Mercurial > repos > mvdbeek > generate_sliding_windows
view generate_sliding_windows.xml @ 5:79e43a3b0883 draft default tip
Uploaded
author | mvdbeek |
---|---|
date | Wed, 15 Apr 2015 10:14:04 -0400 |
parents | cb2d94bb6772 |
children |
line wrap: on
line source
<tool id="generate_sliding_windows" name="generate_sliding_windows" version="0.2.0"> <description>Split fasta sequence in nucleotide windows</description> <requirements> <requirement type="package" version="1.65">biopython</requirement> </requirements> <stdio> <exit_code range="1:" /> </stdio> <command interpreter="python"><![CDATA[ generate_sliding_windows.py --input #if $refFastaSource.fastaSource == "history": "$input" #else "$refFastaSource.pre_installed_fasta.fields.path" #end if --output "$output" --window $window --step $step ]]></command> <inputs> <conditional name="refFastaSource"> <param help="" label="Will you select a fasta sequence from your history or use a pre-installed sequence?" name="fastaSource" type="select"> <option value="history">Use one from the history</option> <option value="pre_installed">Use a pre-installed fasta sequence</option> </param> <when value="pre_installed"> <param help="if you wish to have your fasta sequence listed contact instance administrator" label="Select a fasta sequence" name="pre_installed_fasta" type="select"> <options from_data_table="all_fasta"> </options> </param> </when> <when value="history"> <param format="fasta" label="Select a fasta file for which you wish to generate a multi-fasta file in a sliding window fashion" name="input" type="data" /> </when> </conditional> <param type="integer" name="window" value="21" min="1" label="window size" help="Specifiy the size of the windows that should be generated"/> <param type="integer" name="step" value="21" min="1" label="step size" help="Specify the distance with which windows should be spaced apart."/> </inputs> <outputs> <data name="output" format="fasta" /> </outputs> <tests> <test> <param name="input" value="EcR_USP_224.fa"/> <param name="window" value="21"/> <param name="step" value="21"/> <output name="output" file="output.fa"/> </test> </tests> <help><![CDATA[ Generate fixed size sliding windows in fasta format from multi-fasta sequence. ----------------------------- Given an input fasta sequence :: >input ATGCATGCATGCATGCATGCATGCATCGATGCATCGATCG produces the following multi-fasta output with window size 10 and step 5: :: >input_start:1_stop:10 ATGCATGCAT >input_start:6_stop:15 TGCATGCATG >input_start:11_stop:20 GCATGCATGC >input_start:16_stop:25 CATGCATGCA >input_start:21_stop:30 ATGCATCGAT >input_start:26_stop:35 TCGATGCATC ------------------------- optional arguments: -h, --help show this help message and exit --input INPUT supply an input multi-fasta file. --output OUTPUT supply an output multi-fasta file. If not specified use stdout. --window WINDOW Set the size of the generated windows --step STEP Set distance between the windows ]]></help> </tool>