|
0
|
1 <tool id="yac" name="Clip adapter" version="1.3.2">
|
|
|
2 <description />
|
|
|
3 <command interpreter="python">yac.py --input $input
|
|
|
4 --output $output
|
|
|
5 --output_format "$out_format"
|
|
|
6 --adapter_to_clip $clip_source.clip_sequence
|
|
|
7 --min $min
|
|
|
8 --max $max
|
|
|
9 --Nmode $Nmode
|
|
|
10 </command>
|
|
|
11 <inputs>
|
|
|
12 <param format="fastq" label="Source file" name="input" type="data" />
|
|
|
13 <param label="min size" name="min" size="4" type="integer" value="15" />
|
|
|
14 <param label="max size" name="max" size="4" type="integer" value="36" />
|
|
|
15 <param label="Select output format" name="out_format" type="select">
|
|
|
16 <option selected="true" value="fasta">Fasta format</option>
|
|
|
17 <option value="fastq">Fastq format</option>
|
|
|
18 </param>
|
|
|
19 <param label="Accept reads containing N?" name="Nmode" type="select">
|
|
|
20 <option selected="True" value="accept">accept</option>
|
|
|
21 <option value="reject">reject</option>
|
|
|
22 </param>
|
|
|
23 <conditional name="clip_source">
|
|
|
24 <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select">
|
|
|
25 <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option>
|
|
|
26 <option value="user">Use custom sequence</option>
|
|
|
27 </param>
|
|
|
28 <when value="prebuilt">
|
|
|
29 <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select">
|
|
|
30 <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option>
|
|
|
31 <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option>
|
|
|
32 <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option>
|
|
|
33 <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option>
|
|
|
34 </param>
|
|
|
35 </when>
|
|
|
36 <when value="user">
|
|
|
37 <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" />
|
|
|
38 </when>
|
|
|
39 </conditional>
|
|
|
40 </inputs>
|
|
|
41 <outputs>
|
|
|
42 <data format="fasta" metadata="input" name="output" />
|
|
|
43 <change_format>
|
|
|
44 <when format="fastq" input="out_format" value="fastq" />
|
|
|
45 </change_format>
|
|
|
46 </outputs>
|
|
|
47 <tests>
|
|
|
48 <test>
|
|
|
49 <param ftype="fastqsanger" name="input" value="yac.fastq" />
|
|
|
50 <param name="min" value="18" />
|
|
|
51 <param name="max" value="29" />
|
|
|
52 <param name="clip_source_list" value="prebuilt" />
|
|
|
53 <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
|
|
|
54 <param name="Nmode" value="accept" />
|
|
|
55 <output file="yac.out" name="output" />
|
|
|
56 </test>
|
|
|
57 <test>
|
|
|
58 <param ftype="fastqsanger" name="input" value="yac.fastq" />
|
|
|
59 <param name="min" value="18" />
|
|
|
60 <param name="max" value="29" />
|
|
|
61 <param name="clip_source_list" value="prebuilt" />
|
|
|
62 <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
|
|
|
63 <param name="Nmode" value="accept" />
|
|
|
64 <param name="out_format" value="fastq" />
|
|
|
65 <output file="yac_fastq.out" name="output" />
|
|
|
66 </test>
|
|
|
67 </tests>
|
|
|
68 <help>
|
|
|
69 This tool clips adapter sequences from a fastq file and fasta file of clipped reads with renumbered fasta headers.
|
|
|
70
|
|
|
71 Clipped sequences with Ns can be discarded.
|
|
|
72
|
|
|
73 Min size and max size filter clipped reads on their size.
|
|
|
74
|
|
|
75 Note that unclipped reads that satisfy the min and max size conditions are kept.
|
|
|
76 </help>
|
|
|
77 </tool>
|
