<tool id="generate_sliding_windows" name="generate_sliding_windows"  version="0.1.3">
<description>Split fasta sequence in nucleotide windows</description>
    <requirements>
        <requirement type="package" version="1.65">biopython</requirement>
    </requirements>
    <stdio>
        <exit_code range="1:" />
    </stdio>

    <command interpreter="python"><![CDATA[
        generate_sliding_windows.py --input "$input" --output "$output" --window $window --step $step
    ]]></command>
    <inputs>
        <conditional name="refFastaSource">
            <param help="" label="Will you select a fasta sequence from your history or use a pre-installed sequence?" name="fastaSource" type="select">
                <option value="history">Use one from the history</option>
                <option value="pre-installed">Use a pre-installed fasta sequence</option>
            </param>
            <when value="pre-installed">
                <param help="if you wish to have your fasta sequence listed contact instance administrator" label="Select a fasta sequence" name="input" type="select">
                    <options from_data_table="all_fasta">
          </options>
                </param>
            </when>
            <when value="history">
                <param format="fasta" label="Select a fasta file for which you wish to generate a multi-fasta file in a sliding window fashion" name="input" type="data" />
            </when>
        </conditional>
        <param type="integer" name="window" value="21" min="1" label="window size" help="Specifiy the size of the windows that should be generated"/>
        <param type="integer" name="step" value="21" min="1" label="step size" help="Specify the distance with which windows should be spaced apart."/>
    </inputs>
    <outputs>
        <data name="output" format="fasta" />
    </outputs>
    <tests>
        <test>
            <param name="input" value="EcR_USP_224.fa"/>
            <param name="window" value="21"/>
            <param name="step" value="21"/>
            <output name="output" file="output.fa"/>
        </test>
    </tests>
    <help><![CDATA[

Generate fixed size sliding windows in fasta format from multi-fasta sequence.

-----------------------------

Given an input fasta sequence 

::


  >input
  ATGCATGCATGCATGCATGCATGCATCGATGCATCGATCG

produces the following multi-fasta output with window size 10 and step 5:

::


  >input_start:1_stop:10
  ATGCATGCAT
  >input_start:6_stop:15
  TGCATGCATG
  >input_start:11_stop:20
  GCATGCATGC
  >input_start:16_stop:25
  CATGCATGCA
  >input_start:21_stop:30
  ATGCATCGAT
  >input_start:26_stop:35
  TCGATGCATC 

-------------------------

optional arguments:
  -h, --help       show this help message and exit
  --input INPUT    supply an input multi-fasta file.
  --output OUTPUT  supply an output multi-fasta file. If not specified use
                   stdout.
  --window WINDOW  Set the size of the generated windows
  --step STEP      Set distance between the windows

    ]]></help>
</tool>