Mercurial > repos > matthias > samtools_fixmate
annotate samtools_fastx/test-data/samtools_fastx-out1.fasta @ 0:50ebde5d5c63 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
| author | matthias |
|---|---|
| date | Fri, 22 Feb 2019 15:45:27 -0500 |
| parents | |
| children |
| rev | line source |
|---|---|
|
0
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
1 >chrM_101_581_3:0:0_1:0:0_45/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
2 GAGGTAAAATTACACATGCAAACCTCCATAGACCGGAGAAAAATCCCTTAAAGATTTACTTAAAATTTAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
3 >chrM_101_581_3:0:0_1:0:0_45/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
4 TTTTAAGCTATGGCTAGTAGTTCTCTGGCAAATATTTTTGTTAAATTTAATTATTTAGGTTTATGGCTAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
5 >chrM_271_788_1:2:0_0:1:0_73/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
6 TAGCCCATTTCTTCCCATTGCATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTTGCTTAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
7 >chrM_271_788_1:2:0_0:1:0_73/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
8 TGACTAAGTTATACCTCTTAGGGTTGGCAAATTTCGTGCCAGCCACCTCGTTCATACGATTAACCCAAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
9 >chrM_296_703_3:1:0_0:1:0_b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
10 GGGTTTGCTGAAGATGGCGGTATATAGGCTGAATTAGCAAGTGATGGTGAGGTAGAGCGGGGTTTATCGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
11 >chrM_296_703_3:1:0_0:1:0_b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
12 TTTAAATTTCGTGCCAGCCACCTGGGTCATACGATTAACCCAAACTAATTATCTTCGGCGTAAAACGTGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
13 >chrM_317_794_1:3:0_0:1:0_18/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
14 CTCGGTCATACGATTAACCCAAACTAAATATTTTCGGCGTAAAACGTGTCATCTATAAATAAATAAATAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
15 >chrM_317_794_1:3:0_0:1:0_18/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
16 AAAATGTAGCCCATTTCTTCCCATTGCATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
17 >chrM_408_812_0:2:1_4:2:0_ad/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
18 TGAAAAATCATTGTTAGGACCTAAACCGTCAATAACGAAAGTAATTCTACTCATTTATAATACACGACAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
19 >chrM_408_812_0:2:1_4:2:0_ad/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
20 GAAATGTTCTGTTATAAGAAAATGACGCCCATTTCTTCCCATTGCATTGGCTCCACCTTGACCTAACGTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
21 >chrM_424_929_1:0:1_1:1:0_4a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
22 GGACCTAAACCGTCAATAACGAAAGTAATTCTAGTCATTTATAATCCACGACAGCTAAGACCCAAACTGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
23 >chrM_424_929_1:0:1_1:1:0_4a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
24 TAATTTGAGGAGGGTGACTGGCGGTGTGTGCGTACTTCATTGCTCAATTCAATTAAGCTCCCTATTCTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
25 >chrM_769_1311_4:2:0_1:0:0_9b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
26 CAAAGGGAAGACATGGGGTACATTTTCTTATAACAGAACATTACTATCCCCTTTATGAAACTAAAGGACT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
27 >chrM_769_1311_4:2:0_1:0:0_9b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
28 TTAGTTAGAAGTTTTCTAGTTAGTTCATTATGCAAAAGGAACAAGGTTTAATCTTTGCTTGTTCTTACTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
29 >chrM_826_1305_2:0:0_0:0:0_63/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
30 AGAAGTTTTCTAGTTAGTTCATTATGCAAAAGGTACAAGGTTTAATCTTTGCTTGTTCTTACTTTTAATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
31 >chrM_826_1305_2:0:0_0:0:0_63/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
32 AAACTAAAGGACTAAGGAGGATTTAGTAGTAACTTAAGAATAGAGAGCTTAATTGAATTGAGGAATGAAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
33 >chrM_946_1374_2:0:1_1:0:0_b7/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
34 GTTGATTCATAAAATTGTTTTTAGGTAGGTCGTTTGGTTTCGGGGTTTCTAGCTGTAATTCTTTTAGTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
35 >chrM_946_1374_2:0:1_1:0:0_b7/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
36 CTTATTTCTAGACATCCGTTTCTGAGAGGAGATAAGTCGTAACAAGGTAAGCATACTGGAAAGTGTGCTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
37 >chrM_1166_1638_1:0:0_3:1:0_54/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
38 AGAATTGGAGAAAGAAATTCGTACATCTAGGAGCTATAGAACTAGTACCGCAAGGGAAAGATGAAAGACT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
39 >chrM_1166_1638_1:0:0_3:1:0_54/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
40 ATCGCATTCTTTATTGGTGGCTGCTTATAGGCCTCCAATGGTTAAAAGCTGTTTTGTTAATTATTCACTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
41 >chrM_1187_1670_2:0:0_1:1:0_5/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
42 TACATCTAGGAGCTATAGAACTAGAACCGCAAGGGAAAGATGAAAGCCTAATTAAAAGTAAGAACAAGCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
43 >chrM_1187_1670_2:0:0_1:1:0_5/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
44 ATGGAATTAATTGAAATTTTATTTTGAGCTTGATCGCTTTCTTTATTGGTGGCTGCTTTTAGGCCTACAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
45 >chrM_1366_1837_1:0:0_0:0:0_24/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
46 ATTTATAGTGTGATTATTGCCTATAGTCTGATTAACTAACAATGGTTATCCGAGTTGTTATACGCGTATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
47 >chrM_1366_1837_1:0:0_0:0:0_24/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
48 TGAATCAACTCGTCTATGTGGCAAAATAGTGAGACGATTTTTAGGTAGAGGTGAAAAGCCTAACGAGCTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
49 >chrM_1396_1891_4:1:0_3:0:0_55/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
50 GAGAAGATTTTTAGGTAGAGGTGAAACGCCTACCGAGCTTGTTGATAGCTTGTTACCCAAAAAGTGAATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
51 >chrM_1396_1891_4:1:0_3:0:0_55/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
52 ATCTTTCCTATAGGCATTCCGGATTTGGGTTAACAGAGAAGTTATAGGTGGATTATTTATAGTGTGATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
53 >chrM_1461_2059_1:2:0_0:0:0_8f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
54 GAATTTAAGTTCAATTATAAACTTGCTGAAAAAAGAACAAAATCAAAAAGTAAGTTTAGATTATAGCCAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
55 >chrM_1461_2059_1:2:0_0:0:0_8f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
56 CCCTAATTAAGGAACAAGTGATTATGCTACCTTTGCACGGTCAGGATACCGCGGCCGTTAAACTTTAGTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
57 >chrM_1654_2097_0:1:0_1:0:0_a8/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
58 AGAGACAGTTGGACCCTCGTTTAGCCGTTCATGCTAGTCCCTAATTAAGGACCAAGTGATTATGCTACCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
59 >chrM_1654_2097_0:1:0_1:0:0_a8/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
60 ATTTCAATTAATTCCATAATCTACACCAACTTCCTAAACTTAAAATTGGGTTAATCTATAACTTTATAGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
61 >chrM_1772_2275_1:0:0_1:0:0_3f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
62 ATTTTTATTCTCCGAGGTCACCCCAACCGAAATTTCAAACTTATACTATAGTTTTTGGGCCATTAGGTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
63 >chrM_1772_2275_1:0:0_1:0:0_3f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
64 CGCGTATAACAACTCGGATAACCATTGTTAGTTAATCAGACTATAGGCAATAATCACACTATACATAATC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
65 >chrM_2021_2595_3:0:0_2:0:0_22/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
66 AAGGTGGCTCTATTTCTCTTGACCTTTCGTACTGGGAGAAATCGTAAATAGATAGAAACCGACCAGGATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
67 >chrM_2021_2595_3:0:0_2:0:0_22/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
68 CGTGCAACGGTAGCATAATCACTTGTTCCTTAATTAGGGACTAGCATGAACGGCTCAACGAGGGTCCACC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
69 >chrM_2195_2667_1:0:0_2:0:0_95/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
70 TTTAATTTATTAAACCTAATGGCCCAAAAACTATAGTCTAAGTTTGAAATTTCGGTTGGGGTGACCTCGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
71 >chrM_2195_2667_1:0:0_2:0:0_95/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
72 GTAGGTTAGAGGGTGTACGTATATATTTTATTTAGATTTTATTCATAAATTAAGTTGAGAGCGCTTATAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
73 >chrM_2674_3159_3:1:0_1:1:1_e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
74 CTACGGCTCGTAAAGCTCCGATTAGTGAGAATTTGGAGTTTGAGGCTCATCCTGATCAAGAATGGAGTAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
75 >chrM_2674_3159_3:1:0_1:1:1_e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
76 TTATTGGGGTGGCAGAGCCATGAAATTGCGTAAGACTAAAAACCTTGTTCCCAGAGGTTCAAATGCTCTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
77 >chrM_2706_3137_0:1:0_1:0:1_af/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
78 AGACTTAAAACCTTGTTCCCAGAGGTTCAAATCCTCTCCCTAATAGTGTTCTTTATTATTATCCTAACAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
79 >chrM_2706_3137_0:1:0_1:0:1_af/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
80 TAGTGAGTATTTGGAGTTTGAGGCTCATCCTGATCAAGAATGGAGTAAACTGCTAGGCTAGATGTTGCTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
81 >chrM_2740_3253_1:1:0_1:1:0_6c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
82 GTTGTAATAAGTGTTTTTAGAGAGTAGAATCCATTTATTAATAGAACTGATAAAAGGATAATAGCTATGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
83 >chrM_2740_3253_1:1:0_1:1:0_6c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
84 TCTCCCTAAAAGTGTTCTTTATTATTATCCTAACACTCCTCGTCCCCATTCTAATCGCCATAGCCTTCCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
85 >chrM_2789_3314_1:0:0_0:1:0_f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
86 TCTAATCGCCATAGCCTTCCTCACATTAGTAGAACGCAAAATCTTAGGGTACATACAACTACGAAAAGGC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
87 >chrM_2789_3314_1:0:0_0:1:0_f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
88 TGAGATATATCATATTATGGCTATGGGTCAGGCTGGCAGAAGTAATCATATGTGTTCTTGGGTTGTAATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
89 >chrM_2945_3338_1:0:0_1:1:0_19/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
90 GGCCCGGTTTGTTTCTGCTAGGGTTGAGATATATCATATTATGGCTATGGGTCAGGCTGGCAGACGTAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
91 >chrM_2945_3338_1:0:0_1:1:0_19/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
92 AACCTCTATATCCTTATTTATTATAGCACCTACCCTATCACTCACACTAGCATTAAGTCTATGAGTTCCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
93 >chrM_3103_3621_2:1:0_1:0:0_71/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
94 GATCAGGATGATCCTCAAACTCCAAATCCTCACTAATCGGAGCTTTACGAGCCGTAGCCCAAACAATTTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
95 >chrM_3103_3621_2:1:0_1:0:0_71/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
96 TTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGCTAAGATGCTCGGATCCATAGGAATGTTGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
97 >chrM_3135_3669_1:2:0_1:0:0_2c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
98 AAGAAATATGTCACATACATAATGCTAGAGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
99 >chrM_3135_3669_1:2:0_1:0:0_2c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
100 GTAATCGGAGCTTTACGAGCCGTAGCCCAAACAATTTCATATGATGTAACCATAGCTATTATCCTTTTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
101 >chrM_3169_3659_1:2:0_2:0:0_68/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
102 TTTCATATGATGTAACCATAGCTATTATCCTTTTAACAGTTCTATTAATAAATGGATTCTACTCTCTACA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
103 >chrM_3169_3659_1:2:0_2:0:0_68/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
104 TCACATACATCATTCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
105 >chrM_3187_3702_2:1:0_1:1:0_8d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
106 TAGCTATTCTCCTTTTATCAGTTCTATTAATAAATGGATTCTACTCTCTACAAACACTTATTACAACCGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
107 >chrM_3187_3702_2:1:0_1:1:0_8d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
108 TGTATGGTGGCACTCCGGCTGTAAAAATTGGTAAAGAAATATGTCACATACATAATGCTAGTGTTAGGGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
109 >chrM_3204_3728_0:1:0_2:2:0_4b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
110 TCAGTTCTATTAATAAATGGATTCTACTCTCTACAAACACTTATTACAACCCAAGAACACATATGATTAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
111 >chrM_3204_3728_0:1:0_2:2:0_4b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
112 ATTCTTTTATCAGACATATTTCTATATGTCTGGTGGCACTCCCGCTTTAAAAATTGGTAAAGCAATATGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
113 >chrM_3289_3819_1:1:0_4:1:0_3c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
114 CCAAAGCCATAATATGATATATCTCAACCCTAGCAGAAACAAACCGGGCCCCCTTCGACCTGACAGAAGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
115 >chrM_3289_3819_1:1:0_4:1:0_3c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
116 AGGAGAATTTTGAAATCTTAATTGTAGGTTCAATTCCTAATGTCCTAGAAATAAGCGGGCTTGAACCTCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
117 >chrM_3422_3872_1:0:0_2:1:0_3b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
118 CCCTATAGCTTAATTAGCTGACCTTAGTATTAGGATAAGGTGTTTAGGTAGCAAGGAGAATTTTGAATTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
119 >chrM_3422_3872_1:0:0_2:1:0_3b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
120 TATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTAACAACTATAATCTTCCTAGGACCCCTATAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
121 >chrM_3504_4052_0:0:0_0:2:0_b9/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
122 CCAGAACTCTACTCAACTAACTTCATAATAGAAGCTCTACTACTATCATCAACATTCCTATGGATCCGAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
123 >chrM_3504_4052_0:0:0_0:2:0_b9/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
124 TGTTGATTAGTATGGGGATAATTGCTAGTAGGCTGAATTCCAGGCATACTCATATCAGTATTAGGTTGGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
125 >chrM_3542_4113_1:0:0_0:0:0_65/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
126 ACTACTATCATCAACATTCCTATGGATCCGAGCATCTTATCGACGCTTCCGTTACGATCAACTTATACAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
127 >chrM_3542_4113_1:0:0_0:0:0_65/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
128 GAGGCTGTTGCTTGTGTGACGAAGTATTTTGTTGCTGCTTCAGTTGATCGTGGGTTTTTTTTGTTGATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
129 >chrM_3560_4153_2:0:0_1:0:0_4f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
130 CCTATGGATCCGAGCATCTTATGCACGCTTCCGTTACGATCAACTTATACATCTTCTATGAAAAAACATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
131 >chrM_3560_4153_2:0:0_1:0:0_4f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
132 TTGTTTATAGTTGAGTACGATGGCCAGGAGGATACTTATTGAGGCTGTTGCTTGTGTGACGAAGTATTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
133 >chrM_3562_4117_0:0:0_3:0:0_51/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
134 TATGGATCCGAGCATCTTATCCACGCTTCCGTTACGATCAACTTATACATCTTCTATGAAAAAACTTTCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
135 >chrM_3562_4117_0:0:0_3:0:0_51/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
136 TCTTGAGGCTGATGCTTGTGTGACGAAGTATTTTGTTGCTTCTTCAGTTGATCGTGGGTTTTTTTTGTTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
137 >chrM_3587_4003_0:0:0_1:1:0_a7/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
138 TCATATCAGTATTAGGTTGGTGCTGGATATTGTGATTACAGGACCTAATAAGATTGTGAAGTAGATGATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
139 >chrM_3587_4003_0:0:0_1:1:0_a7/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
140 CTTCCGTTACGATCAACTTATACATCTTCTATGAAAAAACTTTCTACCCCTAACACTAGCATTATGTATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
141 >chrM_3799_4278_3:2:0_1:0:0_1d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
142 TTAAGAATTCAAAATTCTGCTAGCTACCAAAACACCTTATCCTGATAGTAAGGTCAGCTAATTAAGCTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
143 >chrM_3799_4278_3:2:0_1:0:0_1d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
144 ATCCCTTGAGTTACTTCTGGTAATCAGAAGTGGAATGGTGCGAGGCCTAGTTTTATGGATAGGGCTATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
145 >chrM_3889_4361_3:0:0_3:0:0_33/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
146 TGAGTAGCGGGTAAATTTGACTTAAAATTGAAAGGGGCGCAATTTTTTGTCATGTAAGAAGAATAAGTCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
147 >chrM_3889_4361_3:0:0_3:0:0_33/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
148 TTTTGTATAAATCCTTCCCGTACTAATAAATCCTATCACCCTTGCCATCATCTACTTCACAATCTTCTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
149 >chrM_3912_4414_3:0:0_2:1:0_91/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
150 TCATGCCCCAATGAAAATAGAAGTAAATGCTAGTATTAAAATGATAGTAGAGTTGAGTATCGGGTAAATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
151 >chrM_3912_4414_3:0:0_2:1:0_91/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
152 TAATAAATCCTATCACCCTTGCCAACATCTAGTTCACAATCTTCTTAGGTCCTGTAATCACAAAATCCAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
153 >chrM_3945_4422_1:2:0_0:1:0_64/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
154 AGTCCTCCTCATGCCCCAATGAAAATAGAAGTAATTGCTAGTATTAAAATGATAGTAGAGTTGAGTAGCG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
155 >chrM_3945_4422_1:2:0_0:1:0_64/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
156 TCACAATCTTCTTAGGTCCTGTAATCACAATATCCAGGACCAACCTAATACTGATATGAGTATGCCTGGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
157 >chrM_3998_4489_2:1:0_1:1:0_be/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
158 ATATGAGAAGGCCTGGAATTCCGCCAACTAGCAATTATCCCCATACTAATCAACAAAAAAAACCCACGAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
159 >chrM_3998_4489_2:1:0_1:1:0_be/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
160 TGCTAATATTCATCCTATGTGGGCAATTGATGAATAGGGTATAATTTTTCGTATTTGTGTTTGGTTAAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
161 >chrM_4007_4449_2:0:0_3:1:0_17/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
162 GTCCTGGAATTCAGCCTACTAGCACTTATCCCCATACTAATCAACAAAAAAAACCCACGATCAACTGAAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
163 >chrM_4007_4449_2:0:0_3:1:0_17/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
164 ATAATTTTTCGTATTTGTGTTTGGTTAAATCGTCCTGATGCCCCTATGAAAATAGAAGTACTTGCTAGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
165 >chrM_4079_4594_1:0:0_3:0:0_28/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
166 GATGGTTATAGCGTTATTTAGTATAAGTGCTATGAATCTAGGGGCTGTAAGAATCATATAGATTATGAGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
167 >chrM_4079_4594_1:0:0_3:0:0_28/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
168 GCAACAAAATACTTCGTCACACAAGCAACAGCCTGAATAATTATCCTCCTGGCCATCGTACTCAACTATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
169 >chrM_4139_4621_1:0:0_4:0:0_7e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
170 CTCAACTATAAACAACTAGGAACATGAATATTTCAACAACAAACAAACTGTCTTATCCTTAACATAACAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
171 >chrM_4139_4621_1:0:0_4:0:0_7e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
172 TTTATTTCATAGAAGTGCGATTGAGTTGATGGATATAGATTTATTTAGTATAAGTGCTAAGAATATAGGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
173 >chrM_4140_4598_2:0:0_2:0:0_12/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
174 AGATGATGGTTATAGAGTTATTTAGTATAAGTGCTATGAATAAAGGGGCTGTAAGAATAATATAGATTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
175 >chrM_4140_4598_2:0:0_2:0:0_12/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
176 TCAACTATAAACAACTAGGAACATGAATATTTCAACAAGAAACAAACGGTCTTATCCTTAACATACCATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
177 >chrM_4200_4733_4:0:0_0:1:0_6f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
178 ACATCAGATTAATAGCCCTAACCATAAAACTAGGCCTCGCCCCATTCCACTACTGATTACCAGAAGTAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
179 >chrM_4200_4733_4:0:0_0:1:0_6f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
180 GGTTTTTTATAAGTTCTGTGATGATAATTCATTTTGGTAAGAATCCTGTTAGTGGTGGAAGGCCTCCTAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
181 >chrM_4256_4777_1:0:0_2:2:0_66/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
182 TTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATTCTTGTTACATGACAAAAAATTGCTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
183 >chrM_4256_4777_1:0:0_2:2:0_66/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
184 TAGTAGAGCTACTATTGCTATGAGTGTTGCAATAATTAGACAGTGGTTTTTTATAAGTTCTGTGATGATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
185 >chrM_4306_4893_3:0:0_3:1:0_83/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
186 GAAAATATTAGGTTATGTTTAGTTTTTGTTTGGTGAGTTATTAATTTTGAGTTATTGTTGGTTGGCAATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
187 >chrM_4306_4893_3:0:0_3:1:0_83/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
188 TACATGACAAAAAATTGCTCCCCTATCAATTTTAAATCAAATTTACCCGCTACTCAACTGAACTATCATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
189 >chrM_4354_4860_0:1:0_1:0:1_b1/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
190 GCTACTCAACTCTACTATCATTTTAATACTAGCAATTACTTCTATTTTCATAGGGGCATGAGGAGGATTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
191 >chrM_4354_4860_0:1:0_1:0:1_b1/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
192 TGAGTTATTATTTTTGAGTTAATGTTGGTTGGAAATATTGTTAGTGAAGTGGAATAAATTAGGCGCAAGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
193 >chrM_4383_4859_1:1:0_0:0:1_90/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
194 TAGCAATTACTTCTATTTTCATAGGGGCATTAGGAGGATTTAACCAAACACAAATACGAAAAATTATAGC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
195 >chrM_4383_4859_1:1:0_0:0:1_90/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
196 GAGTTATTATTTTTGAGTTATTGTTGGTTGGAAATATTGTTAGTGAAGTGGAATAAATTAGGCGCAAGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
197 >chrM_4425_4987_2:0:0_2:3:0_35/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
198 GCTTTGATTGCTCGCGGACTGGTAAATCCTAACCTTCTAGGTAATTAGTTGGGGGGCTAGGGGTAGGGTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
199 >chrM_4425_4987_2:0:0_2:3:0_35/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
200 ACCAAACACAAATACGACAAATTCTAGCCTATTCATCAATTGCCCACATAGGATGAATATTAGCAATTCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
201 >chrM_4427_4991_1:0:0_3:3:0_7/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
202 CAAACACAAATACGAAAAATTATAGCCTATTCATCAATTGCCCACCTAGGATGAATATTAGCAATTCTTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
203 >chrM_4427_4991_1:0:0_3:3:0_7/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
204 TATTGCTTTGATGGGTCGCGGACTGGTATATCCTAACCTTCTAGGTAATTAGTTGGGGGGCTAGGGGTAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
205 >chrM_4480_4986_1:1:0_2:3:0_98/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
206 AAAATTAGCAATTCTTCCTTACAACCCATCCCTCACTCTACTCAACCTCATAATGTATATTATTCTTACA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
207 >chrM_4480_4986_1:1:0_2:3:0_98/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
208 CTTTGATGGCTCGCTGACTGGTAAATCCTAACCTTCTAGGTAATTAGTTGGGGGGCTAGGGGTAGGGTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
209 >chrM_4484_4978_1:2:0_1:2:0_3d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
210 GCTCGCGGACTGGTATATCCTAACCTTCTAGGTAATTAGTTGGGGGGCTCGGGGTAGGGTTATTGTGCTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
211 >chrM_4484_4978_1:2:0_1:2:0_3d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
212 TTAGCAATTCTTCCTTAGAACCCATCCCTCACTCTACTCAACCTCATAATGTATATTATTCTTACATCCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
213 >chrM_4491_4937_1:0:0_1:1:0_5e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
214 TTCTTCCTTACAACCCATCCCTCACTCAACTCAACCTCATAATCTATATTATTCTTACAGCCCCTATATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
215 >chrM_4491_4937_1:0:0_1:1:0_5e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
216 GGGGGGCTAGGGGTAGGGTTATTGTGCTTATGATAGCTAGGGTGGAAAATATTAGGTTAGGTATAGTTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
217 >chrM_4627_5166_2:0:0_2:1:0_13/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
218 AGCAATACTACCTATAATCTCAGTGATATTACTATCCCTAGGAGGCCTTCCACCACTAACAGGATTCTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
219 >chrM_4627_5166_2:0:0_2:1:0_13/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
220 GTATAAGTAGATTGAAGCCAGTAATAGGGTATTTAGCTGTTACCTAAATTTTCGTCGGTTTAATTCCTGC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
221 >chrM_4810_5337_0:1:0_0:3:0_9c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
222 CACTTCACTAACAATATTTCCAACCAACAATAACTCAAAAATAATAACTCACCAAACAAAAACTAAACCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
223 >chrM_4810_5337_0:1:0_0:3:0_9c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
224 TAATCAACATAGGTAAAATGGCTGAGTAAGCATTAGACTGTAATTCTAAACACAGAGGTTTAAAACCTCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
225 >chrM_4842_5304_1:1:0_0:2:0_41/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
226 CCTCAAAAATAATAACTCACCAAACAAAAACTAAACCTAACCTAATATTTTCCACCCTAGCTATCATAAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
227 >chrM_4842_5304_1:1:0_0:2:0_41/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
228 TAGACTGTAATTCTAAACACAGAGGTTTAAAACCTCTTTTTACCAGAGGTCTTAAGGTGATATTCATGTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
229 >chrM_4918_5435_0:2:0_1:1:0_74/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
230 TAAAATACTTAGTGCAGTACCCACTATTCCCGCTCAGGCTCCGAATAGTAGAAAGAGGGTTCGGATATCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
231 >chrM_4918_5435_0:2:0_1:1:0_74/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
232 AACCCTACCCCTAGCCCCCCAACTAATTACCTAGAAGGTTAGGATATACCAGTCCGCGAGCCTTCAAAGC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
233 >chrM_5340_5854_0:1:0_0:0:0_a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
234 ATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
235 >chrM_5340_5854_0:1:0_0:0:0_a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
236 CGTTGATTAGTCTCAACCAATCACAAAGATATCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
237 >chrM_5403_5984_0:0:0_1:2:0_ab/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
238 GAAAGTTTTGTTTAGGTTGCGGTGTGTTAGTAGTATAGTAATGCCTGCGGCTAACACTGGTAGTGATAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
239 >chrM_5403_5984_0:0:0_1:2:0_ab/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
240 GCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
241 >chrM_5451_5933_2:1:0_1:1:0_57/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
242 TAACACTTGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
243 >chrM_5451_5933_2:1:0_1:1:0_57/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
244 GGTCAACCAGGTGCACTTTTAGGAGATGACCAAAAATACCATGTTATCGTAACTGCCCATGCTTTTGTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
245 >chrM_5499_5905_2:3:0_1:0:0_2f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
246 ACGGGTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
247 >chrM_5499_5905_2:3:0_1:0:0_2f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
248 GTAACTGCCCATGCTTTTGTAATAATTTTCTTCCTAGTAATACCAATAATAATTGGGGGCATTGGCAACT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
249 >chrM_5540_5928_2:2:0_1:0:0_2d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
250 ACCAATAATAATTGGTGGCTTTGGCAACTGACTTGTCCCACTAATAATCGTAGCCCCAGATATAGCATTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
251 >chrM_5540_5928_2:2:0_1:0:0_2d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
252 CTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCCGACAAATAGTGGAGTTTGATACTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
253 >chrM_5583_6032_2:0:0_3:1:0_2b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
254 ATACTCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGAGTCCTACCACCATCAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
255 >chrM_5583_6032_2:0:0_3:1:0_2b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
256 GAACAGATGCTGGTAGAGAATTGTGTCCCCTCCTCCCGCGGGATCACAGAAAGTTGTGTTTAGGTTGCTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
257 >chrM_5615_6110_2:1:0_0:3:0_14/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
258 GTAGTAAGTAACTACATGTGAAATAATTCCAAATCCTGGGAGGATAAGAAAAAAAACTTCTGGGTGCCCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
259 >chrM_5615_6110_2:1:0_0:3:0_14/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
260 AATAACTAATATAAGTTTTTGACTCCTACCACCATCCTTTCTCCTTCTCCTAGCATCATCAATAGTAGAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
261 >chrM_5645_6067_1:2:0_1:3:0_1c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
262 ACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAGGCAGGAGTAGGAACATGATGAACAGTCTAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
263 >chrM_5645_6067_1:2:0_1:3:0_1c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
264 ATAAGAAAAAAAACTTCTGGGTGCCCCAAGAATCAGAACAGATGCAGGTAGAGAATTGGGTCCCCTCCTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
265 >chrM_5770_6257_3:0:0_1:2:0_46/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
266 TCTCCCTTCATTTAGCAGGAGTGTCATCTATTTTAGGTGCAATTACTTTTATTACCACTATTCTCAACAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
267 >chrM_5770_6257_3:0:0_1:2:0_46/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
268 TATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATATAATCCTCCTGTGAATAAGTGGTGGGCTCAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
269 >chrM_5831_6292_0:0:0_1:0:0_15/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
270 CTAAATACTTTGACACCGGTAGGACTTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
271 >chrM_5831_6292_0:0:0_1:0:0_15/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
272 TATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
273 >chrM_5910_6386_0:2:0_1:1:0_1e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
274 TAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCAGTTAAAATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
275 >chrM_5910_6386_0:2:0_1:1:0_1e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
276 CTCCTATTATCACTACCAGTGTTAGCCGCAGGCATTACTATACTACTAACACACCGCAACCTAAACACAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
277 >chrM_5930_6421_2:3:0_1:1:0_2e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
278 GTTAGCCGCAGGCATTACTATACTACTACCAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCGGGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
279 >chrM_5930_6421_2:3:0_1:1:0_2e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
280 ATGTCAAGGGATGAGTTGGATAAAGCAATTCCGGTTAGACCACCAACTGTAAATAAGAAACTAAAGCCTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
281 >chrM_5959_6526_0:2:0_1:2:0_c5/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
282 AATAATGTGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTCCTCCCATTGATGGAACATAGTGGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
283 >chrM_5959_6526_0:2:0_1:2:0_c5/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
284 CACACCGCAACCTAAACACAACTTTCTTTGATCCCGCGGGAGGAGGGGACCCAATTCTCTACCAGCATCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
285 >chrM_6074_6685_2:0:0_0:2:0_a3/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
286 AGGATTTGGAATTATTTCACATGTAGTTACTTACTACTCCGGCAACAAAGAACCTTTCGGCTATATAGGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
287 >chrM_6074_6685_2:0:0_0:2:0_a3/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
288 ACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
289 >chrM_6138_6598_0:0:0_1:2:0_6e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
290 GTTATGTTCACTCCTACGAATATGAAGTCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
291 >chrM_6138_6598_0:0:0_1:2:0_6e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
292 ATAGGAATAGTATGAGCAATAATGTCTATTGGCTTTCTAGGCTTTATTGTATGAGCCCACCACATATTCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
293 >chrM_6228_6791_1:0:0_0:0:0_ae/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
294 ACACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTAAGCTGAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
295 >chrM_6228_6791_1:0:0_0:0:0_ae/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
296 AGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
297 >chrM_6246_6734_0:0:0_1:0:0_69/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
298 TCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
299 >chrM_6246_6734_0:0:0_1:0:0_69/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
300 GATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCGTATAGAAGAGACAGTGTTTCATGTGGTGTAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
301 >chrM_6261_6802_2:0:0_2:0:0_87/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
302 ATGGCAATTCCTACCGGAGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
303 >chrM_6261_6802_2:0:0_2:0:0_87/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
304 AAATTTGTTGAAGCATACGATACTGATCTTACTTCTCGTTTTGAAGCAAAGGCGTCTCAAATTATAAAGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
305 >chrM_6356_6909_2:1:0_4:0:0_72/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
306 CTTTATTTTCTTATTTACCGTTGGTGGTCTAACCGTAATTGCTTTATCCAACTCATCCCTTGACATCGTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
307 >chrM_6356_6909_2:1:0_4:0:0_72/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
308 ATGAAAGCAATTTTAGGTGGTTCGATTGCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
309 >chrM_6366_6887_1:1:0_3:0:0_85/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
310 TTATTTACAGTTGGTGGTCTAACCGTAATTGCTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
311 >chrM_6366_6887_1:1:0_3:0:0_85/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
312 CGATTCCTTCCTTTCTTAATTTACTATTACATAGGTTGGTTCCTCGAATGTGTGATATTGTGGAGGGCAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
313 >chrM_6367_6804_0:1:0_1:1:0_5d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
314 CTAAATTTGTTGAATCATACGATACTGATATTACTTATCGTTTTGAAGCAAAGGCCTCTCAAATTATAAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
315 >chrM_6367_6804_0:1:0_1:1:0_5d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
316 TATTTACAGTTGGTGGTCTAACCGGAATTGCTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
317 >chrM_6458_6985_2:2:0_1:0:0_b5/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
318 CCACTATGTTCCATCAATGGGAGGAGTGTTTGCAATCATAGCAGGATTTGTTCACAGATTCCCATTATTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
319 >chrM_6458_6985_2:2:0_1:0:0_b5/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
320 ATTTAACTTTGACAAAGTTATGTAATTGATTTTACTAATATCTTATTGAGAAAGACATATATGATATGAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
321 >chrM_6510_7029_2:1:0_1:0:0_16/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
322 CACTGATTCCCATTATTTTCCGGGTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCTTCATAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
323 >chrM_6510_7029_2:1:0_1:0:0_16/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
324 TGGCATGGGTAGGCCATATAAGATATATAGATTATTGATCTATAATTTAACTTTGACAAAGTTATGTAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
325 >chrM_6514_6987_2:1:0_1:0:0_8/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
326 TAATTTAACTTTGACAAAGTTATGTAATTGATTTTACTAATATCTTATTGAGAAAGACATATCGGATATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
327 >chrM_6514_6987_2:1:0_1:0:0_8/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
328 GATACCCATTATTTTCAGGCTTCACCCTAGATGACACAAGAGCAAAAGCCCACTTCGCCTTCATATTCGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
329 >chrM_6719_7233_1:0:0_4:1:0_b0/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
330 TGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGATAAGTAATATCAGTATCGTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
331 >chrM_6719_7233_1:0:0_4:1:0_b0/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
332 ATAAGGATTACAGCTGGTAGCCTAGTTCAAATGGTTACAACTACTAGTGCATCTATTGTGCTTGTATGTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
333 >chrM_6720_7201_2:1:0_1:0:0_b8/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
334 TTTCTCATCATGATCTTTATAATTAGAGAGGCCTTTGCTTCAAAACGATAAGTAATATCAGTATCGTATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
335 >chrM_6720_7201_2:1:0_1:0:0_b8/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
336 GGTTTCAACTTCTTGTGCATCTATTGTGCTTGTATGTGTTAGTTTTGTTTTTAATATTAGCGAGATGATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
337 >chrM_6845_7289_0:0:0_4:0:0_5c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
338 GGAACCAACCTATGTAAAAGTAAAATAAGAAAGGAAGGAATCGAACCCCCTAAAATTGGTTTCAAGCCAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
339 >chrM_6845_7289_0:0:0_4:0:0_5c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
340 GGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGATAGGTGAGAGCCATTATGATAAGGATTACATC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
341 >chrM_6864_7309_1:0:0_0:0:0_a6/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
342 GTAAAATAAGAAAGGAAGGAATCGAACCCCCTAAAATTGGTTTCAAGCCAATCTCATATCCTATCTGTCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
343 >chrM_6864_7309_1:0:0_0:0:0_a6/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
344 GGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
345 >chrM_6938_7424_2:0:0_1:0:0_b4/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
346 CTTCTAGCAGTCGTAGTTCACCAGGTTTTCGGTCGTTTGTTGGGATTATATATGAATCAAAGCATAGGTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
347 >chrM_6938_7424_2:0:0_1:0:0_b4/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
348 CAATAAGATATTCGTAAAATCAATTACATAACTTTGTCAAAGTTAAATTATAGATCAATAATCTAAATAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
349 >chrM_7046_7557_1:0:0_2:2:1_c6/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
350 GCCACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTATTCCTAATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
351 >chrM_7046_7557_1:0:0_2:2:1_c6/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
352 GCTTGATTTATTCGGCCTGGGTTGCATCAGTTTAAAGTCCTAGGGAGGGGACTGCTCGTGAGTGGAGGAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
353 >chrM_7156_7672_2:1:0_0:0:0_53/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
354 AAACCTAACACATACAAGCACAATAGATGCACTAGAAGTTGAAACCATTTGAACTATTGTACCAGCTGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
355 >chrM_7156_7672_2:1:0_0:0:0_53/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
356 TTCGAAATATTTTAGTGGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
357 >chrM_7188_7644_1:1:0_2:1:0_a9/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
358 AGGACAATGGGCATAAAGCTATGGTTCGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
359 >chrM_7188_7644_1:1:0_2:1:0_a9/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
360 TAGAAGTTGAAACCATTTGAACTATTCTAGCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
361 >chrM_7223_7762_2:1:0_1:1:0_a1/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
362 ACAATGGAGATATTAAGGTCTCTAACTTTAACTTAAAAGGTTAACGCTCTTAGCTTCATAGTGAAATTAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
363 >chrM_7223_7762_2:1:0_1:1:0_a1/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
364 GTAATCCTTCTCATAATTGCTCTCCCCTCTCAACGCATTCTATATATAATAGACGAAATCAACAACCCCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
365 >chrM_7258_7724_0:1:0_0:0:0_10/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
366 CATTCTATATATAATAGACGAAATCAACAACCCCTTATTAACCGTTAAAACCATAGGGCACCAATGATAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
367 >chrM_7258_7724_0:1:0_0:0:0_10/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
368 GGTTAACGCTCTTAGCTTCATAGTGAAATTAAATTATTGAAGCAGATCAGTTTTCGAAATATTTTAGTGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
369 >chrM_7339_7816_1:0:0_3:4:0_43/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
370 AATTGATGAGATAATTGTGATAATTCATGTTGAAGTATCTAGTTGTGGGTTAGCACAATGGAGATTTTAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
371 >chrM_7339_7816_1:0:0_3:4:0_43/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
372 ATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACCAACGACCTAAAACCTGGTGAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
373 >chrM_7358_7894_0:0:0_1:0:1_bc/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
374 TTTTAGGATTTTGGTGAAGGTGCCAGTGGGAATGTTTGTGATGAGACTTTTAGTTGAAATAAGATAAATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
375 >chrM_7358_7894_0:0:0_1:0:1_bc/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
376 CTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
377 >chrM_7550_8033_2:2:0_0:0:0_26/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
378 AATCAAGCAACAGCAACATCCAACGGACCCGGGTTATTCTATGGCCAATGCTCTGAAATTTGTGGATCTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
379 >chrM_7550_8033_2:2:0_0:0:0_26/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
380 CGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAATGATGGCTACAACGATTGGGAATCCTATTATTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
381 >chrM_7668_8147_1:1:1_1:2:1_6b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
382 TCGAAAACTGATCTGCTTCAATCATTTAATTTCACTATGAAGCTAAGAAGCGTTAACCTTTTAAGTTAAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
383 >chrM_7668_8147_1:1:1_1:2:1_6b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
384 GACACAATTATTAGGGTTCATGTTCGCACTTTTGGTGGTGGATTAGCATTATTTGTTTGATAATAAGTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
385 >chrM_7728_8283_1:4:0_2:0:0_1b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
386 GTGTCGGAAGCCTGTAATTACGGCTCCATCTCCTAGTGGAATGGCTATACTTAGATTTATGGATAGTTGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
387 >chrM_7728_8283_1:4:0_2:0:0_1b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
388 TAAGTTAAAGTTAGAGACCTAAAAATCTCCATTGTGCTAAGCCACAACTAGATACATCAACATGAATTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
389 >chrM_7785_8278_5:1:0_2:0:0_99/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
390 GGAAGCCTGTAATTACGGCTGCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATATTTGGGTAGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
391 >chrM_7785_8278_5:1:0_2:0:0_99/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
392 CAACATGAATTATCCCAATTATCTCATGAATAAATACCCTATTTATCATATTTCAACTAAAAGTCACATC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
393 >chrM_7788_8291_0:0:0_3:1:0_86/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
394 TTAAGTTTGTGTCGGAAGCCTGTAATTAGGGCTCCAGCTCATAGGGGAATGTCTATACTTAGATTTATGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
395 >chrM_7788_8291_0:0:0_3:1:0_86/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
396 CATGATTTATCACAATTATCTCATCAATAATTACCCTATTTATCTTATTTCAACTAAAAGTCTCATCACA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
397 >chrM_7835_8385_1:0:1_2:0:0_c7/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
398 TGGTAGAATAAATAGGCTAATTGTTTCAATAATAATAATTATTGGAATTAGTGAAATTGGAGTTCCTTGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
399 >chrM_7835_8385_1:0:1_2:0:0_c7/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
400 TTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCCCCTTCACCAAAATCCTAACAACCATAAAAGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
401 >chrM_7872_8415_2:0:1_1:0:0_1a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
402 GTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATCATAATAAGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
403 >chrM_7872_8415_2:0:1_1:0:0_1a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
404 CACCTTCACGAAAATCCTAACAACGATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
405 >chrM_7939_8482_1:1:0_2:0:0_25/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
406 GGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTATGTGTATTAATAAGTGTCCTGCAGAAATGTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
407 >chrM_7939_8482_1:1:0_2:0:0_25/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
408 CTATTTACCTCATTCATTACCCCAACAATAATAGGAATCCCAATCGTTGTAGCCATCATTATATTTCCTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
409 >chrM_7964_8497_0:0:0_2:0:0_8c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
410 CAATAATAGGATTCCCAATCGTTGTAGCCATCATTATATTTCCTTCAATCCTATTCCCATCCTCAAAACG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
411 >chrM_7964_8497_0:0:0_2:0:0_8c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
412 TGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTCGCTCCTCCGATTAGGTTTATTAATAAGTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
413 >chrM_8325_8781_1:0:0_2:0:0_9d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
414 TCCAATTTCACTAATTCCAATACTTATTATAATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
415 >chrM_8325_8781_1:0:0_2:0:0_9d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
416 GTCATCATTGATATATTGTGATGATATTGGTGAGTAGGCCAAGGGTTAATAGTGTCATTGAATTATAGTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
417 >chrM_8419_8906_1:0:0_3:0:0_9f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
418 CGGTGAGAAGAATGCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
419 >chrM_8419_8906_1:0:0_3:0:0_9f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
420 ACTGCAGGACACTTATTAATACACCTAATCGGAGGCGCTACTCTAGTATTAATAAATATTAGCCCACCAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
421 >chrM_8733_9211_0:0:0_0:0:0_47/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
422 TTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAGACGTAATTCGTGAAGGAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
423 >chrM_8733_9211_0:0:0_0:0:0_47/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
424 CCAGTAGCCATGAAGAATGTAGAACCATAGATACCATCTGAAATGGAGAATGATGTTTCAAAGTATTCTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
425 >chrM_8761_9187_1:1:0_0:0:0_ba/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
426 CCATAGATACCATCTGAAATGGAGAATGATGTTTCAAAGTATTCTGAAGCTTGGAGGATGGTGAAGTAAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
427 >chrM_8761_9187_1:1:0_0:0:0_ba/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
428 TCACAATATATCAATGATGACGAGACGTAATTCGTGAAGGAACCTAACAAGGCCACCACACTCCTATAGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
429 >chrM_8781_9305_4:1:0_3:0:1_3e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
430 TAAGTGATGTTTTGATGTGCAGTGAAATTTTAGTTTTCTAGTAGGCAAACAATAAGGAATGTTGATCCAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
431 >chrM_8781_9305_4:1:0_3:0:1_3e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
432 CGATACGTAATTCGTGAAGTAACCTAACAATGCCACCACACTCCTATAGTACAAAAAGGACTACGATATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
433 >chrM_8794_9257_1:1:0_1:0:0_79/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
434 AAGAATAAGGAATGTTGATCCAATAATTACATGGAGTCCATGGAATCCAGTAGCCATGAAGAATGTAGAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
435 >chrM_8794_9257_1:1:0_1:0:0_79/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
436 GTGAAGGAACCTAACAAGGCCACCACACTCCTCTTGTACAAAAAGGACTACGATATGGTATAATTCTATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
437 >chrM_8863_9244_0:0:0_1:0:0_92/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
438 GTTGATCCAATAATTACATGGAGTCCATGGAATCCAGTAGCCATGAAGAATGTAGCACCATAGATACCAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
439 >chrM_8863_9244_0:0:0_1:0:0_92/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
440 TCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATCATTCTAGCCTCGTACCAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
441 >chrM_8886_9293_2:1:0_0:0:1_a2/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
442 TTTGGAGGATTCTTCTGAGCGTACTATCATTATAGCCTCGTACCAACACATGATCTAGGAGGCTGCTGAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
443 >chrM_8886_9293_2:1:0_0:0:1_a2/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
444 TGATGTGAAGTGAAATTTTAGTTGTCTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
445 >chrM_9031_9522_3:3:0_2:0:0_84/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
446 ATGGAACTAGAATTAGCGTTAGGGATAATAAAATATTAATGAAGATAACAGTGTACATGTTAATTACTCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
447 >chrM_9031_9522_3:3:0_2:0:0_84/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
448 TTTCAATTACATGCCCTCATCATAGCAATATAGAAGGTAAACGAAACCACATAAATCAAGCCCTCCTCAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
449 >chrM_9032_9593_1:2:1_1:0:0_b2/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
450 TTCATTACATGACCTCATTATAGCCTTATAGAAGGTAAACGAAACCACATAAAACAAGCCCTACTAATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
451 >chrM_9032_9593_1:2:1_1:0:0_b2/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
452 GCTTGTAGGGTCGAATCCGCATTCATATGGATTTGCTTTTTCAGAGTACAGATTTATTTGGGGGAGTCAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
453 >chrM_9038_9471_1:3:0_1:1:0_8a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
454 TGTACAGGTTAATTACTCTGTTCTGGGTTTATTCAGAATCTACTAATTGGAAGTCAGTTCTATTAATTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
455 >chrM_9038_9471_1:3:0_1:1:0_8a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
456 TACATGACGTCATCATAGCAATATAGAAGGTAAACGAAACCACATAAATCAAGCCCTACTAATTACCATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
457 >chrM_9120_9714_1:1:0_0:1:0_88/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
458 TACTTCACCATCCTCCAAGCTTCAGAATACATTGAAACACCATTCTCCATTTCAGATGGTATCTATGGTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
459 >chrM_9120_9714_1:1:0_0:1:0_88/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
460 TAGAGGTTTTAATTGTTTGAATTGCTCATGGTAGTGGAAGTAGAAGAGCAATTTTTAGGTCAAATAATAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
461 >chrM_9142_9548_1:1:0_1:2:0_77/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
462 CAGAATACTTTGAAACACCATTCTCGATTTCAGATGGTATCTATGGTTCTACATTCTTCATGGCTACTGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
463 >chrM_9142_9548_1:1:0_1:2:0_77/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
464 GTACAGATTTATTTGGGGGAGTCAGAAAGCAACTAGAATTAGCGTTAGGGATAAAGAAATATTAATGAAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
465 >chrM_9150_9818_1:1:0_1:1:0_bf/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
466 TTTGAAACACCATTCTCCATTTCAGATGGTATCTAAGGTTCTACATTCTTCATGGCTACTGGATTCCATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
467 >chrM_9150_9818_1:1:0_1:1:0_bf/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
468 ACTAATTACGATTCACTCTGTTCATTCTAATCCTTTTTGTGTTCATTCATATGCTAGGCCTAGAGATAGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
469 >chrM_9222_9781_2:0:1_1:0:0_23/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
470 CTCCATGTAATTATTGGATCAACATTCCTTCTAGTTTGCCTACTAGACAACTAAAATTTCACTTCACATC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
471 >chrM_9222_9781_2:0:1_1:0:0_23/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
472 TGTGTTCATTCATATGCTAGGCCTAGAGATAGAATTGTGACTAGACTAAAGGCTATAATTATTATAGTAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
473 >chrM_9409_9920_3:1:0_1:0:0_d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
474 GATAGAGAGAAGGCTATGGTGAGGTTGAAGAAGGTAGATGGCATATTGGTAATTATGAACATCATCATAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
475 >chrM_9409_9920_3:1:0_1:0:0_d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
476 ATATCACTGACTTCCAATTAGTAGATTCTGAATAAACCCAGCACAGAGTAATTAACCTGTAGACTGTTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
477 >chrM_9496_9991_0:0:0_3:1:0_80/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
478 CTAATACTATGCCTTCCAGGCATAGTAAAGTGGATATTAGGTGAGAGCGAAATCTAAGTGTTCCTAGAAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
479 >chrM_9496_9991_0:0:0_3:1:0_80/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
480 TATCCCTAACGCTAATTCTAGTTGCATTCTGACTCCCCCAAATAAATCTGTACTCAGAAAAAGCAAATCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
481 >chrM_9505_10155_3:0:0_1:0:0_9a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
482 CGCTACTTCTAGTTGCATTCTGACTCCCCCAAATACATCTGTCCTCAGAAAAAGCAAATCCATATGAATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
483 >chrM_9505_10155_3:0:0_1:0:0_9a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
484 GAGATTTTGGACGTAATCTGTTCCGAACGTGTTTGAAACTTTTACTAGTAGGGCTAGTCCTACAGCTGCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
485 >chrM_9647_10116_2:0:0_1:2:0_2a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
486 ATTATTTGACCTAGCAATTGCTCTTCTACTTCCACTACCATGAGCAATTCAAACAATTAAAACCTGTACT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
487 >chrM_9647_10116_2:0:0_1:2:0_2a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
488 TTTTACTAGTAGGGCTAGTCCTACAGCTGCTTCTCAGGCTGCGAAAACTACGATGGTGATGGGGAATGGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
489 >chrM_9735_10262_1:0:0_1:2:0_40/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
490 AAAACTATATGAGGTTACGTTTGTGCAGGTATTTTTAGGGCTTGATAGTCAGGTTAGTGGGAGTAGCATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
491 >chrM_9735_10262_1:0:0_1:2:0_40/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
492 ATTCTAGTCACAATTCTATCTCTAGGCCTAGCATATGAATGAACACAAAAAGGATTAGAATGAACAGATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
493 >chrM_9897_10466_3:1:0_1:0:2_1/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
494 CCTCACCATAGCCTTCTCACTATCACTACTAGGAACACTTATATTTCGCTCACACCTCATATCCACATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
495 >chrM_9897_10466_3:1:0_1:0:2_1/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
496 GATTAGTCTTGAGATGTAGAGTTTTTGTAGTACGTTATTATCTTTTTTTAGGTGGTTGGCTAGCTATTAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
497 >chrM_9907_10368_2:0:0_1:0:0_c2/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
498 GCCTTCTCACTATCCCTTCTAGGGACACTTATATTTCGCTCTCACCTAATATCCAGATTACTATGCCTGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
499 >chrM_9907_10368_2:0:0_1:0:0_c2/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
500 AAATCATTAATGGTGTGGATAGGGGGTCTGAGGAGAATATATTTGAAAAGTTTTTATAATTTTCGTCGGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
501 >chrM_9910_10411_1:1:0_0:1:2_bb/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
502 TTCTCACTATCACTTCTAGGAACACTTATATTTCGCTCTCACCTAATATCCACATTACTATGCCAGGAAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
503 >chrM_9910_10411_1:1:0_0:1:2_bb/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
504 TTGGCTAGCTATTAATATTAGTGGCAGTAATCAGGTTGTTAAAATAATTAATGGTGTGGATAGGGGGTCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
505 >chrM_10023_10620_2:2:0_3:0:0_4/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
506 AAACTCCAACTCCATAAGCTCCATACCATTCCCCATCACGATCGTAGTTATCGCAGCCTGCGAAGCAGCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
507 >chrM_10023_10620_2:2:0_3:0:0_4/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
508 AAAATAGGAAATAAATCCCTGCGTTAAGGCGTTCAGTATGGTTCCCTCATCGGGTAATAATAATAAGTGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
509 >chrM_10106_10577_3:1:0_2:0:0_5b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
510 AACTAGTAAAAGTTTCAAACACGAACGGAACAGATTACGTCCAAAATCTCAACCTGCTACAATGGTAAAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
511 >chrM_10106_10577_3:1:0_2:0:0_5b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
512 CCCTCATCGGGTAATAATAATAAGAGTTGGGATTACGGTTGCTTCAAATAAAATATAAAATATAATTAGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
513 >chrM_10193_10658_0:2:0_1:0:0_b6/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
514 AATGCTACTCCCACTAACCTGACTATCAAGCCCTAAAAAAACCTGCACAAACGTAACCTCATATAGTTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
515 >chrM_10193_10658_0:2:0_1:0:0_b6/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
516 GAGGGCAATTAGCAGTGGAATAGAACCGATTAGGGTATAAAATAGGAAATAAATCCCTGCGTTTAGGCGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
517 >chrM_10203_10663_1:0:0_1:0:0_42/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
518 AAGATGAGGGCAATTAGCAGTGGAATAGAACCGATTCGGGTATAAAATAGGAAATAAATCCCTGCGTTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
519 >chrM_10203_10663_1:0:0_1:0:0_42/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
520 CCACTAACCTGACTAACAAGCCCTAAAAAAACCTGAACAAACGTAACCTCATATAGTTTTCTAATTAGTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
521 >chrM_10206_10702_1:0:0_3:1:0_9e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
522 CTAACCTTACTATCAAGCCCTAAAAAAACCTGAACAAACGTAACCTCATATAGTTTTCTAATTAGTTTAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
523 >chrM_10206_10702_1:0:0_3:1:0_9e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
524 AAAATACTGAGTTTTAGGGTTCCTACATGGTTTTGGATTAAGATGAGGGCAATTAGCCGTGGAATAGAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
525 >chrM_10254_10719_0:0:0_1:1:0_8e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
526 TATAGTTTTCTAATTAGTTTAACCAGCCTAACACTTCTATGACAAACCGACGAAAATTATAAAAACTTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
527 >chrM_10254_10719_0:0:0_1:1:0_8e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
528 TTTGTGTTGTGAATGATAAAATTATGAGGTTTAGGGTTCCTACATGGTTTTGGATTAAGTTGAGGGCAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
529 >chrM_10362_10821_2:1:2_0:0:0_c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
530 CTTTTGGTAGTCATAGGTGAACTCCATATAATGGTATTTTAATAAGAAATGCTATTATGCATGCCAACCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
531 >chrM_10362_10821_2:1:2_0:0:0_c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
532 ATTATTTTAACAACCTGATTACTGCCACTAATATTAATATCTAGCCAACCACCTAAAAAAAGCTAATAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
533 >chrM_10389_10966_1:0:0_1:0:0_61/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
534 CATAGGGAGAGAAGGAAGAAGGGGTATGCTATATATTTTGTTAGTGGGTCTAGAATAATGGAGATGCGAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
535 >chrM_10389_10966_1:0:0_1:0:0_61/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
536 CTAATATTAATAGCTAGCCAAAACCACCTAAAAAAAGATAATAACGTACTACAAAAAGTCTACATCTCAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
537 >chrM_10461_11010_1:1:0_0:0:0_21/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
538 AATCTGTTTGGCGTAAGCAGATTGAGCTAGTTATAATTATTCCTCATAGGGAGAGAAGGATGAAGGGGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
539 >chrM_10461_11010_1:1:0_0:0:0_21/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
540 CTAATCTGCTTACAAATTCTCCTAATCATAACCTTTTCAGCAAGTGAACTAATTATATTTTATATTTTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
541 >chrM_10767_11161_1:0:0_2:0:1_39/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
542 GAGTTTGCTAGGCAGAATAGGAGTGATGATGTGAGGCCATTTTCGATTATTAGTATTTTGCTCCTATGAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
543 >chrM_10767_11161_1:0:0_2:0:1_39/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
544 ATAGCATTTCTTATTAAAATACCATTATATGGAGTTCACCTATGACTACCAAACGCCCATGTTGAAGCTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
545 >chrM_11041_11475_1:0:0_1:1:0_7b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
546 GCCACATAGCACTTGTTCTTGCATCAATCATAATCCAAACTCCATGAAGCTTCATAGGAGCAACAATACT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
547 >chrM_11041_11475_1:0:0_1:1:0_7b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
548 TTAGTGTTAGTACTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGCTTAGTTTGCCGCGTTGGGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
549 >chrM_11195_11669_2:0:0_1:0:0_49/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
550 AGCAAGCCATGTTTTTAAACATGGAAGCATGAATTAGCAGTTCTTGCAATCTTTCTTGGTGAATAAGGAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
551 >chrM_11195_11669_2:0:0_1:0:0_49/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
552 CATGGCCCGAGGACTTCAAATGGTCATCCCACTTATAGCCACATGATGACTGATAGCAATTCTAGCTAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
553 >chrM_11211_11625_0:1:0_2:0:0_37/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
554 CAAATGGTCTTACCACTTATAGCCACATGATGACTGATAGCAAGTCTAGCTAATCTAGCTCTACCCCCTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
555 >chrM_11211_11625_0:1:0_2:0:0_37/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
556 TGCAATCTTTCTTGGTGAATAAGGAGGTTTATTTCCTGTTGTCAGATTGACAGTCTAATGATTTTTGTAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
557 >chrM_11464_11999_0:1:0_3:1:0_3a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
558 AGAGAAAAAGTTCGTTTTTAAGCATATTTTAAGTTCTATTGAATTTATGGTGACTCAGTGCCAGGTTGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
559 >chrM_11464_11999_0:1:0_3:1:0_3a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
560 AACTAACACTAATAGCCCTTCACATAATTCCACTTATTATTCTAACTACCAGTCCAAAACTAATTACAGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
561 >chrM_11475_12014_1:1:0_2:1:0_56/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
562 ATAGCCCTTCACATAATTCCACTTATTATTCTAACTACCAGTCCAAAACTAATTACAGGCCTGAGAATAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
563 >chrM_11475_12014_1:1:0_2:1:0_56/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
564 AGATGTCAACAGGATAGAGAAAAAGATAGTTTTGAAGCTTATTTTAAGTTCTATTGAATTTATGGTGACT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
565 >chrM_11715_12248_2:1:0_1:1:1_a0/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
566 TAGGGCTGCAGTATATGCGACTGTTCTCCGTACCATCATCCAATTAGTAGGAAAGATATAATTCCCACCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
567 >chrM_11715_12248_2:1:0_1:1:1_a0/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
568 ACCTTGGTGCAAATCCAAATCAAAGTAATCAATATTTTCACAACCTTAATCTTATTAATCTTCATTCTTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
569 >chrM_12064_12604_0:1:0_1:0:1_aa/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
570 GTAAATAATGTGGTTAGGGCTCCGAGGCAAAGTATAGTTGTTAAAATAAAGTTAATATTAGCGTGAGGGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
571 >chrM_12064_12604_0:1:0_1:0:1_aa/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
572 TACACTCAGACCCAAACATCAATCGATTCATTAAATATCTTACACTATTCCTGTTTACCATGCTTATCCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
573 >chrM_12113_12598_3:3:0_2:0:1_70/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
574 CCTGTTTACCATGCTTATCCTCACCTCAGCCAACCACATATTTCAACCTTTCATTGGCTGAGCAGGGTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
575 >chrM_12113_12598_3:3:0_2:0:1_70/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
576 AAAGTGGTTAGGGGTCCGAGGCAAAGTATAGTTGTTAAAATAAAGTTATTATTAGCGTGAGGGGGTGGAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
577 >chrM_12174_12610_1:1:0_0:0:1_93/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
578 GAAGGTGTGGGAATTATATCTTTCCTACTAATTGGATGATGGTACGGACGAACAGTCGCAAATACTGCAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
579 >chrM_12174_12610_1:1:0_0:0:1_93/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
580 ATAGCTGTAAATAATGTGGTTAGGGCTCCGAGGCAAAGTATAGTTGTTAAAATAAAGTTATTATTAGCGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
581 >chrM_12218_12618_2:1:1_1:1:0_32/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
582 CGGAGAACCGTCGCAAATACTGCAGCCCTACAAGCAATCCTCTATAACCGCATCTGAGACATCGGATTCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
583 >chrM_12218_12618_2:1:1_1:1:0_32/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
584 GAGCACAAATAGCTGTAAATAATGTGGTTAGGGCTCCGAGGCAAAGTATAGTTGTTAAAAAAAAGCTATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
585 >chrM_12243_12713_2:0:0_1:0:0_bd/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
586 GCCCTCCAAGCAATCCTCTATACCCGCATCGGAGACATCGGATTCATTTTAGCTATAGTTTGATTTTCCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
587 >chrM_12243_12713_2:0:0_1:0:0_bd/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
588 TAGGTGTGGTTGGTTTATTCCTAGCGTCACTATTATCAGGCCTAGTTGGCTTGAAGTAGAGAAGGCAATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
589 >chrM_12275_12781_1:0:0_1:0:1_6/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
590 ATGATTGAGCGAGAGCATATAGAAGAGTATAGCTTTGAAGAATGCGTGGGTACAGATGTGTAGGAATGCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
591 >chrM_12275_12781_1:0:0_1:0:1_6/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
592 AGACATCGGATTCCTTTTAGCTATAGTTTGATTTTCCCTAAACATAAACTCATGAGAACTTCAACAGATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
593 >chrM_12355_12806_0:1:0_1:0:0_6a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
594 GTCTTGTTCGTCTGCCAGGCTATGAATTATTGAGCCAGAGCATATAAAGAGTATAGCTTTGAAGAATGCG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
595 >chrM_12355_12806_0:1:0_1:0:0_6a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
596 ACAACAACGACAATCTAATTCCACTTAGAGGCCTATTAATCGCAGCTACAGGAAAATCAGCACAATTTGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
597 >chrM_12440_12937_5:0:0_1:0:0_8b/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
598 ATTGCTTCAATAATTAGGTCTTTTGAGTAGAACCCTGTTAGGAATGGTATTCGTGTGAGGGCGAGGCTTC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
599 >chrM_12440_12937_5:0:0_1:0:0_8b/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
600 AGCATCAGCAATAGACGGCCCTACACCAGTTTCATCACTACTACACTCAAGTACAATAGTATATGCAGGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
601 >chrM_12577_13079_0:0:0_1:1:1_11/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
602 ATTTTGGTTAATGGAGATGTAGGGGGGGAAAAGGCGGTTTTGTTATTGTTACGAAGTAAATGATTCGTAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
603 >chrM_12577_13079_0:0:0_1:1:1_11/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
604 GCCTCGGAGCCCTAACCACATTATTTACAGCTATTTGTGCTCTCACCCAAAACGACATCAAAAAAATCAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
605 >chrM_12622_13091_0:0:0_3:0:1_78/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
606 CCCAAAACGACATCAAAAAAATCATTGCCTTCTCTACATCAAGCCAACTAGGCCTGATAATAGTGACGCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
607 >chrM_12622_13091_0:0:0_3:0:1_78/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
608 GAGGTCTGGGTCATTTTCGTAAATGGAGATGTAGGTGGGGAAAACGCGGTTTTGATATTGTTACGAAGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
609 >chrM_12640_13011_2:0:0_2:1:0_62/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
610 TGCTGTACATAGCTGTCATCGAAGTGGGGATTAGTGTAATTAGTAGGGCTCAGGCGTTGGTGTTGCAGGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
611 >chrM_12640_13011_2:0:0_2:1:0_62/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
612 AAATCATTGCCTTCTCTACATCAAGCCAACTATGCCTGATAATAGTGACGCTAGGAATAAACCACCCACA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
613 >chrM_12705_13147_4:0:0_2:0:0_94/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
614 CGACACCTAGCATTCCTACACATCTGTACCCACGCAATGTTCAAAGCTATACTCTTTCTATGCTCTGGCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
615 >chrM_12705_13147_4:0:0_2:0:0_94/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
616 GAGATGACAAATCCTGCAAAGATGCTTCCGCATGCTAGGCGTTTGATTGGGTTTATGAGGTCTGGGACAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
617 >chrM_12720_13279_1:0:1_2:0:0_2/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
618 ATTGCTAGTTTTATGGTTAGGTTGTTTAGTTCTAGTGCGATTAGTAATCCTAATACTGAAATAATTAGGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
619 >chrM_12720_13279_1:0:1_2:0:0_2/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
620 CTACACATCTTTACCCACGCATTCTTCAAAGCTATACTCTTCTATATGCTCTGGCTCAATCATTCATAGC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
621 >chrM_12881_13337_0:0:0_1:1:0_89/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
622 AATAGATGGTAAAAACCCCAGTAAACTTGAGAAGGATGAATATGGATTTGCTTTATTTATTGATAGTTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
623 >chrM_12881_13337_0:0:0_1:1:0_89/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
624 CACAGGAATACCATTCCTAACAGGGTTCTACTCAAAAGACCTAATTATTGAAGCAATTAATACCTGCAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
625 >chrM_12982_13475_3:1:0_2:0:1_75/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
626 TCGCCACTTCTATGACAGCTATGAACAGCATACGACTCATTTACTTCGTAACAATCACAAAACCGCGTTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
627 >chrM_12982_13475_3:1:0_2:0:1_75/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
628 GGTTGTTAAAGTGGTTATGTTTGTGTGCAAGAGTTGCGGTGGATTTTGGGATGGTTTTTTGTAACCAGAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
629 >chrM_13142_13600_1:0:0_1:2:0_34/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
630 ATCTTTGTTTGCGGGTATTTTTGTTATTATAGAGATTACTCGAGATTAATTGAGTATAAGAAAATAATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
631 >chrM_13142_13600_1:0:0_1:2:0_34/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
632 CATCTCATATAAAATTCCACCAACCAGCATTCCAGTCCTCACAATACCATGATTTTTAAAAACCACAGCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
633 >chrM_13198_13763_2:0:0_0:1:0_7c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
634 TTTGTGTGCTTAATTATTATGATGAAGTTGGAGTAATTAATCTTGATGGTATGGGAGATTGGTTGATGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
635 >chrM_13198_13763_2:0:0_0:1:0_7c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
636 TAAAAACCACAGCCCTAATAATTTCAGTATTAGGCTTCCTAATCGCACTAGAACTAAACAACCTAACCAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
637 >chrM_13281_13783_1:1:0_1:0:0_67/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
638 AATAAAGCAAATCCATATTCATCCTTCACAAGTTTACTGGGGTTTTTCCCATCTATTATTCACCGCATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
639 >chrM_13281_13783_1:1:0_1:0:0_67/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
640 GATTATAGAGGTTTTTTTAATTTGTGTGGTTAATTATTATGATGAAGTTGGAGTAATTAATCTTGATGGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
641 >chrM_13326_13750_2:0:1_2:1:0_82/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
642 TTATTATGATGAAGTTGGAGTAATTACTCTTGATGGTATGGGAGATTGGTTGATGTATTAGGTTGATGAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
643 >chrM_13326_13750_2:0:1_2:1:0_82/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
644 TACCCATCTCTTATTCACCGCATTACACCCATAAAATTCTCAACCTAAGCCTAAAAACATCCCTAACTCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
645 >chrM_13338_13860_2:1:1_2:0:1_4d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
646 ATTCACCGCATTACACCCATAAAATTCTGAACCTAAGCCTAAAAACATCCCTGACTCTCCTAGAGTTGAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
647 >chrM_13338_13860_2:1:1_2:0:1_4d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
648 ACTGCTATAGCTACTGAGGAATATCCAGAGACATGGGGATCTAACTGATTAATTTTGGGTATTTAGTATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
649 >chrM_13482_13976_0:0:0_1:2:0_c1/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
650 TAATTGTTACTGGGTTTGTTGGTCGTTTAATGGTTTTAGGGTTTGGTTGATCGTTTTTAGGTTTAATAGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
651 >chrM_13482_13976_0:0:0_1:2:0_c1/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
652 AAAGGCTTAATTAAATTGTACTTTATATCATTCCTAATTAACATCATCTTAATTATTATCTTATACTCAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
653 >chrM_13494_14044_3:1:0_1:1:0_7d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
654 AAATTGTACATTATATCATTCCTAATTAACATCATCTTAATTATTATCTTTTACTCCAATAATCTCGAGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
655 >chrM_13494_14044_3:1:0_1:1:0_7d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
656 TTCATTATTTTCGGTTGGTTGTCTTGGGTTCGCATTAAAGCCTTCACCTATTTATGGAGGTTTAGGTTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
657 >chrM_13715_14154_1:0:0_1:1:0_96/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
658 CCATCACGATTAATTACTCCAACTTCATCATAATAATTAAGCACACAAATTAAAAAAACCTCTATAATCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
659 >chrM_13715_14154_1:0:0_1:1:0_96/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
660 TGTTTGTCATACGGTGTTTCTGTAGTTGAATTACAACGATGATTTTTCATGTCATTGGTCGCAGTTGAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
661 >chrM_13791_14330_0:0:0_3:0:0_29/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
662 GGCTGTTATTGTAACTGATGTGTAGTGAATGGCTAAGAAAAGACCTGTAATGATTTGGACTATAAGGCAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
663 >chrM_13791_14330_0:0:0_3:0:0_29/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
664 ATACTAAAAAACCCAAAATTAATCAGTTAGATCCCCAAGTCTCTGGATATTCCTCAGTAGCTATAGCAGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
665 >chrM_13813_14351_0:1:0_0:1:0_1f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
666 TCAGTTAGATCCCCAAGTCTCTGGATATTCCTCAGTAGCTATAGCAGTTGTATATCCAAACACAACCAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
667 >chrM_13813_14351_0:1:0_0:1:0_1f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
668 AATGTGTGTTACTGATGAAAAGGCTGCTATTGTATCTGATGTGTAGTGTATGGCTAAGAAAAGACCTGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
669 >chrM_13910_14543_2:1:0_1:1:0_30/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
670 ATTAAACCTAAAAACGATCCACCAAACCCTAAAACCATTAAACGAGCAACAAACCGACTAACAATTAAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
671 >chrM_13910_14543_2:1:0_1:1:0_30/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
672 AAGGAGGTAGCCTATAAATGCTGTGGCTATGACTGCGAACAGAAGAAGTACTCCAATGTTTCAGGTTTCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
673 >chrM_13936_14395_2:2:0_1:1:1_76/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
674 CCCTAAAACCATTAAACGACCAACAAACCCAGTAACCATTAAACCTAAACCTCCATAAATAGGTGAATGC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
675 >chrM_13936_14395_2:2:0_1:1:1_76/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
676 GCGTGTATATATCGGATTAGTCACCCGTAAATTAACATCTCGACAAATGTGTGTTACTGATGAAAAGGCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
677 >chrM_13940_14475_1:1:0_3:2:0_27/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
678 AAAACCATTAAACGACCAACAAACCCACTAACAATTAACCCTAAACCTCCATAAATAGGTGAAGGCTTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
679 >chrM_13940_14475_1:1:0_3:2:0_27/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
680 CTATAAATGTATCTGATCCATAATATAATCGTCGTCCGACAAGAAGGAACAAGCAAATAAAAAATATTGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
681 >chrM_13944_14351_1:1:0_0:0:0_44/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
682 AATGTGTGTTACTGATGAAAAGGCTGTTATTGTATCTGATGTGTAGTGTATGGCTAAGAAAAGACCTGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
683 >chrM_13944_14351_1:1:0_0:0:0_44/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
684 CCATTAAACGACCAACAAACCCACTAACAATTAAACCTAAACGTCCATAAATAGGTGAAGGCTTTAATGC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
685 >chrM_13991_14484_3:1:0_3:4:0_20/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
686 TAAATAGGTGAAGGCTTTAATGCTAACCCCAGACAACCAACCCAAAATAATGATCTTAAAACCAAAATAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
687 >chrM_13991_14484_3:1:0_3:4:0_20/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
688 AAGAGGTTTCTATAAATGTATCTGATCCATAATATAAGCCTCGTCGGACCTGAAGGAACAAGCAAATAAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
689 >chrM_13992_14451_1:1:0_1:3:0_52/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
690 ATAAGCCTCGTCGGAGCTGAAGGAACAAGCAAATAAAAAATATTGAGGCTCCGTTTGCGTGTATATATCG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
691 >chrM_13992_14451_1:1:0_1:3:0_52/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
692 AAATAGGTGAAGGCTTTAATTCTAACCCAAGACAACCAACCAAAAATAATGATCTTAAAACAAAAATATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
693 >chrM_14052_14489_0:0:0_3:4:0_4c/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
694 CAAAAATATAATTATTCATTATTTCTACACAGCATTCAACTGCGACCAATGACATGAAAAATCATCGTTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
695 >chrM_14052_14489_0:0:0_3:4:0_4c/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
696 AATGTTTCAGGTAACTATAAATGTATCTGATCCATAATATAAGCCTCGTCGGACCTTAAGGAACAAGCAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
697 >chrM_14105_14613_0:0:0_2:0:0_48/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
698 ATGAAAAATCATCGTTGTAATTCAACTACAGAAACACCTAATGACAAACATACGAAAAACACACCCATTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
699 >chrM_14105_14613_0:0:0_2:0:0_48/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
700 CAATATATGGGATGGCAGATAGGAGGTTTGTAATAACTGTGGCACCTCAGAATGATATTTGTCCTCATTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
701 >chrM_14128_14614_0:1:0_1:1:0_97/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
702 AACTACAGAAACACCGAATGACAAACATACGAAAAACACACCCATTATTTAAAATTATTAACCACTCATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
703 >chrM_14128_14614_0:1:0_1:1:0_97/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
704 CCAATATCTTGGATGGCTGATAGGAGGTTTGTAATAACTGTGGCACCTCAGAATGATATTTGTCCTCATG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
705 >chrM_14131_14628_2:1:0_2:1:0_36/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
706 TACAGAAACACCGAATGACAAACATACGACAAACACACCCATTATTTAAAATTATAAACCACTCATTCAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
707 >chrM_14131_14628_2:1:0_2:1:0_36/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
708 CGACTAGGGTTGTTCCAATATATTGGATGGCTGATAGGAGGATTGTAATAACTGTGTCACCTCAGAATGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
709 >chrM_14312_14826_2:1:1_4:1:0_a4/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
710 CTTTGATTTTATAGTAGGGGTGAAATGGACATTTATCTGCATCTGAGAATAATCCTGTTGGGTTGTTTGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
711 >chrM_14312_14826_2:1:1_4:1:0_a4/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
712 ATCAGATAGAATAACAGCCTTTTCATCAGTAACACACATTTGTCGATATGTAAATTTACGGGTGACTAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
713 >chrM_14442_15026_1:2:0_3:0:0_60/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
714 CGAGGCTTATATTATGGATCAGATACATTTATAGAAACCTGAAACATTGGAGTACTTCTTCAGTTCGCAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
715 >chrM_14442_15026_1:2:0_3:0:0_60/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
716 TAAGGCTATGACACCTCCTAGTTTCTTGGGGATTGAGGGTAGAATGGCGTATGCAAATAGGAAATATCAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
717 >chrM_14576_14894_2:0:0_0:0:0_5f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
718 AGTTATTCCAAACCTCCTATGAGCCATCCCATATATTGGAACAACCCTAGTCGAATGAATTTGAGGGGGC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
719 >chrM_14576_14894_2:0:0_0:0:0_5f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
720 TAGTATGTCTGGGAAAAATAATACTAGGGTTATGAGAATTAAGAATATGATTAGGATACCTAGGATATCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
721 >chrM_14707_15163_1:1:0_1:2:0_9/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
722 TTATCGGGGCCCTAGCAATCGTTCACCTCATCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
723 >chrM_14707_15163_1:1:0_1:2:0_9/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
724 CCCCCAATTCAGGTTACGATAAGTAGGTTGGCTACTAGGATTCAGTACAAAATTTTTCTGATTGGGCGGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
725 >chrM_14728_15189_1:2:0_2:0:0_7a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
726 TTCACCTCATCTTCCTCCACGAAACAGGATCAAACCACCCAACAGGATTATACTCAGATGCAGATAAAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
727 >chrM_14728_15189_1:2:0_2:0:0_7a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
728 TAATAAATGGGTGTTCTCCTGGTTGGCCCCCAATTCAGGTTAAGATAAGTAGGTTGGCTACTAGGAATCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
729 >chrM_14768_15298_0:1:0_1:1:0_ac/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
730 CTATCAAGACATGGATATAATTTTAGTATTTTGTCTTCGATAAGTCCTGAGCTTGGTATAAGAATTAAGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
731 >chrM_14768_15298_0:1:0_1:1:0_ac/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
732 AACAGGATTATACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
733 >chrM_14794_15314_1:0:0_1:0:0_c0/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
734 AAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATTCTTAATTCTGAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
735 >chrM_14794_15314_1:0:0_1:0:0_c0/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
736 CAGAGTAATGTTTATACTATCAAGACATGGATATAATTTTAGTATTTTGTCTTCGATACTTCCTGAGATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
737 >chrM_14820_15346_1:0:0_0:0:0_5a/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
738 AAGAGAAGATCTTCATTTCAGGTTTACAAGACCAGAGTAATGTTTATACTATCAAGACATGGATATAATT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
739 >chrM_14820_15346_1:0:0_0:0:0_5a/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
740 ATCAAAGATATCCTAGGTATCCTAATCATATTCTTAATTCTCCTAACCCTAGTATTATTTTTCCCAGACA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
741 >chrM_14858_15398_0:0:0_3:0:0_b3/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
742 CAGCTTTGGGTGCTGGAGGTGGGTAGTAGCTCCTTCTTCTTGATGTCTTGAGAAGAGCAGATCTTCATTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
743 >chrM_14858_15398_0:0:0_3:0:0_b3/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
744 TCTCATAACCCTAGTATTATTTTTCCCAGACATACTAGGAGACCCAGACAACTACATACCAGCTAATCCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
745 >chrM_14885_15311_3:1:0_1:0:0_3/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
746 AGTAATGTTTATACTATCAAGACATGGATATAATTTTAGTATTTTGTCTTCGATAATTCCAGAGATTGGT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
747 >chrM_14885_15311_3:1:0_1:0:0_3/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
748 AGACATACTAGGAGAGGCCGACAACTACCTACCAGCTAATCCACTAAACACCCCACCCCATATTAAACCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
749 >chrM_14975_15480_1:0:1_0:1:0_4e/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
750 ATACGCCATTCTACGCTCCACTCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
751 >chrM_14975_15480_1:0:1_0:1:0_4e/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
752 AATAGTTTAATGTACGATATACATGAATGTACTGTTGTACTATGTAAATTTATGTACTCAAGAAGTAGTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
753 >chrM_14988_15504_0:0:0_1:1:0_38/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
754 GTATTAGCTTATATGCTTGGGGAAAATAGTTTAATGTACGATATACCTAAATGTACTGTTGTACTATGTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
755 >chrM_14988_15504_0:0:0_1:1:0_38/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
756 CGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAATTTTAGCCCTAATAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
757 >chrM_15171_15615_1:0:0_0:1:0_c3/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
758 TAACACAGATATGTCCTTATAACATTAGTTTAATGTGTTTAAGATAATATTCATGGTATATATATTGGTT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
759 >chrM_15171_15615_1:0:0_0:1:0_c3/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
760 GTAGAACACCCATTTATTATCATTGGCCAACTAGCCTCCATCACATACTTCTCAATCATCTTAATTCTTA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
761 >chrM_15196_15749_1:1:1_2:1:0_c4/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
762 GCTAACTAGCCCCATCTCATACTTCTCAATCATCTTAATTCTTATACCAATGTCAGGAATTATCGAAGAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
763 >chrM_15196_15749_1:1:1_2:1:0_c4/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
764 TGGCCCGGAGCGAGAAGAGGGGCATTGGTGGGCGGGTTGTAGGTTTCACGGAGGATGGAAGATTAATAGA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
765 >chrM_15361_15805_1:0:0_2:0:0_81/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
766 TGAAGTAAGAACCAGATGTCTTATAAAGTTTCAGTTTAGCTACCCGCAAGTTTAATGGGCCCGGAGCGAG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
767 >chrM_15361_15805_1:0:0_2:0:0_81/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
768 AAGAAGGAGCTACTCCCCACCACCAGCACCCAAAGCTGGTATTCTAATTAAACTACTTCTTGAGAACATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
769 >chrM_15417_15889_0:0:0_2:0:0_50/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
770 TTCTTGAGTACATAAATTTACATAGTACAACAGTACATTTATGTATATCGTACATTAAACTATTTTCCCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
771 >chrM_15417_15889_0:0:0_2:0:0_50/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
772 GTTGGTCATGGGCTGATTAGACCCGAAACCATCGAGATGTCTTATTTAAGGGGCACGTATGGGCGATAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
773 >chrM_15462_15945_2:1:0_0:0:0_0/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
774 TATCGTACATTAAACAATTTTCCCCAAGCATATAAGGTAATACATTAAATCAATGGTTCAGGTCATAAAA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
775 >chrM_15462_15945_2:1:0_0:0:0_0/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
776 TGTTGATGAAAGTAGGCCAAAATAAAAAGATACCAAATGCATGACACCACAGTTATGTTGGTCATGGGCT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
777 >chrM_15481_15968_1:2:0_2:0:0_6d/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
778 GTCCTTACATGCCTTGACGGCTATGTTGATGAAAGTAGGCCAAAATAAAAAGATCCCAAATGCATGACAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
779 >chrM_15481_15968_1:2:0_2:0:0_6d/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
780 TTCCCCAAGCATATAAGCTAATACATTAAATCCATGGTTCAGGTCATAAAATAATCATCAACATAAACCA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
781 >chrM_15523_16020_2:1:0_1:1:0_31/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
782 GGGTTTTGCGGACTAATGATTCTTCACCTAAGGTGCGTCTAGACTGTGTGCTGTCCTTTCATGCCTTGAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
783 >chrM_15523_16020_2:1:0_1:1:0_31/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
784 GTCATAAAATACTCAACAACATAAACCAATATATATACCATGAATATTATCTTAAACACATTAAACTAAT |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
785 >chrM_15549_16044_0:1:0_1:1:0_59/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
786 ATGAATAATTAGCCTTAGGTGATTGGGTTTTGCGGACTAATTATTCTTCACCGAAGGTGCGTCTAGACTG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
787 >chrM_15549_16044_0:1:0_1:1:0_59/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
788 CAATATATATACCATGAATATTATCTTAAACACATTAAACTAATGTTATAAGGACATATCTGTGTTATCC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
789 >chrM_15642_16224_2:1:0_0:0:0_a5/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
790 AGTACTAAAATATAAGTCATATTTTGGGAACTACTAGAATTGATCAGGACATAGGGTTTGATAGTTAATA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
791 >chrM_15642_16224_2:1:0_0:0:0_a5/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
792 CTCTTCTCTTCCATCTGACTATCCCCTTCCCCATTTTGTCTATTAATCTTCCATCCTCCGTGAAACCAAC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
793 >chrM_15720_16131_0:1:0_2:1:0_58/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
794 TGTTTATGGGGTTTGGCATTAAGAGGACGGGGTGGGGGGTTTTGAGAGTTAAAATTTGGTATTGAGTAGC |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
795 >chrM_15720_16131_0:1:0_2:1:0_58/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
796 CACCAATGCCCCTCCTCTCGCTCCGGGCCCATTAAACTTGGGGGTAGCTAAACTGAAACTTTATCAGACA |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
797 >chrM_15820_16268_3:1:0_1:0:2_7f/1 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
798 TTAGAGTTTTGGTTCACGGAACATGATTTTGTAAAATTTTTACAAGTACTAAAATAAGTCATATTTTGGG |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
799 >chrM_15820_16268_3:1:0_1:0:2_7f/2 |
|
50ebde5d5c63
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools commit 17bfa0739bf7c72cf92de0d7013437dff2bbba7f-dirty
matthias
parents:
diff
changeset
|
800 GTTATCGCCCATACGTTTCCCTTAACTCAGACATCTCGATGGTATCGGGTCTAATCAGCCCCTGACCAAC |
