changeset 0:1e64bb6893b2 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/ucsc_tools/maftools commit 06cd9c75a53dc14c476349a3c12d7428a5aa351c
author iuc
date Thu, 05 Jun 2025 19:23:48 +0000
parents
children 76f19f4cb5e6
files mafAddIRows.xml test-data/gorGor3.bed test-data/hg38.bed test-data/mafIn.maf test-data/panTro4.bed test-data/ref.2bit test-data/ref.fa
diffstat 7 files changed, 127 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/mafAddIRows.xml	Thu Jun 05 19:23:48 2025 +0000
@@ -0,0 +1,115 @@
+<tool id="ucsc_mafaddirows" name="mafAddIRows" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="24.2" license="MIT">
+    <description>Add i rows to a MAF file</description>
+    <macros>
+        <token name="@TOOL_VERSION@">469</token>
+        <token name="@VERSION_SUFFIX@">0</token>
+    </macros>
+    <requirements>
+        <requirement type="package" version="@TOOL_VERSION@">ucsc-mafaddirows</requirement>
+    </requirements>
+    <command detect_errors="exit_code"><![CDATA[
+        mafAddIRows
+        $input_maf
+        $twoBitFile
+        $output_maf
+        #if $nBeds
+            #import re
+            #for $bed in $nBeds:
+                #set identifier = re.sub('[^\s\w\-\\.]','_',str($bed.element_identifier))
+                && ln -s '$bed' '$identifier' &&
+                echo '$identifier' >> 'bed.txt'
+            #end for
+            -nBeds='bed.txt'
+        #end if
+        $addN
+        $addDash
+    ]]></command>
+    <inputs>
+        <param name="input_maf" type="data" format="maf" label="Input MAF file" help="MAF file with a single target sequence"/>
+        <param name="twoBitFile" type="data" format="twobit" label="TwoBit reference file" help="TwoBit file for the reference genome"/>
+        <param name="nBeds" type="data" format="bed" optional="true" multiple="true" label="List of BED files" help="One BED file per species with N locations"/>
+        <param name="addN" type="boolean" truevalue="-addN" falsevalue="" label="Add rows of N's" help="Add rows of N's into MAF blocks instead of annotating them"/>
+        <param name="addDash" type="boolean" truevalue="-addDash" falsevalue="" label="Add rows of -'s" help="Add rows of -'s into MAF blocks instead of annotating them"/>
+    </inputs>
+    <outputs>
+        <data name="output_maf" format="maf" label="${tool.name} on ${on_string}: MAF output"/>
+    </outputs>
+    <tests>
+        <!-- Test 1: Using -addN option -->
+        <test expect_num_outputs="1">
+            <param name="input_maf" value="mafIn.maf"/>
+            <param name="twoBitFile" value="ref.2bit"/>
+            <param name="addN" value="true"/>
+            <param name="addDash" value="false"/>
+            <output name="output_maf" ftype="maf">
+                <assert_contents>
+                    <has_n_lines n="8"/>
+                    <has_line line="i gorGor3.chr7 N 0 N 0"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 2: Using -addDash option -->
+        <test expect_num_outputs="1">
+            <param name="input_maf" value="mafIn.maf"/>
+            <param name="twoBitFile" value="ref.2bit"/>
+            <param name="addN" value="false"/>
+            <param name="addDash" value="true"/>
+            <output name="output_maf" ftype="maf">
+                <assert_contents>
+                    <has_n_lines n="8"/>
+                    <has_line line="i gorGor3.chr7 N 0 N 0"/>
+                    <has_line line="s panTro4.chr7 1000 20 + 159345973 ACGTAC-TAC-TACGTACGT"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 3: -nBeds option -->
+        <test expect_num_outputs="1">
+            <param name="input_maf" value="mafIn.maf"/>
+            <param name="twoBitFile" value="ref.2bit"/>
+            <param name="nBeds" value="gorGor3.bed,hg38.bed,panTro4.bed"/>
+            <param name="addN" value="true"/>
+            <param name="addDash" value="false"/>
+            <output name="output_maf" ftype="maf">
+                <assert_contents>
+                    <has_n_lines n="8"/>
+                    <has_line line="i gorGor3.chr7 N 0 N 0"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help><![CDATA[
+**mafAddIRows**
+
+This tool adds 'i' rows to a Multiple Alignment Format (MAF) file. It requires a MAF file with a single target sequence.
+
+**Usage**
+
+- **Input MAF file**: Provide a MAF file containing alignments with only one target sequence.
+- **TwoBit reference file**: Specify a TwoBit file for the reference genome.
+- **List of BED files** (optional): Provide BED files (one per species) specifying N locations.
+- **Add rows of N's**: Check to insert rows of N's into MAF blocks instead of annotating.
+- **Add rows of -'s**: Check to insert rows of -'s into MAF blocks instead of annotating.
+
+**Output**
+
+- A modified MAF file with added 'i' rows or annotations based on the provided options.
+
+**Note**
+
+- The input MAF file must contain only a single target sequence.
+- Use either `-addN` or `-addDash`, but not both, to modify the MAF blocks directly.
+    ]]></help>
+    <citations>
+        <citation type="bibtex">
+@misc{mafAddIRows,
+  title = {mafAddIRows: Add 'i' rows to a MAF file},
+  author = {Kent UCSC},
+  note = {Tool for adding 'i' rows to MAF files with a single target sequence}
+}
+        </citation>
+    </citations>
+    <creator>
+        <person givenName="Saim" familyName="Momin" url="https://github.com/SaimMomin12"/>
+        <organization name="Galaxy Europe" url="https://galaxyproject.org/eu/"/>
+    </creator>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gorGor3.bed	Thu Jun 05 19:23:48 2025 +0000
@@ -0,0 +1,2 @@
+chr7    1006    1007
+chr7    1013    1014
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hg38.bed	Thu Jun 05 19:23:48 2025 +0000
@@ -0,0 +1,2 @@
+chr7    1005    1006
+chr7    1010    1012
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mafIn.maf	Thu Jun 05 19:23:48 2025 +0000
@@ -0,0 +1,5 @@
+##maf version=1 scoring=blastz
+a score=1234
+s hg38.chr7     1000 20 + 248956422 ACGTACGTACGTACGTACGT
+s panTro4.chr7  1000 20 + 159345973 ACGTAC-TAC-TACGTACGT
+s gorGor3.chr7  1000 20 + 174310764 A-GTACGTAC-TACG-AC-T
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/panTro4.bed	Thu Jun 05 19:23:48 2025 +0000
@@ -0,0 +1,1 @@
+chr7    1007    1008
\ No newline at end of file
Binary file test-data/ref.2bit has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ref.fa	Thu Jun 05 19:23:48 2025 +0000
@@ -0,0 +1,2 @@
+>chr7
+NNNNNACGTACGTACGTACGTNNNNNTGCACTGCACTGCACTGCANNNNN
\ No newline at end of file