	BALIOE_22890		hypothetical protein	
c1	cds	4566093	4566368	+	BALIOE_22895		hypothetical protein	
c1	cds	4566387	4568495	+	BALIOE_22900		hypothetical protein	
c1	cds	4568535	4569191	+	BALIOE_22905		hypothetical protein	
c1	cds	4569197	4571278	+	BALIOE_22910		hypothetical protein	
c1	cds	4571263	4572129	-	BALIOE_22915		hypothetical protein	
c1	cds	4572132	4573337	-	BALIOE_22920		hypothetical protein	
c1	cds	4573617	4575008	+	BALIOE_22925		hypothetical protein	
c1	cds	4575129	4576838	+	BALIOE_22930		hypothetical protein	
c1	cds	4576891	4579209	-	BALIOE_22935		hypothetical protein	
c1	cds	4579219	4580601	-	BALIOE_22940		hypothetical protein	
c1	tRNA	4580894	4580988	+	BALIOE_22945	SeC_trna	tRNA-SeC	SO:0005857
c1	cds	4581184	4582365	+	BALIOE_22950		hypothetical protein	
c1	cds	4582500	4582814	+	BALIOE_22955		hypothetical protein	
c1	cds	4582934	4583680	+	BALIOE_22960		hypothetical protein	
c1	cds	4583931	4584305	+	BALIOE_22965		hypothetical protein	
c1	cds	4584302	4584793	+	BALIOE_22970		hypothetical protein	
c1	cds	4584805	4585002	+	BALIOE_22975		hypothetical protein	
c1	cds	4585087	4585428	+	BALIOE_22980		hypothetical protein	
c1	cds	4585489	4585632	+	BALIOE_22985		hypothetical protein	
c1	cds	4586205	4586585	+	BALIOE_22990		hypothetical protein	
c1	cds	4586582	4586929	+	BALIOE_22995		hypothetical protein	
c1	cds	4586979	4588517	+	BALIOE_23000		hypothetical protein	
c1	cds	4589382	4590128	-	BALIOE_23005		hypothetical protein	
c1	cds	4590213	4590491	-	BALIOE_23010		hypothetical protein	
c1	cds	4590497	4590718	-	BALIOE_23015		hypothetical protein	
c1	cds	4590754	4591161	-	BALIOE_23020		hypothetical protein	
c1	cds	4591168	4592106	-	BALIOE_23025		hypothetical protein	
c1	cds	4592127	4593251	-	BALIOE_23030		hypothetical protein	
c1	cds	4593264	4593842	-	BALIOE_23035		hypothetical protein	
c1	cds	4593901	4594956	-	BALIOE_23040		hypothetical protein	
c1	cds	4595099	4596319	+	BALIOE_23045		hypothetical protein	
c1	cds	4596583	4599387	-	BALIOE_23050		hypothetical protein	
c1	cds	4599447	4599917	-	BALIOE_23055		hypothetical protein	
c1	cds	4600055	4601731	-	BALIOE_23060		hypothetical protein	
c1	cds	4602155	4602766	-	BALIOE_23065		hypothetical protein	
c1	cds	4603032	4603415	+	BALIOE_23070		hypothetical protein	
c1	cds	4603613	4604119	-	BALIOE_23075		hypothetical protein	
c1	cds	4604150	4605067	-	BALIOE_23080		hypothetical protein	
c1	cds	4605439	4605759	-	BALIOE_23085		hypothetical protein	
c1	cds	4605819	4607159	-	BALIOE_23090		hypothetical protein	
c1	cds	4607143	4609170	-	BALIOE_23095		hypothetical protein	
c1	cds	4609167	4609520	-	BALIOE_23100		hypothetical protein	
c1	cds	4609705	4610004	+	BALIOE_23105		hypothetical protein	
c1	cds	4610088	4610465	+	BALIOE_23110		hypothetical protein	
c1	cds	4610468	4611040	+	BALIOE_23115		hypothetical protein	
c1	cds	4611046	4611501	+	BALIOE_23120		hypothetical protein	
c1	cds	4611501	4613039	+	BALIOE_23125		hypothetical protein	
c1	cds	4613053	4613508	+	BALIOE_23130		hypothetical protein	
c1	cds	4613892	4614305	-	BALIOE_23135		hypothetical protein	
c1	cds	4614360	4614731	-	BALIOE_23140		hypothetical protein	
c1	cds	4614927	4615385	+	BALIOE_23145		hypothetical protein	
c1	cds	4615382	4616419	-	BALIOE_23150		hypothetical protein	
c1	cds	4616412	4617188	-	BALIOE_23155		hypothetical protein	
c1	cds	4617188	4617457	-	BALIOE_23160		hypothetical protein	
c1	cds	4617457	4618110	-	BALIOE_23165		hypothetical protein	
c1	cds	4618115	4618768	-	BALIOE_23170		hypothetical protein	
c1	cds	4618755	4619354	-	BALIOE_23175		hypothetical protein	
c1	cds	4619351	4619665	-	BALIOE_23180		hypothetical protein	
c1	cds	4619678	4619896	-	BALIOE_23185		hypothetical protein	
c1	cds	4619911	4620282	-	BALIOE_23190		hypothetical protein	
c1	cds	4621596	4622741	+	BALIOE_23195		hypothetical protein	
c1	cds	4622869	4623687	+	BALIOE_23200		hypothetical protein	
c1	cds	4624081	4624188	-	BALIOE_23205		hypothetical protein	
c1	cds	4624707	4625630	+	BALIOE_23210		hypothetical protein	
c1	cds	4625634	4626452	-	BALIOE_23215		hypothetical protein	
c1	cds	4626674	4626967	+	BALIOE_23220		hypothetical protein	
c1	cds	4627008	4628246	-	BALIOE_23225		hypothetical protein	
c1	cds	4628432	4628785	+	BALIOE_23230		hypothetical protein	
c1	cds	4628769	4629092	+	BALIOE_23235		hypothetical protein	
c1	cds	4629208	4629660	-	BALIOE_23240		hypothetical protein	
c1	cds	4629713	4630078	-	BALIOE_23245		hypothetical protein	
c1	cds	4630051	4631046	-	BALIOE_23250		hypothetical protein	
c1	cds	4631221	4632987	+	BALIOE_23255		hypothetical protein	
c1	cds	4633033	4634424	-	BALIOE_23260		hypothetical protein	
c1	cds	4634562	4635881	-	BALIOE_23265		hypothetical protein	
c1	cds	4635891	4637393	-	BALIOE_23270		hypothetical protein	
c1	cds	4637393	4637983	-	BALIOE_23275		hypothetical protein	
c1	cds	4638145	4639248	-	BALIOE_23280		hypothetical protein	
c1	cds	4639264	4639578	-	BALIOE_23285		hypothetical protein	
c1	cds	4639856	4640338	-	BALIOE_23290		hypothetical protein	
c1	cds	4640486	4641139	-	BALIOE_23295		hypothetical protein	
c1	cds	4641402	4641692	-	BALIOE_23300		hypothetical protein	
c1	cds	4641696	4643384	-	BALIOE_23305		hypothetical protein	
c1	cds	4644153	4644242	+	BALIOE_23310		hypothetical protein	
c1	cds	4644522	4645706	+	BALIOE_23315		hypothetical protein	
c1	cds	4645714	4646211	-	BALIOE_23320		hypothetical protein	
c1	cds	4646208	4646570	-	BALIOE_23325		hypothetical protein	
c1	cds	4646560	4646907	-	BALIOE_23330		hypothetical protein	
c1	cds	4647016	4647465	+	BALIOE_23335		hypothetical protein	
c1	cds	4647512	4649005	-	BALIOE_23340		hypothetical protein	
c1	cds	4649002	4650717	-	BALIOE_23345		hypothetical protein	
c1	cds	4650884	4651777	+	BALIOE_23350		hypothetical protein	
c1	cds	4651774	4653096	-	BALIOE_23355		hypothetical protein	
c1	cds	4653096	4654712	-	BALIOE_23360		hypothetical protein	
c1	cds	4655008	4655724	+	BALIOE_23365		hypothetical protein	
c1	cds	4655721	4657382	-	BALIOE_23370		hypothetical protein	
c1	cds	4657578	4658006	-	BALIOE_23375		hypothetical protein	
c1	cds	4658118	4658531	-	BALIOE_23380		hypothetical protein	
c1	cds	4658909	4659169	+	BALIOE_23385		hypothetical protein	
c1	cds	4659171	4660385	-	BALIOE_23390		hypothetical protein	
c1	cds	4660486	4661550	+	BALIOE_23395		hypothetical protein	
c1	cds	4661796	4662452	+	BALIOE_23400		hypothetical protein	
c1	cds	4662498	4663310	-	BALIOE_23405		hypothetical protein	
c1	cds	4663425	4663823	-	BALIOE_23410		hypothetical protein	
c1	cds	4664063	4666477	-	BALIOE_23415		hypothetical protein	
c1	cds	4666506	4667579	-	BALIOE_23420		hypothetical protein	
c1	cds	4667579	4668679	-	BALIOE_23425		hypothetical protein	
c1	cds	4668684	4670087	-	BALIOE_23430	dnaA	Chromosomal replication initiator protein DnaA	COG:COG0593, COG:L, GO:0003688, GO:0005524, GO:0005737, GO:0006270, GO:0006275, RefSeq:WP_000059116.1, SO:0001217, UniParc:UPI0000129520, UniRef:UniRef100_Q8XBZ3, UniRef:UniRef50_Q9KVX6, UniRef:UniRef90_Q6CYR4
c1	cds	4670694	4670834	+	BALIOE_23435		hypothetical protein	
c1	cds	4670884	4671210	+	BALIOE_23440		hypothetical protein	
c1	cds	4671434	4673080	+	BALIOE_23445		hypothetical protein	
c1	cds	4673186	4674550	+	BALIOE_23450		hypothetical protein	
c1	cds	4674700	4674930	-	BALIOE_23455		hypothetical protein	
c1	cds	4674881	4676869	-	BALIOE_23460		hypothetical protein	
c1	cds	4677564	4678979	+	BALIOE_23465		hypothetical protein	
c1	cds	4679070	4680317	+	BALIOE_23470		hypothetical protein	
c1	cds	4680449	4681624	+	BALIOE_23475		hypothetical protein	
c1	cds	4681599	4682558	+	BALIOE_23480		hypothetical protein	
c1	cds	4682715	4683464	+	BALIOE_23485		hypothetical protein	
c1	cds	4683486	4684052	+	BALIOE_23490		hypothetical protein	
c1	cds	4684106	4685443	-	BALIOE_23495		hypothetical protein	
c1	cds	4685609	4686274	+	BALIOE_23500		hypothetical protein	
c1	cds	4686411	4688819	-	BALIOE_23505		hypothetical protein	
c1	cds	4689120	4689791	+	BALIOE_23510		hypothetical protein	
c1	cds	4689882	4690307	+	BALIOE_23515		hypothetical protein	
c1	cds	4690776	4693037	-	BALIOE_23520		hypothetical protein	
c1	cds	4693127	4693261	-	BALIOE_23525		hypothetical protein	
c1	cds	4693686	4694411	-	BALIOE_23530		hypothetical protein	
c1	cds	4694426	4695199	-	BALIOE_23535		hypothetical protein	
c1	cds	4695382	4696272	-	BALIOE_23540		hypothetical protein	
c1	cds	4696272	4697231	-	BALIOE_23545		hypothetical protein	
c1	cds	4697318	4698358	-	BALIOE_23550		hypothetical protein	
c1	cds	4698570	4699652	-	BALIOE_23555		hypothetical protein	
c1	cds	4699680	4700750	-	BALIOE_23560		hypothetical protein	
c1	cds	4700762	4703296	-	BALIOE_23565		hypothetical protein	
c1	cds	4703620	4704003	-	BALIOE_23570		hypothetical protein	
c1	cds	4704107	4704709	-	BALIOE_23575		hypothetical protein	
c1	cds	4705409	4707238	-	BALIOE_23580		hypothetical protein	
c1	cds	4707400	4708770	-	BALIOE_23585		hypothetical protein	
c1	cds	4709122	4709541	-	BALIOE_23590		hypothetical protein	
c1	cds	4709562	4710944	-	BALIOE_23595		hypothetical protein	
c1	cds	4710971	4711834	-	BALIOE_23600		hypothetical protein	
c1	cds	4711885	4713426	-	BALIOE_23605		hypothetical protein	
c1	cds	4713439	4713972	-	BALIOE_23610		hypothetical protein	
c1	cds	4713987	4714457	-	BALIOE_23615		hypothetical protein	
c1	cds	4714519	4714758	-	BALIOE_23620		hypothetical protein	
c1	cds	4714805	4715620	-	BALIOE_23625		hypothetical protein	
c1	cds	4715629	4716009	-	BALIOE_23630		hypothetical protein	
c1	cds	4716626	4717249	-	BALIOE_23635		hypothetical protein	
c1	cds	4717313	4719202	-	BALIOE_23640		hypothetical protein	
c1	cds	4719581	4720024	-	BALIOE_23645		hypothetical protein	
c1	cds	4720114	4720572	-	BALIOE_23650		hypothetical protein	
c1	cds	4720724	4721716	+	BALIOE_23655		hypothetical protein	
c1	cds	4721721	4723172	-	BALIOE_23660		hypothetical protein	
c1	cds	4723166	4724662	-	BALIOE_23665		hypothetical protein	
c1	cds	4724885	4726753	+	BALIOE_23670		hypothetical protein	
c1	cds	4726920	4727339	+	BALIOE_23675		hypothetical protein	
c1	cds	4727347	4728852	+	BALIOE_23680		hypothetical protein	
c1	cds	4728857	4729822	+	BALIOE_23685		hypothetical protein	
c1	cds	4729847	4730737	+	BALIOE_23690		hypothetical protein	
c1	cds	4730863	4731792	+	BALIOE_23695		hypothetical protein	
c1	cds	4731796	4732788	+	BALIOE_23700		hypothetical protein	
c1	cds	4732754	4734181	-	BALIOE_23705		hypothetical protein	
c1	cds	4734204	4734896	-	BALIOE_23710		hypothetical protein	
c1	rRNA	4735377	4736918	+	BALIOE_23715	16S_rrna	16S ribosomal RNA	GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
c1	tRNA	4737004	4737079	+	BALIOE_23720	Glu_trna	tRNA-Glu	SO:0000259
c1	tRNA	4740442	4740518	+	BALIOE_23725	Asp_trna	tRNA-Asp	SO:0000256
c1	tRNA	4740527	4740602	+	BALIOE_23730	Trp_trna	tRNA-Trp	SO:0000271
c1	cds	4740698	4741537	-	BALIOE_23735		hypothetical protein	
c1	cds	4741656	4741994	+	BALIOE_23740		hypothetical protein	
c1	cds	4742019	4743539	-	BALIOE_23745		hypothetical protein	
c1	cds	4743694	4743783	+	BALIOE_23750		hypothetical protein	
c1	cds	4744130	4745776	+	BALIOE_23755		hypothetical protein	
c1	cds	4745773	4746036	+	BALIOE_23760		hypothetical protein	
c1	cds	4746056	4746985	+	BALIOE_23765		hypothetical protein	
c1	cds	4747050	4748900	+	BALIOE_23770		hypothetical protein	
c1	cds	4748903	4750447	+	BALIOE_23775		hypothetical protein	
c1	cds	4750499	4751392	-	BALIOE_23780		hypothetical protein	
c1	cds	4751542	4753017	+	BALIOE_23785		hypothetical protein	
c1	cds	4753063	4753344	-	BALIOE_23790		hypothetical protein	
c1	cds	4753543	4753992	-	BALIOE_23795		hypothetical protein	
c1	cds	4754209	4756230	+	BALIOE_23800		hypothetical protein	
c1	cds	4756277	4757761	-	BALIOE_23805		hypothetical protein	
c1	cds	4757897	4759162	-	BALIOE_23810		hypothetical protein	
c1	cds	4759293	4759622	+	BALIOE_23815		hypothetical protein	
c1	cds	4759949	4761208	+	BALIOE_23820		hypothetical protein	
c1	cds	4761218	4761436	+	BALIOE_23825		hypothetical protein	
c1	cds	4761448	4762551	+	BALIOE_23830		hypothetical protein	
c1	cds	4762563	4763609	+	BALIOE_23835		hypothetical protein	
c1	cds	4763665	4764795	+	BALIOE_23840		hypothetical protein	
c1	cds	4764792	4766054	+	BALIOE_23845		hypothetical protein	
c1	cds	4766054	4767121	+	BALIOE_23850		hypothetical protein	
c1	cds	4767140	4768021	+	BALIOE_23855		hypothetical protein	
c1	cds	4767999	4768673	+	BALIOE_23860		hypothetical protein	
c1	cds	4768678	4769808	+	BALIOE_23865		hypothetical protein	
c1	cds	4769810	4771060	+	BALIOE_23870		hypothetical protein	
c1	cds	4771057	4772136	+	BALIOE_23875		hypothetical protein	
c1	cds	4772133	4773485	+	BALIOE_23880		hypothetical protein	
c1	cds	4773488	4774228	+	BALIOE_23885		hypothetical protein	
c1	cds	4774419	4775804	+	BALIOE_23890		hypothetical protein	
c1	tRNA	4775907	4775983	+	BALIOE_23895	Arg_trna	tRNA-Arg	SO:0001036
c1	tRNA	4776042	4776117	+	BALIOE_23900	His_trna	tRNA-His	SO:0000262
c1	tRNA	4776138	4776224	+	BALIOE_23905	Leu_trna	tRNA-Leu	SO:0000264
c1	tRNA	4776273	4776343	+	BALIOE_23910	Pro_trna	(pseudo) tRNA-Pro	SO:0000268
c1	tRNA	4776364	4776450	+	BALIOE_23915	Leu_trna	tRNA-Leu	SO:0000264
c1	tRNA	4776493	4776569	+	BALIOE_23920	Pro_trna	tRNA-Pro	SO:0000268
c1	cds	4776716	4777951	+	BALIOE_23925		hypothetical protein	
c1	cds	4778119	4779774	-	BALIOE_23930		hypothetical protein	
c1	cds	4780453	4781649	-	BALIOE_23935		hypothetical protein	
c1	cds	4781652	4782851	-	BALIOE_23940		hypothetical protein	
c1	cds	4782873	4783613	-	BALIOE_23945		hypothetical protein	
c1	cds	4783610	4784572	-	BALIOE_23950		hypothetical protein	
c1	cds	4784938	4787484	+	BALIOE_23955		hypothetical protein	
c1	cds	4787524	4787844	-	BALIOE_23960		hypothetical protein	
c1	cds	4788307	4788510	+	BALIOE_23965		hypothetical protein	
c1	cds	4788547	4789371	+	BALIOE_23970		hypothetical protein	
c1	cds	4789368	4790075	+	BALIOE_23975		hypothetical protein	
c1	cds	4790072	4790968	+	BALIOE_23980		hypothetical protein	
c1	cds	4790968	4791684	+	BALIOE_23985		hypothetical protein	
c1	cds	4791768	4793930	+	BALIOE_23990		hypothetical protein	
c1	cds	4793975	4794877	-	BALIOE_23995		hypothetical protein	
c1	cds	4794960	4795724	-	BALIOE_24000		hypothetical protein	
c1	cds	4796094	4797044	+	BALIOE_24005		hypothetical protein	
c1	cds	4797086	4797577	-	BALIOE_24010		hypothetical protein	
c1	cds	4797574	4798422	-	BALIOE_24015		hypothetical protein	
c1	cds	4799382	4799681	+	BALIOE_24020		hypothetical protein	
c1	cds	4799728	4800615	-	BALIOE_24025		hypothetical protein	
c1	cds	4800667	4801134	-	BALIOE_24030		hypothetical protein	
c1	cds	4801299	4802168	+	BALIOE_24035		hypothetical protein	
c1	cds	4802295	4804130	+	BALIOE_24040		hypothetical protein	
c1	cds	4804194	4804814	+	BALIOE_24045		hypothetical protein	
c1	cds	4804876	4805496	-	BALIOE_24050		hypothetical protein	
c1	cds	4805607	4806629	+	BALIOE_24055		hypothetical protein	
c1	cds	4806637	4807437	+	BALIOE_24060		hypothetical protein	
c1	cds	4807513	4808412	+	BALIOE_24065		hypothetical protein	
c1	cds	4808300	4809253	-	BALIOE_24070		hypothetical protein	
c1	cds	4809489	4811750	+	BALIOE_24075		hypothetical protein	
c1	cds	4811790	4812605	-	BALIOE_24080		hypothetical protein	
c1	cds	4812867	4813628	+	BALIOE_24085		hypothetical protein	
c1	cds	4813769	4815196	+	BALIOE_24090		hypothetical protein	
c1	cds	4815291	4816046	+	BALIOE_24095		hypothetical protein	
c1	cds	4816060	4816665	+	BALIOE_24100		hypothetical protein	
c1	cds	4816662	4818302	+	BALIOE_24105		hypothetical protein	
c1	cds	4818381	4818650	+	BALIOE_24110		hypothetical protein	
c1	cds	4818654	4819169	+	BALIOE_24115		hypothetical protein	
c1	cds	4819172	4819948	+	BALIOE_24120		hypothetical protein	
c1	cds	4819990	4820772	+	BALIOE_24125		hypothetical protein	
c1	cds	4820769	4821257	-	BALIOE_24130		hypothetical protein	
c1	cds	4821424	4822917	+	BALIOE_24135		hypothetical protein	
c1	cds	4822963	4823664	+	BALIOE_24140		hypothetical protein	
c1	cds	4823856	4825019	-	BALIOE_24145		hypothetical protein	
c1	cds	4825029	4827218	-	BALIOE_24150		hypothetical protein	
c1	cds	4827408	4828739	+	BALIOE_24155		hypothetical protein	
c1	cds	4828739	4829353	+	BALIOE_24160		hypothetical protein	
c1	cds	4829392	4830843	+	BALIOE_24165		hypothetical protein	
c1	cds	4830855	4831400	+	BALIOE_24170		hypothetical protein	
c1	rRNA	4831781	4833322	+	BALIOE_24175	16S_rrna	16S ribosomal RNA	GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
c1	tRNA	4833391	4833467	+	BALIOE_24180	Ile_trna	tRNA-Ile	SO:0000263
c1	tRNA	4833510	4833585	+	BALIOE_24185	Ala_trna	tRNA-Ala	SO:0000254
c1	cds	4836985	4837512	-	BALIOE_24190		hypothetical protein	
c1	cds	4837494	4838078	-	BALIOE_24195		hypothetical protein	
c1	cds	4838148	4838417	+	BALIOE_24200		hypothetical protein	
c1	cds	4838494	4839480	+	BALIOE_24205		hypothetical protein	
c1	cds	4839497	4840123	+	BALIOE_24210		hypothetical protein	
c1	cds	4840278	4841708	+	BALIOE_24215		hypothetical protein	
c1	cds	4841749	4842681	-	BALIOE_24220		hypothetical protein	
c1	cds	4842801	4842986	-	BALIOE_24225		hypothetical protein	
c1	cds	4843045	4845831	+	BALIOE_24230		hypothetical protein	
c1	cds	4846213	4846845	-	BALIOE_24235		hypothetical protein	
c1	cds	4847427	4847933	+	BALIOE_24240		hypothetical protein	
c1	cds	4848122	4849495	+	BALIOE_24245		hypothetical protein	
c1	cds	4849685	4849795	-	BALIOE_24250		hypothetical protein	
c1	cds	4849907	4851316	-	BALIOE_24255		hypothetical protein	
c1	cds	4851328	4852377	-	BALIOE_24260		hypothetical protein	
c1	cds	4852551	4853960	-	BALIOE_24265		hypothetical protein	
c1	cds	4854333	4856156	+	BALIOE_24270		hypothetical protein	
c1	cds	4856373	4857083	+	BALIOE_24275		hypothetical protein	
c1	cds	4857091	4858071	+	BALIOE_24280		hypothetical protein	
c1	cds	4858173	4859438	+	BALIOE_24285		hypothetical protein	
c1	cds	4859529	4860287	-	BALIOE_24290		hypothetical protein	
c1	cds	4860288	4861691	-	BALIOE_24295		hypothetical protein	
c1	cds	4861734	4863119	-	BALIOE_24300		hypothetical protein	
c1	cds	4863165	4865201	-	BALIOE_24305		hypothetical protein	
c1	cds	4865309	4866184	-	BALIOE_24310		hypothetical protein	
c1	cds	4866245	4867147	-	BALIOE_24315		hypothetical protein	
c1	cds	4867214	4868455	-	BALIOE_24320		hypothetical protein	
c1	cds	4868471	4869349	-	BALIOE_24325		hypothetical protein	
c1	cds	4869373	4870269	-	BALIOE_24330		hypothetical protein	
c1	cds	4870437	4871333	+	BALIOE_24335		hypothetical protein	
c1	cds	4871367	4872152	+	BALIOE_24340		hypothetical protein	
c1	cds	4872251	4872850	+	BALIOE_24345		hypothetical protein	
c1	cds	4872844	4873716	+	BALIOE_24350		hypothetical protein	
c1	cds	4873713	4874150	+	BALIOE_24355		hypothetical protein	
c1	cds	4874195	4875136	+	BALIOE_24360		hypothetical protein	
c1	cds	4875547	4876440	+	BALIOE_24365		hypothetical protein	
c1	cds	4876447	4877361	+	BALIOE_24370		hypothetical protein	
c1	cds	4878055	4878273	+	BALIOE_24375		hypothetical protein	
c1	cds	4878490	4878732	+	BALIOE_24380		hypothetical protein	
c1	cds	4878732	4878914	+	BALIOE_24385		hypothetical protein	
c1	cds	4879062	4879991	-	BALIOE_24390		hypothetical protein	
c1	cds	4879988	4880623	-	BALIOE_24395		hypothetical protein	
c1	cds	4880620	4881522	-	BALIOE_24400		hypothetical protein	
c1	cds	4881535	4883949	-	BALIOE_24405		hypothetical protein	
c1	cds	4883998	4884585	-	BALIOE_24410		hypothetical protein	
c1	cds	4884779	4885612	+	BALIOE_24415		hypothetical protein	
c1	cds	4885765	4886820	+	BALIOE_24420		hypothetical protein	
c1	cds	4886870	4888618	-	BALIOE_24425		hypothetical protein	
c1	cds	4888618	4889688	-	BALIOE_24430		hypothetical protein	
c1	cds	4889678	4891117	-	BALIOE_24435		hypothetical protein	
c1	cds	4891128	4891574	-	BALIOE_24440		hypothetical protein	
c1	cds	4892052	4893446	+	BALIOE_24445		hypothetical protein	
c1	cds	4893487	4893801	-	BALIOE_24450		hypothetical protein	
c1	cds	4893811	4894635	-	BALIOE_24455		hypothetical protein	
c1	ncRNA	4894682	4894752	+	BALIOE_24460	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	4894810	4896069	-	BALIOE_24465		hypothetical protein	
c1	cds	4896066	4897535	-	BALIOE_24470		hypothetical protein	
c1	cds	4897823	4898659	+	BALIOE_24475		hypothetical protein	
c1	cds	4898643	4899581	+	BALIOE_24480		hypothetical protein	
c1	cds	4899578	4900369	-	BALIOE_24485		hypothetical protein	
c1	cds	4900460	4900612	-	BALIOE_24490		hypothetical protein	
c1	cds	4900897	4901517	+	BALIOE_24495		hypothetical protein	
c1	cds	4901777	4902760	+	BALIOE_24500		hypothetical protein	
c1	cds	4902909	4903583	+	BALIOE_24505		hypothetical protein	
c1	ncRNA	4903597	4903674	-	BALIOE_24510	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	4903689	4905062	-	BALIOE_24515		hypothetical protein	
c1	cds	4905059	4905757	-	BALIOE_24520		hypothetical protein	
c1	cds	4905907	4906407	+	BALIOE_24525		hypothetical protein	
c1	cds	4906556	4907458	+	BALIOE_24530		hypothetical protein	
c1	cds	4907404	4907508	-	BALIOE_24535		hypothetical protein	
c1	cds	4907639	4908601	+	BALIOE_24540		hypothetical protein	
c1	cds	4908920	4909909	+	BALIOE_24545		hypothetical protein	
c1	cds	4910016	4910771	+	BALIOE_24550		hypothetical protein	
c1	cds	4910826	4911593	-	BALIOE_24555		hypothetical protein	
c1	cds	4911701	4912300	-	BALIOE_24560		hypothetical protein	
c1	cds	4912401	4912841	+	BALIOE_24565		hypothetical protein	
c1	cds	4913053	4913352	+	BALIOE_24570		hypothetical protein	
c1	cds	4913379	4913807	+	BALIOE_24575		hypothetical protein	
c1	cds	4913812	4914558	-	BALIOE_24580		hypothetical protein	
c1	cds	4914655	4915665	-	BALIOE_24585		hypothetical protein	
c1	cds	4915895	4917403	-	BALIOE_24590		hypothetical protein	
c1	cds	4917426	4918271	-	BALIOE_24595		hypothetical protein	
c1	cds	4918703	4918942	+	BALIOE_24600		hypothetical protein	
c1	cds	4918981	4919607	-	BALIOE_24605		hypothetical protein	
c1	cds	4919730	4920404	-	BALIOE_24610		hypothetical protein	
c1	cds	4920464	4920949	-	BALIOE_24615		hypothetical protein	
c1	cds	4921042	4921968	-	BALIOE_24620		hypothetical protein	
c1	cds	4922035	4923366	-	BALIOE_24625		hypothetical protein	
c1	cds	4923376	4923906	-	BALIOE_24630		hypothetical protein	
c1	cds	4923999	4924853	-	BALIOE_24635		hypothetical protein	
c1	cds	4925050	4926075	-	BALIOE_24640		hypothetical protein	
c1	cds	4926231	4928429	-	BALIOE_24645		hypothetical protein	
c1	cds	4928632	4928844	+	BALIOE_24650		hypothetical protein	
c1	cds	4929004	4933188	+	BALIOE_24655		hypothetical protein	
c1	cds	4933190	4933426	+	BALIOE_24660		hypothetical protein	
c1	cds	4933479	4933757	+	BALIOE_24665		hypothetical protein	
c1	cds	4934002	4934274	-	BALIOE_24670		hypothetical protein	
c1	cds	4934419	4935027	-	BALIOE_24675		hypothetical protein	
c1	cds	4935087	4935404	-	BALIOE_24680		hypothetical protein	
c1	cds	4935681	4936841	+	BALIOE_24685		hypothetical protein	
c1	cds	4936844	4939276	+	BALIOE_24690		hypothetical protein	
c1	cds	4939625	4940515	+	BALIOE_24695		hypothetical protein	
c1	cds	4940844	4943024	+	BALIOE_24700		hypothetical protein	
c1	cds	4943118	4944023	+	BALIOE_24705		hypothetical protein	
c1	cds	4944050	4944667	-	BALIOE_24710		hypothetical protein	
c1	cds	4944941	4946044	-	BALIOE_24715		hypothetical protein	
c1	cds	4946055	4946717	-	BALIOE_24720		hypothetical protein	
c1	cds	4946729	4949230	-	BALIOE_24725		hypothetical protein	
c1	cds	4949539	4950279	+	BALIOE_24730		hypothetical protein	
c1	cds	4950301	4950618	+	BALIOE_24735		hypothetical protein	
c1	cds	4950633	4950953	+	BALIOE_24740		hypothetical protein	
c1	cds	4951004	4953301	+	BALIOE_24745		hypothetical protein	
c1	cds	4953267	4954145	+	BALIOE_24750		hypothetical protein	
c1	cds	4954147	4954488	+	BALIOE_24755		hypothetical protein	
c1	cds	4954475	4955326	-	BALIOE_24760		hypothetical protein	
c1	cds	4955541	4957274	-	BALIOE_24765		hypothetical protein	
c1	cds	4957457	4960108	-	BALIOE_24770		hypothetical protein	
c1	cds	4960460	4961611	-	BALIOE_24775		hypothetical protein	
c1	cds	4961765	4962769	+	BALIOE_24780		hypothetical protein	
c1	cds	4962780	4963553	+	BALIOE_24785		hypothetical protein	
c1	cds	4963614	4964987	+	BALIOE_24790		hypothetical protein	
c1	cds	4965254	4966171	+	BALIOE_24795		hypothetical protein	
c1	cds	4966154	4967554	-	BALIOE_24800		hypothetical protein	
c1	cds	4967884	4969050	+	BALIOE_24805		hypothetical protein	
c1	cds	4969093	4970409	+	BALIOE_24810		hypothetical protein	
c1	cds	4970459	4971163	+	BALIOE_24815		hypothetical protein	
c1	cds	4971163	4971522	+	BALIOE_24820		hypothetical protein	
c1	cds	4971562	4972662	-	BALIOE_24825		hypothetical protein	
c1	cds	4973031	4974875	+	BALIOE_24830		hypothetical protein	
c1	cds	4974820	4975677	+	BALIOE_24835		hypothetical protein	
c1	rRNA	4976054	4977595	+	BALIOE_24840	16S_rrna	16S ribosomal RNA	GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
c1	tRNA	4977681	4977756	+	BALIOE_24845	Glu_trna	tRNA-Glu	SO:0000259
c1	cds	4981201	4982229	+	BALIOE_24850		hypothetical protein	
c1	cds	4982226	4983191	+	BALIOE_24855		hypothetical protein	
c1	cds	4983220	4984146	-	BALIOE_24860		hypothetical protein	
c1	tRNA	4984532	4984607	+	BALIOE_24865	Thr_trna	tRNA-Thr	SO:0000270
c1	tRNA	4984616	4984700	+	BALIOE_24870	Tyr_trna	tRNA-Tyr	SO:0000272
c1	tRNA	4984817	4984891	+	BALIOE_24875	Gly_trna	tRNA-Gly	SO:0000260
c1	tRNA	4984898	4984973	+	BALIOE_24880	Thr_trna	tRNA-Thr	SO:0000270
c1	cds	4985088	4986272	+	BALIOE_24885		hypothetical protein	
c1	cds	4986502	4986885	+	BALIOE_24890		hypothetical protein	
c1	cds	4986887	4987432	+	BALIOE_24895		hypothetical protein	
c1	cds	4987591	4988019	+	BALIOE_24900		hypothetical protein	
c1	cds	4988023	4988727	+	BALIOE_24905		hypothetical protein	
c1	cds	4989019	4989516	+	BALIOE_24910		hypothetical protein	
c1	cds	4989583	4989948	+	BALIOE_24915		hypothetical protein	
c1	cds	4990268	4994296	+	BALIOE_24920		hypothetical protein	
c1	cds	4994373	4998596	+	BALIOE_24925		hypothetical protein	
c1	cds	4998809	4999252	+	BALIOE_24930		hypothetical protein	
c1	cds	4999687	5000820	-	BALIOE_24935		hypothetical protein	
c1	cds	5000817	5001587	-	BALIOE_24940		hypothetical protein	
c1	cds	5001589	5001789	-	BALIOE_24945		hypothetical protein	
c1	cds	5001773	5002528	-	BALIOE_24950		hypothetical protein	
c1	cds	5002521	5003156	-	BALIOE_24955		hypothetical protein	
c1	cds	5003156	5005051	-	BALIOE_24960		hypothetical protein	
c1	cds	5005284	5005760	-	BALIOE_24965		hypothetical protein	
c1	cds	5005855	5006628	+	BALIOE_24970		hypothetical protein	
c1	cds	5006668	5007732	+	BALIOE_24975		hypothetical protein	
c1	cds	5007742	5008413	+	BALIOE_24980		hypothetical protein	
c1	cds	5008456	5009046	+	BALIOE_24985		hypothetical protein	
c1	cds	5009233	5009505	+	BALIOE_24990		hypothetical protein	
c1	cds	5009578	5010213	+	BALIOE_24995		hypothetical protein	
c1	cds	5010215	5010640	-	BALIOE_25000		hypothetical protein	
c1	cds	5010643	5010771	-	BALIOE_25005		hypothetical protein	
c1	cds	5010878	5012254	+	BALIOE_25010		hypothetical protein	
c1	cds	5012251	5013576	+	BALIOE_25015		hypothetical protein	
c1	cds	5013573	5014862	-	BALIOE_25020		hypothetical protein	
c1	cds	5014874	5016463	-	BALIOE_25025		hypothetical protein	
c1	rRNA	5017080	5018621	+	BALIOE_25030	16S_rrna	16S ribosomal RNA	GO:0003735, GO:0005840, RFAM:RF00177, SO:0001000
c1	tRNA	5018707	5018782	+	BALIOE_25035	Glu_trna	tRNA-Glu	SO:0000259
c1	cds	5022207	5022650	-	BALIOE_25040		hypothetical protein	
c1	cds	5022807	5023736	+	BALIOE_25045		hypothetical protein	
c1	cds	5024005	5025606	+	BALIOE_25050		hypothetical protein	
c1	cds	5025636	5026940	+	BALIOE_25055		hypothetical protein	
c1	ncRNA	5026967	5027044	+	BALIOE_25060	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5027124	5028860	+	BALIOE_25065		hypothetical protein	
c1	cds	5028829	5031015	-	BALIOE_25070		hypothetical protein	
c1	cds	5031332	5032156	-	BALIOE_25075		hypothetical protein	
c1	cds	5032356	5036039	+	BALIOE_25080		hypothetical protein	
c1	cds	5036259	5037890	+	BALIOE_25085		hypothetical protein	
c1	cds	5037981	5038670	-	BALIOE_25090		hypothetical protein	
c1	cds	5039053	5040282	-	BALIOE_25095		hypothetical protein	
c1	cds	5040334	5040987	-	BALIOE_25100		hypothetical protein	
c1	cds	5041220	5041750	-	BALIOE_25105		hypothetical protein	
c1	cds	5042191	5044281	+	BALIOE_25110		hypothetical protein	
c1	cds	5044352	5045284	+	BALIOE_25115		hypothetical protein	
c1	cds	5045287	5045508	+	BALIOE_25120		hypothetical protein	
c1	cds	5045521	5045775	+	BALIOE_25125		hypothetical protein	
c1	cds	5045777	5046058	+	BALIOE_25130		hypothetical protein	
c1	cds	5046055	5046327	+	BALIOE_25135		hypothetical protein	
c1	cds	5046332	5046625	+	BALIOE_25140		hypothetical protein	
c1	cds	5046637	5047167	+	BALIOE_25145		hypothetical protein	
c1	cds	5047265	5047807	+	BALIOE_25150		hypothetical protein	
c1	cds	5047811	5048344	+	BALIOE_25155		hypothetical protein	
c1	cds	5048344	5048859	+	BALIOE_25160		hypothetical protein	
c1	cds	5048863	5049414	+	BALIOE_25165		hypothetical protein	
c1	cds	5049411	5049596	+	BALIOE_25170		hypothetical protein	
c1	cds	5049635	5049967	+	BALIOE_25175		hypothetical protein	
c1	cds	5049960	5050157	+	BALIOE_25180		hypothetical protein	
c1	cds	5050147	5050443	+	BALIOE_25185		hypothetical protein	
c1	cds	5050440	5050949	+	BALIOE_25190		hypothetical protein	
c1	cds	5051019	5051444	+	BALIOE_25195		hypothetical protein	
c1	cds	5051516	5052016	+	BALIOE_25200		hypothetical protein	
c1	cds	5051979	5052479	+	BALIOE_25205		hypothetical protein	
c1	cds	5052691	5052918	+	BALIOE_25210		hypothetical protein	
c1	cds	5052899	5053207	+	BALIOE_25215		hypothetical protein	
c1	cds	5053204	5053494	+	BALIOE_25220		hypothetical protein	
c1	cds	5053497	5054078	+	BALIOE_25225		hypothetical protein	
c1	cds	5054078	5055742	+	BALIOE_25230		hypothetical protein	
c1	cds	5055742	5057331	+	BALIOE_25235		hypothetical protein	
c1	tRNA	5058640	5058720	-	BALIOE_25240		tRNA-Xxx	
c1	cds	5058759	5059232	+	BALIOE_25245		hypothetical protein	
c1	cds	5059409	5060533	+	BALIOE_25250		hypothetical protein	
c1	cds	5060533	5061480	+	BALIOE_25255		hypothetical protein	
c1	cds	5061524	5061910	+	BALIOE_25260		hypothetical protein	
c1	cds	5061907	5062326	+	BALIOE_25265		hypothetical protein	
c1	cds	5062323	5062883	+	BALIOE_25270		hypothetical protein	
c1	cds	5062884	5063129	+	BALIOE_25275		hypothetical protein	
c1	cds	5063126	5064628	+	BALIOE_25280		hypothetical protein	
c1	cds	5064637	5065002	+	BALIOE_25285		hypothetical protein	
c1	cds	5065017	5065493	+	BALIOE_25290		hypothetical protein	
c1	cds	5065620	5067695	+	BALIOE_25295		hypothetical protein	
c1	cds	5067682	5069031	+	BALIOE_25300		hypothetical protein	
c1	cds	5069015	5070139	+	BALIOE_25305		hypothetical protein	
c1	cds	5070129	5070743	+	BALIOE_25310		hypothetical protein	
c1	cds	5070736	5071173	+	BALIOE_25315		hypothetical protein	
c1	cds	5071173	5072255	+	BALIOE_25320		hypothetical protein	
c1	cds	5072246	5072806	+	BALIOE_25325		hypothetical protein	
c1	cds	5072806	5073717	+	BALIOE_25330		hypothetical protein	
c1	cds	5073752	5074273	-	BALIOE_25335		hypothetical protein	
c1	cds	5074778	5075338	+	BALIOE_25340		hypothetical protein	
c1	cds	5075438	5077477	+	BALIOE_25345		hypothetical protein	
c1	cds	5077624	5077806	+	BALIOE_25350		hypothetical protein	
c1	cds	5077842	5078087	+	BALIOE_25355		hypothetical protein	
c1	cds	5078126	5078590	-	BALIOE_25360		hypothetical protein	
c1	cds	5078859	5079596	+	BALIOE_25365		hypothetical protein	
c1	cds	5079720	5079917	-	BALIOE_25370		hypothetical protein	
c1	cds	5079928	5080725	-	BALIOE_25375		hypothetical protein	
c1	cds	5080791	5081285	-	BALIOE_25380		hypothetical protein	
c1	cds	5081285	5081692	-	BALIOE_25385		hypothetical protein	
c1	cds	5081702	5082508	-	BALIOE_25390		hypothetical protein	
c1	cds	5082578	5083525	-	BALIOE_25395		hypothetical protein	
c1	cds	5083873	5084745	+	BALIOE_25400		hypothetical protein	
c1	cds	5084746	5085018	-	BALIOE_25405		hypothetical protein	
c1	cds	5085271	5086620	-	BALIOE_25410		hypothetical protein	
c1	cds	5087145	5088794	+	BALIOE_25415		hypothetical protein	
c1	ncRNA	5088824	5088895	+	BALIOE_25420	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5089307	5089549	+	BALIOE_25425		hypothetical protein	
c1	cds	5089663	5090301	+	BALIOE_25430		hypothetical protein	
c1	cds	5090298	5091035	+	BALIOE_25435		hypothetical protein	
c1	cds	5091035	5093131	+	BALIOE_25440		hypothetical protein	
c1	cds	5093726	5094136	+	BALIOE_25445		hypothetical protein	
c1	cds	5094180	5095655	-	BALIOE_25450		hypothetical protein	
c1	cds	5096027	5096917	-	BALIOE_25455		hypothetical protein	
c1	cds	5096932	5098476	-	BALIOE_25460		hypothetical protein	
c1	ncRNA	5098496	5098566	+	BALIOE_25465	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5098630	5099820	-	BALIOE_25470		hypothetical protein	
c1	cds	5100185	5101300	+	BALIOE_25475		hypothetical protein	
c1	cds	5101372	5102712	+	BALIOE_25480		hypothetical protein	
c1	cds	5102863	5103783	+	BALIOE_25485		hypothetical protein	
c1	cds	5104012	5105592	+	BALIOE_25490		hypothetical protein	
c1	cds	5105815	5106312	+	BALIOE_25495		hypothetical protein	
c1	cds	5106325	5107197	+	BALIOE_25500		hypothetical protein	
c1	cds	5107352	5109775	-	BALIOE_25505		hypothetical protein	
c1	cds	5109946	5110314	+	BALIOE_25510		hypothetical protein	
c1	cds	5110424	5111032	+	BALIOE_25515		hypothetical protein	
c1	cds	5111105	5112430	+	BALIOE_25520		hypothetical protein	
c1	cds	5112546	5112755	+	BALIOE_25525		hypothetical protein	
c1	cds	5112797	5113312	-	BALIOE_25530		hypothetical protein	
c1	cds	5113631	5114527	+	BALIOE_25535		hypothetical protein	
c1	cds	5114950	5115987	+	BALIOE_25540		hypothetical protein	
c1	cds	5116121	5116363	+	BALIOE_25545		hypothetical protein	
c1	cds	5116529	5117512	-	BALIOE_25550		hypothetical protein	
c1	cds	5117595	5119010	+	BALIOE_25555		hypothetical protein	
c1	cds	5119063	5120142	+	BALIOE_25560		hypothetical protein	
c1	cds	5120395	5121588	+	BALIOE_25565		hypothetical protein	
c1	cds	5121927	5122286	-	BALIOE_25570		hypothetical protein	
c1	cds	5122687	5123400	+	BALIOE_25575		hypothetical protein	
c1	cds	5123511	5123927	+	BALIOE_25580		hypothetical protein	
c1	cds	5123931	5124287	+	BALIOE_25585		hypothetical protein	
c1	cds	5124322	5127144	-	BALIOE_25590		hypothetical protein	
c1	cds	5127399	5127935	+	BALIOE_25595		hypothetical protein	
c1	cds	5128034	5128315	-	BALIOE_25600		hypothetical protein	
c1	cds	5128744	5130330	+	BALIOE_25605		hypothetical protein	
c1	cds	5130333	5130656	-	BALIOE_25610		hypothetical protein	
c1	cds	5130742	5131206	+	BALIOE_25615		hypothetical protein	
c1	cds	5131752	5133101	+	BALIOE_25620		hypothetical protein	
c1	cds	5133252	5134901	+	BALIOE_25625		hypothetical protein	
c1	cds	5135055	5136347	-	BALIOE_25630		hypothetical protein	
c1	cds	5136528	5138177	-	BALIOE_25635		hypothetical protein	
c1	cds	5138174	5138488	-	BALIOE_25640		hypothetical protein	
c1	ncRNA	5138580	5138651	+	BALIOE_25645	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5138689	5140647	-	BALIOE_25650		hypothetical protein	
c1	cds	5141040	5142476	+	BALIOE_25655		hypothetical protein	
c1	cds	5142521	5143087	+	BALIOE_25660		hypothetical protein	
c1	cds	5143084	5143755	+	BALIOE_25665		hypothetical protein	
c1	cds	5143752	5144708	+	BALIOE_25670		hypothetical protein	
c1	cds	5144824	5146446	+	BALIOE_25675		hypothetical protein	
c1	cds	5146439	5146822	+	BALIOE_25680		hypothetical protein	
c1	cds	5146819	5147415	+	BALIOE_25685		hypothetical protein	
c1	cds	5147757	5149070	+	BALIOE_25690		hypothetical protein	
c1	ncRNA	5149173	5149243	+	BALIOE_25695	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5149248	5149937	-	BALIOE_25700		hypothetical protein	
c1	cds	5150031	5151710	-	BALIOE_25705		hypothetical protein	
c1	cds	5151759	5152178	-	BALIOE_25710		hypothetical protein	
c1	cds	5152376	5153842	-	BALIOE_25715		hypothetical protein	
c1	cds	5153839	5155890	-	BALIOE_25720		hypothetical protein	
c1	cds	5155890	5156921	-	BALIOE_25725		hypothetical protein	
c1	cds	5156940	5157215	-	BALIOE_25730		hypothetical protein	
c1	cds	5157424	5159409	-	BALIOE_25735		hypothetical protein	
c1	cds	5159700	5160407	+	BALIOE_25740		hypothetical protein	
c1	cds	5160404	5161405	-	BALIOE_25745		hypothetical protein	
c1	cds	5161402	5162262	-	BALIOE_25750		hypothetical protein	
c1	cds	5162277	5162960	-	BALIOE_25755		hypothetical protein	
c1	cds	5163015	5163956	-	BALIOE_25760		hypothetical protein	
c1	cds	5163975	5164949	-	BALIOE_25765		hypothetical protein	
c1	cds	5164946	5166466	-	BALIOE_25770		hypothetical protein	
c1	cds	5166580	5168850	+	BALIOE_25775		hypothetical protein	
c1	cds	5168919	5169248	+	BALIOE_25780		hypothetical protein	
c1	cds	5169325	5170083	-	BALIOE_25785		hypothetical protein	
c1	cds	5170085	5170510	-	BALIOE_25790		hypothetical protein	
c1	cds	5170507	5171064	-	BALIOE_25795		hypothetical protein	
c1	cds	5171064	5172200	-	BALIOE_25800		hypothetical protein	
c1	cds	5172197	5172877	-	BALIOE_25805		hypothetical protein	
c1	cds	5172988	5173746	-	BALIOE_25810		hypothetical protein	
c1	cds	5173743	5174588	-	BALIOE_25815		hypothetical protein	
c1	cds	5174581	5175645	-	BALIOE_25820		hypothetical protein	
c1	cds	5175645	5176229	-	BALIOE_25825		hypothetical protein	
c1	cds	5176226	5176678	-	BALIOE_25830		hypothetical protein	
c1	cds	5176679	5177404	-	BALIOE_25835		hypothetical protein	
c1	cds	5177425	5178204	-	BALIOE_25840		hypothetical protein	
c1	ncRNA	5178223	5178303	+	BALIOE_25845	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5178310	5179326	-	BALIOE_25850		hypothetical protein	
c1	cds	5179351	5180139	-	BALIOE_25855		hypothetical protein	
c1	cds	5180272	5180715	-	BALIOE_25860		hypothetical protein	
c1	ncRNA	5180780	5180856	-	BALIOE_25865	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	5180880	5180956	-	BALIOE_25870	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5180974	5181309	-	BALIOE_25875		hypothetical protein	
c1	cds	5181711	5183939	+	BALIOE_25880		hypothetical protein	
c1	cds	5183936	5184814	+	BALIOE_25885		hypothetical protein	
c1	cds	5185078	5186580	+	BALIOE_25890		hypothetical protein	
c1	cds	5186692	5186781	+	BALIOE_25895		hypothetical protein	
c1	cds	5186757	5187857	-	BALIOE_25900		hypothetical protein	
c1	cds	5187858	5188526	-	BALIOE_25905		hypothetical protein	
c1	cds	5188523	5190166	-	BALIOE_25910		hypothetical protein	
c1	cds	5190270	5191607	-	BALIOE_25915		hypothetical protein	
c1	cds	5191744	5192505	-	BALIOE_25920		hypothetical protein	
c1	cds	5192830	5195100	-	BALIOE_25925		hypothetical protein	
c1	cds	5195296	5196204	-	BALIOE_25930		hypothetical protein	
c1	cds	5196487	5197842	+	BALIOE_25935		hypothetical protein	
c1	cds	5197957	5199366	+	BALIOE_25940		hypothetical protein	
c1	cds	5199505	5200134	-	BALIOE_25945		hypothetical protein	
c1	cds	5200257	5201903	-	BALIOE_25950		hypothetical protein	
c1	cds	5201981	5203321	-	BALIOE_25955		hypothetical protein	
c1	cds	5203892	5204611	-	BALIOE_25960		hypothetical protein	
c1	cds	5204608	5206239	-	BALIOE_25965		hypothetical protein	
c1	cds	5206420	5206650	+	BALIOE_25970		hypothetical protein	
c1	cds	5206662	5206934	+	BALIOE_25975		hypothetical protein	
c1	cds	5207161	5207457	+	BALIOE_25980		hypothetical protein	
c1	cds	5207485	5207658	+	BALIOE_25985		hypothetical protein	
c1	cds	5207777	5209294	-	BALIOE_25990		hypothetical protein	
c1	cds	5209531	5210988	-	BALIOE_25995		hypothetical protein	
c1	cds	5211047	5213194	-	BALIOE_26000		hypothetical protein	
c1	cds	5213274	5214608	-	BALIOE_26005		hypothetical protein	
c1	cds	5214974	5216512	-	BALIOE_26010		hypothetical protein	
c1	tRNA	5217129	5217204	-	BALIOE_26015	Phe_trna	tRNA-Phe	SO:0000267
c1	cds	5217311	5217886	-	BALIOE_26020		hypothetical protein	
c1	cds	5217923	5219620	-	BALIOE_26025		hypothetical protein	
c1	cds	5219596	5219934	-	BALIOE_26030		hypothetical protein	
c1	cds	5220050	5221351	-	BALIOE_26035		hypothetical protein	
c1	cds	5221469	5222905	-	BALIOE_26040		hypothetical protein	
c1	cds	5223242	5223718	+	BALIOE_26045		hypothetical protein	
c1	cds	5223734	5224990	-	BALIOE_26050		hypothetical protein	
c1	cds	5225266	5225559	+	BALIOE_26055		hypothetical protein	
c1	cds	5225603	5227249	+	BALIOE_26060		hypothetical protein	
c1	cds	5227387	5227740	+	BALIOE_26065		hypothetical protein	
c1	cds	5227933	5228802	-	BALIOE_26070		hypothetical protein	
c1	cds	5229037	5230065	-	BALIOE_26075		hypothetical protein	
c1	cds	5230107	5230673	+	BALIOE_26080		hypothetical protein	
c1	cds	5230725	5230850	+	BALIOE_26085		hypothetical protein	
c1	cds	5230961	5231107	+	BALIOE_26090		hypothetical protein	
c1	cds	5231283	5231600	+	BALIOE_26095		hypothetical protein	
c1	cds	5231597	5232130	-	BALIOE_26100		hypothetical protein	
c1	cds	5232218	5233351	-	BALIOE_26105		hypothetical protein	
c1	cds	5233414	5233773	-	BALIOE_26110		hypothetical protein	
c1	cds	5233784	5234179	-	BALIOE_26115		hypothetical protein	
c1	cds	5234190	5234924	-	BALIOE_26120		hypothetical protein	
c1	cds	5234917	5236725	-	BALIOE_26125		hypothetical protein	
c1	cds	5237050	5238027	+	BALIOE_26130		hypothetical protein	
c1	cds	5238291	5239748	+	BALIOE_26135		hypothetical protein	
c1	cds	5239899	5243222	-	BALIOE_26140		hypothetical protein	
c1	cds	5243244	5244212	-	BALIOE_26145		hypothetical protein	
c1	cds	5244309	5245361	-	BALIOE_26150		hypothetical protein	
c1	cds	5245456	5246001	+	BALIOE_26155		hypothetical protein	
c1	tRNA	5246212	5246287	+	BALIOE_26160	Gly_trna	tRNA-Gly	SO:0000260
c1	tRNA	5246324	5246399	+	BALIOE_26165	Gly_trna	tRNA-Gly	SO:0000260
c1	tRNA	5246435	5246510	+	BALIOE_26170	Gly_trna	tRNA-Gly	SO:0000260
c1	cds	5246780	5247919	-	BALIOE_26175		hypothetical protein	
c1	cds	5247933	5249465	+	BALIOE_26180		hypothetical protein	
c1	cds	5249437	5249898	+	BALIOE_26185		hypothetical protein	
c1	cds	5249917	5251254	+	BALIOE_26190		hypothetical protein	
c1	cds	5251264	5253111	+	BALIOE_26195		hypothetical protein	
c1	cds	5253104	5254054	+	BALIOE_26200		hypothetical protein	
c1	cds	5254140	5254448	+	BALIOE_26205		hypothetical protein	
c1	cds	5254525	5255805	+	BALIOE_26210		hypothetical protein	
c1	cds	5255891	5257150	+	BALIOE_26215		hypothetical protein	
c1	cds	5257153	5258157	+	BALIOE_26220		hypothetical protein	
c1	cds	5258239	5258436	+	BALIOE_26225		hypothetical protein	
c1	cds	5258540	5259838	+	BALIOE_26230		hypothetical protein	
c1	cds	5260043	5260468	+	BALIOE_26235		hypothetical protein	
c1	cds	5260507	5262948	+	BALIOE_26240		hypothetical protein	
c1	cds	5263129	5263860	+	BALIOE_26245		hypothetical protein	
c1	cds	5263987	5264388	+	BALIOE_26250		hypothetical protein	
c1	cds	5264407	5265105	+	BALIOE_26255		hypothetical protein	
c1	cds	5265156	5265815	+	BALIOE_26260		hypothetical protein	
c1	cds	5265833	5266231	+	BALIOE_26265		hypothetical protein	
c1	cds	5266241	5266879	+	BALIOE_26270		hypothetical protein	
c1	cds	5266882	5268045	+	BALIOE_26275		hypothetical protein	
c1	cds	5268129	5269754	+	BALIOE_26280		hypothetical protein	
c1	cds	5269871	5270146	-	BALIOE_26285		hypothetical protein	
c1	cds	5270295	5270624	-	BALIOE_26290		hypothetical protein	
c1	cds	5270806	5271555	+	BALIOE_26295		hypothetical protein	
c1	cds	5271552	5272307	-	BALIOE_26300		hypothetical protein	
c1	cds	5272415	5273479	-	BALIOE_26305		hypothetical protein	
c1	cds	5273834	5275231	+	BALIOE_26310		hypothetical protein	
c1	cds	5275247	5275552	+	BALIOE_26315		hypothetical protein	
c1	cds	5275562	5276026	+	BALIOE_26320		hypothetical protein	
c1	cds	5276040	5276690	+	BALIOE_26325		hypothetical protein	
c1	cds	5276700	5277554	+	BALIOE_26330		hypothetical protein	
c1	cds	5277554	5278240	+	BALIOE_26335		hypothetical protein	
c1	cds	5278369	5278644	-	BALIOE_26340		hypothetical protein	
c1	cds	5278971	5279366	+	BALIOE_26345		hypothetical protein	
c1	cds	5279373	5279687	+	BALIOE_26350		hypothetical protein	
c1	cds	5279692	5279919	+	BALIOE_26355		hypothetical protein	
c1	cds	5279961	5280410	+	BALIOE_26360		hypothetical protein	
c1	cds	5280481	5281038	-	BALIOE_26365		hypothetical protein	
c1	cds	5281898	5282329	-	BALIOE_26370		hypothetical protein	
c1	cds	5282397	5283545	+	BALIOE_26375		hypothetical protein	
c1	cds	5283680	5284318	-	BALIOE_26380		hypothetical protein	
c1	cds	5284536	5285156	+	BALIOE_26385		hypothetical protein	
c1	cds	5285465	5286877	+	BALIOE_26390		hypothetical protein	
c1	cds	5286922	5287584	-	BALIOE_26395		hypothetical protein	
c1	cds	5287692	5288657	-	BALIOE_26400		hypothetical protein	
c1	cds	5288765	5289625	-	BALIOE_26405		hypothetical protein	
c1	cds	5289714	5290094	+	BALIOE_26410		hypothetical protein	
c1	cds	5290212	5292155	-	BALIOE_26415		hypothetical protein	
c1	cds	5292345	5293085	+	BALIOE_26420		hypothetical protein	
c1	cds	5293297	5294235	+	BALIOE_26425		hypothetical protein	
c1	cds	5294298	5294852	-	BALIOE_26430		hypothetical protein	
c1	cds	5295177	5295383	+	BALIOE_26435		hypothetical protein	
c1	cds	5295479	5296822	-	BALIOE_26440		hypothetical protein	
c1	cds	5297145	5297783	-	BALIOE_26445		hypothetical protein	
c1	cds	5297989	5299722	+	BALIOE_26450		hypothetical protein	
c1	cds	5299719	5303498	+	BALIOE_26455		hypothetical protein	
c1	cds	5303501	5303842	+	BALIOE_26460		hypothetical protein	
c1	cds	5304054	5304305	+	BALIOE_26465		hypothetical protein	
c1	cds	5304335	5304649	+	BALIOE_26470		hypothetical protein	
c1	cds	5304729	5305259	-	BALIOE_26475		hypothetical protein	
c1	cds	5305569	5306525	+	BALIOE_26480		hypothetical protein	
c1	ncRNA	5306554	5306632	+	BALIOE_26485	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5306665	5308167	+	BALIOE_26490		hypothetical protein	
c1	cds	5308181	5309203	+	BALIOE_26495		hypothetical protein	
c1	cds	5309190	5310185	+	BALIOE_26500		hypothetical protein	
c1	cds	5310218	5311216	-	BALIOE_26505		hypothetical protein	
c1	cds	5311392	5312765	+	BALIOE_26510		hypothetical protein	
c1	ncRNA	5312795	5312872	+	BALIOE_26515	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5312921	5313472	-	BALIOE_26520		hypothetical protein	
c1	cds	5313566	5314918	+	BALIOE_26525		hypothetical protein	
c1	cds	5315102	5315488	+	BALIOE_26530		hypothetical protein	
c1	cds	5315533	5315997	-	BALIOE_26535		hypothetical protein	
c1	ncRNA	5316101	5316171	+	BALIOE_26540	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5316187	5318325	-	BALIOE_26545		hypothetical protein	
c1	cds	5318719	5320374	-	BALIOE_26550		hypothetical protein	
c1	cds	5320424	5321845	-	BALIOE_26555		hypothetical protein	
c1	cds	5321964	5322911	-	BALIOE_26560		hypothetical protein	
c1	cds	5323290	5325986	+	BALIOE_26565		hypothetical protein	
c1	cds	5326192	5326578	-	BALIOE_26570		hypothetical protein	
c1	cds	5326651	5327112	-	BALIOE_26575		hypothetical protein	
c1	cds	5327125	5328060	-	BALIOE_26580		hypothetical protein	
c1	cds	5328479	5328874	-	BALIOE_26585		hypothetical protein	
c1	cds	5329005	5329718	-	BALIOE_26590		hypothetical protein	
c1	cds	5329789	5330382	+	BALIOE_26595		hypothetical protein	
c1	cds	5330527	5330979	+	BALIOE_26600		hypothetical protein	
c1	cds	5331102	5332874	+	BALIOE_26605		hypothetical protein	
c1	cds	5332931	5333935	-	BALIOE_26610		hypothetical protein	
c1	cds	5334097	5334513	+	BALIOE_26615		hypothetical protein	
c1	cds	5334559	5335062	-	BALIOE_26620		hypothetical protein	
c1	cds	5335255	5336451	+	BALIOE_26625		hypothetical protein	
c1	cds	5336506	5339361	-	BALIOE_26630		hypothetical protein	
c1	cds	5339361	5339804	-	BALIOE_26635		hypothetical protein	
c1	ncRNA	5339912	5339987	+	BALIOE_26640	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	5340008	5340083	+	BALIOE_26645	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5340158	5341669	-	BALIOE_26650		hypothetical protein	
c1	cds	5341936	5343036	+	BALIOE_26655		hypothetical protein	
c1	cds	5343036	5344118	+	BALIOE_26660		hypothetical protein	
c1	cds	5344279	5345781	-	BALIOE_26665		hypothetical protein	
c1	cds	5345911	5346930	-	BALIOE_26670		hypothetical protein	
c1	tRNA	5347126	5347210	+	BALIOE_26675	Leu_trna	tRNA-Leu	SO:0000264
c1	cds	5347301	5349250	+	BALIOE_26680		hypothetical protein	
c1	cds	5349450	5349776	+	BALIOE_26685		hypothetical protein	
c1	cds	5349776	5350663	+	BALIOE_26690		hypothetical protein	
c1	cds	5350846	5351223	-	BALIOE_26695		hypothetical protein	
c1	cds	5351345	5351677	-	BALIOE_26700		hypothetical protein	
c1	cds	5352681	5353148	-	BALIOE_26705		hypothetical protein	
c1	cds	5353341	5353910	+	BALIOE_26710		hypothetical protein	
c1	cds	5354109	5355425	-	BALIOE_26715		hypothetical protein	
c1	cds	5355577	5356350	-	BALIOE_26720		hypothetical protein	
c1	cds	5356473	5356931	+	BALIOE_26725		hypothetical protein	
c1	cds	5357647	5358474	+	BALIOE_26730		hypothetical protein	
c1	cds	5358934	5359785	-	BALIOE_26735		hypothetical protein	
c1	cds	5359772	5360080	-	BALIOE_26740		hypothetical protein	
c1	cds	5360326	5361429	-	BALIOE_26745		hypothetical protein	
c1	cds	5361433	5362140	-	BALIOE_26750		hypothetical protein	
c1	cds	5362147	5363799	-	BALIOE_26755		hypothetical protein	
c1	cds	5364011	5367370	+	BALIOE_26760		hypothetical protein	
c1	cds	5367370	5373684	+	BALIOE_26765		hypothetical protein	
c1	cds	5373908	5376766	+	BALIOE_26770		hypothetical protein	
c1	cds	5376769	5381703	+	BALIOE_26775		hypothetical protein	
c1	cds	5381703	5388044	+	BALIOE_26780		hypothetical protein	
c1	cds	5388041	5390155	+	BALIOE_26785		hypothetical protein	
c1	cds	5391108	5391353	-	BALIOE_26790		hypothetical protein	
c1	cds	5391649	5392629	-	BALIOE_26795		hypothetical protein	
c1	cds	5392694	5393800	-	BALIOE_26800		hypothetical protein	
c1	cds	5393820	5394536	-	BALIOE_26805		hypothetical protein	
c1	cds	5395992	5396594	+	BALIOE_26810		hypothetical protein	
c1	cds	5397072	5397668	+	BALIOE_26815		hypothetical protein	
c1	cds	5398133	5398681	+	BALIOE_26820		hypothetical protein	
c1	cds	5398788	5399285	+	BALIOE_26825		hypothetical protein	
c1	cds	5399322	5400047	+	BALIOE_26830		hypothetical protein	
c1	cds	5400114	5402750	+	BALIOE_26835		hypothetical protein	
c1	cds	5402760	5403290	+	BALIOE_26840		hypothetical protein	
c1	cds	5403303	5403806	+	BALIOE_26845		hypothetical protein	
c1	cds	5403826	5404728	+	BALIOE_26850		hypothetical protein	
c1	cds	5404902	5406245	-	BALIOE_26855		hypothetical protein	
c1	cds	5406585	5407769	+	BALIOE_26860		hypothetical protein	
c1	cds	5407850	5409310	+	BALIOE_26865		hypothetical protein	
c1	cds	5409332	5409526	-	BALIOE_26870		hypothetical protein	
c1	cds	5409573	5410298	+	BALIOE_26875		hypothetical protein	
c1	cds	5410439	5411269	-	BALIOE_26880		hypothetical protein	
c1	cds	5411523	5411624	+	BALIOE_26885		hypothetical protein	
c1	cds	5411942	5412334	+	BALIOE_26890		hypothetical protein	
c1	cds	5412327	5413055	-	BALIOE_26895		hypothetical protein	
c1	cds	5413303	5414475	-	BALIOE_26900		hypothetical protein	
c1	cds	5414488	5414949	-	BALIOE_26905		hypothetical protein	
c1	cds	5414946	5415629	-	BALIOE_26910		hypothetical protein	
c1	cds	5415770	5416255	-	BALIOE_26915		hypothetical protein	
c1	cds	5416586	5421688	-	BALIOE_26920		hypothetical protein	
c1	cds	5422038	5423216	-	BALIOE_26925		hypothetical protein	
c1	cds	5423284	5424126	-	BALIOE_26930		hypothetical protein	
c1	cds	5424392	5426599	-	BALIOE_26935		hypothetical protein	
c1	cds	5426911	5427177	-	BALIOE_26940		hypothetical protein	
c1	cds	5427174	5427941	-	BALIOE_26945		hypothetical protein	
c1	cds	5427951	5429102	-	BALIOE_26950		hypothetical protein	
c1	cds	5429218	5430489	-	BALIOE_26955		hypothetical protein	
c1	cds	5430530	5431762	-	BALIOE_26960		hypothetical protein	
c1	cds	5432229	5433011	+	BALIOE_26965		hypothetical protein	
c1	cds	5432986	5433186	+	BALIOE_26970		hypothetical protein	
c1	cds	5433429	5434841	-	BALIOE_26975		hypothetical protein	
c1	cds	5435018	5435182	+	BALIOE_26980		hypothetical protein	
c1	cds	5435279	5436160	+	BALIOE_26985		hypothetical protein	
c1	cds	5436208	5437371	+	BALIOE_26990		hypothetical protein	
c1	cds	5437418	5437759	-	BALIOE_26995		hypothetical protein	
c1	cds	5437980	5439734	-	BALIOE_27000		hypothetical protein	
c1	cds	5439734	5441203	-	BALIOE_27005		hypothetical protein	
c1	cds	5441270	5443702	-	BALIOE_27010		hypothetical protein	
c1	cds	5443980	5444264	+	BALIOE_27015		hypothetical protein	
c1	cds	5444273	5445631	+	BALIOE_27020		hypothetical protein	
c1	cds	5445700	5446656	-	BALIOE_27025		hypothetical protein	
c1	cds	5446667	5446870	-	BALIOE_27030		hypothetical protein	
c1	cds	5446920	5449070	-	BALIOE_27035		hypothetical protein	
c1	cds	5449363	5449905	-	BALIOE_27040		hypothetical protein	
c1	cds	5450134	5451798	+	BALIOE_27045		hypothetical protein	
c1	cds	5451847	5453208	-	BALIOE_27050		hypothetical protein	
c1	cds	5453423	5454337	-	BALIOE_27055		hypothetical protein	
c1	cds	5454476	5455498	+	BALIOE_27060		hypothetical protein	
c1	cds	5455635	5457926	-	BALIOE_27065		hypothetical protein	
c1	cds	5458180	5458674	-	BALIOE_27070		hypothetical protein	
c1	cds	5458723	5459460	-	BALIOE_27075		hypothetical protein	
c1	cds	5459463	5460002	-	BALIOE_27080		hypothetical protein	
c1	cds	5460109	5460582	-	BALIOE_27085		hypothetical protein	
c1	cds	5460573	5461343	-	BALIOE_27090		hypothetical protein	
c1	cds	5461964	5462689	+	BALIOE_27095		hypothetical protein	
c1	cds	5462647	5463324	+	BALIOE_27100		hypothetical protein	
c1	cds	5463362	5464150	-	BALIOE_27105		hypothetical protein	
c1	cds	5464291	5464527	+	BALIOE_27110		hypothetical protein	
c1	tRNA	5464566	5464652	-	BALIOE_27115	Leu_trna	tRNA-Leu	SO:0000264
c1	cds	5464842	5465873	-	BALIOE_27120		hypothetical protein	
c1	cds	5465976	5466389	+	BALIOE_27125		hypothetical protein	
c1	cds	5466358	5466804	+	BALIOE_27130		hypothetical protein	
c1	cds	5466819	5467496	+	BALIOE_27135		hypothetical protein	
c1	cds	5467587	5469176	+	BALIOE_27140		hypothetical protein	
c1	cds	5469569	5470174	+	BALIOE_27145		hypothetical protein	
c1	cds	5470301	5470462	+	BALIOE_27150		hypothetical protein	
c1	cds	5470584	5471657	+	BALIOE_27155		hypothetical protein	
c1	cds	5471654	5472436	+	BALIOE_27160		hypothetical protein	
c1	ncRNA	5472533	5472611	+	BALIOE_27165	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	ncRNA	5472533	5472611	-	BALIOE_27170	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5472650	5473513	-	BALIOE_27175		hypothetical protein	
c1	cds	5473485	5473730	-	BALIOE_27180		hypothetical protein	
c1	cds	5473766	5475034	-	BALIOE_27185		hypothetical protein	
c1	cds	5475292	5476071	+	BALIOE_27190		hypothetical protein	
c1	cds	5476198	5477520	+	BALIOE_27195		hypothetical protein	
c1	cds	5477572	5478795	+	BALIOE_27200		hypothetical protein	
c1	cds	5478852	5479571	+	BALIOE_27205		hypothetical protein	
c1	cds	5479732	5479995	-	BALIOE_27210		hypothetical protein	
c1	cds	5480027	5481715	-	BALIOE_27215		hypothetical protein	
c1	cds	5481821	5482789	+	BALIOE_27220		hypothetical protein	
c1	cds	5482838	5484220	+	BALIOE_27225		hypothetical protein	
c1	cds	5484241	5485473	+	BALIOE_27230		hypothetical protein	
c1	cds	5485507	5485674	+	BALIOE_27235		hypothetical protein	
c1	ncRNA	5485624	5485702	+	BALIOE_27240	naRNA4	Nucleoid-associated noncoding RNA 4 (CssrE)	RFAM:RF02564, SO:0000655
c1	cds	5485781	5487448	-	BALIOE_27245		hypothetical protein	
c1	cds	5487659	5489596	+	BALIOE_27250		hypothetical protein	
c1	cds	5489716	5490012	+	BALIOE_27255		hypothetical protein	
c1	cds	5490159	5490671	-	BALIOE_27260		hypothetical protein	
c1	cds	5490723	5491370	+	BALIOE_27265		hypothetical protein	
c1	cds	5491367	5492236	-	BALIOE_27270		hypothetical protein	
c1	cds	5492447	5492920	+	BALIOE_27275		hypothetical protein	
c1	cds	5492933	5493622	+	BALIOE_27280		hypothetical protein	
c1	cds	5493622	5495046	+	BALIOE_27285		hypothetical protein	
c1	cds	5495104	5496456	+	BALIOE_27290		hypothetical protein	
c1	cds	5496516	5497232	-	BALIOE_27295		hypothetical protein	
c1	cds	5497868	5498554	+	BALIOE_27300		hypothetical protein	
p2	cds	1	141	-	BALIOE_27305		hypothetical protein	
p2	cds	413	736	+	BALIOE_27310		hypothetical protein	
p2	cds	971	1351	-	BALIOE_27315		hypothetical protein	
p2	cds	1348	2388	-	BALIOE_27320	mock1	mock hypothetical user protein 1	EC:0.0.0.0, USERDB:MOCK1