changeset 0:39bac90c773d draft

Uploaded
author iuc
date Fri, 15 Aug 2014 06:00:47 -0400
parents
children 1938721334b3
files data_manager/data_manager_snpEff_databases.py data_manager/data_manager_snpEff_databases.xml data_manager/data_manager_snpEff_download.py data_manager/data_manager_snpEff_download.xml data_manager_conf.xml datatypes_conf.xml lib/galaxy/datatypes/snpeff.py lib/galaxy/datatypes/snpeff.pyc readme.rst snpEff.xml snpEff_download.xml snpEff_macros.xml snpSift_annotate.xml snpSift_caseControl.xml snpSift_filter.xml snpSift_geneSets.xml snpSift_int.xml snpsift_dbnsfp.xml snpsift_vartype.xml test-data/annotate_1.vcf test-data/annotate_5.vcf test-data/db_test_1.vcf test-data/interval.bed test-data/test.private.01.vcf test-data/test.private.02.vcf test-data/test01.vcf test-data/vcf_homhet.vcf tool-data/snpeff_annotations.loc.sample tool-data/snpeff_databases.loc.sample tool-data/snpeff_genomedb.loc.sample tool-data/snpeff_regulationdb.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml
diffstat 33 files changed, 2650 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/data_manager_snpEff_databases.py	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,82 @@
+#!/usr/bin/env python
+
+import sys
+import os
+import re
+import tempfile
+import subprocess
+import fileinput
+import shutil
+import optparse
+import urllib2
+from ftplib import FTP
+import tarfile
+
+from galaxy.util.json import from_json_string, to_json_string
+
+def stop_err(msg):
+    sys.stderr.write(msg)
+    sys.exit(1)
+
+def fetch_databases(data_manager_dict, target_directory, jar_path):
+    (snpEff_dir,snpEff_jar) = os.path.split(jar_path)
+    if not os.path.exists(target_directory):
+        os.makedirs(target_directory)
+    databases_path = os.path.join( target_directory, 'databases.out' )
+    databases_output = open(databases_path,'w')
+    args = [ 'java','-jar', ]
+    args.append( snpEff_jar )
+    args.append( 'databases' )
+    # tmp_stderr = tempfile.NamedTemporaryFile( prefix = "tmp-data-manager-snpEff-stderr" )
+    # databases_output = open(databases_path)
+    # proc = subprocess.Popen( args=args, shell=False, cwd=snpEff_dir, stdout=databases_output.fileno(), stderr=tmp_stderr.fileno() )
+    proc = subprocess.Popen( args=args, shell=False, cwd=snpEff_dir, stdout=databases_output.fileno() )
+    return_code = proc.wait()
+    if return_code:
+        sys.exit( return_code )
+    databases_output.close()
+    try:
+        data_manager_dict['data_tables'] = data_manager_dict.get( 'data_tables', {} )
+        data_manager_dict['data_tables']['snpeff_databases'] = data_manager_dict['data_tables'].get( 'snpeff_databases', [] )
+        data_table_entries = []
+        fh = open(databases_path,'r')
+        for i,line in enumerate(fh):
+            fields = line.split('\t')
+            if len(fields) >= 2:
+                genome_version = fields[0].strip()
+                if genome_version.startswith("Genome") or genome_version.startswith("-"):
+                    continue
+                #snpeff test genome
+                if genome_version == '30c2c903' or fields[1].strip() == 'TestCase' or fields[1].strip().startswith('Test_'):
+                    continue
+                description = fields[1].strip() + ' : ' + genome_version
+                data_table_entries.append(dict(value=genome_version, name=description))
+        data_manager_dict['data_tables']['snpeff_databases'] = data_table_entries
+    except Exception, e:
+        stop_err( 'Error parsing %s %s\n' % (config,str( e )) )
+    else:
+        fh.close()
+    return data_manager_dict
+
+def main():
+    #Parse Command Line
+    parser = optparse.OptionParser()
+    parser.add_option( '-j', '--jar_path', dest='jar_path', action='store', type="string", default=None, help='snpEff.jar path' )
+    (options, args) = parser.parse_args()
+
+    filename = args[0]
+
+    params = from_json_string( open( filename ).read() )
+    target_directory = params[ 'output_data' ][0]['files_path']
+    os.mkdir( target_directory )
+    data_manager_dict = {}
+
+
+    #Create Defuse Reference Data
+    data_manager_dict = fetch_databases( data_manager_dict, target_directory, options.jar_path)
+
+    #save info to json file
+    open( filename, 'wb' ).write( to_json_string( data_manager_dict ) )
+
+if __name__ == "__main__": main()
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/data_manager_snpEff_databases.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,41 @@
+<tool id="data_manager_snpeff_databases" name="SnpEff Databases" version="3.6" tool_type="manage_data">
+	<description>Read the list of available snpEff databases</description>
+	<requirements>
+		<requirement type="package" version="3.6">snpEff</requirement>
+	</requirements>
+	<command interpreter="python">
+        data_manager_snpEff_databases.py --jar_path \$SNPEFF_JAR_PATH/snpEff.jar "$out_file"
+        </command>
+	<inputs>
+	</inputs>
+	<outputs>
+           <data name="out_file" format="data_manager_json"/>
+	</outputs>
+        <stdio>
+          <exit_code range=":-1"  level="fatal"   description="Error: Cannot open file" />
+          <exit_code range="1:"  level="fatal"   description="Error" />
+        </stdio>
+        <tests>
+            <test>
+                <output name="out_file">
+                    <assert_contents>
+                        <!-- Check that a genome was added -->
+                        <has_text text="GRCh37.72" />
+                    </assert_contents>
+                </output>
+            </test>
+        </tests>
+	<help>
+
+This tool updatess the list of SnpEff databases for the SnpEff Download data manager.
+It should only need to be run once for a snpEff version, 
+since it populates the SnpEff Download data manager from the snpEff config file.
+
+For information about snpEff:    http://snpEff.sourceforge.net
+
+Please cite:
+"A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.", Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. Fly (Austin). 2012 Apr-Jun;6(2):80-92. PMID: 22728672 [PubMed - in process]
+
+	</help>
+</tool>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/data_manager_snpEff_download.py	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,114 @@
+#!/usr/bin/env python
+
+import sys
+import os
+import re
+import tempfile
+import subprocess
+import fileinput
+import shutil
+import optparse
+import urllib2
+from ftplib import FTP
+import tarfile
+
+from galaxy.util.json import from_json_string, to_json_string
+
+def stop_err(msg):
+    sys.stderr.write(msg)
+    sys.exit(1)
+
+"""
+# Download human database 'hg19'
+java -jar snpEff.jar download -v hg19
+
+        <command>java -jar \$SNPEFF_JAR_PATH/snpEff.jar download -c \$JAVA_JAR_PATH/snpEff.config $genomeVersion > $logfile </command>
+
+snpEffectPredictor.bin
+regulation_HeLa-S3.bin
+regulation_pattern = 'regulation_(.+).bin'
+
+
+"""
+def download_database(data_manager_dict, target_directory, jar_path,config,genome_version,organism):
+    ## get data_dir from config 
+    ##---
+    ## Databases are stored here
+    ## E.g.: Information for 'hg19' is stored in data_dir/hg19/
+    ##
+    ## Note: Since version 2.1 you can use tilde ('~') as first character to refer to your home directory
+    ##---
+    #data_dir = ~/snpEff/data/
+    data_dir = target_directory
+    (snpEff_dir,snpEff_jar) = os.path.split(jar_path)
+    args = [ 'java','-jar' ]
+    args.append( jar_path )
+    args.append( 'download' )
+    args.append( '-c' )
+    args.append( config )
+    args.append( '-dataDir' )
+    args.append( data_dir )
+    args.append( '-v' )
+    args.append( genome_version )
+    proc = subprocess.Popen( args=args, shell=False, cwd=snpEff_dir )
+    return_code = proc.wait()
+    if return_code:
+        sys.exit( return_code )
+    ## search data_dir/genome_version for files
+    regulation_pattern = 'regulation_(.+).bin'
+    #  annotation files that are included in snpEff by a flag
+    annotations_dict = {'nextProt.bin' : '-nextprot','motif.bin': '-motif'}
+    genome_path = os.path.join(data_dir,genome_version)
+    if os.path.isdir(genome_path):
+        for root, dirs, files in os.walk(genome_path):
+            for fname in files:
+                if fname.startswith('snpEffectPredictor'):
+                    # if snpEffectPredictor.bin download succeeded
+                    name = genome_version + (' : ' + organism if organism else '') 
+                    data_table_entry = dict(value=genome_version, name=name, path=data_dir)
+                    _add_data_table_entry( data_manager_dict, 'snpeff_genomedb', data_table_entry )
+                else:
+                    m = re.match(regulation_pattern,fname)
+                    if m:
+                        name = m.groups()[0]
+                        data_table_entry = dict(genome=genome_version,value=name, name=name)
+                        _add_data_table_entry( data_manager_dict, 'snpeff_regulationdb', data_table_entry )
+                    elif fname in annotations_dict:
+                        value = annotations_dict[fname]
+                        name = value.lstrip('-')
+                        data_table_entry = dict(genome=genome_version,value=value, name=name)
+                        _add_data_table_entry( data_manager_dict, 'snpeff_annotations', data_table_entry )
+    return data_manager_dict
+
+def _add_data_table_entry( data_manager_dict, data_table, data_table_entry ):
+    data_manager_dict['data_tables'] = data_manager_dict.get( 'data_tables', {} )
+    data_manager_dict['data_tables'][data_table] = data_manager_dict['data_tables'].get( data_table, [] )
+    data_manager_dict['data_tables'][data_table].append( data_table_entry )
+    return data_manager_dict
+
+def main():
+    #Parse Command Line
+    parser = optparse.OptionParser()
+    parser.add_option( '-j', '--jar_path', dest='jar_path', action='store', type="string", default=None, help='snpEff.jar path' )
+    parser.add_option( '-c', '--config', dest='config', action='store', type="string", default=None, help='snpEff.config path' )
+    parser.add_option( '-g', '--genome_version', dest='genome_version', action='store', type="string", default=None, help='genome_version' )
+    parser.add_option( '-o', '--organism', dest='organism', action='store', type="string", default=None, help='organism name' )
+    (options, args) = parser.parse_args()
+
+    filename = args[0]
+
+    params = from_json_string( open( filename ).read() )
+    target_directory = params[ 'output_data' ][0]['files_path']
+    os.mkdir( target_directory )
+    data_manager_dict = {}
+
+
+    #Create SnpEff Reference Data
+    for genome_version, organism in zip(options.genome_version.split(','), options.organism.split(',')):
+        download_database( data_manager_dict, target_directory, options.jar_path, options.config, genome_version, organism )
+
+    #save info to json file
+    open( filename, 'wb' ).write( to_json_string( data_manager_dict ) )
+
+if __name__ == "__main__": main()
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/data_manager_snpEff_download.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,51 @@
+<tool id="data_manager_snpeff_download" name="SnpEff Download" version="3.6" tool_type="manage_data">
+    <description>Download a new database</description>
+    <requirements>
+        <requirement type="package" version="3.6">snpEff</requirement>
+    </requirements>
+    <command interpreter="python">
+        data_manager_snpEff_download.py --jar_path \$SNPEFF_JAR_PATH/snpEff.jar --config \$SNPEFF_JAR_PATH/snpEff.config 
+        --genome_version "${genome_databases.fields.value}"
+        --organism "${genome_databases.fields.name}"
+        "$out_file"
+        </command>
+    <inputs>
+        <param name="genome_databases" type="select" display="checkboxes" multiple="true" label="Genome Version">
+            <options from_data_table="snpeff_databases">
+                <filter type="sort_by" column="0" />
+            </options>
+        </param>
+    </inputs>
+
+    <outputs>
+           <data name="out_file" format="data_manager_json" label="${tool.name} : ${genome_databases.fields.value}"/>
+    </outputs>
+    <stdio>
+        <exit_code range=":-1"  level="fatal"   description="Error: Cannot open file" />
+        <exit_code range="1:"  level="fatal"   description="Error" />
+    </stdio>
+    <tests>
+        <test>
+            <param name="genome_databases" value="GRCh37.71"/>
+            <output name="out_file">
+                <assert_contents>
+                    <!-- Check that a genome was added -->
+                    <has_text text="GRCh37.71" />
+                    <has_text text="snpeff_regulationdb" />
+                    <has_text text="snpeff_annotations" />
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help>
+
+This tool downloads a SnpEff database.
+
+For details about this tool, please go to http://snpEff.sourceforge.net
+
+Please cite:
+"A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.", Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. Fly (Austin). 2012 Apr-Jun;6(2):80-92. PMID: 22728672 [PubMed - in process]
+
+    </help>
+</tool>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager_conf.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,42 @@
+<?xml version="1.0"?>
+<data_managers>
+  <data_manager tool_file="data_manager/data_manager_snpEff_databases.xml" id="data_manager_snpeff_databases" >
+    <data_table name="snpeff_databases">  <!-- Defines a Data Table to be modified. -->
+      <output> <!-- Handle the output of the Data Manager Tool -->
+        <column name="value" /> <!-- columns that are going to be specified by the Data Manager Tool -->
+        <column name="name" /> <!-- columns that are going to be specified by the Data Manager Tool -->
+      </output>
+    </data_table>
+  </data_manager>
+  <data_manager tool_file="data_manager/data_manager_snpEff_download.xml" id="data_manager_snpeff_download" >
+    <data_table name="snpeff_genomedb">  <!-- Defines a Data Table to be modified. -->
+      <output> <!-- Handle the output of the Data Manager Tool -->
+        <column name="value" /> <!-- columns that are going to be specified by the Data Manager Tool -->
+        <column name="name" />  <!-- columns that are going to be specified by the Data Manager Tool -->
+        <column name="path" output_ref="out_file" >
+          <move type="directory" relativize_symlinks="True">
+            <target base="${GALAXY_DATA_MANAGER_DATA_PATH}">snpEff/data</target>
+          </move>
+          <value_translation>${GALAXY_DATA_MANAGER_DATA_PATH}/snpEff/data</value_translation>
+          <value_translation type="function">abspath</value_translation>
+        </column>
+      </output>
+    </data_table>
+    <data_table name="snpeff_regulationdb">  <!-- Defines a Data Table to be modified. -->
+      <output> <!-- Handle the output of the Data Manager Tool -->
+        <column name="genome" /> <!-- columns that are going to be specified by the Data Manager Tool -->
+        <column name="value" /> <!-- columns that are going to be specified by the Data Manager Tool -->
+        <column name="name" />  <!-- columns that are going to be specified by the Data Manager Tool -->
+      </output>
+    </data_table>
+    <data_table name="snpeff_annotations">  <!-- Defines a Data Table to be modified. -->
+      <output> <!-- Handle the output of the Data Manager Tool -->
+        <column name="genome" /> <!-- columns that are going to be specified by the Data Manager Tool -->
+        <column name="value" /> <!-- columns that are going to be specified by the Data Manager Tool -->
+        <column name="name" />  <!-- columns that are going to be specified by the Data Manager Tool -->
+      </output>
+    </data_table>
+  </data_manager>
+</data_managers>
+
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/datatypes_conf.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,10 @@
+<?xml version="1.0"?>
+<datatypes>
+    <datatype_files>
+        <datatype_file name="snpeff.py"/>
+    </datatype_files>
+    <registration>
+        <datatype extension="snpeffdb" type="galaxy.datatypes.snpeff:SnpEffDb" display_in_upload="True"/>
+    </registration>
+</datatypes>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/snpeff.py	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,46 @@
+"""
+SnpEff datatypes
+"""
+import os,os.path,re,sys
+import galaxy.datatypes.data
+from galaxy.datatypes.data import Text
+from galaxy.datatypes.metadata import MetadataElement
+
+class SnpEffDb( Text ):
+    """Class describing an IGV tiled data file (TDF) .tdf  binary file"""
+    file_ext = "snpeffdb"
+    MetadataElement( name="genome_version", default=None, desc="Genome Version", readonly=True, visible=True, no_value=None )
+    MetadataElement( name="regulation", default=[], desc="Regulation Names", readonly=True, visible=True, no_value=[] )
+    MetadataElement( name="annotation", default=[], desc="Annotation Names", readonly=True, visible=True, no_value=[] )
+
+    def __init__( self, **kwd ):
+        Text.__init__( self, **kwd )
+
+    def set_meta( self, dataset, **kwd ):
+        Text.set_meta(self, dataset, **kwd )
+        data_dir = dataset.files_path
+        ## search data_dir/genome_version for files
+        regulation_pattern = 'regulation_(.+).bin'
+        #  annotation files that are included in snpEff by a flag
+        annotations_dict = {'nextProt.bin' : '-nextprot','motif.bin': '-motif'}
+        regulations = []
+        annotations = []
+        if data_dir and os.path.isdir(data_dir):
+            for root, dirs, files in os.walk(data_dir):
+                for fname in files:
+                    if fname.startswith('snpEffectPredictor'):
+                        # if snpEffectPredictor.bin download succeeded
+                        genome_version = os.path.basename(root)
+                        dataset.metadata.genome_version = genome_version
+                    else:
+                        m = re.match(regulation_pattern,fname)
+                        if m:
+                            name = m.groups()[0]
+                            regulations.append(name)
+                        elif fname in annotations_dict:
+                            value = annotations_dict[fname]
+                            name = value.lstrip('-')
+                            annotations.append(name)
+            dataset.metadata.regulation = regulations
+            dataset.metadata.annotation = annotations
+
Binary file lib/galaxy/datatypes/snpeff.pyc has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.rst	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,37 @@
+SnpEff wrappers
+===============
+
+These are galaxy tools for SnpEff_, a variant annotation and effect prediction tool by Pablo Cingolani.
+It annotates and predicts the effects of variants on genes (such as amino acid changes).
+
+.. _SnpEff: http://snpeff.sourceforge.net/
+
+This repository let you automatically install SnpEff and SnpSift.
+This will use the default location for genome reference downloads from the ``snpEff.config`` file:
+
+  data_dir = ~/snpEff/data/
+
+You can manually edit the installed ``snpEff.config`` file and change the location, or you can create a symbolic link to the desired data location from ``~/snpEff``.
+
+The genome reference options used by the tools "SnpEff" (snpEff.xml) and "SnpEff Download" (snpEff_download.xml) are taken from the ``tool-data/snpeffect_genomedb.loc`` file.
+You can fill this file by running the following command:
+
+  java -jar snpEff.jar databases | tail -n +3 | cut -f 1,2 | awk '{ gsub(/_/, " ", $2); printf "%s\\t%s : %s\\n", $1, $2, $1 }' | sort -k 2 > snpeffect_genomedb.loc
+
+There are 2 datamanagers to download and install prebuilt SnpEff genome databases:
+
+* data_manager_snpeff_databases: generates a list of available SnpEff genome databases into the ``tool-data/snpeff_databases.loc`` file
+* data_manager_snpeff_download: downloads a SnpEff genome database selected from ``tool-data/snpeff_databases.loc`` and adds entries to ``snpeff_genomedb.loc``, ``snpeff_regulationdb.loc`` and ``snpeff_annotations.loc``
+
+SnpEff citation: |Cingolani2012program|_.
+
+.. |Cingolani2012program| replace:: Cingolani, P., Platts, A., Wang, L. L., Coon, M., Nguyen, T., Wang, L., Land, S. J., Lu, X., Ruden, D. M. (2012) A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of *Drosophila melanogaster* strain w1118; iso-2; iso-3. *Fly* 6(2):80-92
+.. _Cingolani2012program: https://www.landesbioscience.com/journals/fly/article/19695/
+
+SnpSift citation: |Cingolani2012using|_.
+
+.. |Cingolani2012using| replace:: Cingolani, P., Patel, V. M., Coon, M., Nguyen, T., Land, S. J., Ruden, D. M., Lu, X. (2012) Using *Drosophila melanogaster* as a model for genotoxic chemical mutational studies with a new program, SnpSift. *Front. Genet.* 3:35
+.. _Cingolani2012using: http://journal.frontiersin.org/Journal/10.3389/fgene.2012.00035/
+
+Wrapper authors: Jim Johnson
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpEff.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,347 @@
+<tool id="snpEff" name="SnpEff" version="3.6">
+    <description>Variant effect and annotation</description>
+    <expand macro="requirements" />
+    <macros>
+        <import>snpEff_macros.xml</import>
+    </macros>
+    <command>
+        java -Xmx6G -jar \$SNPEFF_JAR_PATH/snpEff.jar eff 
+        -c \$SNPEFF_JAR_PATH/snpEff.config 
+        -i $inputFormat -o ${outputConditional.outputFormat} -upDownStreamLen $udLength
+        #if $spliceSiteSize and $spliceSiteSize.__str__ != '':
+          -spliceSiteSize $spliceSiteSize
+        #end if
+        #if $filterIn and $filterIn.__str__ != 'no_filter':
+          $filterIn 
+        #end if
+        #if $filterHomHet and $filterHomHet.__str__ != 'no_filter':
+          $filterHomHet 
+        #end if
+        #if $annotations and $annotations.__str__ != '':
+          #echo " "
+          #echo ' '.join($annotations.__str__.split(','))
+        #end if
+        #if $filterOut and $filterOut.__str__ != '':
+          #echo " "
+          #echo ' '.join($filterOut.__str__.split(','))
+        #end if
+        #if str( $transcripts ) != 'None':
+          -onlyTr $transcripts
+        #end if
+        #if str( $intervals ) != 'None':     ### fix this for multiple dataset input
+          -interval $intervals
+        #end if
+        #if $statsFile:
+          -stats $statsFile 
+        #end if
+        #if $offset.__str__ != '':
+          ${offset} 
+        #end if
+        #if $chr.__str__.strip() != '':
+          -chr "$chr" 
+        #end if
+          $noLog 
+        #if $snpDb.genomeSrc == 'cached':
+          -dataDir ${snpDb.genomeVersion.fields.path}
+          #if $snpDb.extra_annotations and $snpDb.extra_annotations.__str__ != '':
+            #echo " "
+            #echo ' '.join($snpDb.extra_annotations.__str__.split(','))
+          #end if
+          #if $snpDb.regulation and $snpDb.regulation.__str__ != '':
+            -reg #echo ' -reg '.join($snpDb.regulation.__str__.split(','))#
+          #end if
+          $snpDb.genomeVersion
+        #elif $snpDb.genomeSrc == 'history':
+          -dataDir ${snpDb.snpeff_db.files_path}
+          #if $snpDb.extra_annotations and $snpDb.extra_annotations.__str__ != '':
+            #set xannotations = [' '] + $snpDb.extra_annotations.__str__.split(',')
+            #echo " "
+            #echo ' -'.join($xannotations)
+          #end if
+          #if $snpDb.regulation and $snpDb.regulation.__str__ != '':
+            -reg #echo ' -reg '.join($snpDb.regulation.__str__.split(','))#
+          #end if
+          ${snpDb.snpeff_db.metadata.genome_version}
+        #else 
+          -download
+          $snpDb.genome_version
+        #end if
+        $input > $snpeff_output ;
+        #if $statsFile:
+            #import os
+            #set $genes_file = str($statsFile) + '.genes.txt'
+            #set $genes_file_name = os.path.split($genes_file)[-1]
+            mkdir $statsFile.files_path;
+            mv $genes_file #echo os.path.join($statsFile.files_path, $genes_file_name)#;
+        #end if
+        #if $outputConditional.outputFormat == 'gatk' and $outputConditional.gatk_v1
+          ## Replace real SnpEff version with 2.0.5 to prevent this GATK 1.x error: "The version of SnpEff used to generate the SnpEff input file (x.x) is not currently supported by the GATK. Supported versions are: [2.0.5]"
+          sed -i 's/^\#\#SnpEffVersion="\(\S*\s\)/\#\#SnpEffVersion="2.0.5 - real is \1/' $snpeff_output
+        #end if
+    </command>
+    <inputs>
+        <param format="vcf,tabular,pileup,bed" name="input" type="data" label="Sequence changes (SNPs, MNPs, InDels)"/>
+
+        <param name="inputFormat" type="select" label="Input format">
+            <option value="vcf" selected="true">VCF</option>
+            <option value="txt">Tabular (Deprecated)</option>
+            <option value="pileup">Pileup (Deprecated)</option>
+            <option value="bed">BED (Deprecated)</option>
+        </param>
+
+        <conditional name="outputConditional">
+            <param name="outputFormat" type="select" label="Output format">
+                <option value="vcf" selected="true">VCF (only if input is VCF)</option>
+                <option value="gatk">GATK-compatible VCF (only if input is VCF)</option>
+                <option value="txt">Tabular</option>
+                <option value="bed">BED</option>
+                <option value="bedAnn">BED annotations</option>
+            </param>
+            <when value="vcf" />
+            <when value="gatk">
+                <param name="gatk_v1" type="boolean" checked="true" label="Compatible with GATK 1.x" />
+            </when>
+            <when value="txt" />
+            <when value="bed" />
+            <when value="bedAnn" />
+        </conditional>
+
+        <conditional name="snpDb">
+            <param name="genomeSrc" type="select" label="Genome source">
+                <option value="cached">Locally installed reference genome</option>
+                <option value="history">Reference genome from your history</option>
+                <option value="named">Named on demand</option>
+            </param>
+            <when value="cached">
+                <param name="genomeVersion" type="select" label="Genome">
+                    <!--GENOME    DESCRIPTION-->
+                    <options from_data_table="snpeff_genomedb">
+                           <filter type="unique_value" column="0" />
+                    </options>
+                </param>
+                <param name="extra_annotations" type="select" display="checkboxes" multiple="true" label="Additional annotations">
+                       <help>These are available for only a few genomes</help>
+                       <options from_data_table="snpeff_annotations">
+                           <filter type="param_value" ref="genomeVersion" key="genome" column="0" />
+                           <filter type="unique_value" column="1" />
+                       </options>
+                </param>
+                <param name="regulation" type="select" display="checkboxes" multiple="true" label="Non-coding and regulatory annotation">
+                       <help>These are available for only a few genomes</help>
+                       <options from_data_table="snpeff_regulationdb">
+                           <filter type="param_value" ref="genomeVersion" key="genome" column="0" />
+                           <filter type="unique_value" column="1" />
+                       </options>
+                </param>
+            </when>
+            <when value="history">
+                <param format="snpeffdb" name="snpeff_db" type="data" label="SnpEff Genome Version Data"/>
+                <!-- From metadata -->
+                <param name="extra_annotations" type="select" display="checkboxes" multiple="true" label="Additional annotations">
+                    <help>These are available for only a few genomes</help>
+                    <options>
+                        <filter type="data_meta" ref="snpeff_db" key="annotation" />
+                    </options>
+                </param>
+                <param name="regulation" type="select" display="checkboxes" multiple="true" label="Non-coding and regulatory annotation">
+                    <help>These are available for only a few genomes</help>
+                    <options>
+                        <filter type="data_meta" ref="snpeff_db" key="regulation" />
+                    </options>
+                </param>
+            </when>
+            <when value="named">
+                <param name="genome_version" type="text" value="GRCh37.68" label="Snpff Version Name"/>
+            </when>
+        </conditional>
+
+        <param name="udLength" type="select" label="Upstream / Downstream length">
+            <option value="0">No upstream / downstream intervals (0 bases)</option>
+            <option value="200">200 bases</option>
+            <option value="500">500 bases</option>
+            <option value="1000">1000 bases</option>
+            <option value="2000">2000 bases</option>
+            <option value="5000" selected="true">5000 bases</option>
+            <option value="10000">10000 bases</option>
+            <option value="20000">20000 bases</option>
+        </param>
+
+        <param name="spliceSiteSize" type="select" optional="true" label="Set size for splice sites (donor and acceptor) in bases" help="Default: 2">
+            <option value="1">1 base</option>
+            <option value="2" selected="true">2 bases</option>
+            <option value="3">3 bases</option>
+            <option value="4">4 bases</option>
+            <option value="5">5 bases</option>
+            <option value="6">6 bases</option>
+            <option value="7">7 bases</option>
+            <option value="8">8 bases</option>
+            <option value="9">9 bases</option>
+        </param>
+
+        <param name="filterHomHet" type="select" display="radio" label="Filter homozygous / heterozygous changes">
+            <option value="no_filter" selected="true">No filter (analyze everything)</option>
+            <option value="-hom">Analyze homozygous sequence changes only</option>
+            <option value="-het">Analyze heterozygous sequence changes only</option>
+        </param>
+
+        <param name="filterIn" type="select" display="radio" label="Filter sequence changes">
+            <option value="no_filter" selected="true">No filter (analyze everything)</option>
+            <option value="-del">Analyze deletions only</option>
+            <option value="-ins">Analyze insertions only</option>
+            <option value="-mnp">Only MNPs (multiple nucleotide polymorphisms)</option>
+            <option value="-snp">Only SNPs (single nucleotide polymorphisms)</option>
+        </param>
+
+        <param name="annotations" type="select" display="checkboxes" multiple="true" label="Annotation options">
+            <option value="-cancer">Perform 'cancer' comparisons (somatic vs. germline)</option>
+            <option value="-canon">Only use canonical transcripts</option>
+            <option value="-geneId">Use gene ID instead of gene name (VCF output)</option>
+            <option value="-hgvs">Use HGVS annotations for amino acid sub-field</option>
+            <option value="-lof">Add loss of function (LOF) and nonsense mediated decay (NMD) tags</option>
+            <option value="-oicr">Add OICR tag in VCF file</option>
+            <option value="-onlyReg">Only use regulation tracks</option>
+            <option value="-sequenceOntolgy">Use Sequence Ontology terms</option>
+        </param>
+        <param name="intervals" format="bed" type="data" optional="true" label="Use custom interval file for annotation"/>
+        <param name="transcripts" format="tabular" type="data" optional="true" label="Only use the transcripts in this file." help="Format is one transcript ID per line."/>
+        <param name="filterOut" type="select" display="checkboxes" multiple="true" label="Filter output">
+            <option value="-no-downstream">Do not show DOWNSTREAM changes</option>
+            <option value="-no-intergenic">Do not show INTERGENIC changes</option>
+            <option value="-no-intron">Do not show INTRON changes</option>
+            <option value="-no-upstream">Do not show UPSTREAM changes</option>
+            <option value="-no-utr">Do not show 5_PRIME_UTR or 3_PRIME_UTR changes</option>
+        </param>
+
+        <param name="offset" type="select" display="radio" optional="true" label="Chromosomal position">
+            <option value="" selected="true">Use default (based on input type)</option>
+            <option value="-0">Force zero-based positions (both input and output)</option>
+            <option value="-1">Force one-based positions (both input and output)</option>
+        </param>
+        <param name="chr" type="text" optionl="true" label="Text to prepend to chromosome name">
+            <help>
+               By default SnpEff simplifies all chromosome names. For instance 'chr1' is just '1'.
+               You can prepend any string you want to the chromosome name.
+            </help>
+            <validator type="regex" message="No whitespace allowed">^\S*$</validator>
+        </param>
+        <param name="generate_stats" type="boolean" truevalue="" falsevalue="-noStats" checked="true" label="Produce Summary Stats"/>
+        <param name="noLog" type="boolean" truevalue="-noLog" falsevalue="" checked="true" label="Do not report usage statistics to server"/>
+    </inputs>
+    <outputs>
+        <data format="vcf" name="snpeff_output" >
+            <change_format>
+                <when input="outputConditional.outputFormat" value="txt" format="tabular" />
+                <when input="outputConditional.outputFormat" value="bed" format="bed" />
+                <when input="outputConditional.outputFormat" value="bedAnn" format="bed" />
+            </change_format>
+        </data>
+        <data format="html" name="statsFile" label="${tool.name} on ${on_string} - stats">
+            <filter>generate_stats == True</filter>
+        </data>
+    </outputs>
+    <expand macro="stdio" />
+    <tests>
+        <!-- Check that an effect was added in out VCF -->
+        <!-- Check for a HTML header indicating that this was successful -->
+        <!--
+        <output name="statsFile">
+            <assert_contents>
+            <has_text text="SnpEff: Variant analysis" />
+            </assert_contents>
+        </output>
+        --> 
+        <!-- Setting filterOut throws exception in twilltestcase.py
+        <test>
+        <param name="input" ftype="vcf" value="vcf_homhet.vcf"/>
+        <param name="inputFormat" value="vcf"/>
+        <param name="outputFormat" value="vcf"/>
+        <param name="genomeSrc" value="named"/>
+        <param name="genome_version" value="testCase"/>
+        <param name="udLength" value="0"/>
+        <param name="filterHomHet" value="no_filter"/>
+        <param name="filterIn" value="no_filter"/>
+        <param name="generate_stats" value="False"/>
+        <param name="filterOut" value="+-no-upstream"/>
+        <output name="snpeff_output">
+            <assert_contents>
+            <has_text text="EFF=" />
+            </assert_contents>
+        </output>
+        </test>
+        --> 
+
+        <test>
+        <param name="input" ftype="vcf" value="vcf_homhet.vcf"/>
+        <param name="inputFormat" value="vcf"/>
+        <param name="outputFormat" value="vcf"/>
+        <param name="genomeSrc" value="named"/>
+        <param name="genome_version" value="testCase"/>
+        <param name="udLength" value="0"/>
+        <param name="filterHomHet" value="+-het"/>
+        <param name="filterIn" value="no_filter"/>
+        <!--
+        <param name="filterOut" value=""/>
+        -->
+        <param name="generate_stats" value="False"/>
+        <output name="snpeff_output">
+            <assert_contents>
+            <!-- Check that NO effects were added since -het is set -->
+            <not_has_text text="EFF=NON_SYNONYMOUS_CODING" />
+            </assert_contents>
+        </output>
+        </test>
+
+        <test>
+        <param name="input" ftype="vcf" value="vcf_homhet.vcf"/>
+        <param name="inputFormat" value="vcf"/>
+        <param name="outputFormat" value="vcf"/>
+        <param name="genomeSrc" value="named"/>
+        <param name="genome_version" value="testCase"/>
+        <param name="udLength" value="0"/>
+        <param name="filterHomHet" value="no_filter"/>
+        <param name="filterIn" value="+-del"/>
+        <!--
+        <param name="filterOut" value=""/>
+        -->
+        <param name="generate_stats" value="False"/>
+        <output name="snpeff_output">
+            <assert_contents>
+            <!-- Check that deleletions were evaluated -->
+            <has_text_matching expression="Y\t59030478\t.*EFF=INTERGENIC" />
+            <!-- Check that insertion on last line was NOT evaluated -->
+            <has_text_matching expression="Y\t59032947\t.*SF=5\tGT" />
+            </assert_contents>
+        </output>
+        </test>
+
+        <!-- Check that NO UPSTREAM  effect was added -->
+        <!-- Setting filterOut throws exception in twilltestcase.py
+        <test>
+        <param name="input" ftype="vcf" value="vcf_homhet.vcf"/>
+        <param name="inputFormat" value="vcf"/>
+        <param name="outputFormat" value="vcf"/>
+        <param name="genomeSrc" value="named"/>
+        <param name="genome_version" value="testCase"/>
+        <param name="udLength" value="0"/>
+        <param name="filterHomHet" value="no_filter"/>
+        <param name="filterIn" value="no_filter"/>
+        <param name="filterOut" value="+-no-upstream"/>
+        <param name="generate_stats" value="False"/>
+        <output name="snpeff_output">
+            <assert_contents>
+            <not_has_text text="UPSTREAM" />
+            </assert_contents>
+        </output>
+        </test>
+        -->
+
+    </tests>
+    <help>
+This tool calculate the effect of variants (SNPs/MNPs/Insertions) and deletions.
+
+@EXTERNAL_DOCUMENTATION@
+
+    </help>
+    <expand macro="citations" />
+</tool>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpEff_download.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,30 @@
+<tool id="snpEff_download" name="SnpEff Download" version="3.6">
+    <description>Download a new database</description>
+    <expand macro="requirements" />
+    <macros>
+        <import>snpEff_macros.xml</import>
+    </macros>
+    <command>
+    echo $genomeVersion > $snpeff_db; 
+    java -jar \$SNPEFF_JAR_PATH/snpEff.jar download -c \$SNPEFF_JAR_PATH/snpEff.config -dataDir $snpeff_db.files_path -v $genomeVersion > $logfile 
+    </command>
+    <inputs>
+        <param name="genomeVersion" type="select" label="Select the genome version you want to download">
+            <options from_data_table="snpeff_databases">
+                <filter type="sort_by" column="0" />
+            </options>
+        </param>
+    </inputs>
+    <outputs>
+        <data format="txt" name="logfile" />
+        <data format="snpeffdb" name="snpeff_db" label="${genomeVersion}" />
+    </outputs>
+    <expand macro="stdio" />
+    <help>
+
+@EXTERNAL_DOCUMENTATION@
+
+    </help>
+    <expand macro="citations" />
+</tool>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpEff_macros.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,26 @@
+<macros>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="3.6">snpEff</requirement>
+        </requirements>
+    </xml>
+  <xml name="stdio">
+    <stdio>
+        <exit_code range=":-1"  level="fatal" description="Error: Cannot open file" />
+        <exit_code range="1:"  level="fatal" description="Error" />
+    </stdio>
+  </xml>
+  <token name="@EXTERNAL_DOCUMENTATION@">
+
+For details about this tool, please go to http://snpeff.sourceforge.net/SnpSift.html#intervals
+
+  </token>
+  <xml name="citations">
+      <citations>
+        <citation type="doi">10.3389/fgene.2012.00035</citation>
+        <citation type="doi">10.4161/fly.19695</citation>
+        <yield />
+      </citations>
+  </xml>
+
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpSift_annotate.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,97 @@
+<tool id="snpSift_annotate" name="SnpSift Annotate" version="3.6">
+    <description>SNPs from dbSnp</description>
+    <!-- 
+        You can change the amount of memory used, just change the -Xmx parameter (e.g. use -Xmx2G for 2Gb of memory)
+    -->
+    <expand macro="requirements" />
+    <macros>
+        <import>snpEff_macros.xml</import>
+    </macros>
+    <command>
+        java -Xmx6G -jar \$SNPEFF_JAR_PATH/SnpSift.jar $annotate_cmd 
+        #if $annotate.id :
+          -id
+        #elif $annotate.info_ids.__str__.strip() != '' :
+          -info "$annotate.info_ids"
+        #end if          
+        -q $dbSnp $input > $output 
+    </command>
+    <inputs>
+        <param format="vcf" name="input" type="data" label="Variant input file in VCF format"/>
+        <param format="vcf" name="dbSnp" type="data" label="VCF File with ID field annotated (e.g. dnSNP.vcf)" 
+            help="The ID field for a variant in input will be assigned from a matching variant in this file."/>
+        <conditional name="annotate">
+            <param name="id" type="boolean" truevalue="id" falsevalue="info" checked="True" label="Only annotate ID field (do not add INFO field)" help=""/>
+            <when value="id"/>
+            <when value="info">
+                <param name="info_ids" type="text" value="" size="60" optional="true" label="Limit INFO annotation to these INFO IDs"
+                    help="list is a comma separated list of fields. When blank, all INFO fields are included">    
+                    <validator type="regex" message="IDs separted by commas">^(([a-zA-Z][a-zA-Z0-9_-]*)(,[a-zA-Z][a-zA-Z0-9_-]*)*)?$</validator>
+                </param>
+            </when>
+        </conditional>
+        <param name="annotate_cmd" type="boolean" truevalue="annMem" falsevalue="annotate" checked="false" label="Allow unsorted VCF files"> 
+            <help>
+                This option will load the entire 'database' VCF file into memory (which may not be practical for large 'database' VCF files).
+                Otherwise, both the database and the input VCF files should be sorted by position (Chromosome sort order can differ between files). 
+            </help>
+            </param>
+    </inputs>
+    <expand macro="stdio" />
+    <outputs>
+        <data format="vcf" name="output" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" ftype="vcf" value="annotate_1.vcf"/>
+            <param name="dbSnp" ftype="vcf" value="db_test_1.vcf"/>
+            <param name="annotate_cmd" value="False"/>
+            <param name="id" value="True"/>
+            <output name="output">
+                <assert_contents>
+                    <has_text text="rs76166080" />
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help>
+
+This is typically used to annotate IDs from dbSnp.
+
+Annotatating only the ID field from dbSnp137.vcf ::
+
+    Input VCF:
+    CHROM  POS         ID           REF  ALT  QUAL   FILTER  INFO
+    22      16157571    .            T    G    0.0    FAIL    NS=53
+    22      16346045    .            T    C    0.0    FAIL    NS=244
+    22      16350245    .            C    A    0.0    FAIL    NS=192
+
+    Annotated Output VCF:
+    #CHROM  POS         ID           REF  ALT  QUAL   FILTER  INFO
+    22      16157571    .            T    G    0.0    FAIL    NS=53
+    22      16346045    rs56234788   T    C    0.0    FAIL    NS=244
+    22      16350245    rs2905295    C    A    0.0    FAIL    NS=192
+
+
+
+Annotatating both the ID and INFO fields from dbSnp137.vcf ::
+
+    Input VCF:
+    #CHROM  POS         ID           REF  ALT  QUAL   FILTER  INFO
+    22      16157571    .            T    G    0.0    FAIL    NS=53
+    22      16346045    .            T    C    0.0    FAIL    NS=244
+    22      16350245    .            C    A    0.0    FAIL    NS=192
+
+    Annotated Output VCF:
+    #CHROM  POS         ID           REF  ALT  QUAL   FILTER  INFO
+    22      16157571    .            T    G    0.0    FAIL    NS=53
+    22      16346045    rs56234788   T    C    0.0    FAIL    NS=244;RSPOS=16346045;GMAF=0.162248628884826;dbSNPBuildID=129;SSR=0;SAO=0;VP=050100000000000100000100;WGT=0;VC=SNV;SLO;GNO
+    22      16350245    rs2905295    C    A    0.0    FAIL    NS=192;RSPOS=16350245;GMAF=0.230804387568556;dbSNPBuildID=101;SSR=1;SAO=0;VP=050000000000000100000140;WGT=0;VC=SNV;GNO
+
+
+@EXTERNAL_DOCUMENTATION@
+
+    </help>
+    <expand macro="citations" />
+</tool>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpSift_caseControl.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,120 @@
+<tool id="snpSift_caseControl" name="SnpSift CaseControl" version="3.6">
+    <description>Count samples are in 'case' and 'control' groups.</description>
+    <!-- 
+        You can change the amount of memory used, just change the -Xmx parameter (e.g. use -Xmx2G for 2Gb of memory)
+    -->
+    <expand macro="requirements" />
+    <macros>
+        <import>snpEff_macros.xml</import>
+    </macros>
+    <command>
+    java -Xmx1G -jar \$SNPEFF_JAR_PATH/SnpSift.jar caseControl -q 
+    #if $name.__str__.strip() != '':
+      -name $name
+    #end if
+    #if $ctrl.ctrl_src == 'caseString':
+      '$ctrl.caseControlStr' 
+    #else
+      -tfam "$ctrl.tfam"
+    #end if
+    $input > $output
+    </command>
+    <inputs>
+        <param format="vcf" name="input" type="data" label="Variant input file in VCF format"/>
+        <conditional name="ctrl">
+            <param name="ctrl_src" type="select" label="Case Control defined in">
+            <option value="caseString">Case Control String</option>
+            <option value="tfam">TFAM file</option>
+        </param>
+        <when value="caseString">
+            <param name="caseControlStr" type="text" label="Case / Control column designation" size="50">
+            <help>
+                Case and control are defined by a string containing plus and minus symbols {'+', '-', '0'} where '+' is case, '-' is control and '0' is neutral
+            </help>
+            <validator type="regex" message="must be  only plus(+), minus(-), or zero(0) characters">[+-0]+</validator>
+            </param>
+        </when>
+        <when value="tfam">
+            <param format="tabular" name="tfam" type="data" label="PLINK TFAM file" help="Read more about TFAM at http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#tr"/>
+        </when>
+        </conditional>
+        <param name="name" type="text" optional="true" label="name" help="name to append to the 'Cases' or 'Controls' tags">
+            <validator type="regex" message="Use only valid ID characters">[_a-zA-Z0-9]+</validator>
+        </param>
+    </inputs>
+    <outputs>
+        <data format="vcf" name="output" />
+    </outputs>
+    <expand macro="stdio" />
+    <tests>
+        <test>
+            <param name="input" ftype="vcf" value="test.private.01.vcf"/>
+            <param name="ctrl_src" value="caseString"/>
+            <param name="caseControlStr" value="--"/>
+            <output name="output">
+                <assert_contents>
+                    <has_text text="Cases=0,0,0;" />
+                    <has_text text="Controls=0,0,0;" />
+                </assert_contents>
+            </output>
+        </test>
+
+        <test>
+            <param name="input" ftype="vcf" value="test.private.02.vcf"/>
+            <param name="ctrl_src" value="caseString"/>
+            <param name="caseControlStr" value="--"/>
+            <output name="output">
+                <assert_contents>
+                    <has_text text="Cases=0,0,0;" />
+                    <has_text text="Controls=2,0,4;" />
+                </assert_contents>
+            </output>
+        </test>
+
+        <test>
+            <param name="input" ftype="vcf" value="test.private.02.vcf"/>
+            <param name="name" value=""/>
+            <param name="ctrl_src" value="caseString"/>
+            <param name="caseControlStr" value="-+"/>
+            <output name="output">
+                <assert_contents>
+                    <has_text text="Cases=1,0,2;" />
+                    <has_text text="Controls=1,0,2;" />
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help>
+
+**SnpSift CaseControl**
+
+Allows you to count how many samples are in 'case' group and a 'control' group. You can count 'homozygous', 'heterozygous' or 'any' variants. 
+
+Case and control are defined by a string containing plus and minus symbols {'+', '-', '0'} where '+' is case, '-' is control and '0' is neutral. 
+
+This command adds two annotations to the VCF file:
+
+ - **CaseControl**: Two comma separated numbers numbers representing the number of samples that have the variant in the case and the control group. Example: 
+
+  "CaseControl=3,4" *the variant is present in 3 cases and 4 controls.*
+
+
+ - **CaseControlP**: A p-value (Fisher exact test) that the number of cases is N or more. Example:
+
+  "CaseControl=4,0;CaseControlP=3.030303e-02" *in this case the pValue of having 4 or more cases and zero controls is 0.03*
+
+
+For example, if we have ten samples (which means ten genotype columns in the VCF file), the first four are 'case' and the last six are 'control', so the description string would be "++++------".  Let's say we want to distinguish genotypes that are homozygous in 'case' and either homozygous or heterozygous in 'control'.  We would set:
+
+  - Hom/Het case = "hom"
+
+  - Hom/Het control = "any"  
+
+  - Case / Control column designation = ""++++------"
+
+
+@EXTERNAL_DOCUMENTATION@
+
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpSift_filter.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,147 @@
+<tool id="snpSift_filter" name="SnpSift Filter" version="3.6">
+    <options sanitize="False" />
+    <description>Filter variants using arbitrary expressions</description>
+    <expand macro="requirements" />
+    <macros>
+        <import>snpEff_macros.xml</import>
+    </macros>
+    <command>
+        java -Xmx6G -jar \$SNPEFF_JAR_PATH/SnpSift.jar filter -f $input -e $exprFile $inverse 
+        #if $filtering.mode == 'field':
+            #if $filtering.replace.pass:
+                --pass
+                #if $filtering.replace.filterId and len($filtering.replace.filterId.__str__.strip()) > 0:
+                    --filterId "$filtering.replace.filterId"
+                #end if
+            #end if
+            #if $filtering.addFilter and len($filtering.addFilter.__str__.strip()) > 0:
+                --addFilter "$filtering.addFilter"
+            #end if
+            #if $filtering.rmFilter and len($filtering.rmFilter.__str__.strip()) > 0:
+                --rmFilter "$filtering.rmFilter"
+            #end if
+        #end if
+         > $output
+    </command>
+    <inputs>
+        <param format="vcf" name="input" type="data" label="Variant input file in VCF format"/>
+        <param name="expr" type="text" label="Filter criteria" size="160" help="Need help? See below a few examples." />
+        <param name="inverse" type="boolean" truevalue="--inverse" falsevalue="" checked="false" label="Inverse filter" help="Show lines that do not match filter expression" />
+        <conditional name="filtering">
+            <param name="mode" type="select" label="Filter mode">
+                <option value="entries" selected="true">Retain entries that pass filter, remove other entries</option>
+                <option value="field">Change the FILTER field, but retain all entries</option>
+            </param> 
+            <when value="entries"/>
+            <when value="field">
+                <conditional name="replace">
+                    <param name="pass" type="boolean" truevalue="yes" falsevalue="no" checked="false" label="Set matching entry FILTER to 'PASS'" 
+                           help="appends an ID tag to non-matching entry FILTER "/>
+                    <when value="no"/>
+                    <when value="yes">
+                        <param name="filterId" type="text" value="" optional="true" label="ID appended to non-matching (##FILTER tag in header and FILTER VCF field)." size="10"
+                               help="Default ID is 'SnpSift'"/>
+                    </when>
+                </conditional>
+                <param name="addFilter" type="text" value="" optional="true" label="Add a string to FILTER VCF field if 'expression' is true." size="10"/>
+                <param name="rmFilter" type="text" value="" optional="true" label="Remove a string from FILTER VCF field if 'expression' is true (and 'str' is in the field)." size="10"/>
+            </when>
+        </conditional>
+    </inputs>
+    <configfiles>
+        <configfile name="exprFile">
+        $expr
+        </configfile> 
+    </configfiles>
+
+    <outputs>
+        <data format="vcf" name="output" />
+    </outputs>
+    <expand macro="stdio" />
+    <tests>
+        <test>
+        <param name="input" ftype="vcf" value="test01.vcf"/>
+        <param name="expr" value="QUAL >= 50"/>
+        <param name="mode" value="entries"/>
+        <output name="output">
+            <assert_contents>
+            <has_text text="28837706" />
+            <not_has_text text="NT_166464" />
+            </assert_contents>
+        </output>
+        </test>
+
+        <test>
+        <param name="input" ftype="vcf" value="test01.vcf"/>
+        <param name="expr" value="(CHROM = '19')"/>
+        <param name="mode" value="entries"/>
+        <output name="output">
+            <assert_contents>
+            <has_text text="3205820" />
+            <not_has_text text="NT_16" />
+            </assert_contents>
+        </output>
+        </test>
+
+        <test>
+        <param name="input" ftype="vcf" value="test01.vcf"/>
+        <param name="expr" value="(POS >= 20175) &amp; (POS &lt;= 35549)"/>
+        <param name="mode" value="entries"/>
+        <output name="output">
+            <assert_contents>
+            <has_text text="20175" />
+            <has_text text="35549" />
+            <has_text text="22256" />
+            <not_has_text text="18933" />
+            <not_has_text text="37567" />
+            </assert_contents>
+        </output>
+        </test>
+
+        <test>
+        <param name="input" ftype="vcf" value="test01.vcf"/>
+        <param name="expr" value="( DP >= 5 )"/>
+        <param name="mode" value="entries"/>
+        <output name="output">
+            <assert_contents>
+            <has_text text="DP=5;" />
+            <has_text text="DP=6;" />
+            <not_has_text text="DP=1;" />
+            </assert_contents>
+        </output>
+        </test>
+    </tests>
+    <help>
+
+**SnpSift filter**
+
+You can filter ia vcf file using arbitrary expressions, for instance "(QUAL > 30) | (exists INDEL) | ( countHet() > 2 )". The actual expressions can be quite complex, so it allows for a lot of flexibility.
+
+Some examples:
+
+  - *I want to filter out samples with quality less than 30*:
+
+    * **( QUAL &gt; 30 )**
+
+  - *...but we also want InDels that have quality 20 or more*:
+
+    * **(( exists INDEL ) &amp; (QUAL >= 20)) | (QUAL >= 30 )**
+
+  - *...or any homozygous variant present in more than 3 samples*:
+
+    * **(countHom() > 3) | (( exists INDEL ) &amp; (QUAL >= 20)) | (QUAL >= 30 )**
+
+  - *...or any heterozygous sample with coverage 25 or more*:
+
+    * **((countHet() > 0) &amp; (DP >= 25)) | (countHom() > 3) | (( exists INDEL ) &amp; (QUAL >= 20)) | (QUAL >= 30 )**
+
+  - *I want to keep samples where the genotype for the first sample is homozygous variant and the genotype for the second sample is reference*:
+
+    * **isHom( GEN[0] ) &amp; isVariant( GEN[0] ) &amp; isRef( GEN[1] )**
+
+
+@EXTERNAL_DOCUMENTATION@
+
+    </help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpSift_geneSets.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,64 @@
+<tool id="snpSift_geneSets" name="SnpSift GeneSets" version="3.6">
+    <description>Annotating GeneSets, such as Gene Ontology, KEGG, Reactome</description>
+    <!-- 
+        You can change the amount of memory used, just change the -Xmx parameter (e.g. use -Xmx2G for 2Gb of memory)
+    -->
+    <expand macro="requirements" />
+    <macros>
+        <import>snpEff_macros.xml</import>
+    </macros>
+    <command>
+        java -Xmx2G -jar \$SNPEFF_JAR_PATH/SnpSift.jar geneSets -v
+        #if $db_opts.db_opts_selector == "db"
+          "${db_opts.database.fields.path}"
+        #elif $db_opts.db_opts_selector == "histdb"
+          "$db_opts.histdb"
+        #end if
+        
+        $input 2&gt; $log &gt; $output
+    </command>
+    <inputs>
+        <param format="vcf" name="input" type="data" label="Variant input file in VCF format"/>
+        <conditional name="db_opts">
+            <param name="db_opts_selector" type="select" label="Select Annotation database" help="">
+              <option value="db" selected="True">Locally installed database</option>
+              <option value="histdb">database from your history</option>
+            </param>
+            <when value="db">
+                <param name="database" type="select" label="Molecular Signatures Database (MSigDB)">
+                    <options from_file="snpeff_msigdb_database.loc">
+                      <column name="value" index="0"/>
+                      <column name="name" index="1"/>
+                      <column name="path" index="2"/>
+                    </options>
+                </param>
+                <param name="histdb" type="hidden" value="" />
+            </when>
+            <when value="histdb">
+                <param name="histdb" type="data" format="txt" label="Molecular Signatures Database (MSigDB)" />
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="vcf" name="${tool.name} on ${on_string}: VCF" />
+        <data format="txt" name="log" label="${tool.name} on ${on_string}: log" />
+    </outputs>
+    <expand macro="stdio" />
+    <tests>
+    </tests>
+    <help>
+This tool uses `SnpSift GeneSets`_ to add annotations from `MSigDB`_, a collection of annotated gene sets from different sources including Gene Ontology (GO), KEGG, Reactome.
+
+.. _SnpSift GeneSets: http://snpeff.sourceforge.net/SnpSift.html#geneSets
+
+.. class:: warningmark
+
+The input VCF file must be annotated using SnpEff before performing GeneSets annotations. This is because the tool must know which gene the variant affects.
+
+@EXTERNAL_DOCUMENTATION@
+
+    </help>
+    <expand macro="citations">
+        <citation type="doi">10.1073/pnas.0506580102</citation><!-- MSigDB citation -->
+    </expand>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpSift_int.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,55 @@
+<tool id="snpSift_int" name="SnpSift Intervals" version="3.6">
+    <description>Filter variants using intervals</description>
+    <!-- 
+        You can change the amount of memory used, just change the -Xmx parameter (e.g. use -Xmx2G for 2Gb of memory)
+    -->
+    <expand macro="requirements" />
+    <macros>
+        <import>snpEff_macros.xml</import>
+    </macros>
+    <command>
+        java -Xmx2G -jar \$SNPEFF_JAR_PATH/SnpSift.jar intervals -i $input $exclude $bedFile > $output
+    </command>
+    <inputs>
+        <param format="vcf" name="input" type="data" label="Variant input file in VCF format"/>
+        <param format="bed" name="bedFile" type="data" label="Intervals (BED file)"/>
+        <param name="exclude" type="boolean" truevalue="-x" falsevalue="" checked="false" label="Exclude Intervals" 
+            help="Filter out (exclude) VCF entries that match any interval in the BED files"/>
+    </inputs>
+    <outputs>
+        <data format="vcf" name="output" />
+    </outputs>
+    <expand macro="stdio" />
+    <tests>
+        <test>
+            <param name="input" ftype="vcf" value="annotate_5.vcf"/>
+            <param name="bedFile" ftype="bed" value="interval.bed"/>
+            <param name="exclude" value="False"/>
+            <output name="output">
+                <assert_contents>
+                    <has_text text="872687" />
+                    <not_has_text text="1195966" />
+                </assert_contents>
+            </output>
+        </test>
+        <test>
+            <param name="input" ftype="vcf" value="annotate_5.vcf"/>
+            <param name="bedFile" ftype="bed" value="interval.bed"/>
+            <param name="exclude" value="True"/>
+            <output name="output">
+                <assert_contents>
+                    <has_text text="1195966" />
+                    <not_has_text text="872687" />
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help>
+
+You can filter using intervals (BED file).
+
+@EXTERNAL_DOCUMENTATION@
+
+    </help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpsift_dbnsfp.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,171 @@
+<tool id="snpsift_dbnsfp" name="SnpSift dbNSFP" version="3.6">
+    <description>Annotate with dbNSFP</description>
+    <expand macro="requirements" />
+    <macros>
+        <import>snpEff_macros.xml</import>
+    </macros>
+    <command>
+        SNPEFF_DATA_DIR=`grep '^data_dir' \$SNPEFF_JAR_PATH/snpEff.config | sed 's/.*data_dir.*[=:]//'`;
+        java -jar \$SNPEFF_JAR_PATH/SnpSift.jar dbnsfp -f "$annotations" -v \$SNPEFF_DATA_DIR/dbNSFP2.4.txt.gz $input 2&gt; $log &gt; $output
+    </command>
+    <inputs>
+        <param name="input" type="data" format="vcf" label="Variant file (VCF)" />
+        <param name="annotations" type="select" display="checkboxes" multiple="true" label="Select annotations (-f)" help="See below for the full description of some annotations">
+            <option value="1000Gp1_AC">1000Gp1_AC: Alternative allele counts in the whole 1000 genomes phase 1 (1000Gp1) data</option>
+            <option value="1000Gp1_AF" selected="true">1000Gp1_AF: Alternative allele frequency in the whole 1000Gp1 data</option>
+            <option value="1000Gp1_AFR_AC">1000Gp1_AFR_AC: Alternative allele counts in the 1000Gp1 African descendent samples</option>
+            <option value="1000Gp1_AFR_AF" selected="true">1000Gp1_AFR_AF: Alternative allele frequency in the 1000Gp1 African descendent samples</option>
+            <option value="1000Gp1_AMR_AC">1000Gp1_AMR_AC: Alternative allele counts in the 1000Gp1 American descendent samples</option>
+            <option value="1000Gp1_AMR_AF" selected="true">1000Gp1_AMR_AF: Alternative allele frequency in the 1000Gp1 American descendent samples</option>
+            <option value="1000Gp1_ASN_AC">1000Gp1_ASN_AC: Alternative allele counts in the 1000Gp1 Asian descendent samples</option>
+            <option value="1000Gp1_ASN_AF" selected="true">1000Gp1_ASN_AF: Alternative allele frequency in the 1000Gp1 Asian descendent samples</option>
+            <option value="1000Gp1_EUR_AC">1000Gp1_EUR_AC: Alternative allele counts in the 1000Gp1 European descendent samples</option>
+            <option value="1000Gp1_EUR_AF" selected="true">1000Gp1_EUR_AF: Alternative allele frequency in the 1000Gp1 European descendent samples</option>
+            <option value="aaalt">aaalt: Alternative amino acid. "." if the variant is a splicing site SNP (2bp on each end of an intron)</option>
+            <option value="aapos">aapos: Amino acid position as to the protein. "-1" if the variant is a splicing site SNP (2bp on each end of an intron)</option>
+            <option value="aapos_SIFT">aapos_SIFT: ENSP id and amino acid positions corresponding to SIFT scores. Multiple entries separated by ";"</option>
+            <option value="aapos_FATHMM">aapos_FATHMM: ENSP id and amino acid positions corresponding to FATHMM scores. Multiple entries separated by ";"</option>
+            <option value="aaref">aaref: Reference amino acid. "." if the variant is a splicing site SNP (2bp on each end of an intron)</option>
+            <option value="alt">alt: Alternative nucleotide allele (as on the + strand)</option>
+            <option value="Ancestral_allele">Ancestral_allele: Ancestral allele (based on 1000 genomes reference data)</option>
+            <option value="CADD_phred">CADD_phred: CADD phred-like score</option>
+            <option value="CADD_raw">CADD_raw: CADD raw score for functional prediction of a SNP</option>
+            <option value="CADD_raw_rankscore">CADD_raw_rankscore: CADD raw scores were ranked among all CADD raw scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of CADD raw scores in dbNSFP</option>
+            <option value="cds_strand">cds_strand: Coding sequence (CDS) strand (+ or -)</option>
+            <option value="chr">chr: Chromosome number</option>
+            <option value="codonpos">codonpos: Position on the codon (1, 2 or 3)</option>
+            <option value="Ensembl_geneid">Ensembl_geneid: Ensembl gene ID</option>
+            <option value="Ensembl_transcriptid">Ensembl_transcriptid: Ensembl transcript IDs (separated by ";")</option>
+            <option value="ESP6500_AA_AF" selected="true">ESP6500_AA_AF: Alternative allele frequency in the African American samples of the NHLBI GO Exome Sequencing Project (ESP6500 data set)</option>
+            <option value="ESP6500_EA_AF" selected="true">ESP6500_EA_AF: Alternative allele frequency in the European American samples of the NHLBI GO Exome Sequencing Project (ESP6500 data set)</option>
+            <option value="FATHMM_pred">FATHMM_pred: If a FATHMM_score is &lt;=-1.5 (or rankscore &lt;=0.81415) the corresponding non-synonymous SNP is predicted as "D(AMAGING)"; otherwise it is predicted as "T(OLERATED)". Multiple predictions separated by ";"</option>
+            <option value="FATHMM_rankscore">FATHMM_rankscore: FATHMMori scores were ranked among all FATHMMori scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of FATHMMori scores in dbNSFP. If there are multiple scores, only the most damaging (largest) rankscore is presented. The scores range from 0 to 1</option>
+            <option value="FATHMM_score">FATHMM_score: FATHMM default score (FATHMMori)</option>
+            <option value="fold-degenerate">fold-degenerate: Degenerate type (0, 2 or 3)</option>
+            <option value="genename">genename: Gene name; if the non-synonymous SNP can be assigned to multiple genes, gene names are separated by ";"</option>
+            <option value="GERP++_NR" selected="true">GERP++_NR: GERP++ neutral rate</option>
+            <option value="GERP++_RS" selected="true">GERP++_RS: GERP++ RS score, the larger the score, the more conserved the site</option>
+            <option value="GERP++_RS_rankscore">GERP++_RS_rankscore: GERP++ RS scores were ranked among all GERP++ RS scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of GERP++ RS scores in dbNSFP</option>
+            <option value="hg18_pos(1-coor)">hg18_pos(1-coor): Physical position on the chromosome as to hg18 (1-based coordinate)</option>
+            <option value="Interpro_domain" selected="true">Interpro_domain: Domain or conserved site on which the variant locates</option>
+            <option value="LR_pred">LR_pred: Prediction of our LR based ensemble prediction score, "T(olerated)" or "D(amaging)". The score cutoff between "D" and "T" is 0.5. The rankscore cutoff between "D" and "T" is 0.82268</option>
+            <option value="LR_rankscore">LR_rankscore: LR scores were ranked among all LR scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of LR scores in dbNSFP. The scores range from 0 to 1</option>
+            <option value="LR_score">LR_score: Our logistic regression (LR) based ensemble prediction score, which incorporated 10 scores (SIFT, PolyPhen-2 HDIV, PolyPhen-2 HVAR, GERP++, MutationTaster, Mutation Assessor, FATHMM, LRT, SiPhy, PhyloP) and the maximum frequency observed in the 1000 genomes populations. Larger value means the SNV is more likely to be damaging. Scores range from 0 to 1</option>
+            <option value="LRT_Omega">LRT_Omega: Estimated nonsynonymous-to-synonymous-rate ratio (Omega, reported by LRT)</option>
+            <option value="LRT_converted_rankscore">LRT_converted_rankscore: LRTori scores were first converted as LRTnew=1-LRTori*0.5 if Omega&lt;1, or LRTnew=LRTori*0.5 if Omega&gt;=1. Then LRTnew scores were ranked among all LRTnew scores in dbNSFP. The rankscore is the ratio of the rank over the total number of the scores in dbNSFP. The scores range from 0.00166 to 0.85682</option>
+            <option value="LRT_pred" selected="true">LRT_pred: LRT prediction, D(eleterious), N(eutral) or U(nknown), which is not solely determined by the score</option>
+            <option value="LRT_score">LRT_score: The original LRT two-sided p-value (LRTori), ranges from 0 to 1</option>
+            <option value="MutationAssessor_pred">MutationAssessor_pred: MutationAssessor's functional impact of a variant</option>
+            <option value="MutationAssessor_rankscore">MutationAssessor_rankscore: MAori scores were ranked among all MAori scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of MAori scores in dbNSFP. The scores range from 0 to 1</option>
+            <option value="MutationAssessor_score">MutationAssessor_score: MutationAssessor functional impact combined score (MAori)</option>
+            <option value="MutationTaster_converted_rankscore">MutationTaster_converted_rankscore: The MTori scores were first converted: if the prediction is "A" or "D" MTnew=MTori; if the prediction is "N" or "P", MTnew=1-MTori. Then MTnew scores were ranked among all MTnew scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of MTnew scores in dbNSFP. The scores range from 0.0931 to 0.80722</option>
+            <option value="MutationTaster_pred" selected="true">MutationTaster_pred: MutationTaster prediction</option>
+            <option value="MutationTaster_score">MutationTaster_score: MutationTaster p-value (MTori), ranges from 0 to 1</option>
+            <option value="phastCons46way_placental">phastCons46way_placental: phastCons conservation score based on the multiple alignments of 33 placental mammal genomes (including human). The larger the score, the more conserved the site</option>
+            <option value="phastCons46way_placental_rankscore">phastCons46way_placental_rankscore: phastCons46way_placental scores were ranked among all phastCons46way_placental scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of phastCons46way_placental scores in dbNSFP</option>
+            <option value="phastCons46way_primate">phastCons46way_primate: phastCons conservation score based on the multiple alignments of 10 primate genomes (including human). The larger the score, the more conserved the site</option>
+            <option value="phastCons46way_primate_rankscore">phastCons46way_primate_rankscore: phastCons46way_primate scores were ranked among all phastCons46way_primate scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of phastCons46way_primate scores in dbNSFP</option>
+            <option value="phastCons100way_vertebrate" selected="true">phastCons100way_vertebrate: phastCons conservation score based on the multiple alignments of 100 vertebrate genomes (including human). The larger the score, the more conserved the site</option>
+            <option value="phastCons100way_vertebrate_rankscore">phastCons100way_vertebrate_rankscore: phastCons100way_vertebrate scores were ranked among all phastCons100way_vertebrate scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of phastCons100way_vertebrate scores in dbNSFP</option>
+            <option value="phyloP46way_placental">phyloP46way_placental: phyloP (phylogenetic p-values) conservation score based on the multiple alignments of 33 placental mammal genomes (including human). The larger the score, the more conserved the site</option>
+            <option value="phyloP46way_placental_rankscore">phyloP46way_placental_rankscore: phyloP46way_placental scores were ranked among all phyloP46way_placental scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of phyloP46way_placental scores in dbNSFP</option>
+            <option value="phyloP46way_primate">phyloP46way_primate: phyloP (phylogenetic p-values) conservation score based on the multiple alignments of 10 primate genomes (including human). The larger the score, the more conserved the site</option>
+            <option value="phyloP46way_primate_rankscore">phyloP46way_primate_rankscore: phyloP46way_primate scores were ranked among all phyloP46way_primate scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of phyloP46way_primate scores in dbNSFP</option>
+            <option value="phyloP100way_vertebrate">phyloP100way_vertebrate: phyloP (phylogenetic p-values) conservation score based on the multiple alignments of 100 vertebrate genomes (including human). The larger the score, the more conserved the site</option>
+            <option value="phyloP100way_vertebrate_rankscore">phyloP100way_vertebrate_rankscore: phyloP100way_vertebrate scores were ranked among all phyloP100way_vertebrate scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of phyloP100way_vertebrate scores in dbNSFP</option>
+            <option value="Polyphen2_HDIV_pred" selected="true">Polyphen2_HDIV_pred: Polyphen2 prediction based on HumDiv</option>
+            <option value="Polyphen2_HDIV_rankscore">Polyphen2_HDIV_rankscore: Polyphen2 HDIV scores were first ranked among all HDIV scores in dbNSFP. The rankscore is the ratio of the rank the score over the total number of the scores in dbNSFP. If there are multiple scores, only the most damaging (largest) rankscore is presented. The scores range from 0.02656 to 0.89917</option>
+            <option value="Polyphen2_HDIV_score">Polyphen2_HDIV_score: Polyphen2 score based on HumDiv, i.e. hdiv_prob. The score ranges from 0 to 1. Multiple entries separated by ";"</option>
+            <option value="Polyphen2_HVAR_pred" selected="true">Polyphen2_HVAR_pred: Polyphen2 prediction based on HumVar</option>
+            <option value="Polyphen2_HVAR_rankscore">Polyphen2_HVAR_rankscore: Polyphen2 HVAR scores were first ranked among all HVAR scores in dbNSFP. The rankscore is the ratio of the rank the score over the total number of the scores in dbNSFP. If there are multiple scores, only the most damaging (largest) rankscore is presented. The scores range from 0.01281 to 0.9711</option>
+            <option value="Polyphen2_HVAR_score">Polyphen2_HVAR_score: Polyphen2 score based on HumVar, i.e. hvar_prob. The score ranges from 0 to 1. Multiple entries separated by ";"</option>
+            <option value="pos(1-coor)">pos(1-coor): Physical position on the chromosome as to hg19 (1-based coordinate)</option>
+            <option value="RadialSVM_pred">RadialSVM_pred: Prediction of our SVM based ensemble prediction score, "T(olerated)" or "D(amaging)". The score cutoff between "D" and "T" is 0. The rankscore cutoff between "D" and "T" is 0.83357</option>
+            <option value="RadialSVM_rankscore">RadialSVM_rankscore: RadialSVM scores were ranked among all RadialSVM scores in dbNSFP. The rankscore is the ratio of the rank of the screo over the total number of RadialSVM scores in dbNSFP. The scores range from 0 to 1</option>
+            <option value="RadialSVM_score">RadialSVM_score: Our support vector machine (SVM) based ensemble prediction score, which incorporated 10 scores (SIFT, PolyPhen-2 HDIV, PolyPhen-2 HVAR, GERP++, MutationTaster, Mutation Assessor, FATHMM, LRT, SiPhy, PhyloP) and the maximum frequency observed in the 1000 genomes populations. Larger value means the SNV is more likely to be damaging. Scores range from -2 to 3 in dbNSFP</option>
+            <option value="ref">ref: Reference nucleotide allele (as on the + strand)</option>
+            <option value="refcodon">refcodon: Reference codon</option>
+            <option value="Reliability_index">Reliability_index: Number of observed component scores (except the maximum frequency in the 1000 genomes populations) for RadialSVM and LR. Ranges from 1 to 10. As RadialSVM and LR scores are calculated based on imputed data, the less missing component scores, the higher the reliability of the scores and predictions</option>
+            <option value="SIFT_converted_rankscore">SIFT_converted_rankscore: SIFTori scores were first converted to SIFTnew=1-SIFTori, then ranked among all SIFTnew scores in dbNSFP. The rankscore is the ratio of the rank the SIFTnew score over the total number of SIFTnew scores in dbNSFP. If there are multiple scores, only the most damaging (largest) rankscore is presented. The rankscores range from 0.02654 to 0.87932</option>
+            <option value="SIFT_pred" selected="true">SIFT_pred: If SIFTori is smaller than 0.05 (rankscore&gt;0.55) the corresponding non-synonymous SNP is predicted as "D(amaging)"; otherwise it is predicted as "T(olerated)". Multiple predictions separated by ";"</option>
+            <option value="SIFT_score">SIFT_score: SIFT score (SIFTori). Scores range from 0 to 1. The smaller the score the more likely the SNP has damaging effect. Multiple scores separated by ";"</option>
+            <option value="SiPhy_29way_logOdds">SiPhy_29way_logOdds: SiPhy score based on 29 mammals genomes. The larger the score, the more conserved the site</option>
+            <option value="SiPhy_29way_pi">SiPhy_29way_pi: The estimated stationary distribution of A, C, G and T at the site, using SiPhy algorithm based on 29 mammals genomes</option>
+            <!-- <option value="SLR_test_statistic">SLR_test_statistic: SLR test statistic for testing natural selection on codons. A negative value indicates negative selection, and a positive value indicates positive selection. Larger magnitude of the value suggests stronger evidence</option> temporarily disable because of https://github.com/pcingola/SnpSift/issues/3 -->
+            <option value="Uniprot_aapos">Uniprot_aapos: Amino acid position as to Uniprot. Multiple entries separated by ";"</option>
+            <option value="Uniprot_acc" selected="true">Uniprot_acc: Uniprot accession number. Multiple entries separated by ";"</option>
+            <option value="Uniprot_id">Uniprot_id: Uniprot ID number. Multiple entries separated by ";"</option>
+            <option value="UniSNP_ids">UniSNP_ids: rs numbers from UniSNP, which is a cleaned version of dbSNP build 129, in format: rs number1;rs number2;...</option>
+            <validator type="no_options" message="Select at least one annotation" />
+        </param>
+    </inputs>
+    <outputs>
+        <data name="output" format="vcf" label="${tool.name} on ${on_string}: VCF" />
+        <data name="log" format="txt" label="${tool.name} on ${on_string}: log" />
+    </outputs>
+    <expand macro="stdio" />
+    <tests>
+    </tests>
+    <help>
+**What it does**
+
+This tool uses `SnpSift dbNSFP`_ to add annotations from `dbNSFP`_ v2.4, an integrated database of functional annotations from multiple sources for the comprehensive collection of human non-synonymous SNPs.
+
+.. _SnpSift dbNSFP: http://snpeff.sourceforge.net/SnpSift.html#dbNSFP
+
+**Annotations**
+
+Ancestral_allele
+    Ancestral allele (based on 1000 genomes reference data). The following comes from its original README file:
+
+    ACTG
+        high-confidence call, ancestral state supproted by the other two sequences
+    actg
+        low-confindence call, ancestral state supported by one sequence only
+    N
+        failure, the ancestral state is not supported by any other sequence
+    \-
+        the extant species contains an insertion at this position
+    \.
+        no coverage in the alignment
+
+CADD_phred
+    CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores. Please refer to Kircher et al. (2014) Nat. Genet. 46(3):310-5 for details. The larger the score, the more likely the SNP has damaging effect. Please note the following copyright statement for CADD: "CADD scores (http://cadd.gs.washington.edu/) are Copyright 2013 University of Washington and Hudson-Alpha Institute for Biotechnology (all rights reserved) but are freely available for all academic, non-commercial applications. For commercial licensing information contact Jennifer McCullar (mccullaj@uw.edu)"
+CADD_raw
+    CADD raw score for functional prediction of a SNP. Please refer to Kircher et al. (2014) Nat. Genet. 46(3):310-315 for details. The larger the score, the more likely the SNP has damaging effect. Please note the following copyright statement for CADD: "CADD scores (http://cadd.gs.washington.edu/) are Copyright 2013 University of Washington and Hudson-Alpha Institute for Biotechnology (all rights reserved) but are freely available for all academic, non-commercial applications. For commercial licensing information contact Jennifer McCullar (mccullaj@uw.edu)"
+CADD_raw_rankscore
+    CADD raw scores were ranked among all CADD raw scores in dbNSFP. The rankscore is the ratio of the rank of the score over the total number of CADD raw scores in dbNSFP. Please note the following copyright statement for CADD: "CADD scores (http://cadd.gs.washington.edu/) are Copyright 2013 University of Washington and Hudson-Alpha Institute for Biotechnology (all rights reserved) but are freely available for all academic, non-commercial applications. For commercial licensing information contact Jennifer McCullar (mccullaj@uw.edu)"
+FATHMM_score
+    FATHMM default score (weighted for human inherited-disease mutations with Disease Ontology) (FATHMMori). Scores range from -18.09 to 11.0. Multiple scores separated by ";". Please refer to Shihab et al. (2013) Human Mutation 34(1):57-65 for details
+Interpro_domain
+    domain or conserved site on which the variant locates. Domain annotations come from Interpro database. The number in the brackets following a specific domain is the count of times Interpro assigns the variant position to that domain, typically coming from different predicting databases. Multiple entries separated by ";"
+MutationAssessor_pred
+    MutationAssessor's functional impact of a variant: predicted functional, i.e. high ("H") or medium ("M"), or predicted non-functional, i.e. low ("L") or neutral ("N"). The MAori score cutoffs between "H" and "M", "M" and "L", and "L" and "N", are 3.5, 1.9 and 0.8, respectively. The rankscore cutoffs between "H" and "M", "M" and "L", and "L" and "N", are 0.9416, 0.61387 and 0.26162, respectively
+MutationAssessor_score
+    MutationAssessor functional impact combined score (MAori). The score ranges from -5.545 to 5.975 in dbNSFP. Please refer to Reva et al. (2011) Nucl. Acids Res. 39(17):e118 for details
+MutationTaster_pred
+    MutationTaster prediction, "A" ("disease_causing_automatic"), "D" ("disease_causing"), "N" ("polymorphism") or "P" ("polymorphism_automatic"). The score cutoff between "D" and "N" is 0.5 for MTori and 0.328 for the rankscore
+Polyphen2_HDIV_pred
+    Polyphen2 prediction based on HumDiv, "D" ("probably damaging", HDIV score in [0.957,1] or rankscore in [0.52996,0.89917]), "P" ("possibly damaging", HDIV score in [0.453,0.956] or rankscore in [0.34412,0.52842]) and "B" ("benign", HDIV score in [0,0.452] or rankscore in [0.02656,0.34399]). Score cutoff for binary classification is 0.5 for HDIV score or 0.35411 for rankscore, i.e. the prediction is "neutral" if the HDIV score is smaller than 0.5 (rankscore is smaller than 0.35411), and "deleterious" if the HDIV score is larger than 0.5 (rankscore is larger than 0.35411). Multiple entries separated by ";"
+Polyphen2_HVAR_pred
+    Polyphen2 prediction based on HumVar, "D" ("probably damaging", HVAR score in [0.909,1] or rankscore in [0.62955,0.9711]), "P" ("possibly damaging", HVAR score in [0.447,0.908] or rankscore in [0.44359,0.62885]) and "B" ("benign", HVAR score in [0,0.446] or rankscore in [0.01281,0.44315]). Score cutoff for binary classification is 0.5 for HVAR score or 0.45998 for rankscore, i.e. the prediction is "neutral" if the HVAR score is smaller than 0.5 (rankscore is smaller than 0.45998), and "deleterious" if the HVAR score is larger than 0.5 (rankscore is larger than 0.45998). Multiple entries separated by ";"
+
+**License and citation**
+
+This Galaxy tool is Copyright © 2013-2014 `CRS4 Srl.`_ and is released under the `MIT license`_.
+
+.. _CRS4 Srl.: http://www.crs4.it/
+.. _MIT license: http://opensource.org/licenses/MIT
+
+If you use this tool in Galaxy, please cite |Cuccuru2014|_.
+
+.. |Cuccuru2014| replace:: Cuccuru, G., Orsini, M., Pinna, A., Sbardellati, A., Soranzo, N., Travaglione, A., Uva, P., Zanetti, G., Fotia, G. (2014) Orione, a web-based framework for NGS analysis in microbiology. *Bioinformatics*, doi:10.1093/bioinformatics/btu135
+.. _Cuccuru2014: http://bioinformatics.oxfordjournals.org/content/early/2014/04/03/bioinformatics.btu135
+
+    </help>
+
+    <expand macro="citations">
+        <citation type="doi">10.1002/humu.22376</citation><!-- dbNSFP v2.0 citation -->
+    </expand>
+
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snpsift_vartype.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,43 @@
+<tool id="snpsift_vartype" name="SnpSift Variant Type" version="3.6">
+    <description>Annotate with variant type</description>
+    <expand macro="requirements" />
+    <macros>
+        <import>snpEff_macros.xml</import>
+    </macros>
+    <command>
+        java -jar \$SNPEFF_JAR_PATH/SnpSift.jar varType $input 2&gt; $log &gt; $output
+    </command>
+    <inputs>
+        <param format="vcf" name="input" type="data" label="Variant file (VCF)"/>
+    </inputs>
+    <outputs>
+        <data format="vcf" name="output" label="${tool.name} on ${on_string}: VCF" />
+        <data format="txt" name="log" label="${tool.name} on ${on_string}: log" />
+    </outputs>
+    <expand macro="stdio" />
+    <tests>
+    </tests>
+    <help>
+**What it does**
+
+This tool uses `SnpSift Variant type`_ to add the variant type (SNP/MNP/INS/DEL/MIXED) in the INFO field. It also adds "HOM/HET", but this last one works if there is only one sample (otherwise it doesn't make any sense).
+
+.. _SnpSift Variant type: http://snpeff.sourceforge.net/SnpSift.html#VariantType
+
+------
+
+**License and citation**
+
+This Galaxy tool is Copyright © 2013-2014 `CRS4 Srl.`_ and is released under the `MIT license`_.
+
+.. _CRS4 Srl.: http://www.crs4.it/
+.. _MIT license: http://opensource.org/licenses/MIT
+
+If you use this tool in Galaxy, please cite |Cuccuru2014|_.
+
+.. |Cuccuru2014| replace:: Cuccuru, G., Orsini, M., Pinna, A., Sbardellati, A., Soranzo, N., Travaglione, A., Uva, P., Zanetti, G., Fotia, G. (2014) Orione, a web-based framework for NGS analysis in microbiology. *Bioinformatics*, doi:10.1093/bioinformatics/btu135
+.. _Cuccuru2014: http://bioinformatics.oxfordjournals.org/content/early/2014/04/03/bioinformatics.btu135
+
+    </help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotate_1.vcf	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,1 @@
+1	872687	.	C	G	.	.	.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotate_5.vcf	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,5 @@
+1	872687	rs76166080	C	G	.	.	.
+1	970878	.	C	T	.	.	.
+1	979690	rs115413462	G	A	.	.	.
+1	1160967	.	C	T	.	.	.
+1	1195966	rs114569001	G	A	.	.	.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/db_test_1.vcf	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,1 @@
+1	872687	rs76166080	C	G	0	.	.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/interval.bed	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,10 @@
+chr1	1	100000
+chr1	100000	200000
+chr1	200000	300000
+chr1	300000	400000
+chr1	400000	500000
+chr1	500000	600000
+chr1	600000	700000
+chr1	700000	800000
+chr1	800000	900000
+chr1	900000	1000000
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.private.01.vcf	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,3 @@
+##fileformat=VCFv4.0
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	id1	id2
+1	123456	.	A	G	.	.	AF=0	GT	0/0	0/0	
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.private.02.vcf	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,3 @@
+##fileformat=VCFv4.0
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	id1	id2
+1	123456	.	A	G	.	.	AF=0	GT	1/1	1/1	
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test01.vcf	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,1000 @@
+##fileformat=VCFv4.1
+##samtoolsVersion=0.1.16 (r963:234)
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw read depth">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=MQ,Number=1,Type=Integer,Description="Root-mean-square mapping quality of covering reads">
+##INFO=<ID=FQ,Number=1,Type=Float,Description="Phred probability of all samples being the same">
+##INFO=<ID=AF1,Number=1,Type=Float,Description="Max-likelihood estimate of the site allele frequency of the first ALT allele">
+##INFO=<ID=G3,Number=3,Type=Float,Description="ML estimate of genotype frequencies">
+##INFO=<ID=HWE,Number=1,Type=Float,Description="Chi^2 based HWE test P-value based on G3">
+##INFO=<ID=CI95,Number=2,Type=Float,Description="Equal-tail Bayesian credible interval of the site allele frequency at the 95% level">
+##INFO=<ID=PV4,Number=4,Type=Float,Description="P-values for strand bias, baseQ bias, mapQ bias and tail distance bias">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=PC2,Number=2,Type=Integer,Description="Phred probability of the nonRef allele frequency in group1 samples being larger (,smaller) than in group2.">
+##INFO=<ID=PCHI2,Number=1,Type=Float,Description="Posterior weighted chi^2 P-value for testing the association between group1 and group2 samples.">
+##INFO=<ID=QCHI2,Number=1,Type=Integer,Description="Phred scaled PCHI2.">
+##INFO=<ID=PR,Number=1,Type=Integer,Description="# permutations yielding a smaller PCHI2.">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=GL,Number=3,Type=Float,Description="Likelihoods for RR,RA,AA genotypes (R=ref,A=alt)">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="# high-quality bases">
+##FORMAT=<ID=SP,Number=1,Type=Integer,Description="Phred-scaled strand bias P-value">
+##FORMAT=<ID=PL,Number=-1,Type=Integer,Description="List of Phred-scaled genotype likelihoods, number of values is (#ALT+1)*(#ALT+2)/2">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	s_1_BcA2.sort.rmdup.Q20.noMh.bam
+NT_166464	696	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166464	745	.	G	C	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+NT_166464	7258	.	A	C	40	.	DP=4;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,2,1;MQ=32;FQ=-4.12;PV4=1,0.28,0.21,0.17	GT:PL:GQ	0/1:70,0,25:28
+NT_166464	7268	.	A	G	8.65	.	DP=4;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,1,1;MQ=30;FQ=3.32;PV4=1,0.017,0,1	GT:PL:GQ	0/1:38,0,28:32
+NT_166464	7283	.	T	C	11.3	.	DP=3;AF1=0.501;CI95=0.5,0.5;DP4=1,0,1,1;MQ=30;FQ=-4.81;PV4=1,1,0,1	GT:PL:GQ	0/1:41,0,24:28
+NT_166464	7335	.	G	A	18.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33	GT:PL:GQ	1/1:50,6,0:10
+NT_166464	8030	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166452	8268	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166452	16693	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166480	12474	.	G	A	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_166480	12483	.	A	G	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+NT_166476	578	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166476	22223	.	A	C	3.01	.	DP=4;AF1=0.4998;CI95=0.5,0.5;DP4=0,2,2,0;MQ=32;FQ=4.63;PV4=0.33,0.26,0,0.42	GT:PL:GQ	0/1:30,0,43:28
+NT_166476	22256	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166476	23076	.	A	T	8.44	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33	GT:PL:GQ	1/1:39,6,0:8
+NT_166476	23487	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166454	64	.	T	A	8.64	.	DP=7;AF1=0.5;CI95=0.5,0.5;DP4=1,4,2,0;MQ=29;FQ=11.3;PV4=0.14,1,1,1	GT:PL:GQ	0/1:38,0,91:40
+NT_166454	95	.	T	A	9.52	.	DP=7;AF1=0.5;CI95=0.5,0.5;DP4=2,3,1,1;MQ=29;FQ=12.3;PV4=1,0.19,1,1	GT:PL:GQ	0/1:39,0,101:41
+NT_166454	1580	.	T	C	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+NT_166454	7132	.	A	G	42.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:74,6,0:10
+NT_166454	7142	.	T	C	42.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:74,6,0:10
+NT_166454	7181	.	C	A	11.1	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:42,6,0:9
+NT_166454	11670	.	C	T	4.61	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:34,6,0:5
+NT_166454	15049	.	A	T	13.9	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:45,6,0:10
+NT_166454	15052	.	TA	T	35.2	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:74,6,0:10
+NT_166454	15373	.	C	G	30.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:62,6,0:10
+NT_166454	15388	.	C	G	22.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:54,6,0:10
+NT_166454	15440	.	TA	T	28.2	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:67,6,0:10
+NT_166454	18840	.	C	T	6.79	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33	GT:PL:GQ	1/1:37,6,0:7
+NT_166454	18863	.	T	C	13.9	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33	GT:PL:GQ	1/1:45,6,0:10
+NT_166454	18933	.	C	T	4.77	.	DP=3;AF1=0.5003;CI95=0.5,0.5;DP4=1,0,2,0;MQ=30;FQ=-3.1;PV4=1,0.032,0,0.31	GT:PL:GQ	0/1:33,0,28:30
+NT_166454	21433	.	G	T	6.02	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:36,6,0:6
+NT_166454	21485	.	TAAAAA	TAAAA	17.5	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:57,9,0:15
+NT_166481	473	.	A	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166481	476	.	A	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166481	558	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166481	9526	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166481	10879	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166481	17878	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166481	20402	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166481	20413	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166459	13329	.	T	G	20.1	.	DP=3;AF1=0.5013;CI95=0.5,0.5;DP4=1,0,1,1;MQ=37;FQ=-5.45;PV4=1,0.48,1,0.33	GT:PL:GQ	0/1:50,0,23:26
+NT_166459	21532	.	T	C	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+NT_166473	10619	.	T	A	4.13	.	DP=4;AF1=0.5003;CI95=0.5,0.5;DP4=1,0,0,3;MQ=28;FQ=-3.64;PV4=0.25,0.036,0,1	GT:PL:GQ	0/1:32,0,27:29
+NT_166473	10641	.	A	T	47.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=28;FQ=-39	GT:PL:GQ	1/1:80,12,0:21
+NT_166461	20175	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166462	4505	.	A	G	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_166462	4585	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166462	25794	.	A	C	7.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166462	25801	.	T	G	22.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:54,6,0:10
+NT_166462	25952	.	T	C	32.1	.	DP=9;AF1=1;CI95=0.5,1;DP4=0,0,6,0;MQ=37;FQ=-45	GT:PL:GQ	1/1:65,18,0:33
+NT_166462	25967	.	T	C	135	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,9,0;MQ=37;FQ=-54	GT:PL:GQ	1/1:168,27,0:51
+NT_166462	26035	.	T	C	82	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,9,0;MQ=37;FQ=-54	GT:PL:GQ	1/1:115,27,0:51
+NT_166462	26537	.	C	G	83.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39	GT:PL:GQ	1/1:116,12,0:21
+NT_166462	26577	.	A	C	29.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39	GT:PL:GQ	1/1:62,12,0:21
+NT_166462	26682	.	A	G	222	.	DP=19;AF1=1;CI95=1,1;DP4=0,0,9,9;MQ=30;FQ=-81	GT:PL:GQ	1/1:255,54,0:99
+NT_166462	26690	.	A	G	184	.	DP=20;AF1=1;CI95=1,1;DP4=0,0,10,10;MQ=31;FQ=-87	GT:PL:GQ	1/1:217,60,0:99
+NT_166462	26717	.	A	G	207	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=36;FQ=-57	GT:PL:GQ	1/1:240,30,0:57
+NT_166462	26722	.	T	C	98	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=36;FQ=-57	GT:PL:GQ	1/1:131,30,0:57
+NT_166462	26762	.	CAA	CAAA	207	.	INDEL;DP=10;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=36;FQ=-64.5	GT:PL:GQ	1/1:248,30,0:57
+NT_166453	185	.	A	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166453	198	.	T	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166453	264	.	T	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_166453	312	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166453	321	.	C	T	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_166453	20370	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166467	12821	.	C	T	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_166338	16706	.	C	A	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+NT_166338	16707	.	T	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166338	16708	.	C	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166338	16774	.	G	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_166442	37512	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166442	37558	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166442	37567	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166451	487	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166450	27330	.	T	A	28	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36	GT:PL:GQ	1/1:60,9,0:16
+NT_166450	27339	.	T	C	51	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36	GT:PL:GQ	1/1:83,9,0:16
+NT_166450	27452	.	G	A	101	.	DP=11;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=37;FQ=-57	GT:PL:GQ	1/1:134,30,0:57
+NT_166450	27483	.	T	C	67.3	.	DP=7;AF1=1;CI95=0.5,1;DP4=0,0,3,2;MQ=37;FQ=-42	GT:PL:GQ	1/1:100,15,0:27
+NT_166450	27488	.	T	G	7.59	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:38,6,0:7
+NT_166450	27538	.	A	G	12	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33	GT:PL:GQ	1/1:43,6,0:9
+NT_166450	27561	.	T	C	48.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=27;FQ=-45	GT:PL:GQ	1/1:81,18,0:33
+NT_166450	27591	.	T	C	54.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=27;FQ=-45	GT:PL:GQ	1/1:87,18,0:33
+NT_166450	27618	.	T	C	77.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=27;FQ=-45	GT:PL:GQ	1/1:110,18,0:33
+NT_166450	27627	.	A	G	102	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=27;FQ=-45	GT:PL:GQ	1/1:135,18,0:33
+NT_166450	27651	.	G	A	10.2	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:41,6,0:8
+NT_166450	27659	.	C	A	65	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36	GT:PL:GQ	1/1:97,9,0:16
+NT_166450	27664	.	T	C	31.5	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=37;FQ=-39	GT:PL:GQ	1/1:64,12,0:21
+NT_166450	27700	.	T	C	106	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=37;FQ=-51	GT:PL:GQ	1/1:139,24,0:45
+NT_166450	27798	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166450	27807	.	T	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166450	27813	.	A	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166447	29896	.	A	G	4.77	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+NT_166468	8984	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166468	8986	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166468	8989	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166477	2080	.	T	A	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+NT_166455	23979	.	C	A	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+NT_166291	4663	.	G	A	11.1	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:42,6,0:9
+NT_166291	4684	.	C	G	32.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:64,6,0:10
+NT_166291	27578	.	G	A	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+NT_166291	35549	.	C	G	117	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=36;FQ=-57	GT:PL:GQ	1/1:150,30,0:57
+NT_166291	35756	.	A	G	198	.	DP=20;AF1=1;CI95=1,1;DP4=0,0,9,10;MQ=37;FQ=-84	GT:PL:GQ	1/1:231,57,0:99
+NT_166463	6735	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166463	6736	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166309	64876	.	A	G	25	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=33;FQ=-36	GT:PL:GQ	1/1:57,9,0:15
+NT_166309	64910	.	A	C	30.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=30;FQ=-42	GT:PL:GQ	1/1:63,15,0:27
+NT_166309	64925	.	A	G	29.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=30;FQ=-42	GT:PL:GQ	1/1:62,15,0:27
+NT_166309	64960	.	T	G	45.5	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=28;FQ=-39	GT:PL:GQ	1/1:78,12,0:21
+NT_166309	64971	.	T	G	30	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36	GT:PL:GQ	1/1:62,9,0:16
+NT_166309	64979	.	A	C	13.9	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33	GT:PL:GQ	1/1:45,6,0:10
+NT_166309	69760	.	A	G	52	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=33;FQ=-36	GT:PL:GQ	1/1:84,9,0:16
+NT_166309	69765	.	T	C	42	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=33;FQ=-36	GT:PL:GQ	1/1:74,9,0:16
+NT_166309	69773	.	T	C	35	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=33;FQ=-36	GT:PL:GQ	1/1:67,9,0:16
+NT_166309	69799	.	G	C	25	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=33;FQ=-36	GT:PL:GQ	1/1:57,9,0:15
+NT_166309	69869	.	T	C	35.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:67,6,0:10
+NT_166309	103113	.	T	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166309	139729	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166282	41545	.	C	T	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+NT_166282	94999	.	C	T	31.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39	GT:PL:GQ	1/1:64,12,0:21
+NT_166282	95050	.	T	G	33	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-36	GT:PL:GQ	1/1:65,9,0:16
+NT_166314	112573	.	C	A	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+NT_166314	118593	.	C	T	35.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,4;MQ=34;FQ=-39	GT:PL:GQ	1/1:68,12,0:21
+NT_166314	118608	.	C	T	73.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,4;MQ=34;FQ=-39	GT:PL:GQ	1/1:106,12,0:21
+NT_166314	118836	.	A	C	84.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39	GT:PL:GQ	1/1:117,12,0:21
+NT_166314	118924	.	G	C	212	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,3,7;MQ=37;FQ=-57	GT:PL:GQ	1/1:245,30,0:57
+NT_166314	144387	.	A	T	3.54	.	DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=-3.07;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,29:29
+NT_166314	155508	.	A	T	65.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=37;FQ=-45	GT:PL:GQ	1/1:98,18,0:33
+NT_112000	52371	.	G	T	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_112000	52375	.	A	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_110857	19739	.	A	G	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+NT_166280	4649	.	C	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_166280	137528	.	T	C	32.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:64,6,0:10
+NT_166280	137545	.	C	T	13.9	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:45,6,0:10
+NT_166311	1782	.	C	T	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+NT_166311	69821	.	G	A	65.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=33;FQ=-42	GT:PL:GQ	1/1:98,15,0:27
+NT_166311	69841	.	C	A	42.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=33;FQ=-42	GT:PL:GQ	1/1:75,15,0:27
+NT_166311	69894	.	T	G	26	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36	GT:PL:GQ	1/1:58,9,0:16
+NT_166311	69917	.	G	A	20	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36	GT:PL:GQ	1/1:52,9,0:15
+NT_166310	83175	.	C	G	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+NT_166438	13070	.	C	A	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+NT_162750	40051	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_162750	40058	.	A	G	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_162750	71153	.	C	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_162750	71157	.	T	G	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_166387	1835	.	C	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166281	28467	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166281	28468	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166313	178838	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166313	179067	.	C	T	3.01	.	DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:30,0,31:28
+NT_166313	179084	.	T	C	3.54	.	DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=-3.07;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,29:29
+NT_166313	179560	.	A	G	97	.	DP=6;AF1=0.5032;CI95=0.5,0.5;DP4=1,0,1,4;MQ=35;FQ=-8.63;PV4=0.33,0.019,0.35,1	GT:PL:GQ	0/1:127,0,19:22
+NT_166313	179573	.	A	T	76.1	.	DP=7;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=35;FQ=-45	GT:PL:GQ	1/1:109,18,0:33
+NT_166313	179575	.	C	T	68	.	DP=7;AF1=0.5;CI95=0.5,0.5;DP4=1,1,1,4;MQ=36;FQ=26;PV4=1,0.0056,0.29,1	GT:PL:GQ	0/1:98,0,53:56
+NT_166313	179587	.	A	G	42	.	DP=8;AF1=0.5;CI95=0.5,0.5;DP4=1,2,1,4;MQ=36;FQ=42.9;PV4=1,0.0032,0.24,1	GT:PL:GQ	0/1:72,0,74:73
+NT_166313	180199	.	A	G	64	.	DP=13;AF1=0.5;CI95=0.5,0.5;DP4=9,0,3,1;MQ=37;FQ=67;PV4=0.31,1,1,1	GT:PL:GQ	0/1:94,0,143:97
+NT_166313	180204	.	C	T	17.1	.	DP=14;AF1=0.5;CI95=0.5,0.5;DP4=9,0,3,1;MQ=37;FQ=20.1;PV4=0.31,5.5e-06,1,1	GT:PL:GQ	0/1:47,0,143:50
+NT_166313	180258	.	C	G	38	.	DP=19;AF1=0.5;CI95=0.5,0.5;DP4=12,2,2,2;MQ=36;FQ=41;PV4=0.2,0.37,0.029,1	GT:PL:GQ	0/1:68,0,212:71
+NT_166313	180274	.	A	G	45	.	DP=14;AF1=0.5;CI95=0.5,0.5;DP4=5,0,3,6;MQ=36;FQ=47.6;PV4=0.031,2.3e-05,0.15,1	GT:PL:GQ	0/1:75,0,85:78
+NT_166313	180300	.	A	T	11.3	.	DP=15;AF1=0.5;CI95=0.5,0.5;DP4=4,6,1,4;MQ=36;FQ=14.2;PV4=0.6,1.7e-08,1,1	GT:PL:GQ	0/1:41,0,208:43
+NT_166313	180331	.	C	T	189	.	DP=17;AF1=0.5;CI95=0.5,0.5;DP4=1,3,6,6;MQ=34;FQ=59;PV4=0.58,0.16,0.068,1	GT:PL:GQ	0/1:219,0,86:89
+NT_166313	180352	.	C	T	126	.	DP=17;AF1=0.5;CI95=0.5,0.5;DP4=5,5,3,4;MQ=34;FQ=129;PV4=1,1,1,1	GT:PL:GQ	0/1:156,0,196:99
+NT_166313	180384	.	G	A	93	.	DP=16;AF1=0.5;CI95=0.5,0.5;DP4=2,4,6,4;MQ=34;FQ=95.9;PV4=0.61,3.3e-10,0.041,1	GT:PL:GQ	0/1:123,0,141:99
+NT_166313	180748	.	A	C	18.1	.	DP=7;AF1=0.5;CI95=0.5,0.5;DP4=4,1,2,0;MQ=37;FQ=21;PV4=1,1,1,0.13	GT:PL:GQ	0/1:48,0,123:51
+NT_166313	180901	.	A	G	86.5	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39	GT:PL:GQ	1/1:119,12,0:21
+NT_166313	182411	.	T	G	5.46	.	DP=6;AF1=0.4999;CI95=0.5,0.5;DP4=3,0,0,3;MQ=35;FQ=7.8;PV4=0.1,0.0036,0.19,1	GT:PL:GQ	0/1:34,0,72:34
+NT_166313	182447	.	A	G	10.4	.	DP=5;AF1=0.5;CI95=0.5,0.5;DP4=2,0,0,3;MQ=35;FQ=13;PV4=0.1,0.014,0.25,0.14	GT:PL:GQ	0/1:40,0,53:42
+NT_166313	183242	.	C	A	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+NT_166313	184154	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166313	184175	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166313	184807	.	T	C	15.9	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:47,6,0:10
+NT_166313	184892	.	T	G	38.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:70,6,0:10
+NT_166313	184925	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166313	184960	.	T	C	11.1	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:42,6,0:9
+NT_166313	184966	.	C	A	11.1	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:42,6,0:9
+NT_166313	185022	.	C	T	9.31	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:40,6,0:8
+NT_166313	185114	.	G	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_166313	185707	.	TGGGGGG	TGGGG	53.4	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:93,9,0:16
+NT_166313	186575	.	T	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_166313	188906	.	G	C	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+NT_166313	189753	.	T	G	42	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36	GT:PL:GQ	1/1:74,9,0:16
+NT_166313	189763	.	G	A	38	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36	GT:PL:GQ	1/1:70,9,0:16
+NT_166313	190763	.	A	C	7.59	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33	GT:PL:GQ	1/1:38,6,0:7
+NT_166313	190780	.	T	C	5.29	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33	GT:PL:GQ	1/1:35,6,0:6
+NT_166313	191046	.	C	T	33.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:65,6,0:10
+NT_166313	191075	.	C	G	32.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:64,6,0:10
+NT_166313	206710	.	CGAGAGAGAGAGAGAGAGA	CGAGAGAGAGAGAGAGA	8.18	.	INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=4,2,2,0;MQ=37;FQ=10.8;PV4=1,1.5e-06,1,1	GT:PL:GQ	0/1:45,0,159:47
+NT_166313	212911	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166313	242335	.	A	T	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_166313	242381	.	G	C	3.54	.	DP=3;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_166313	243035	.	G	T	8.44	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33	GT:PL:GQ	1/1:39,6,0:8
+NT_166313	243084	.	A	T	18.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33	GT:PL:GQ	1/1:50,6,0:10
+NT_166313	243235	.	T	A	13.9	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:45,6,0:10
+NT_166313	243340	.	C	G	15.1	.	DP=3;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,2,0;MQ=37;FQ=-4.14;PV4=1,0.3,1,0.077	GT:PL:GQ	0/1:45,0,25:28
+NT_161928	42786	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166378	24751	.	T	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_166378	24753	.	C	T	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_161926	91391	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161926	91392	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166385	319808	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_165789	268949	.	A	G	130	.	DP=11;AF1=1;CI95=1,1;DP4=0,0,5,5;MQ=33;FQ=-57	GT:PL:GQ	1/1:163,30,0:57
+NT_165789	268956	.	T	G	133	.	DP=11;AF1=1;CI95=1,1;DP4=0,0,5,5;MQ=33;FQ=-57	GT:PL:GQ	1/1:166,30,0:57
+NT_165789	268973	.	G	A	102	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=32;FQ=-51	GT:PL:GQ	1/1:135,24,0:45
+NT_165789	269002	.	G	A	47.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=25;FQ=-39	GT:PL:GQ	1/1:80,12,0:21
+NT_165789	269016	.	C	T	38	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=25;FQ=-36	GT:PL:GQ	1/1:70,9,0:16
+NT_165789	269124	.	T	A	53.2	.	DP=9;AF1=0.5263;CI95=0.5,1;DP4=0,1,3,5;MQ=33;FQ=-17.1;PV4=1,5.2e-06,0.26,0.24	GT:PL:GQ	0/1:83,0,10:13
+NT_165789	269148	.	A	G	9.53	.	DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=0,1,2,1;MQ=28;FQ=-4.22;PV4=1,0.0014,0,0.27	GT:PL:GQ	0/1:39,0,25:29
+NT_165789	269163	.	G	T	7.8	.	DP=3;AF1=0.5003;CI95=0.5,0.5;DP4=0,1,2,0;MQ=30;FQ=3.27;PV4=0.33,0.071,0,0.13	GT:PL:GQ	0/1:37,0,28:32
+NT_165789	303609	.	T	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166361	150408	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166348	244139	.	T	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166348	244145	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166369	123725	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166417	80615	.	C	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166417	80639	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166383	378092	.	T	A	5.46	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:34,3,0:3
+NT_166362	238907	.	T	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166362	238908	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_165754	250017	.	A	G	190	.	DP=22;AF1=1;CI95=1,1;DP4=0,0,11,8;MQ=37;FQ=-84	GT:PL:GQ	1/1:223,57,0:99
+NT_165754	252055	.	T	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+NT_165754	293702	.	G	C	6.79	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:37,6,0:7
+NT_165754	300330	.	C	A	139	.	DP=21;AF1=1;CI95=1,1;DP4=0,0,18,3;MQ=37;FQ=-90	GT:PL:GQ	1/1:172,63,0:99
+NT_165754	300742	.	AGG	AGGG	3.8	.	INDEL;DP=19;AF1=0.5;CI95=0.5,0.5;DP4=2,7,3,0;MQ=37;FQ=5.8;PV4=0.045,0.32,1,1	GT:PL:GQ	0/1:39,0,152:38
+NT_165754	300745	.	T	G	10.4	.	DP=19;AF1=0.5;CI95=0.5,0.5;DP4=0,7,5,0;MQ=35;FQ=13.2;PV4=0.0013,1.1e-06,0.038,1	GT:PL:GQ	0/1:40,0,128:42
+NT_165754	304284	.	T	TC	12.7	.	INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,2,2,0;MQ=37;FQ=15.6;PV4=0.4,1,1,0.41	GT:PL:GQ	0/1:50,0,89:53
+NT_165754	309950	.	A	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_165754	311521	.	A	AT	6.36	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-40.5	GT:PL:GQ	1/1:44,6,0:7
+NT_165754	329690	.	N	T	7.59	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:38,6,0:7
+NT_165754	329691	.	N	G	7.59	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:38,6,0:7
+NT_165754	329692	.	N	A	6.79	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:37,6,0:7
+NT_165754	329693	.	N	C	26	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=37;FQ=-36	GT:PL:GQ	1/1:58,9,0:16
+NT_165754	338325	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161924	260016	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_165795	433385	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166370	455714	.	T	G	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+NT_166424	307990	.	T	A	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+NT_161877	518452	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161877	518454	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166351	468564	.	A	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166408	488033	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166408	562716	.	A	G	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+NT_166349	214066	.	A	G	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+NT_166349	214070	.	T	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166391	47103	.	C	T	5.46	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:34,3,0:3
+NT_165790	96824	.	T	G	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_165790	96827	.	A	T	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_166344	657504	.	A	C	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_166371	140475	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_166371	140477	.	A	C	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+NT_166371	140491	.	C	A	5.46	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:34,3,0:3
+NT_161895	283625	.	A	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161895	744483	.	C	G	38	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36	GT:PL:GQ	1/1:70,9,0:16
+NT_166404	51731	.	A	T	3.55	.	DP=2;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=-4.23;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,26:28
+NT_161875	219900	.	G	A	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_161875	219903	.	T	C	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+NT_161866	49262	.	C	G	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+NT_161866	49264	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161866	49265	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161872	293963	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161872	616242	.	T	A	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+NT_161872	714587	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161902	401831	.	T	C	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+NT_161902	923924	.	G	A	10.2	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33	GT:PL:GQ	1/1:41,6,0:8
+NT_161937	232325	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161937	232331	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161937	310786	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+NT_161937	1343395	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+Y	356986	.	A	G	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+Y	362133	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+Y	372541	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+Y	385312	.	A	G	4.61	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:34,6,0:5
+Y	385313	.	A	G	4.61	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:34,6,0:5
+Y	472032	.	A	G	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+Y	503298	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+Y	529936	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+Y	534673	.	T	C	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+Y	601401	.	C	CAG	24.5	.	INDEL;DP=10;AF1=0.5;CI95=0.5,0.5;DP4=5,1,2,1;MQ=37;FQ=27.5;PV4=1,0.061,1,0.00024	GT:PL:GQ	0/1:62,0,144:65
+Y	602418	.	T	TGC	21.3	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:60,6,0:10
+Y	1448653	.	A	T	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+Y	2564922	.	C	G	4.61	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33	GT:PL:GQ	1/1:34,6,0:5
+Y	2564933	.	A	T	5.29	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33	GT:PL:GQ	1/1:35,6,0:6
+Y	2564937	.	T	C	4.61	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33	GT:PL:GQ	1/1:34,6,0:5
+Y	2884117	.	T	C	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	3205820	.	G	A	158	.	DP=20;AF1=1;CI95=1,1;DP4=0,0,9,9;MQ=36;FQ=-81	GT:PL:GQ	1/1:191,54,0:99
+19	3205836	.	A	G	220	.	DP=36;AF1=1;CI95=1,1;DP4=0,0,20,14;MQ=37;FQ=-129	GT:PL:GQ	1/1:253,102,0:99
+19	3205943	.	G	C	152	.	DP=21;AF1=1;CI95=1,1;DP4=0,0,8,10;MQ=37;FQ=-81	GT:PL:GQ	1/1:185,54,0:99
+19	3205957	.	G	C	80.1	.	DP=8;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=37;FQ=-45	GT:PL:GQ	1/1:113,18,0:33
+19	3205995	.	T	C	67	.	DP=18;AF1=1;CI95=1,1;DP4=0,0,1,13;MQ=32;FQ=-69	GT:PL:GQ	1/1:100,42,0:81
+19	3206052	.	A	G	120	.	DP=12;AF1=1;CI95=1,1;DP4=0,0,3,7;MQ=34;FQ=-57	GT:PL:GQ	1/1:153,30,0:57
+19	3206060	.	T	A	71.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=33;FQ=-45	GT:PL:GQ	1/1:104,18,0:33
+19	3206638	.	T	G	55.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=25;FQ=-42	GT:PL:GQ	1/1:88,15,0:27
+19	3206671	.	T	C	53.4	.	DP=6;AF1=0.5554;CI95=0.5,1;DP4=1,0,4,1;MQ=25;FQ=-20;PV4=1,0.38,1,1	GT:PL:GQ	0/1:83,0,7:10
+19	3206673	.	T	C	23	.	DP=6;AF1=0.5;CI95=0.5,0.5;DP4=3,0,2,1;MQ=25;FQ=18.3;PV4=1,0.39,1,1	GT:PL:GQ	0/1:53,0,46:48
+19	3206703	.	G	A	64.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=25;FQ=-42	GT:PL:GQ	1/1:97,15,0:27
+19	3281904	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	3352482	.	C	A	32.5	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,4;MQ=34;FQ=-39	GT:PL:GQ	1/1:65,12,0:21
+19	3356313	.	AC	ACC	39.5	.	INDEL;DP=4;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,0,3;MQ=37;FQ=-12.8;PV4=0.25,1,1,0.27	GT:PL:GQ	0/1:77,0,22:25
+19	3362225	.	A	G	23	.	DP=5;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,4,0;MQ=35;FQ=-6.18;PV4=1,0.014,0.34,0.022	GT:PL:GQ	0/1:53,0,22:25
+19	3365671	.	AC	A	3.81	.	INDEL;DP=4;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-7.67;PV4=1,0.16,1,0.012	GT:PL:GQ	0/1:39,0,28:33
+19	3369050	.	G	GA	9.71	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:48,6,0:8
+19	3371339	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	3375209	.	A	AT	54	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=37;FQ=-46.5	GT:PL:GQ	1/1:94,12,0:21
+19	3457052	.	CT	CTTT	4.42	.	INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=2,0,2,0;MQ=34;FQ=6.48;PV4=1,0.051,0.21,0.38	GT:PL:GQ	0/1:40,0,56:40
+19	3462257	.	T	C	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	3490405	.	T	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	3490564	.	C	G	15.1	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36	GT:PL:GQ	1/1:47,9,0:14
+19	3547993	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	3582830	.	T	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	3586482	.	T	G	58	.	DP=12;AF1=0.5;CI95=0.5,0.5;DP4=2,0,7,1;MQ=34;FQ=12.3;PV4=1,0.00069,0.18,1	GT:PL:GQ	0/1:88,0,39:42
+19	3586484	.	A	C	56	.	DP=12;AF1=0.5001;CI95=0.5,0.5;DP4=2,0,7,1;MQ=34;FQ=9.53;PV4=1,0.0044,0.18,1	GT:PL:GQ	0/1:86,0,36:39
+19	3591114	.	CTGTG	CTG	47.5	.	INDEL;DP=5;AF1=0.5016;CI95=0.5,0.5;DP4=0,1,4,0;MQ=37;FQ=-12.8;PV4=0.2,0.12,1,0.25	GT:PL:GQ	0/1:85,0,22:25
+19	3591123	.	T	G	11.3	.	DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,2,0;MQ=37;FQ=3.43;PV4=0.33,0,1,0.17	GT:PL:GQ	0/1:41,0,28:31
+19	3591876	.	C	G	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	3596029	.	GACACACACACACACA	GACACACACACACA	15.6	.	INDEL;DP=7;AF1=0.5;CI95=0.5,0.5;DP4=2,1,2,0;MQ=37;FQ=18.5;PV4=1,7.9e-05,1,1	GT:PL:GQ	0/1:53,0,90:56
+19	3596048	.	TCACACACACACACACA	TCACACACACACACA	35.2	.	INDEL;DP=7;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:74,6,0:10
+19	3610237	.	CG	CGGG	28.2	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:67,6,0:10
+19	3612197	.	CGG	CGGG	12.7	.	INDEL;DP=3;AF1=0.5013;CI95=0.5,0.5;DP4=1,0,1,1;MQ=33;FQ=-11.8;PV4=1,0.43,0.33,0.33	GT:PL:GQ	0/1:50,0,23:26
+19	3615652	.	C	G	7.8	.	DP=5;AF1=0.5003;CI95=0.5,0.5;DP4=0,1,0,2;MQ=33;FQ=3.27;PV4=1,0.046,0.33,0.32	GT:PL:GQ	0/1:37,0,28:32
+19	3621243	.	A	G	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	3647660	.	C	A	3.41	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:32,6,0:4
+19	3649602	.	T	G	41.5	.	DP=9;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=32;FQ=-39	GT:PL:GQ	1/1:74,12,0:21
+19	3649604	.	C	A	26	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=33;FQ=-36	GT:PL:GQ	1/1:58,9,0:16
+19	3649607	.	T	G	31.5	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=32;FQ=-39	GT:PL:GQ	1/1:64,12,0:21
+19	3673470	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	3682731	.	T	G	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+19	3784152	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	3817931	.	A	T	17.1	.	DP=10;AF1=0.5;CI95=0.5,0.5;DP4=1,6,1,1;MQ=37;FQ=20.1;PV4=0.42,1,1,7.9e-09	GT:PL:GQ	0/1:47,0,150:50
+19	3885854	.	TT	TTAT	8.18	.	INDEL;DP=4;AF1=0.5;CI95=0.5,0.5;DP4=0,2,0,2;MQ=37;FQ=10.5;PV4=1,0.26,1,0.36	GT:PL:GQ	0/1:45,0,56:46
+19	3897463	.	C	CA	23.5	.	INDEL;DP=12;AF1=0.5;CI95=0.5,0.5;DP4=4,3,0,4;MQ=37;FQ=26.5;PV4=0.19,0.02,1,2.5e-05	GT:PL:GQ	0/1:61,0,178:64
+19	3899540	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	3903173	.	C	T	3.01	.	DP=13;AF1=0.4997;CI95=0.5,0.5;DP4=4,4,3,0;MQ=36;FQ=4.77;PV4=0.24,0.028,0.052,1	GT:PL:GQ	0/1:30,0,163:28
+19	3903429	.	CTA	C	31.5	.	INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=4,2,3,0;MQ=37;FQ=34.5;PV4=0.5,1.4e-09,1,1	GT:PL:GQ	0/1:69,0,157:72
+19	3903506	.	G	GCC	30.5	.	INDEL;DP=7;AF1=0.5;CI95=0.5,0.5;DP4=1,2,0,3;MQ=35;FQ=33.4;PV4=1,1,0.19,1	GT:PL:GQ	0/1:68,0,87:71
+19	3909282	.	CTG	CTGTG	22.5	.	INDEL;DP=6;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-7.4;PV4=1,0.4,1,0.33	GT:PL:GQ	0/1:60,0,28:31
+19	3909704	.	A	T	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	3909837	.	T	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	3937591	.	G	A	4.61	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:34,6,0:5
+19	3944020	.	TA	T	6.55	.	INDEL;DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,1;MQ=33;FQ=-7.51;PV4=1,0.28,0.33,0	GT:PL:GQ	0/1:43,0,28:33
+19	3955855	.	T	G	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+19	4012679	.	A	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	4036683	.	C	CCAT	16.6	.	INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=2,1,1,1;MQ=37;FQ=19.5;PV4=1,0.12,1,0.04	GT:PL:GQ	0/1:54,0,90:57
+19	4097507	.	G	GCC	45.5	.	INDEL;DP=5;AF1=0.5032;CI95=0.5,0.5;DP4=1,0,4,0;MQ=35;FQ=-15.6;PV4=1,1,0.34,0.34	GT:PL:GQ	0/1:83,0,19:22
+19	4097921	.	AG	A	16.6	.	INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,2,1;MQ=35;FQ=16;PV4=0.4,0.028,0.25,0.013	GT:PL:GQ	0/1:54,0,53:53
+19	4103486	.	GT	GTCT	21.5	.	INDEL;DP=6;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,2,0;MQ=37;FQ=-7.4;PV4=0.33,0.41,1,0.016	GT:PL:GQ	0/1:59,0,28:31
+19	4109610	.	A	G	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	4126040	.	GCCCCC	GCCCC	38.5	.	INDEL;DP=9;AF1=1;CI95=1,1;DP4=0,0,7,0;MQ=37;FQ=-55.5	GT:PL:GQ	1/1:79,21,0:39
+19	4128088	.	T	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	4150222	.	T	TG	16.6	.	INDEL;DP=9;AF1=0.5;CI95=0.5,0.5;DP4=3,3,2,1;MQ=36;FQ=19.5;PV4=1,0.35,0.085,4e-05	GT:PL:GQ	0/1:54,0,140:57
+19	4192878	.	T	TG	159	.	INDEL;DP=17;AF1=1;CI95=0.5,1;DP4=0,1,9,3;MQ=37;FQ=-40.5;PV4=0.31,0.48,1,0.4	GT:PL:GQ	1/1:198,6,0:10
+19	4192885	.	T	A	8.65	.	DP=9;AF1=0.5008;CI95=0.5,0.5;DP4=0,1,3,0;MQ=37;FQ=-4.25;PV4=0.25,0.045,1,0.44	GT:PL:GQ	0/1:38,0,25:29
+19	4193254	.	T	C	111	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,5,2;MQ=32;FQ=-48	GT:PL:GQ	1/1:144,21,0:39
+19	4194973	.	CT	C	114	.	INDEL;DP=14;AF1=0.5;CI95=0.5,0.5;DP4=4,2,3,3;MQ=37;FQ=113;PV4=1,2.2e-05,1,0.018	GT:PL:GQ	0/1:152,0,150:99
+19	4218544	.	GACACACACACACACACACACAC	GACACACACACACACACACAC	20.5	.	INDEL;DP=14;AF1=0.5;CI95=0.5,0.5;DP4=0,10,0,3;MQ=37;FQ=23.5;PV4=1,0.28,1,1	GT:PL:GQ	0/1:58,0,144:61
+19	4265650	.	A	C	15.1	.	DP=8;AF1=0.5002;CI95=0.5,0.5;DP4=1,1,0,3;MQ=35;FQ=5.35;PV4=0.4,1,0.25,1	GT:PL:GQ	0/1:45,0,31:34
+19	4275479	.	A	G	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	4287266	.	TG	T	11.5	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-40.5	GT:PL:GQ	1/1:50,6,0:9
+19	4288411	.	C	A	14.2	.	DP=13;AF1=0.5;CI95=0.5,0.5;DP4=4,5,1,3;MQ=36;FQ=17.1;PV4=1,0.00097,1,1	GT:PL:GQ	0/1:44,0,185:47
+19	4293399	.	G	A	3.01	.	DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:30,0,31:28
+19	4293435	.	T	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	4319284	.	G	GCCA	39.4	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=33;FQ=-43.5	GT:PL:GQ	1/1:79,9,0:16
+19	4320148	.	AT	A	53.4	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=33;FQ=-43.5	GT:PL:GQ	1/1:93,9,0:16
+19	4328716	.	C	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	4356928	.	T	C	9.49	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36	GT:PL:GQ	1/1:41,9,0:12
+19	4395270	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	4397535	.	G	A	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	4616344	.	A	G	31.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:63,6,0:10
+19	4619199	.	G	GACA	28.2	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:67,6,0:10
+19	4746969	.	G	GA	21.3	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:60,6,0:10
+19	4784161	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	4785570	.	G	C	7.8	.	DP=3;AF1=0.5003;CI95=0.5,0.5;DP4=1,0,1,1;MQ=37;FQ=3.27;PV4=1,0.034,1,0.025	GT:PL:GQ	0/1:37,0,28:32
+19	4799879	.	T	C	34.8	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:66,6,0:10
+19	4888267	.	A	T	3.54	.	DP=3;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	4918151	.	CT	CTT	17.3	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:56,6,0:10
+19	4923064	.	CA	C	16.6	.	INDEL;DP=4;AF1=0.5008;CI95=0.5,0.5;DP4=0,1,1,2;MQ=34;FQ=-9.99;PV4=1,0.11,0.33,0.33	GT:PL:GQ	0/1:54,0,25:28
+19	4964673	.	G	GGA	7.98	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-40.5	GT:PL:GQ	1/1:46,6,0:8
+19	5045349	.	G	GT	11.8	.	INDEL;DP=4;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,1,1;MQ=37;FQ=-10;PV4=1,0.47,1,1	GT:PL:GQ	0/1:49,0,25:29
+19	5046911	.	G	GA	35.2	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:74,6,0:10
+19	5048333	.	A	G	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	5081755	.	G	A	20	.	DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,3,1,1;MQ=37;FQ=23;PV4=1,0.22,1,1	GT:PL:GQ	0/1:50,0,107:53
+19	5111720	.	C	CAG	28.2	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:67,6,0:10
+19	5113937	.	TC	TCC	21.3	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:60,6,0:10
+19	5116885	.	T	A	3.01	.	DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:30,0,31:28
+19	5140839	.	T	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	5142716	.	T	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	5152822	.	T	TC	77.5	.	INDEL;DP=8;AF1=0.5064;CI95=0.5,0.5;DP4=1,0,6,0;MQ=37;FQ=-18.6;PV4=1,0.48,1,0.0022	GT:PL:GQ	0/1:115,0,16:19
+19	5152825	.	A	C	3.02	.	DP=6;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,2,0;MQ=37;FQ=-3.6;PV4=1,0.057,1,0.052	GT:PL:GQ	0/1:30,0,28:28
+19	5154577	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	5226915	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	5245293	.	G	A	5.46	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:34,3,0:3
+19	5245305	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	5264850	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	5274427	.	T	C	3.01	.	DP=54;AF1=0.4997;CI95=0.5,0.5;DP4=22,18,6,5;MQ=37;FQ=4.77;PV4=1,1e-18,1,1	GT:PL:GQ	0/1:30,0,255:28
+19	5274978	.	C	CG	99.7	.	INDEL;DP=10;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=37;FQ=-49.5	GT:PL:GQ	1/1:140,15,0:27
+19	5275059	.	C	CA	30.2	.	INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:69,6,0:10
+19	5279268	.	C	CTT	40.5	.	INDEL;DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,3,0;MQ=37;FQ=-9.98;PV4=1,0.46,1,0.0034	GT:PL:GQ	0/1:78,0,25:28
+19	5279373	.	GT	GTCT	115	.	INDEL;DP=11;AF1=0.5263;CI95=0.5,1;DP4=1,0,7,1;MQ=35;FQ=-24.5;PV4=1,1,0.31,0.44	GT:PL:GQ	0/1:152,0,10:13
+19	5279469	.	C	CG	12.7	.	INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,0,3;MQ=35;FQ=13.9;PV4=0.4,0.027,0.25,0.25	GT:PL:GQ	0/1:50,0,53:51
+19	5293078	.	A	G	3.02	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+19	5293322	.	A	G	22	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36	GT:PL:GQ	1/1:54,9,0:15
+19	5299338	.	T	C	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+19	5324189	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	5324197	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	5324249	.	G	C	5.29	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:35,6,0:6
+19	5325094	.	T	C	12	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-33	GT:PL:GQ	1/1:43,6,0:9
+19	5325106	.	A	G	25.8	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-33	GT:PL:GQ	1/1:57,6,0:10
+19	5325161	.	T	C	75.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=35;FQ=-45	GT:PL:GQ	1/1:108,18,0:33
+19	5334753	.	G	A	122	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,3,7;MQ=29;FQ=-57	GT:PL:GQ	1/1:155,30,0:57
+19	5334800	.	G	C	101	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,2,7;MQ=28;FQ=-54	GT:PL:GQ	1/1:134,27,0:51
+19	5334810	.	T	C	29	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=25;FQ=-36	GT:PL:GQ	1/1:61,9,0:16
+19	5371182	.	ATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT	ATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT	28.5	.	INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=1,4,0,3;MQ=37;FQ=31.5;PV4=1,0.24,1,0.4	GT:PL:GQ	0/1:66,0,107:69
+19	5415628	.	A	G	58.2	.	DP=5;AF1=0.5207;CI95=0.5,1;DP4=0,1,2,2;MQ=30;FQ=-16.1;PV4=1,1,0.14,1	GT:PL:GQ	0/1:88,0,11:14
+19	5415652	.	C	G	19.1	.	DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,2;MQ=33;FQ=16.7;PV4=1,0.0019,0.11,1	GT:PL:GQ	0/1:49,0,45:47
+19	5415658	.	A	T	35	.	DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,2;MQ=33;FQ=15.1;PV4=1,1,0.11,1	GT:PL:GQ	0/1:65,0,42:45
+19	5415664	.	G	A	14.2	.	DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,2;MQ=33;FQ=16.1;PV4=1,0.0034,0.11,1	GT:PL:GQ	0/1:44,0,50:46
+19	5423558	.	A	AT	121	.	INDEL;DP=15;AF1=1;CI95=1,1;DP4=0,0,0,9;MQ=37;FQ=-61.5	GT:PL:GQ	1/1:162,27,0:51
+19	5424274	.	GG	GGAG	46.5	.	INDEL;DP=12;AF1=0.5;CI95=0.5,0.5;DP4=2,3,4,1;MQ=37;FQ=49.5;PV4=0.52,0.014,1,1	GT:PL:GQ	0/1:84,0,134:87
+19	5426086	.	A	C	14.2	.	DP=33;AF1=0.5;CI95=0.5,0.5;DP4=15,2,0,9;MQ=37;FQ=17.1;PV4=1.8e-05,1.7e-09,1,1	GT:PL:GQ	0/1:44,0,212:47
+19	5462528	.	A	AGG	45.4	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:85,9,0:16
+19	5479300	.	C	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	5480150	.	G	A	7.59	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-33	GT:PL:GQ	1/1:38,6,0:7
+19	5533657	.	C	G	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	5535804	.	C	T	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	5580726	.	C	T	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+19	5640300	.	CA	C	77.5	.	INDEL;DP=10;AF1=0.5;CI95=0.5,0.5;DP4=1,3,1,4;MQ=37;FQ=71;PV4=1,0.049,1,0.065	GT:PL:GQ	0/1:115,0,106:99
+19	5642274	.	A	G	9.52	.	DP=10;AF1=0.5;CI95=0.5,0.5;DP4=1,6,0,3;MQ=37;FQ=12.3;PV4=1,0.0039,1,0.22	GT:PL:GQ	0/1:39,0,152:41
+19	5646794	.	C	CAA	4.42	.	INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=5,2,0,4;MQ=36;FQ=6.56;PV4=0.061,0.00082,0.1,4.2e-05	GT:PL:GQ	0/1:40,0,170:40
+19	5652568	.	T	TTC	47.5	.	INDEL;DP=13;AF1=0.5;CI95=0.5,0.5;DP4=5,1,4,0;MQ=37;FQ=50.5;PV4=1,0.33,1,0.035	GT:PL:GQ	0/1:85,0,142:88
+19	5652874	.	CT	CTT	45.5	.	INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=0,3,4,0;MQ=36;FQ=34.3;PV4=0.029,0.31,0.22,1	GT:PL:GQ	0/1:83,0,69:72
+19	5655793	.	T	TTTG	15.6	.	INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=2,1,2,0;MQ=37;FQ=18.5;PV4=1,0.031,1,0.0029	GT:PL:GQ	0/1:53,0,90:56
+19	5671522	.	C	CT	8.18	.	INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=3,1,0,2;MQ=37;FQ=10.8;PV4=0.4,0.24,1,0.028	GT:PL:GQ	0/1:45,0,113:47
+19	5673355	.	C	G	16.1	.	DP=4;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,1;MQ=37;FQ=18.7;PV4=1,0.012,1,0.00027	GT:PL:GQ	0/1:46,0,56:48
+19	5673587	.	AGCT	AGCTTGCT	15.6	.	INDEL;DP=7;AF1=0.5;CI95=0.5,0.5;DP4=0,3,2,0;MQ=37;FQ=18.5;PV4=0.1,0.4,1,0.18	GT:PL:GQ	0/1:53,0,79:56
+19	5700971	.	GT	G	13.7	.	INDEL;DP=4;AF1=0.5;CI95=0.5,0.5;DP4=2,0,0,2;MQ=37;FQ=15.4;PV4=0.33,0.057,1,0.00094	GT:PL:GQ	0/1:51,0,56:53
+19	5722189	.	A	T	15.9	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:47,6,0:10
+19	5747411	.	A	ATT	28.2	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:67,6,0:10
+19	5751303	.	G	GAC	36.5	.	INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=3,1,3,0;MQ=37;FQ=39.5;PV4=1,1,1,0.0091	GT:PL:GQ	0/1:74,0,110:77
+19	5765309	.	C	T	3.02	.	DP=3;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,0,2;MQ=37;FQ=-3.6;PV4=0.33,0.14,1,1	GT:PL:GQ	0/1:30,0,28:28
+19	5766155	.	T	TCCC	5.8	.	INDEL;DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,0,2;MQ=37;FQ=-7.54;PV4=0.33,0.044,1,1	GT:PL:GQ	0/1:42,0,28:33
+19	5802669	.	CCT	CCTCT	23.5	.	INDEL;DP=11;AF1=0.5001;CI95=0.5,0.5;DP4=1,1,3,0;MQ=33;FQ=-3.84;PV4=0.4,1,0.11,1	GT:PL:GQ	0/1:61,0,33:36
+19	5837235	.	G	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	5853932	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	5894371	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	5899740	.	A	G	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	5902359	.	GT	G	20.5	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-43.5	GT:PL:GQ	1/1:60,9,0:15
+19	5905108	.	G	C	3.54	.	DP=2;AF1=0.5002;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=-3.4;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,28:29
+19	5951787	.	C	T	18	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36	GT:PL:GQ	1/1:50,9,0:15
+19	5956115	.	CT	CTT	20.5	.	INDEL;DP=4;AF1=0.501;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-10.9;PV4=1,1,1,0.33	GT:PL:GQ	0/1:58,0,24:27
+19	5956116	.	TA	T	20.5	.	INDEL;DP=4;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-7.4;PV4=1,0.24,1,0.31	GT:PL:GQ	0/1:58,0,28:31
+19	5988978	.	AGG	AGGGG	95	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=37;FQ=-46.5	GT:PL:GQ	1/1:135,12,0:21
+19	5990457	.	G	GC	48.5	.	INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=2,0,2,1;MQ=37;FQ=18.5;PV4=1,1,1,0.11	GT:PL:GQ	0/1:86,0,53:56
+19	5992164	.	A	T	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+19	6011296	.	CTT	CTTT	89	.	INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-46.5	GT:PL:GQ	1/1:129,12,0:21
+19	6047971	.	C	T	141	.	DP=14;AF1=0.5;CI95=0.5,0.5;DP4=3,3,2,6;MQ=37;FQ=114;PV4=0.58,0.44,1,1	GT:PL:GQ	0/1:171,0,141:99
+19	6071701	.	A	T	8.64	.	DP=10;AF1=0.5;CI95=0.5,0.5;DP4=3,1,3,0;MQ=36;FQ=11.3;PV4=1,0.12,1,1	GT:PL:GQ	0/1:38,0,89:40
+19	6084061	.	CT	CTT	14.6	.	INDEL;DP=7;AF1=0.5;CI95=0.5,0.5;DP4=1,1,2,0;MQ=37;FQ=16.4;PV4=1,1,1,0.21	GT:PL:GQ	0/1:52,0,57:54
+19	6116433	.	G	T	3.01	.	DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:30,0,31:28
+19	6152712	.	A	G	34	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-36	GT:PL:GQ	1/1:66,9,0:16
+19	6152741	.	T	C	191	.	DP=12;AF1=1;CI95=1,1;DP4=0,0,8,3;MQ=34;FQ=-60	GT:PL:GQ	1/1:224,33,0:63
+19	6152749	.	T	C	167	.	DP=17;AF1=1;CI95=1,1;DP4=0,0,11,5;MQ=35;FQ=-75	GT:PL:GQ	1/1:200,48,0:93
+19	6152890	.	T	C	100	.	DP=7;AF1=1;CI95=1,1;DP4=0,0,3,4;MQ=37;FQ=-48	GT:PL:GQ	1/1:133,21,0:39
+19	6152982	.	G	A	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	6153036	.	C	T	55.5	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=37;FQ=-39	GT:PL:GQ	1/1:88,12,0:21
+19	6153077	.	C	T	222	.	DP=20;AF1=1;CI95=1,1;DP4=0,0,9,11;MQ=37;FQ=-87	GT:PL:GQ	1/1:255,60,0:99
+19	6153163	.	T	C	194	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,3,6;MQ=37;FQ=-54	GT:PL:GQ	1/1:227,27,0:51
+19	6175510	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	6228939	.	CA	C	78	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=34;FQ=-46.5	GT:PL:GQ	1/1:118,12,0:21
+19	6230906	.	C	G	15.1	.	DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,0,3;MQ=37;FQ=-4.14;PV4=0.25,0.0037,1,0.1	GT:PL:GQ	0/1:45,0,25:28
+19	6249082	.	T	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	6251864	.	G	GA	28.2	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:67,6,0:10
+19	6280998	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	6288939	.	C	A	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	6289471	.	A	G	18.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:50,6,0:10
+19	6293530	.	C	T	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	6294628	.	T	TCC	70	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=37;FQ=-46.5	GT:PL:GQ	1/1:110,12,0:21
+19	6313685	.	A	G	4.77	.	DP=5;AF1=0.4999;CI95=0.5,0.5;DP4=1,1,1,1;MQ=37;FQ=6.98;PV4=1,0.00041,1,0.0011	GT:PL:GQ	0/1:33,0,62:33
+19	6314781	.	G	C	44.1	.	DP=8;AF1=1;CI95=0.5,1;DP4=0,0,6,0;MQ=32;FQ=-45	GT:PL:GQ	1/1:77,18,0:33
+19	6316439	.	G	GA	11.7	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=33;FQ=-43.5	GT:PL:GQ	1/1:51,9,0:13
+19	6322372	.	G	GC	10.6	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:49,6,0:9
+19	6355840	.	C	CAG	11.8	.	INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=2,1,2,0;MQ=37;FQ=14.6;PV4=1,1,1,0.45	GT:PL:GQ	0/1:49,0,85:51
+19	6363411	.	G	A	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+19	6365792	.	G	GT	47.5	.	INDEL;DP=16;AF1=0.5;CI95=0.5,0.5;DP4=6,3,4,1;MQ=37;FQ=50.5;PV4=1,0.08,1,0.055	GT:PL:GQ	0/1:85,0,201:88
+19	6365797	.	A	C	4.13	.	DP=14;AF1=0.4998;CI95=0.5,0.5;DP4=6,3,4,0;MQ=37;FQ=6.2;PV4=0.5,5.7e-06,1,0.1	GT:PL:GQ	0/1:32,0,196:31
+19	6372298	.	T	C	18	.	DP=8;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36	GT:PL:GQ	1/1:50,9,0:15
+19	6372626	.	G	GCC	16.6	.	INDEL;DP=8;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,3,0;MQ=37;FQ=-9.99;PV4=1,0.061,1,0.0096	GT:PL:GQ	0/1:54,0,25:28
+19	6374284	.	G	A	13.2	.	DP=7;AF1=0.5016;CI95=0.5,0.5;DP4=0,1,3,1;MQ=33;FQ=-6.21;PV4=0.4,0.012,0.25,1	GT:PL:GQ	0/1:43,0,22:25
+19	6374286	.	A	C	4.13	.	DP=7;AF1=0.5006;CI95=0.5,0.5;DP4=0,1,3,0;MQ=34;FQ=-4.62;PV4=0.25,0.031,0.33,1	GT:PL:GQ	0/1:32,0,25:29
+19	6386021	.	T	TGGC	11.8	.	INDEL;DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,0,2;MQ=33;FQ=-7.43;PV4=0.33,0.44,0.33,0.33	GT:PL:GQ	0/1:49,0,28:32
+19	6390455	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	6502037	.	T	G	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	6592212	.	A	G	6.02	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-33	GT:PL:GQ	1/1:36,6,0:6
+19	6642108	.	C	T	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	6905075	.	A	AGC	7.98	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:46,6,0:8
+19	6909201	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	6915048	.	T	G	5.29	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:35,6,0:6
+19	6981442	.	CT	CTT	56.7	.	INDEL;DP=13;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-49.5	GT:PL:GQ	1/1:97,15,0:27
+19	6986843	.	A	AG	12.7	.	INDEL;DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,1,2;MQ=37;FQ=-10;PV4=1,0.13,1,0.33	GT:PL:GQ	0/1:50,0,25:28
+19	6992893	.	T	C	26	.	DP=6;AF1=0.5;CI95=0.5,0.5;DP4=2,2,1,1;MQ=37;FQ=29;PV4=1,0.27,1,0.42	GT:PL:GQ	0/1:56,0,118:59
+19	7032496	.	G	A	20.8	.	DP=6;AF1=0.6243;CI95=0.5,1;DP4=0,1,4,0;MQ=30;FQ=-23;PV4=0.2,1,0.14,0.037	GT:PL:GQ	0/1:50,0,4:7
+19	7032498	.	T	C	19.1	.	DP=5;AF1=0.501;CI95=0.5,0.5;DP4=0,1,3,0;MQ=28;FQ=-4.76;PV4=0.25,0.1,0,0.0026	GT:PL:GQ	0/1:49,0,24:27
+19	7039010	.	CT	C	30.2	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:69,6,0:10
+19	7052925	.	TCC	TCCCC	11.8	.	INDEL;DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,2,0;MQ=33;FQ=-7.43;PV4=1,0.4,0.33,1	GT:PL:GQ	0/1:49,0,28:32
+19	7053458	.	CTT	CTTT	10.8	.	INDEL;DP=3;AF1=0.501;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-10.9;PV4=1,0.17,1,0.024	GT:PL:GQ	0/1:48,0,24:28
+19	7074272	.	TA	T	4.42	.	INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=1,2,2,0;MQ=37;FQ=6.56;PV4=0.4,1,1,0.099	GT:PL:GQ	0/1:40,0,90:40
+19	7096313	.	CT	CTT	28.5	.	INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,2,1;MQ=37;FQ=20.2;PV4=1,0.26,1,0.06	GT:PL:GQ	0/1:66,0,55:58
+19	7108797	.	GT	G	24.2	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:63,6,0:10
+19	7109279	.	CT	CTT	63	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=34;FQ=-46.5	GT:PL:GQ	1/1:103,12,0:21
+19	7273732	.	G	GC	50.5	.	INDEL;DP=7;AF1=0.504;CI95=0.5,0.5;DP4=0,1,0,4;MQ=37;FQ=-16.6;PV4=1,1,1,0.0018	GT:PL:GQ	0/1:88,0,18:21
+19	7273860	.	ACCT	ACCTCCT	33.5	.	INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=1,1,0,3;MQ=35;FQ=24.2;PV4=0.4,1,0.25,0.021	GT:PL:GQ	0/1:71,0,59:62
+19	7322919	.	G	C	5.46	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:34,3,0:3
+19	7351944	.	T	A	4.77	.	DP=6;AF1=0.4999;CI95=0.5,0.5;DP4=1,1,2,0;MQ=37;FQ=6.98;PV4=1,0.1,1,0.18	GT:PL:GQ	0/1:33,0,61:33
+19	7359479	.	CT	CTT	41.4	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:81,9,0:16
+19	7361488	.	T	TC	8.83	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-40.5	GT:PL:GQ	1/1:47,6,0:8
+19	7401873	.	A	T	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	7435993	.	G	A	3.01	.	DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:30,0,31:28
+19	7446286	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	7450404	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	7451189	.	G	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	7459826	.	T	C	3.54	.	DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,30:29
+19	7473416	.	T	C	212	.	DP=12;AF1=1;CI95=1,1;DP4=0,0,4,6;MQ=37;FQ=-57	GT:PL:GQ	1/1:245,30,0:57
+19	7533049	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	7559363	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	7596698	.	G	A	24	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36	GT:PL:GQ	1/1:56,9,0:15
+19	7609641	.	G	T	49	.	DP=25;AF1=0.5;CI95=0.5,0.5;DP4=7,3,0,10;MQ=37;FQ=52;PV4=0.0031,5.7e-05,1,0.46	GT:PL:GQ	0/1:79,0,183:82
+19	7609735	.	A	G	60	.	DP=28;AF1=0.5;CI95=0.5,0.5;DP4=11,5,5,6;MQ=37;FQ=63;PV4=0.26,2.6e-15,1,0.22	GT:PL:GQ	0/1:90,0,255:93
+19	7609740	.	A	G	141	.	DP=27;AF1=0.5;CI95=0.5,0.5;DP4=7,2,9,9;MQ=37;FQ=130;PV4=0.23,6.6e-13,1,1	GT:PL:GQ	0/1:171,0,157:99
+19	7610022	.	A	G	68	.	DP=22;AF1=0.5;CI95=0.5,0.5;DP4=6,8,3,5;MQ=37;FQ=71;PV4=1,0.013,1,1	GT:PL:GQ	0/1:98,0,225:99
+19	7612605	.	A	G	79	.	DP=43;AF1=0.5;CI95=0.5,0.5;DP4=9,19,6,7;MQ=37;FQ=82;PV4=0.49,5e-12,0.072,0.43	GT:PL:GQ	0/1:109,0,255:99
+19	7672449	.	T	C	3.54	.	DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,30:29
+19	7742879	.	T	C	155	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=37;FQ=-66	GT:PL:GQ	1/1:188,39,0:75
+19	7742923	.	T	C	222	.	DP=29;AF1=1;CI95=1,1;DP4=0,0,10,16;MQ=37;FQ=-105	GT:PL:GQ	1/1:255,78,0:99
+19	7742993	.	A	G	222	.	DP=39;AF1=1;CI95=1,1;DP4=0,0,24,14;MQ=37;FQ=-141	GT:PL:GQ	1/1:255,114,0:99
+19	7743097	.	G	A	222	.	DP=36;AF1=1;CI95=1,1;DP4=0,0,12,24;MQ=37;FQ=-135	GT:PL:GQ	1/1:255,108,0:99
+19	7743265	.	A	G	143	.	DP=17;AF1=1;CI95=1,1;DP4=0,0,8,6;MQ=37;FQ=-69	GT:PL:GQ	1/1:176,42,0:81
+19	7743284	.	A	G	102	.	DP=7;AF1=1;CI95=1,1;DP4=0,0,4,3;MQ=37;FQ=-48	GT:PL:GQ	1/1:135,21,0:39
+19	8034536	.	A	G	42.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:74,6,0:10
+19	8050872	.	T	G	87.1	.	DP=7;AF1=1;CI95=1,1;DP4=0,0,2,5;MQ=25;FQ=-48	GT:PL:GQ	1/1:120,21,0:39
+19	8050884	.	T	C	104	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,2,6;MQ=25;FQ=-51	GT:PL:GQ	1/1:137,24,0:45
+19	8050914	.	A	G	70	.	DP=11;AF1=1;CI95=1,1;DP4=0,0,2,9;MQ=29;FQ=-60	GT:PL:GQ	1/1:103,33,0:63
+19	8050917	.	G	A	103	.	DP=12;AF1=1;CI95=1,1;DP4=0,0,2,9;MQ=29;FQ=-60	GT:PL:GQ	1/1:136,33,0:63
+19	8050932	.	A	G	110	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=30;FQ=-66	GT:PL:GQ	1/1:143,39,0:75
+19	8050976	.	G	T	182	.	DP=19;AF1=1;CI95=1,1;DP4=0,0,4,15;MQ=36;FQ=-84	GT:PL:GQ	1/1:215,57,0:99
+19	8050985	.	T	TA	214	.	INDEL;DP=20;AF1=1;CI95=1,1;DP4=0,0,4,16;MQ=37;FQ=-94.5	GT:PL:GQ	1/1:255,60,0:99
+19	8050996	.	T	C	169	.	DP=19;AF1=1;CI95=1,1;DP4=0,0,4,15;MQ=36;FQ=-84	GT:PL:GQ	1/1:202,57,0:99
+19	8051050	.	G	A	103	.	DP=19;AF1=1;CI95=1,1;DP4=0,0,6,12;MQ=35;FQ=-81	GT:PL:GQ	1/1:136,54,0:99
+19	8051066	.	G	A	122	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,3,7;MQ=34;FQ=-57	GT:PL:GQ	1/1:155,30,0:57
+19	8051084	.	T	C	46.5	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=28;FQ=-39	GT:PL:GQ	1/1:79,12,0:21
+19	8051096	.	A	G	19	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=30;FQ=-36	GT:PL:GQ	1/1:51,9,0:15
+19	8051106	.	T	G	13	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33	GT:PL:GQ	1/1:44,6,0:9
+19	8051236	.	G	A	93.1	.	DP=7;AF1=1;CI95=1,1;DP4=0,0,4,3;MQ=27;FQ=-48	GT:PL:GQ	1/1:126,21,0:39
+19	8051264	.	G	A	52.1	.	DP=7;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=25;FQ=-45	GT:PL:GQ	1/1:85,18,0:33
+19	8051283	.	T	A	87.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=25;FQ=-45	GT:PL:GQ	1/1:120,18,0:33
+19	8051315	.	A	G	80.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=25;FQ=-45	GT:PL:GQ	1/1:113,18,0:33
+19	8051323	.	C	G	28	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=25;FQ=-36	GT:PL:GQ	1/1:60,9,0:16
+19	8051467	.	G	A	13	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33	GT:PL:GQ	1/1:44,6,0:9
+19	8051469	.	C	T	9.31	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33	GT:PL:GQ	1/1:40,6,0:8
+19	8051498	.	T	A	147	.	DP=11;AF1=1;CI95=1,1;DP4=0,0,4,7;MQ=26;FQ=-60	GT:PL:GQ	1/1:180,33,0:63
+19	8051502	.	C	T	113	.	DP=12;AF1=1;CI95=1,1;DP4=0,0,4,5;MQ=25;FQ=-54	GT:PL:GQ	1/1:146,27,0:51
+19	8051544	.	G	A	112	.	DP=14;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=29;FQ=-66	GT:PL:GQ	1/1:145,39,0:75
+19	8051546	.	T	C	104	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=29;FQ=-66	GT:PL:GQ	1/1:137,39,0:75
+19	8051574	.	T	C	192	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=29;FQ=-66	GT:PL:GQ	1/1:225,39,0:75
+19	8051593	.	T	C	45.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,5;MQ=35;FQ=-42	GT:PL:GQ	1/1:78,15,0:27
+19	8100673	.	C	G	3.54	.	DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,30:29
+19	8326732	.	GA	G	45	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,4;MQ=32;FQ=-46.5	GT:PL:GQ	1/1:85,12,0:21
+19	8326738	.	T	A	12.3	.	DP=10;AF1=0.5012;CI95=0.5,0.5;DP4=1,0,0,3;MQ=32;FQ=-5.48;PV4=0.25,0.09,0.21,1	GT:PL:GQ	0/1:42,0,23:26
+19	8326742	.	A	C	77.1	.	DP=16;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=32;FQ=-45	GT:PL:GQ	1/1:110,18,0:33
+19	8347286	.	A	G	25	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-36	GT:PL:GQ	1/1:57,9,0:15
+19	8347289	.	A	C	41.5	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=32;FQ=-39	GT:PL:GQ	1/1:74,12,0:21
+19	8347296	.	T	C	118	.	DP=7;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=33;FQ=-45	GT:PL:GQ	1/1:151,18,0:33
+19	8347384	.	G	GA	214	.	INDEL;DP=29;AF1=1;CI95=1,1;DP4=0,0,23,6;MQ=37;FQ=-122	GT:PL:GQ	1/1:255,87,0:99
+19	8347394	.	T	A	222	.	DP=28;AF1=1;CI95=1,1;DP4=0,0,22,5;MQ=37;FQ=-108	GT:PL:GQ	1/1:255,81,0:99
+19	8347399	.	C	G	167	.	DP=27;AF1=1;CI95=1,1;DP4=0,0,20,5;MQ=37;FQ=-102	GT:PL:GQ	1/1:200,75,0:99
+19	8347408	.	C	G	222	.	DP=23;AF1=1;CI95=1,1;DP4=0,0,17,5;MQ=37;FQ=-93	GT:PL:GQ	1/1:255,66,0:99
+19	8347594	.	A	G	78.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=25;FQ=-45	GT:PL:GQ	1/1:111,18,0:33
+19	8347628	.	A	G	108	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=28;FQ=-51	GT:PL:GQ	1/1:141,24,0:45
+19	8347638	.	G	T	99	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=28;FQ=-51	GT:PL:GQ	1/1:132,24,0:45
+19	8347649	.	T	C	107	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=28;FQ=-51	GT:PL:GQ	1/1:140,24,0:45
+19	8347659	.	T	C	106	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=28;FQ=-51	GT:PL:GQ	1/1:139,24,0:45
+19	8347769	.	T	G	26	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=25;FQ=-36	GT:PL:GQ	1/1:58,9,0:16
+19	8347801	.	A	G	150	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=30;FQ=-51	GT:PL:GQ	1/1:183,24,0:45
+19	8347804	.	A	G	106	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=30;FQ=-51	GT:PL:GQ	1/1:139,24,0:45
+19	8347809	.	T	C	79	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=30;FQ=-51	GT:PL:GQ	1/1:112,24,0:45
+19	8347870	.	T	C	149	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=30;FQ=-51	GT:PL:GQ	1/1:182,24,0:45
+19	8347993	.	A	C	78	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,0,10;MQ=25;FQ=-57	GT:PL:GQ	1/1:111,30,0:57
+19	8348001	.	T	G	86	.	DP=18;AF1=1;CI95=1,1;DP4=0,0,0,16;MQ=27;FQ=-75	GT:PL:GQ	1/1:119,48,0:93
+19	8348026	.	G	A	121	.	DP=26;AF1=1;CI95=1,1;DP4=0,0,2,24;MQ=31;FQ=-105	GT:PL:GQ	1/1:154,78,0:99
+19	8348048	.	A	G	222	.	DP=41;AF1=1;CI95=1,1;DP4=0,0,9,30;MQ=34;FQ=-144	GT:PL:GQ	1/1:255,117,0:99
+19	8348080	.	C	T	167	.	DP=46;AF1=1;CI95=1,1;DP4=0,0,20,26;MQ=35;FQ=-165	GT:PL:GQ	1/1:200,138,0:99
+19	8348129	.	G	A	222	.	DP=36;AF1=1;CI95=1,1;DP4=0,0,21,14;MQ=35;FQ=-132	GT:PL:GQ	1/1:255,105,0:99
+19	8348158	.	C	A	138	.	DP=18;AF1=1;CI95=1,1;DP4=0,0,12,3;MQ=32;FQ=-72	GT:PL:GQ	1/1:171,45,0:87
+19	8348160	.	T	A	179	.	DP=15;AF1=1;CI95=1,1;DP4=0,0,11,3;MQ=32;FQ=-69	GT:PL:GQ	1/1:212,42,0:81
+19	8348441	.	T	A	62.3	.	DP=8;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42	GT:PL:GQ	1/1:95,15,0:27
+19	8348471	.	C	T	222	.	DP=32;AF1=1;CI95=1,1;DP4=0,0,16,16;MQ=33;FQ=-123	GT:PL:GQ	1/1:255,96,0:99
+19	8348485	.	G	A	102	.	DP=40;AF1=1;CI95=1,1;DP4=0,0,21,18;MQ=34;FQ=-144	GT:PL:GQ	1/1:135,117,0:99
+19	8348498	.	G	A	217	.	DP=52;AF1=1;CI95=1,1;DP4=0,0,29,22;MQ=35;FQ=-181	GT:PL:GQ	1/1:250,154,0:99
+19	8348514	.	T	C	212	.	DP=59;AF1=1;CI95=1,1;DP4=0,0,35,24;MQ=35;FQ=-205	GT:PL:GQ	1/1:245,178,0:99
+19	8348590	.	A	G	172	.	DP=20;AF1=1;CI95=1,1;DP4=0,0,14,5;MQ=36;FQ=-84	GT:PL:GQ	1/1:205,57,0:99
+19	8348635	.	T	C	146	.	DP=12;AF1=1;CI95=1,1;DP4=0,0,2,9;MQ=37;FQ=-60	GT:PL:GQ	1/1:179,33,0:63
+19	8348642	.	T	C	222	.	DP=16;AF1=1;CI95=1,1;DP4=0,0,3,13;MQ=37;FQ=-75	GT:PL:GQ	1/1:255,48,0:93
+19	8348695	.	T	TA	214	.	INDEL;DP=18;AF1=1;CI95=1,1;DP4=0,0,4,13;MQ=37;FQ=-85.5	GT:PL:GQ	1/1:255,51,0:99
+19	8348701	.	C	T	155	.	DP=18;AF1=1;CI95=1,1;DP4=0,0,4,14;MQ=37;FQ=-81	GT:PL:GQ	1/1:188,54,0:99
+19	8348922	.	T	C	222	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,7,5;MQ=37;FQ=-63	GT:PL:GQ	1/1:255,36,0:69
+19	8348969	.	T	C	161	.	DP=15;AF1=1;CI95=1,1;DP4=0,0,8,7;MQ=37;FQ=-72	GT:PL:GQ	1/1:194,45,0:87
+19	8349035	.	G	A	50.1	.	DP=7;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=33;FQ=-45	GT:PL:GQ	1/1:83,18,0:33
+19	8349037	.	G	A	56.1	.	DP=7;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=33;FQ=-45	GT:PL:GQ	1/1:89,18,0:33
+19	8349080	.	A	G	33.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-42	GT:PL:GQ	1/1:66,15,0:27
+19	8349101	.	C	G	83.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-42	GT:PL:GQ	1/1:116,15,0:27
+19	8549054	.	T	G	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	8553877	.	G	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	8555072	.	A	C	4.13	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:32,3,0:3
+19	8741092	.	G	T	5.46	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:34,3,0:3
+19	8783635	.	C	CA	147	.	INDEL;DP=23;AF1=0.5;CI95=0.5,0.5;DP4=2,6,10,2;MQ=36;FQ=126;PV4=0.019,1,0.12,0.01	GT:PL:GQ	0/1:185,0,161:99
+19	8783903	.	G	GTC	21.3	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:60,6,0:10
+19	8812489	.	GT	G	34.5	.	INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,2,1;MQ=35;FQ=18.5;PV4=0.4,0.047,0.25,0.0021	GT:PL:GQ	0/1:72,0,53:56
+19	8817010	.	C	T	3.01	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.01;PV4=1,1,1,1	GT:PL:GQ	0/1:30,0,30:28
+19	8838292	.	G	A	23	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=37;FQ=-36	GT:PL:GQ	1/1:55,9,0:15
+19	8838395	.	C	A	3.55	.	DP=2;AF1=0.5014;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=-6.58;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,22:26
+19	8841856	.	G	GCA	36.5	.	INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=2,1,0,4;MQ=36;FQ=38.3;PV4=0.14,0.19,0.22,0.058	GT:PL:GQ	0/1:74,0,79:76
+19	8850152	.	G	C	5.46	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:34,3,0:3
+19	8895305	.	T	A	7.8	.	DP=20;AF1=0.5;CI95=0.5,0.5;DP4=3,5,3,1;MQ=37;FQ=10.4;PV4=0.55,0.0027,1,1.9e-09	GT:PL:GQ	0/1:37,0,157:39
+19	8899002	.	T	G	16.1	.	DP=39;AF1=0.5;CI95=0.5,0.5;DP4=2,3,7,0;MQ=36;FQ=19.1;PV4=0.045,0.00068,1,1	GT:PL:GQ	0/1:46,0,85:49
+19	8900459	.	C	G	7.8	.	DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,0,3;MQ=37;FQ=10.4;PV4=0.4,0.0097,1,0.0075	GT:PL:GQ	0/1:37,0,59:39
+19	8900460	.	AG	AGG	24.5	.	INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,1,1;MQ=37;FQ=21.3;PV4=1,1,1,0.012	GT:PL:GQ	0/1:62,0,57:59
+19	8900589	.	AGG	AG	16.6	.	INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,0,2;MQ=37;FQ=17.4;PV4=1,0.31,1,0.03	GT:PL:GQ	0/1:54,0,56:55
+19	8901128	.	T	TG	15.6	.	INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=0,2,0,3;MQ=37;FQ=6.39;PV4=1,0.37,1,0.00012	GT:PL:GQ	0/1:53,0,40:43
+19	8904439	.	TGG	TG	75.5	.	INDEL;DP=15;AF1=0.5;CI95=0.5,0.5;DP4=2,1,3,3;MQ=35;FQ=43.5;PV4=1,0.004,0.16,0.034	GT:PL:GQ	0/1:113,0,78:81
+19	8904440	.	G	GT	66.5	.	INDEL;DP=13;AF1=0.5;CI95=0.5,0.5;DP4=2,1,4,2;MQ=35;FQ=43.5;PV4=1,0.044,0.16,0.036	GT:PL:GQ	0/1:104,0,78:81
+19	8905828	.	T	A	4.77	.	DP=7;AF1=0.4999;CI95=0.5,0.5;DP4=2,0,3,0;MQ=37;FQ=6.95;PV4=1,0.007,1,0.11	GT:PL:GQ	0/1:33,0,53:33
+19	8920813	.	CGG	CG	10.8	.	INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=0,2,0,2;MQ=37;FQ=13.1;PV4=1,0.0022,1,0.012	GT:PL:GQ	0/1:48,0,56:50
+19	8927995	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	8948001	.	C	G	23	.	DP=9;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,2;MQ=37;FQ=22.5;PV4=1,0.0043,1,0.27	GT:PL:GQ	0/1:53,0,52:52
+19	8966507	.	A	G	5.46	.	DP=6;AF1=0.4999;CI95=0.5,0.5;DP4=1,3,2,0;MQ=37;FQ=7.8;PV4=0.4,0.16,1,0.22	GT:PL:GQ	0/1:34,0,99:34
+19	8977007	.	GA	G	22.2	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:61,6,0:10
+19	8977011	.	G	A	79.1	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,2,5;MQ=37;FQ=-48	GT:PL:GQ	1/1:112,21,0:39
+19	8979553	.	G	GC	41.5	.	INDEL;DP=4;AF1=0.501;CI95=0.5,0.5;DP4=0,1,3,0;MQ=37;FQ=-10.9;PV4=0.25,1,1,1	GT:PL:GQ	0/1:79,0,24:27
+19	8981699	.	C	CA	22.2	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:61,6,0:10
+19	8989644	.	A	C	3.41	.	DP=11;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:32,6,0:4
+19	8989891	.	C	T	8.65	.	DP=5;AF1=0.5005;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-3.17;PV4=1,0.18,1,0.16	GT:PL:GQ	0/1:38,0,27:31
+19	8990112	.	C	A	7.59	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:38,6,0:7
+19	8999131	.	A	G	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	9010575	.	T	G	3.56	.	DP=2;AF1=0.503;CI95=0.5,0.5;DP4=1,0,1,0;MQ=32;FQ=-8.86;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,19:25
+19	9010791	.	C	A	7.8	.	DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,2,0,3;MQ=37;FQ=10.4;PV4=1,0.0042,1,0.093	GT:PL:GQ	0/1:37,0,84:39
+19	9020243	.	TA	T	18.5	.	INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=0,4,1,2;MQ=36;FQ=21.5;PV4=0.43,0.00079,0.14,0.18	GT:PL:GQ	0/1:56,0,93:59
+19	9066341	.	G	T	3.01	.	DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:30,0,31:28
+19	9096827	.	A	G	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+19	9097851	.	C	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	9100285	.	G	T	3.59	.	DP=2;AF1=0.51;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=-13.3;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,14:21
+19	9126825	.	A	T	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+19	9148172	.	T	C	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	9216844	.	T	A	4.13	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:32,3,0:3
+19	9358012	.	G	A	164	.	DP=11;AF1=1;CI95=1,1;DP4=0,0,10,1;MQ=37;FQ=-60	GT:PL:GQ	1/1:197,33,0:63
+19	9358045	.	C	A	191	.	DP=22;AF1=1;CI95=1,1;DP4=0,0,15,6;MQ=37;FQ=-90	GT:PL:GQ	1/1:224,63,0:99
+19	9358292	.	A	G	167	.	DP=58;AF1=1;CI95=1,1;DP4=0,0,27,24;MQ=37;FQ=-181	GT:PL:GQ	1/1:200,154,0:99
+19	9358454	.	G	A	222	.	DP=78;AF1=1;CI95=1,1;DP4=0,0,42,36;MQ=37;FQ=-262	GT:PL:GQ	1/1:255,235,0:99
+19	9358486	.	T	G	158	.	DP=62;AF1=1;CI95=1,1;DP4=0,0,25,32;MQ=37;FQ=-199	GT:PL:GQ	1/1:191,172,0:99
+19	9358567	.	A	G	222	.	DP=50;AF1=1;CI95=1,1;DP4=0,0,11,39;MQ=37;FQ=-178	GT:PL:GQ	1/1:255,151,0:99
+19	9632540	.	A	G	222	.	DP=19;AF1=1;CI95=1,1;DP4=0,0,11,7;MQ=37;FQ=-81	GT:PL:GQ	1/1:255,54,0:99
+19	9632576	.	A	G	222	.	DP=27;AF1=1;CI95=1,1;DP4=0,0,16,10;MQ=37;FQ=-105	GT:PL:GQ	1/1:255,78,0:99
+19	9632798	.	A	G	140	.	DP=29;AF1=1;CI95=1,1;DP4=0,0,14,14;MQ=37;FQ=-111	GT:PL:GQ	1/1:173,84,0:99
+19	9633610	.	T	C	30.8	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33	GT:PL:GQ	1/1:62,6,0:10
+19	9633663	.	T	G	40	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-36	GT:PL:GQ	1/1:72,9,0:16
+19	9633666	.	A	G	39	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-36	GT:PL:GQ	1/1:71,9,0:16
+19	9681721	.	G	A	148	.	DP=11;AF1=0.5;CI95=0.5,0.5;DP4=3,0,5,3;MQ=35;FQ=36;PV4=0.49,0.19,0.19,1	GT:PL:GQ	0/1:178,0,63:66
+19	9681741	.	A	T	81	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,6,2;MQ=34;FQ=-51	GT:PL:GQ	1/1:114,24,0:45
+19	9681750	.	T	A	61.1	.	DP=7;AF1=1;CI95=1,1;DP4=0,0,6,1;MQ=34;FQ=-48	GT:PL:GQ	1/1:94,21,0:39
+19	9681756	.	G	A	45.3	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-42	GT:PL:GQ	1/1:78,15,0:27
+19	9681764	.	A	T	39.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=32;FQ=-39	GT:PL:GQ	1/1:72,12,0:21
+19	9684345	.	A	G	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+19	9952338	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	10057473	.	G	GTC	75.5	.	INDEL;DP=29;AF1=0.5;CI95=0.5,0.5;DP4=1,4,10,0;MQ=33;FQ=73;PV4=0.0037,0.17,0.012,1	GT:PL:GQ	0/1:113,0,109:99
+19	10059270	.	G	C	21	.	DP=35;AF1=0.5;CI95=0.5,0.5;DP4=4,11,0,9;MQ=36;FQ=24;PV4=0.26,3e-14,0.0078,3.5e-05	GT:PL:GQ	0/1:51,0,255:54
+19	10060151	.	CAAA	CAA	27.2	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:66,6,0:10
+19	10126690	.	A	AC	14.6	.	INDEL;DP=4;AF1=0.5;CI95=0.5,0.5;DP4=0,2,2,0;MQ=37;FQ=16.1;PV4=0.33,1,1,0.0011	GT:PL:GQ	0/1:52,0,56:53
+19	10130185	.	GT	G	33.4	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-43.5	GT:PL:GQ	1/1:73,9,0:16
+19	10133086	.	A	G	170	.	DP=27;AF1=0.5;CI95=0.5,0.5;DP4=10,6,7,4;MQ=37;FQ=173;PV4=1,0.5,1,1	GT:PL:GQ	0/1:200,0,255:99
+19	10153682	.	A	C	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	10157183	.	G	T	35	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36	GT:PL:GQ	1/1:67,9,0:16
+19	10163595	.	A	AG	27.2	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:66,6,0:10
+19	10250372	.	G	A	32	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36	GT:PL:GQ	1/1:64,9,0:16
+19	10250380	.	A	G	72.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,4;MQ=35;FQ=-42	GT:PL:GQ	1/1:105,15,0:27
+19	10250405	.	A	G	159	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=32;FQ=-51	GT:PL:GQ	1/1:192,24,0:45
+19	10250417	.	T	C	222	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,9,4;MQ=33;FQ=-66	GT:PL:GQ	1/1:255,39,0:75
+19	10250483	.	A	T	110	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,8,0;MQ=32;FQ=-51	GT:PL:GQ	1/1:143,24,0:45
+19	10250497	.	C	G	55	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,8,0;MQ=32;FQ=-51	GT:PL:GQ	1/1:88,24,0:45
+19	10250501	.	C	T	74	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,8,0;MQ=32;FQ=-51	GT:PL:GQ	1/1:107,24,0:45
+19	10262515	.	A	T	3.58	.	DP=2;AF1=0.5078;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=-12.4;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,15:21
+19	10268290	.	T	TTC	56.5	.	INDEL;DP=5;AF1=0.5016;CI95=0.5,0.5;DP4=0,1,4,0;MQ=37;FQ=-12.8;PV4=0.2,0.49,1,0.13	GT:PL:GQ	0/1:94,0,22:25
+19	10281024	.	G	T	7.8	.	DP=5;AF1=0.5007;CI95=0.5,0.5;DP4=0,1,3,0;MQ=37;FQ=-4.28;PV4=0.25,0.023,1,0.14	GT:PL:GQ	0/1:37,0,25:29
+19	10297732	.	TGG	TGGGG	50.4	.	INDEL;DP=9;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:90,9,0:16
+19	10498385	.	A	T	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	10502388	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	10525511	.	A	C	13.2	.	DP=9;AF1=0.5;CI95=0.5,0.5;DP4=4,1,0,4;MQ=33;FQ=16.1;PV4=0.048,0.019,0.0056,1	GT:PL:GQ	0/1:43,0,107:46
+19	10590412	.	G	C	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	10607212	.	A	G	4.13	.	DP=7;AF1=0.4998;CI95=0.5,0.5;DP4=1,2,2,0;MQ=37;FQ=6.2;PV4=0.4,0.00041,1,1	GT:PL:GQ	0/1:32,0,89:31
+19	10656785	.	TA	TAAA	37.4	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:77,9,0:16
+19	10663128	.	A	G	121	.	DP=22;AF1=0.5;CI95=0.5,0.5;DP4=5,5,7,5;MQ=37;FQ=124;PV4=1,0.0086,1,1	GT:PL:GQ	0/1:151,0,173:99
+19	10669900	.	TC	TCC	21.5	.	INDEL;DP=3;AF1=0.5013;CI95=0.5,0.5;DP4=0,1,2,0;MQ=37;FQ=-11.8;PV4=0.33,1,1,0.027	GT:PL:GQ	0/1:59,0,23:26
+19	10681183	.	G	C	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	10689339	.	TA	TAAA	82.7	.	INDEL;DP=7;AF1=1;CI95=0.5,1;DP4=0,0,0,5;MQ=37;FQ=-49.5	GT:PL:GQ	1/1:123,15,0:27
+19	10690081	.	GT	GTTT	23.2	.	INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:62,6,0:10
+19	10698013	.	G	C	4.61	.	DP=8;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:34,6,0:5
+19	10699336	.	AGG	AG	73.5	.	INDEL;DP=7;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,2,2;MQ=37;FQ=-12.8;PV4=1,1,1,0.14	GT:PL:GQ	0/1:111,0,22:25
+19	10700484	.	A	C	122	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=37;FQ=-45	GT:PL:GQ	1/1:155,18,0:33
+19	10700486	.	G	GC	95	.	INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=37;FQ=-46.5	GT:PL:GQ	1/1:135,12,0:21
+19	10701724	.	AGG	AG	19.5	.	INDEL;DP=12;AF1=0.5;CI95=0.5,0.5;DP4=1,4,2,1;MQ=37;FQ=22.5;PV4=0.46,0.32,1,0.0032	GT:PL:GQ	0/1:57,0,130:60
+19	10702354	.	T	TCTGG	73	.	INDEL;DP=10;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=37;FQ=-46.5	GT:PL:GQ	1/1:113,12,0:21
+19	10773851	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	10788446	.	T	C	13.2	.	DP=32;AF1=0.5;CI95=0.5,0.5;DP4=12,1,0,7;MQ=37;FQ=16.1;PV4=0.0001,0.00062,1,1	GT:PL:GQ	0/1:43,0,165:46
+19	10924486	.	T	C	3.55	.	DP=2;AF1=0.5006;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=-4.74;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,25:28
+19	10927766	.	G	GAT	11.8	.	INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,3,1,1;MQ=37;FQ=14.6;PV4=0.4,0.22,1,0.0014	GT:PL:GQ	0/1:49,0,79:51
+19	10947182	.	G	C	41.8	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:73,6,0:10
+19	10948976	.	TC	TCC	64.9	.	INDEL;DP=7;AF1=0.5554;CI95=0.5,1;DP4=1,0,3,2;MQ=35;FQ=-27.5;PV4=1,0.27,1,0.35	GT:PL:GQ	0/1:102,0,7:10
+19	10972143	.	G	T	8.44	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:39,6,0:8
+19	10975413	.	C	CA	12.5	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:51,6,0:9
+19	11017779	.	TC	TCAC	16.3	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-40.5	GT:PL:GQ	1/1:55,6,0:10
+19	11122585	.	T	TC	53.7	.	INDEL;DP=9;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-49.5	GT:PL:GQ	1/1:94,15,0:27
+19	11165572	.	A	G	222	.	DP=16;AF1=1;CI95=1,1;DP4=0,0,10,6;MQ=37;FQ=-75	GT:PL:GQ	1/1:255,48,0:93
+19	11165677	.	G	A	49.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=37;FQ=-45	GT:PL:GQ	1/1:82,18,0:33
+19	11165689	.	T	A	85.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=37;FQ=-45	GT:PL:GQ	1/1:118,18,0:33
+19	11165712	.	A	G	57.3	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,2;MQ=37;FQ=-42	GT:PL:GQ	1/1:90,15,0:27
+19	11196378	.	CTTT	CTTTT	214	.	INDEL;DP=34;AF1=1;CI95=1,1;DP4=0,0,18,15;MQ=37;FQ=-134	GT:PL:GQ	1/1:255,99,0:99
+19	11196544	.	C	T	141	.	DP=19;AF1=1;CI95=1,1;DP4=0,0,7,11;MQ=37;FQ=-81	GT:PL:GQ	1/1:174,54,0:99
+19	11196769	.	A	G	174	.	DP=23;AF1=1;CI95=1,1;DP4=0,0,6,15;MQ=37;FQ=-90	GT:PL:GQ	1/1:207,63,0:99
+19	11402540	.	TC	T	32.4	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:72,9,0:16
+19	11465876	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	11467556	.	ATGTGTGTGTGTGTGT	ATGTGTGTGTGTGT	216	.	INDEL;DP=92;AF1=0.5;CI95=0.5,0.5;DP4=19,27,6,22;MQ=37;FQ=217;PV4=0.13,0.00092,0.36,1	GT:PL:GQ	0/1:254,0,255:99
+19	11472871	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	11489280	.	A	T	13	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33	GT:PL:GQ	1/1:44,6,0:9
+19	11537444	.	C	CG	48.5	.	INDEL;DP=6;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,0,4;MQ=37;FQ=-12.8;PV4=0.2,0.18,1,1	GT:PL:GQ	0/1:86,0,22:25
+19	11544046	.	G	GCT	74.5	.	INDEL;DP=28;AF1=1;CI95=1,1;DP4=0,0,9,0;MQ=35;FQ=-61.5	GT:PL:GQ	1/1:115,27,0:51
+19	11546250	.	A	G	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	11583902	.	A	C	3.54	.	DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=-3.07;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,29:29
+19	11593164	.	G	GCC	121	.	INDEL;DP=16;AF1=1;CI95=0.5,1;DP4=1,0,15,0;MQ=36;FQ=-45.5;PV4=1,1,0.36,0.34	GT:PL:GQ	1/1:161,11,0:19
+19	11593167	.	A	G	32	.	DP=16;AF1=1;CI95=0.5,1;DP4=1,0,10,0;MQ=37;FQ=-30;PV4=1,0.0089,1,1	GT:PL:GQ	1/1:62,3,0:6
+19	11632363	.	A	AGT	45.4	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:85,9,0:16
+19	11660704	.	GAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG	GAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG	8.83	.	INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:47,6,0:8
+19	11661671	.	TC	TCC	29.2	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:68,6,0:10
+19	11676455	.	CT	C	14.6	.	INDEL;DP=9;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,1;MQ=37;FQ=14.1;PV4=1,0.25,1,0.23	GT:PL:GQ	0/1:52,0,51:51
+19	11677634	.	A	G	15.1	.	DP=8;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=30;FQ=-36	GT:PL:GQ	1/1:47,9,0:14
+19	11777860	.	A	G	49.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=25;FQ=-39	GT:PL:GQ	1/1:82,12,0:21
+19	11777864	.	C	G	51.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=25;FQ=-39	GT:PL:GQ	1/1:84,12,0:21
+19	11777878	.	C	G	58.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=25;FQ=-39	GT:PL:GQ	1/1:91,12,0:21
+19	11777923	.	T	C	47.5	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=28;FQ=-39	GT:PL:GQ	1/1:80,12,0:21
+19	11777948	.	C	G	43.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=28;FQ=-39	GT:PL:GQ	1/1:76,12,0:21
+19	11839957	.	A	G	38.1	.	DP=10;AF1=0.5064;CI95=0.5,0.5;DP4=0,1,4,2;MQ=34;FQ=-11.3;PV4=0.43,0.0041,0.29,0.17	GT:PL:GQ	0/1:68,0,16:19
+19	11839959	.	A	G	32.1	.	DP=11;AF1=0.508;CI95=0.5,0.5;DP4=0,1,4,2;MQ=34;FQ=-12.3;PV4=0.43,0.0011,0.29,0.17	GT:PL:GQ	0/1:62,0,15:18
+19	11839992	.	A	G	106	.	DP=18;AF1=1;CI95=0.5,1;DP4=0,1,13,3;MQ=35;FQ=-41;PV4=0.24,3.8e-07,0.33,0.34	GT:PL:GQ	1/1:139,14,0:25
+19	11840001	.	T	C	112	.	DP=20;AF1=1;CI95=1,1;DP4=0,1,15,3;MQ=35;FQ=-47;PV4=0.21,7.2e-06,0.34,0.37	GT:PL:GQ	1/1:145,20,0:37
+19	11840069	.	T	C	86.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=37;FQ=-45	GT:PL:GQ	1/1:119,18,0:33
+19	11840074	.	GATCATCA	GATCA	60.4	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:100,9,0:16
+19	11840087	.	A	G	19.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:51,6,0:10
+19	11840209	.	A	G	76.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42	GT:PL:GQ	1/1:109,15,0:27
+19	11840219	.	C	G	66.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42	GT:PL:GQ	1/1:99,15,0:27
+19	11840229	.	T	G	65.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42	GT:PL:GQ	1/1:98,15,0:27
+19	11840237	.	A	T	42.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42	GT:PL:GQ	1/1:75,15,0:27
+19	11840260	.	G	C	35.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=25;FQ=-39	GT:PL:GQ	1/1:68,12,0:21
+19	11904739	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	11952270	.	A	G	222	.	DP=34;AF1=1;CI95=1,1;DP4=0,1,13,20;MQ=35;FQ=-92;PV4=1,0.16,0.29,1	GT:PL:GQ	1/1:255,65,0:99
+19	11952283	.	T	C	165	.	DP=38;AF1=1;CI95=1,1;DP4=0,0,14,21;MQ=35;FQ=-132	GT:PL:GQ	1/1:198,105,0:99
+19	11952293	.	A	G	222	.	DP=45;AF1=1;CI95=1,1;DP4=0,0,19,25;MQ=34;FQ=-159	GT:PL:GQ	1/1:255,132,0:99
+19	11952355	.	G	C	21.3	.	DP=14;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=30;FQ=-42	GT:PL:GQ	1/1:54,15,0:26
+19	11952357	.	T	C	39.1	.	DP=14;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=32;FQ=-45	GT:PL:GQ	1/1:72,18,0:33
+19	11952381	.	C	T	82.1	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,5,2;MQ=36;FQ=-48	GT:PL:GQ	1/1:115,21,0:39
+19	11952422	.	CTC	CTCGTC	88.7	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,5;MQ=37;FQ=-49.5	GT:PL:GQ	1/1:129,15,0:27
+19	11952453	.	T	C	88.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,5;MQ=37;FQ=-42	GT:PL:GQ	1/1:121,15,0:27
+19	11952566	.	C	G	112	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,5,4;MQ=37;FQ=-54	GT:PL:GQ	1/1:145,27,0:51
+19	11952602	.	C	T	186	.	DP=21;AF1=1;CI95=1,1;DP4=0,0,12,9;MQ=37;FQ=-90	GT:PL:GQ	1/1:219,63,0:99
+19	11952628	.	CTCTTCT	CTCT	15.6	.	INDEL;DP=28;AF1=0.5;CI95=0.5,0.5;DP4=10,13,3,1;MQ=37;FQ=18.5;PV4=0.33,1,1,1	GT:PL:GQ	0/1:53,0,255:56
+19	11952659	.	A	C	172	.	DP=21;AF1=1;CI95=1,1;DP4=0,0,9,12;MQ=37;FQ=-90	GT:PL:GQ	1/1:205,63,0:99
+19	11952675	.	T	C	178	.	DP=17;AF1=1;CI95=1,1;DP4=0,0,8,8;MQ=37;FQ=-75	GT:PL:GQ	1/1:211,48,0:93
+19	11952711	.	TA	T	31.5	.	INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=0,4,1,2;MQ=37;FQ=34.4;PV4=0.43,1,1,0.0096	GT:PL:GQ	0/1:69,0,86:72
+19	11952712	.	AGCTGCTGCTGCTGC	AGCTGCTGCTGCTGCTGC	99.6	.	INDEL;DP=9;AF1=1;CI95=0.5,1;DP4=0,0,0,6;MQ=37;FQ=-52.5	GT:PL:GQ	1/1:140,18,0:33
+19	11952805	.	A	G	198	.	DP=21;AF1=1;CI95=1,1;DP4=0,0,8,12;MQ=37;FQ=-87	GT:PL:GQ	1/1:231,60,0:99
+19	11952841	.	T	G	191	.	DP=24;AF1=1;CI95=1,1;DP4=0,0,16,7;MQ=36;FQ=-96	GT:PL:GQ	1/1:224,69,0:99
+19	11952882	.	A	C	140	.	DP=28;AF1=1;CI95=1,1;DP4=0,0,22,6;MQ=34;FQ=-111	GT:PL:GQ	1/1:173,84,0:99
+19	11952895	.	A	G	104	.	DP=25;AF1=1;CI95=1,1;DP4=0,0,21,1;MQ=34;FQ=-93	GT:PL:GQ	1/1:137,66,0:99
+19	11997967	.	G	C	6.98	.	DP=3;AF1=0.5003;CI95=0.5,0.5;DP4=1,0,2,0;MQ=33;FQ=3.2;PV4=1,0.019,0.33,1	GT:PL:GQ	0/1:36,0,28:31
+19	12033202	.	G	A	27	.	DP=4;AF1=0.5008;CI95=0.5,0.5;DP4=0,1,1,2;MQ=28;FQ=-4.12;PV4=1,0.048,0,0.22	GT:PL:GQ	0/1:57,0,25:28
+19	12033225	.	T	G	178	.	DP=15;AF1=1;CI95=0.5,1;DP4=0,1,5,7;MQ=34;FQ=-29;PV4=1,0.23,0.26,0.1	GT:PL:GQ	1/1:207,2,0:5
+19	12033238	.	T	C	222	.	DP=23;AF1=1;CI95=1,1;DP4=0,1,10,9;MQ=35;FQ=-50;PV4=1,0.39,0.32,0.24	GT:PL:GQ	1/1:255,23,0:43
+19	12033263	.	A	G	222	.	DP=32;AF1=1;CI95=1,1;DP4=0,0,15,15;MQ=36;FQ=-117	GT:PL:GQ	1/1:255,90,0:99
+19	12033304	.	A	G	222	.	DP=41;AF1=1;CI95=1,1;DP4=0,0,18,23;MQ=36;FQ=-150	GT:PL:GQ	1/1:255,123,0:99
+19	12033367	.	A	C	152	.	DP=32;AF1=1;CI95=1,1;DP4=0,0,11,19;MQ=37;FQ=-117	GT:PL:GQ	1/1:185,90,0:99
+19	12033372	.	TC	TCC	214	.	INDEL;DP=30;AF1=1;CI95=1,1;DP4=0,0,11,18;MQ=37;FQ=-122	GT:PL:GQ	1/1:255,87,0:99
+19	12033396	.	T	C	192	.	DP=21;AF1=1;CI95=1,1;DP4=0,0,9,11;MQ=37;FQ=-87	GT:PL:GQ	1/1:225,60,0:99
+19	12033437	.	A	G	181	.	DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=37;FQ=-51	GT:PL:GQ	1/1:214,24,0:45
+19	12052486	.	T	C	3.55	.	DP=2;AF1=0.5011;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=-5.91;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,23:27
+19	12063068	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	12075788	.	A	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	12596319	.	G	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	12761248	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	12761275	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	12845038	.	AT	ATT	11.5	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:50,6,0:9
+19	12873388	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	12979639	.	A	T	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	12979730	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	12979796	.	G	A	25.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-33	GT:PL:GQ	1/1:57,6,0:10
+19	12980273	.	G	A	29	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-36	GT:PL:GQ	1/1:61,9,0:16
+19	12980707	.	A	G	86	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,3,6;MQ=37;FQ=-54	GT:PL:GQ	1/1:119,27,0:51
+19	12980733	.	G	A	124	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,4,9;MQ=37;FQ=-66	GT:PL:GQ	1/1:157,39,0:75
+19	12980760	.	C	G	222	.	DP=15;AF1=1;CI95=1,1;DP4=0,0,3,12;MQ=37;FQ=-72	GT:PL:GQ	1/1:255,45,0:87
+19	12980967	.	G	A	104	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,3,6;MQ=37;FQ=-54	GT:PL:GQ	1/1:137,27,0:51
+19	12981016	.	T	C	222	.	DP=15;AF1=1;CI95=1,1;DP4=0,0,9,6;MQ=37;FQ=-72	GT:PL:GQ	1/1:255,45,0:87
+19	13670070	.	C	T	13.9	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33	GT:PL:GQ	1/1:45,6,0:10
+19	13670140	.	C	T	28	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36	GT:PL:GQ	1/1:60,9,0:16
+19	13670153	.	A	G	30	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36	GT:PL:GQ	1/1:62,9,0:16
+19	13670161	.	G	A	27	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36	GT:PL:GQ	1/1:59,9,0:16
+19	14007582	.	C	A	3.98	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:33,6,0:5
+19	14007612	.	AAGAGAG	AAGAG	28.2	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:67,6,0:10
+19	14070075	.	T	A	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	14524333	.	TAG	T	14.6	.	INDEL;DP=4;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,1,1;MQ=37;FQ=-7.41;PV4=1,1,1,0.39	GT:PL:GQ	0/1:52,0,28:31
+19	14527043	.	T	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	14580308	.	T	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	14592466	.	GC	GCCC	22.2	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:61,6,0:10
+19	14607703	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	15533970	.	T	C	51	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=30;FQ=-36	GT:PL:GQ	1/1:83,9,0:16
+19	15533994	.	A	G	45.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=32;FQ=-39	GT:PL:GQ	1/1:78,12,0:21
+19	15534018	.	A	G	42.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=32;FQ=-39	GT:PL:GQ	1/1:75,12,0:21
+19	15647552	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	16143433	.	T	G	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	16143436	.	A	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	16213914	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	16296200	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	16298173	.	C	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	16304596	.	G	C	3.54	.	DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,30:29
+19	16471631	.	T	C	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	16548752	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	16631177	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	16735479	.	G	T	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+19	16737011	.	C	G	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	16751327	.	G	A	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	16800107	.	T	C	3.54	.	DP=3;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	17419010	.	C	T	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	17752449	.	T	C	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	17767368	.	C	T	152	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,6,7;MQ=36;FQ=-66	GT:PL:GQ	1/1:185,39,0:75
+19	17767372	.	G	A	161	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,6,7;MQ=36;FQ=-66	GT:PL:GQ	1/1:194,39,0:75
+19	18001132	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	18001229	.	G	C	13.9	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:45,6,0:10
+19	18001743	.	A	G	3.02	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:30,3,0:4
+19	18001767	.	T	C	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	18195972	.	C	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	18484588	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	18664889	.	A	ATG	27.5	.	INDEL;DP=11;AF1=0.5016;CI95=0.5,0.5;DP4=0,1,0,4;MQ=35;FQ=-12.8;PV4=1,0.18,0.34,0.42	GT:PL:GQ	0/1:65,0,22:25
+19	18671826	.	T	C	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	18703713	.	T	G	4.13	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:32,3,0:3
+19	20260046	.	C	A	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	20449580	.	A	T	4.13	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:32,3,0:3
+19	20452978	.	GCC	GCCC	102	.	INDEL;DP=13;AF1=0.5;CI95=0.5,0.5;DP4=2,1,1,5;MQ=37;FQ=32.5;PV4=0.23,1,1,2.4e-05	GT:PL:GQ	0/1:140,0,67:70
+19	20454525	.	C	G	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	20697944	.	G	GC	106	.	INDEL;DP=13;AF1=0.6243;CI95=0.5,1;DP4=0,1,9,1;MQ=36;FQ=-30.5;PV4=0.18,0.19,0.38,0.11	GT:PL:GQ	0/1:143,0,4:7
+19	20699318	.	A	T	34.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=34;FQ=-39	GT:PL:GQ	1/1:67,12,0:21
+19	20705340	.	G	GATT	28.5	.	INDEL;DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,3,0;MQ=34;FQ=-9.98;PV4=1,0.13,0.33,0.0037	GT:PL:GQ	0/1:66,0,25:28
+19	20705889	.	A	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	20711314	.	TGG	TGGGG	17.5	.	INDEL;DP=10;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=33;FQ=-43.5	GT:PL:GQ	1/1:57,9,0:15
+19	20711316	.	G	GGT	89.6	.	INDEL;DP=8;AF1=1;CI95=0.5,1;DP4=0,0,6,0;MQ=35;FQ=-52.5	GT:PL:GQ	1/1:130,18,0:33
+19	20711320	.	G	C	32.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=37;FQ=-39	GT:PL:GQ	1/1:65,12,0:21
+19	20715519	.	G	A	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	20717383	.	G	GAACT	25.5	.	INDEL;DP=12;AF1=0.5;CI95=0.5,0.5;DP4=1,4,0,3;MQ=36;FQ=28.5;PV4=1,0.48,0.11,0.0065	GT:PL:GQ	0/1:63,0,130:66
+19	21354909	.	G	A	12.2	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36	GT:PL:GQ	1/1:44,9,0:14
+19	21467193	.	ACCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTC	ACCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTC	63	.	INDEL;DP=52;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-46.5	GT:PL:GQ	1/1:103,12,0:21
+19	21470903	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	21470906	.	T	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	21486985	.	T	C	28	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-36	GT:PL:GQ	1/1:60,9,0:16
+19	21486986	.	A	AG	65.4	.	INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:105,9,0:16
+19	21736204	.	C	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	21744637	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	21764018	.	T	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	21789476	.	G	T	12	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:43,6,0:9
+19	21798928	.	C	A	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	21897216	.	A	G	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	21917388	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	21919108	.	AGG	AGGG	14.8	.	INDEL;DP=6;AF1=0.5263;CI95=0.5,1;DP4=1,0,1,1;MQ=37;FQ=-24.5;PV4=1,1,1,0	GT:PL:GQ	0/1:52,0,10:13
+19	21936202	.	A	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	22011899	.	A	G	96.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=37;FQ=-39	GT:PL:GQ	1/1:129,12,0:21
+19	22011902	.	A	C	48.5	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=37;FQ=-39	GT:PL:GQ	1/1:81,12,0:21
+19	22011911	.	A	T	67.3	.	DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=37;FQ=-42	GT:PL:GQ	1/1:100,15,0:27
+19	22011974	.	G	A	222	.	DP=37;AF1=1;CI95=1,1;DP4=0,0,17,18;MQ=37;FQ=-132	GT:PL:GQ	1/1:255,105,0:99
+19	22012019	.	T	C	201	.	DP=44;AF1=1;CI95=1,1;DP4=0,0,23,21;MQ=37;FQ=-159	GT:PL:GQ	1/1:234,132,0:99
+19	22012051	.	A	G	165	.	DP=35;AF1=1;CI95=1,1;DP4=0,0,15,19;MQ=37;FQ=-129	GT:PL:GQ	1/1:198,102,0:99
+19	22012155	.	T	A	193	.	DP=24;AF1=1;CI95=1,1;DP4=0,0,16,8;MQ=36;FQ=-99	GT:PL:GQ	1/1:226,72,0:99
+19	22012157	.	C	G	158	.	DP=24;AF1=1;CI95=1,1;DP4=0,0,16,7;MQ=36;FQ=-96	GT:PL:GQ	1/1:191,69,0:99
+19	22012166	.	G	C	146	.	DP=11;AF1=1;CI95=1,1;DP4=0,0,6,5;MQ=35;FQ=-60	GT:PL:GQ	1/1:179,33,0:63
+19	22012217	.	T	C	222	.	DP=17;AF1=1;CI95=1,1;DP4=0,0,7,8;MQ=36;FQ=-72	GT:PL:GQ	1/1:255,45,0:87
+19	22012250	.	A	G	179	.	DP=25;AF1=1;CI95=1,1;DP4=0,0,8,16;MQ=36;FQ=-99	GT:PL:GQ	1/1:212,72,0:99
+19	22012307	.	T	C	222	.	DP=22;AF1=1;CI95=1,1;DP4=0,0,6,16;MQ=36;FQ=-93	GT:PL:GQ	1/1:255,66,0:99
+19	22012325	.	A	C	217	.	DP=12;AF1=1;CI95=1,1;DP4=0,0,4,7;MQ=36;FQ=-60	GT:PL:GQ	1/1:250,33,0:63
+19	22012430	.	T	C	222	.	DP=24;AF1=1;CI95=1,1;DP4=0,0,6,17;MQ=37;FQ=-96	GT:PL:GQ	1/1:255,69,0:99
+19	22012579	.	T	A	222	.	DP=42;AF1=1;CI95=1,1;DP4=0,0,26,15;MQ=37;FQ=-150	GT:PL:GQ	1/1:255,123,0:99
+19	22012727	.	C	T	222	.	DP=21;AF1=1;CI95=1,1;DP4=0,0,8,13;MQ=37;FQ=-90	GT:PL:GQ	1/1:255,63,0:99
+19	22012748	.	A	G	30.5	.	DP=18;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=37;FQ=-39	GT:PL:GQ	1/1:63,12,0:21
+19	22012751	.	T	C	24	.	DP=17;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36	GT:PL:GQ	1/1:56,9,0:15
+19	22012760	.	C	T	222	.	DP=16;AF1=1;CI95=1,1;DP4=0,0,5,10;MQ=36;FQ=-72	GT:PL:GQ	1/1:255,45,0:87
+19	22128042	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	22376925	.	G	A	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	22516053	.	A	G	54	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,3,5;MQ=36;FQ=-51	GT:PL:GQ	1/1:87,24,0:45
+19	23130188	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	23216070	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	23216752	.	T	G	6.02	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-33	GT:PL:GQ	1/1:36,6,0:6
+19	23216754	.	G	A	13	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-33	GT:PL:GQ	1/1:44,6,0:9
+19	23225184	.	C	T	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	23239936	.	C	A	5.46	.	DP=19;AF1=0.4999;CI95=0.5,0.5;DP4=5,1,0,6;MQ=35;FQ=7.8;PV4=0.015,0.00042,0.072,1	GT:PL:GQ	0/1:34,0,116:34
+19	23281456	.	A	G	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	23309145	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	23309152	.	T	C	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	23383229	.	C	G	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	23399342	.	T	C	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	23418245	.	G	T	40	.	DP=5;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,1,3;MQ=37;FQ=-6.18;PV4=0.4,0.014,1,0.043	GT:PL:GQ	0/1:70,0,22:25
+19	23418278	.	T	A	88.1	.	DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=37;FQ=-45	GT:PL:GQ	1/1:121,18,0:33
+19	23418327	.	A	G	43.1	.	DP=7;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=37;FQ=-45	GT:PL:GQ	1/1:76,18,0:33
+19	23418353	.	G	C	68	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36	GT:PL:GQ	1/1:100,9,0:16
+19	23418485	.	T	C	50.1	.	DP=7;AF1=1;CI95=1,1;DP4=0,0,5,2;MQ=36;FQ=-48	GT:PL:GQ	1/1:83,21,0:39
+19	23418549	.	G	A	17.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:49,6,0:10
+19	23418558	.	G	A	12	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:43,6,0:9
+19	23476446	.	G	A	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	23750472	.	TGCAG	TG	112	.	INDEL;DP=41;AF1=0.5;CI95=0.5,0.5;DP4=17,13,4,5;MQ=37;FQ=115;PV4=0.71,0.16,1,1	GT:PL:GQ	0/1:150,0,255:99
+19	23750625	.	A	G	139	.	DP=52;AF1=1;CI95=1,1;DP4=0,0,29,22;MQ=37;FQ=-181	GT:PL:GQ	1/1:172,154,0:99
+19	23800889	.	TA	T	7.35	.	INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=5,3,1,1;MQ=37;FQ=9.94;PV4=1,0.075,1,1	GT:PL:GQ	0/1:44,0,193:45
+19	24001511	.	A	C	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	24021577	.	A	G	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	24054562	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	24069383	.	T	A	27.8	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:59,6,0:10
+19	24125925	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	24191462	.	G	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	24196752	.	C	G	8.44	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-33	GT:PL:GQ	1/1:39,6,0:8
+19	24199057	.	C	T	6.02	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33	GT:PL:GQ	1/1:36,6,0:6
+19	24199212	.	CT	CTT	18.5	.	INDEL;DP=9;AF1=0.5;CI95=0.5,0.5;DP4=1,1,1,1;MQ=37;FQ=18.5;PV4=1,1,1,0.027	GT:PL:GQ	0/1:56,0,56:56
+19	24205962	.	ACC	AC	14.4	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:53,6,0:10
+19	24209339	.	CT	CTT	11.5	.	INDEL;DP=8;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-40.5	GT:PL:GQ	1/1:50,6,0:9
+19	24276126	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	24297919	.	C	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	24409006	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	24434846	.	C	G	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	24439851	.	C	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	25085208	.	C	T	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	25088621	.	A	C	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	25152568	.	AG	A	13.4	.	INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:52,6,0:9
+19	25176862	.	C	T	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	25202314	.	G	T	3.57	.	DP=2;AF1=0.5048;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=-10.6;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,17:23
+19	25264826	.	T	A	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	25568427	.	A	G	28	.	DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=25;FQ=-36	GT:PL:GQ	1/1:60,9,0:16
+19	25568441	.	G	A	89	.	DP=10;AF1=1;CI95=1,1;DP4=0,0,7,3;MQ=29;FQ=-57	GT:PL:GQ	1/1:122,30,0:57
+19	25568480	.	A	G	169	.	DP=11;AF1=1;CI95=1,1;DP4=0,0,8,3;MQ=30;FQ=-60	GT:PL:GQ	1/1:202,33,0:63
+19	25568513	.	T	A	124	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,6,3;MQ=28;FQ=-54	GT:PL:GQ	1/1:157,27,0:51
+19	25568527	.	A	G	109	.	DP=9;AF1=1;CI95=1,1;DP4=0,0,6,3;MQ=28;FQ=-54	GT:PL:GQ	1/1:142,27,0:51
+19	25568536	.	A	G	13.2	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36	GT:PL:GQ	1/1:45,9,0:14
+19	25581569	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	26697796	.	T	A	6.2	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:35,3,0:4
+19	26728829	.	AGG	ATGG,AG	8.83	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-40.5	GT:PL:GQ	1/1:71,30,24,46,0,43:8
+19	26747187	.	AGG	AG	14.4	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:53,6,0:10
+19	26751288	.	G	GAC	116	.	INDEL;DP=8;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=35;FQ=-52.5	GT:PL:GQ	1/1:156,18,0:33
+19	26756358	.	CA	CAAA	11.8	.	INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,1,1;MQ=37;FQ=14.4;PV4=1,0.41,1,0.0024	GT:PL:GQ	0/1:49,0,62:51
+19	26758413	.	GT	GTT	52.4	.	INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-43.5	GT:PL:GQ	1/1:92,9,0:16
+19	26764380	.	C	T	13	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33	GT:PL:GQ	1/1:44,6,0:9
+19	26765941	.	AGG	AGGGG	24.2	.	INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5	GT:PL:GQ	1/1:63,6,0:10
+19	26780556	.	A	AC	18.3	.	INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-40.5	GT:PL:GQ	1/1:57,6,0:10
+19	26787476	.	G	A	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	26803166	.	A	G	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	26803281	.	G	T	7.8	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	1/1:37,3,0:4
+19	26827257	.	G	A	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	26847473	.	A	C	10.2	.	DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33	GT:PL:GQ	1/1:41,6,0:8
+19	26852064	.	TACACACACACACACACACACACACACACACACACACACA	TACACACACACACACACACACACACACACACACACACA	118	.	INDEL;DP=55;AF1=0.5;CI95=0.5,0.5;DP4=8,10,4,6;MQ=37;FQ=121;PV4=1,1,1,1	GT:PL:GQ	0/1:156,0,255:99
+19	27313337	.	G	A	3.41	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33	GT:PL:GQ	1/1:32,6,0:4
+19	27314462	.	T	C	40	.	DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36	GT:PL:GQ	1/1:72,9,0:16
+19	27466173	.	C	G	3.54	.	DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1	GT:PL:GQ	0/1:31,0,31:29
+19	28220602	.	T	G	222	.	DP=21;AF1=1;CI95=1,1;DP4=0,0,8,13;MQ=37;FQ=-90	GT:PL:GQ	1/1:255,63,0:99
+19	28220622	.	C	T	222	.	DP=21;AF1=1;CI95=1,1;DP4=0,0,8,13;MQ=37;FQ=-90	GT:PL:GQ	1/1:255,63,0:99
+19	28220668	.	G	A	222	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,5,6;MQ=36;FQ=-60	GT:PL:GQ	1/1:255,33,0:63
+19	28220691	.	T	C	148	.	DP=7;AF1=1;CI95=1,1;DP4=0,0,3,4;MQ=36;FQ=-48	GT:PL:GQ	1/1:181,21,0:39
+19	28486996	.	T	C	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	28643319	.	C	T	3.55	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:31,3,0:4
+19	28643329	.	C	T	4.77	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30	GT:PL:GQ	0/1:33,3,0:3
+19	28714335	.	C	A	6.98	.	DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30	GT:PL:GQ	1/1:36,3,0:4
+19	28837706	.	A	T	154	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=25;FQ=-66	GT:PL:GQ	1/1:187,39,0:75
+19	28837717	.	G	A	154	.	DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=25;FQ=-66	GT:PL:GQ	1/1:187,39,0:75
+19	28837735	.	A	G	154	.	DP=24;AF1=1;CI95=1,1;DP4=0,0,7,14;MQ=25;FQ=-90	GT:PL:GQ	1/1:187,63,0:99
+19	28837767	.	A	G,T	177	.	DP=53;AF1=1;CI95=1,1;DP4=0,0,21,29;MQ=30;FQ=-175	GT:PL:GQ	1/1:210,148,0,204,125,201:99
+19	28837787	.	C	T	161	.	DP=66;AF1=1;CI95=1,1;DP4=0,1,30,35;MQ=31;FQ=-206;PV4=1,1,1,1	GT:PL:GQ	1/1:194,179,0:99
+19	28837805	.	A	G	222	.	DP=54;AF1=1;CI95=1,1;DP4=0,0,26,26;MQ=32;FQ=-184	GT:PL:GQ	1/1:255,157,0:99
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/vcf_homhet.vcf	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,60 @@
+##fileformat=VCFv4.0
+##samtoolsVersion=0.1.15 (r949:203)
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw read depth">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=MQ,Number=1,Type=Integer,Description="Root-mean-square mapping quality of covering reads">
+##INFO=<ID=FQ,Number=1,Type=Float,Description="Phred probability of all samples being the same">
+##INFO=<ID=AF1,Number=1,Type=Float,Description="Max-likelihood estimate of the site allele frequency of the first ALT allele">
+##INFO=<ID=G3,Number=3,Type=Float,Description="ML estimate of genotype frequencies">
+##INFO=<ID=HWE,Number=1,Type=Float,Description="Chi^2 based HWE test P-value based on G3">
+##INFO=<ID=CI95,Number=2,Type=Float,Description="Equal-tail Bayesian credible interval of the site allele frequency at the 95% level">
+##INFO=<ID=PV4,Number=4,Type=Float,Description="P-values for strand bias, baseQ bias, mapQ bias and tail distance bias">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=PC2,Number=2,Type=Integer,Description="Phred probability of the nonRef allele frequency in group1 samples being larger (,smaller) than in group2.">
+##INFO=<ID=PCHI2,Number=1,Type=Float,Description="Posterior weighted chi^2 P-value for testing the association between group1 and group2 samples.">
+##INFO=<ID=QCHI2,Number=1,Type=Integer,Description="Phred scaled PCHI2.">
+##INFO=<ID=PR,Number=1,Type=Integer,Description="# permutations yielding a smaller PCHI2.">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=GL,Number=3,Type=Float,Description="Likelihoods for RR,RA,AA genotypes (R=ref,A=alt)">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="# high-quality bases">
+##FORMAT=<ID=SP,Number=1,Type=Integer,Description="Phred-scaled strand bias P-value">
+##FORMAT=<ID=PL,Number=.,Type=Integer,Description="List of Phred-scaled genotype likelihoods, number of values is (#ALT+1)*(#ALT+2)/2">
+##source_20110319.1=/wsu/home/eq/eq83/eq8302/tools/vcftools/bin//vcf-merge s_1_ACAGTGA.vcf.gz s_1_CAGATCA.vcf.gz s_1_CGATGTA.vcf.gz s_1_CTTGTAA.vcf.gz s_1_GCCAATA.vcf.gz s_1_TGACCAA.vcf.gz
+##sourceFiles_20110319.1=0:s_1_ACAGTGA.vcf.gz,1:s_1_CAGATCA.vcf.gz,2:s_1_CGATGTA.vcf.gz,3:s_1_CTTGTAA.vcf.gz,4:s_1_GCCAATA.vcf.gz,5:s_1_TGACCAA.vcf.gz
+##INFO=<ID=SF,Number=.,Type=String,Description="Source File (index to sourceFiles, f when filtered)">
+##INFO=<ID=AC,Number=.,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	s_1_ACAGTGA_sort.bam	s_1_CAGATCA_sort.bam	s_1_CGATGTA_sort.bam	s_1_CTTGTAA_sort.bam	s_1_GCCAATA_sort.bam	s_1_TGACCAA_sort.bam
+Y	3718196	.	C	T	7.59	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,2,0;DP=2;FQ=-33;G3=4.617e-16,8.575e-07,1;MQ=39;SF=1	GT:GQ:PL	.	1/1:61:38,6,0	.	.	.	.
+Y	3720217	.	A	G	8.65	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,0,1;DP=2;FQ=-30;G3=4.415e-15,5.291e-06,1;MQ=38;SF=5	GT:GQ:PL	.	.	.	.	.	1/1:53:38,3,0
+Y	3720581	.	A	G	7.80	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,1,0;DP=1;FQ=-30;G3=5.56e-15,5.291e-06,1;MQ=44;SF=1	GT:GQ:PL	.	1/1:53:37,3,0	.	.	.	.
+Y	3721154	.	A	G	13.90	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,2,0;DP=2;FQ=-33;G3=9.194e-17,8.566e-07,1;MQ=37;SF=3	GT:GQ:PL	.	.	.	1/1:61:45,6,0	.	.
+Y	3721230	.	C	G	21.80	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,0,2;DP=2;FQ=-33;G3=1.456e-17,8.564e-07,1;MQ=29;SF=3	GT:GQ:PL	.	.	.	1/1:61:53,6,0	.	.
+Y	3744605	.	C	A	3.98	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,0,2;DP=2;FQ=-33;G3=1.468e-15,8.599e-07,1;MQ=19;SF=2	GT:GQ:PL	.	.	1/1:61:33,6,0	.	.	.
+Y	4433091	.	T	C	11.10	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,2,0;DP=2;FQ=-33;G3=1.835e-16,8.568e-07,1;MQ=23;SF=5	GT:GQ:PL	.	.	.	.	.	1/1:61:42,6,0
+Y	9945223	.	ATTT	ATTTT	19.80	.	AC=4;AF1=1;AN=4;CI95=0.5,1;DP4=0,0,0,2;DP=2;FQ=-40.5;G3=2.906e-18,8.564e-07,1;INDEL;MQ=45;SF=0,2	GT:GQ:PL	1/1:61:60,6,0	.	1/1:61:57,6,0	.	.	.
+Y	9987395	.	TTAT	TT	80.40	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,1,2;DP=3;FQ=-43.5;G3=5.464e-26,5.886e-08,1;INDEL;MQ=43;SF=5	GT:GQ:PL	.	.	.	.	.	1/1:72:120,9,0
+Y	10011604	.	C	CTT	119.17	.	AC=12;AF1=1;AN=12;CI95=1,1;DP4=0,0,7,0;DP=9;FQ=-55.5;G3=4.948e-32,3.15e-11,1;INDEL;MQ=33;SF=0,1,2,3,4,5	GT:GQ:PL	1/1:99:139,21,0	1/1:96:134,24,0	1/1:99:168,36,0	1/1:99:159,45,0	1/1:99:185,33,0	1/1:99:175,39,0
+Y	10011748	.	GAAAAAA	GAAAAAAA	23.70	.	AC=6;AF1=0.5;AN=12;CI95=0.5,0.5;DP4=12,12,11,10;DP=51;FQ=33.5;G3=1.256e-14,1,1.991e-19;INDEL;MQ=33;PV4=1,0.49,0.012,0.2;SF=0,1,2,3,4,5	GT:GQ:PL	0/0:71:68,0,92	1/1:55:52,0,77	1/1:71:69,0,75	1/1:69:66,0,79	1/1:56:53,0,80	1/1:62:59,0,98
+Y	10011894	.	ATTATTTATTT	ATTATTT	58.62	.	AC=4;AF1=0.5;AN=8;CI95=0.5,0.5;DP4=4,11,0,6;DP=34;FQ=32.5;G3=1.991e-14,1,7.924e-52;INDEL;MQ=35;PV4=0.28,0.049,0.14,0.2;SF=1,3,4,5	GT:GQ:PL	.	0/0:70:67,0,254	.	1/1:99:152,0,255	1/1:83:80,0,255	1/1:89:86,0,255
+Y	10011930	.	ACT	A	90.85	.	AC=2;AF1=0.5;AN=4;CI95=0.5,0.5;DP4=2,6,1,3;DP=17;FQ=16.6;G3=3.155e-11,1,1.991e-34;INDEL;MQ=35;PV4=1,0.00044,0.33,1;SF=0,5	GT:GQ:PL	0/0:54:51,0,167	.	.	.	.	0/0:99:206,0,255
+Y	10011935	.	C	CT	83.83	.	AC=3;AF1=0.5;AN=6;CI95=0.5,0.5;DP4=1,8,2,5;DP=23;FQ=90.3;G3=1.256e-28,1,5e-26;INDEL;MQ=39;PV4=0.55,1,0.15,1;SF=1,2,4	GT:GQ:PL	.	0/0:99:138,0,125	1/1:92:89,0,148	.	1/1:99:138,0,171	.
+Y	10011966	.	ATT	AT	79.38	.	AC=6;AF1=0.5;AN=12;CI95=0.5,0.5;DP4=1,6,0,2;DP=14;FQ=5.09;G3=1.991e-12,1,1.256e-28;INDEL;MQ=38;PV4=1,1,0.46,0.088;SF=0,1,2,3,4,5	GT:GQ:PL	1/1:41:38,0,92	1/1:76:73,0,109	1/1:99:181,0,109	1/1:99:114,0,103	1/1:99:139,0,171	1/1:99:155,0,144
+Y	10028061	.	CA	CAA	28.40	.	AC=4;AF1=1;AN=4;CI95=0.5,1;DP4=0,0,2,1;DP=9;FQ=-43.5;G3=2.739e-22,5.886e-08,1;INDEL;MQ=37;SF=4,5	GT:GQ:PL	.	.	.	.	1/1:72:83,9,0	0/0:61:52,6,0
+Y	10029194	.	CA	C	73.47	.	AC=10;AF1=0.7304;AN=12;CI95=0.5,1;DP4=2,0,7,3;DP=19;FQ=-32.5;G3=2.922e-150,0.9991,0.000854;INDEL;MQ=25;PV4=1,0.4,1,0.23;SF=0,1,2,3,4,5	GT:GQ:PL	0/0:3:93,0,2	1/1:85:100,17,0	1/1:99:181,36,0	1/1:90:107,18,0	1/1:3:104,0,2	1/1:70:90,10,0
+Y	10029452	.	CAA	CAAA	7.26	.	AC=4;AF1=1;AN=4;CI95=0.5,1;DP4=0,0,4,0;DP=13;FQ=-46.5;G3=2.341e-18,6.106e-08,1;INDEL;MQ=26;SF=3,4	GT:GQ:PL	.	.	.	1/1:72:50,12,0	1/1:72:42,12,0	.
+Y	10037877	.	GCCC	GCCCC	14.40	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,0,2;DP=3;FQ=-40.5;G3=1.456e-17,8.564e-07,1;INDEL;MQ=29;SF=2	GT:GQ:PL	.	.	1/1:61:53,6,0	.	.	.
+Y	13266272	.	TTTT	TTTTATTT	51.50	.	AC=1;AF1=0.5;AN=2;CI95=0.5,0.5;DP4=5,1,7,0;DP=15;FQ=54.5;G3=7.924e-19,1,3.155e-24;INDEL;MQ=30;PV4=0.46,1,0.078,0.00035;SF=3	GT:GQ:PL	.	.	.	0/0:92:89,0,116	.	.
+Y	13268110	.	GC	GCC	3.66	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,2,0;DP=2;FQ=-40.5;G3=2.911e-16,8.571e-07,1;INDEL;MQ=23;SF=2	GT:GQ:PL	.	.	1/1:61:40,6,0	.	.	.
+Y	13292082	.	TCCCCCCCCCC	TCCCCCCC	14.40	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,0,2;DP=2;FQ=-40.5;G3=1.456e-17,8.564e-07,1;INDEL;MQ=29;SF=3	GT:GQ:PL	.	.	.	1/1:61:53,6,0	.	.
+Y	13297070	.	AGGTGGTGGTGGT	AGGTGGTGGT	12.70	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,0,1;DP=1;FQ=-37.5;G3=2.782e-16,5.287e-06,1;INDEL;MQ=50;SF=5	GT:GQ:PL	.	.	.	.	.	1/1:53:50,3,0
+Y	13312198	.	CGGGGG	CGGGG	14.87	.	AC=5;AF1=1;AN=6;CI95=0.5,1;DP4=2,0,10,0;DP=12;FQ=-43.5;G3=1.373e-19,5.886e-08,1;INDEL;MQ=24;PV4=1,0.44,1,0.019;SF=1,4,5	GT:GQ:PL	.	1/1:72:56,9,0	.	.	1/1:70:57,10,0	1/1:44:48,0,42
+Y	13312608	.	CA	CAA	22.50	.	AC=1;AF1=0.5032;AN=2;CI95=0.5,0.5;DP4=2,0,7,0;DP=16;FQ=-15.6;G3=4.937e-25,1,1.272e-08;INDEL;MQ=24;PV4=1,1,0.093,1;SF=2	GT:GQ:PL	.	.	0/0:22:60,0,19	.	.	.
+Y	13402810	.	TAGAGA	TAGA	29.80	.	AC=4;AF1=1;AN=4;CI95=0.5,1;DP4=0,0,1,1;DP=2;FQ=-40.5;G3=7.299e-19,8.564e-07,1;INDEL;MQ=33;SF=0,2	GT:GQ:PL	1/1:61:66,6,0	.	1/1:72:72,9,0	.	.	.
+Y	21153016	.	AG	ATG	213.83	.	AC=12;AF1=1;AN=12;CI95=1,1;DP4=0,0,6,9;DP=15;FQ=-79.5;G3=7.905e-54,1e-18,1;INDEL;MQ=43;SF=0,1,2,3,4,5	GT:GQ:PL	1/1:99:255,45,0	1/1:99:.,.,0	1/1:99:255,87,0	1/1:99:.,.,0	1/1:99:255,78,0	1/1:99:.,.,0
+Y	21153067	.	CCA	C	46.50	.	AC=1;AF1=0.5;AN=2;CI95=0.5,0.5;DP4=8,4,5,0;DP=18;FQ=49.5;G3=7.924e-18,1,5e-52;INDEL;MQ=39;PV4=0.26,0.08,0.035,1;SF=3	GT:GQ:PL	.	.	.	0/0:87:84,0,255	.	.
+Y	26325233	.	TGAGAGAGAGAGA	TGAGAGAGAGA	22.20	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,2,0;DP=2;FQ=-40.5;G3=2.308e-18,8.564e-07,1;INDEL;MQ=33;SF=0	GT:GQ:PL	1/1:61:61,6,0	.	.	.	.	.
+Y	28588049	.	ACATCAT	ACAT	7.35	.	AC=4;AF1=1;AN=4;CI95=0.5,1;DP4=0,0,1,0;DP=1;FQ=-37.5;G3=1.108e-15,5.288e-06,1;INDEL;MQ=44;SF=1,3	GT:GQ:PL	.	1/1:53:44,3,0	.	1/1:53:44,3,0	.	.
+Y	59030478	.	AAAACAAACAAACAAACAAACAAACAAA	AAAACAAACAAACAAA	14.40	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,0,2;DP=2;FQ=-40.5;G3=1.456e-17,8.564e-07,1;INDEL;MQ=29;SF=2	GT:GQ:PL	.	.	1/1:61:53,6,0	.	.	.
+Y	59032947	.	GTT	GTTT	28.20	.	AC=2;AF1=1;AN=2;CI95=0.5,1;DP4=0,0,0,2;DP=2;FQ=-40.5;G3=5.798e-19,8.564e-07,1;INDEL;MQ=37;SF=5	GT:GQ:PL	.	.	.	.	.	1/1:61:67,6,0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/snpeff_annotations.loc.sample	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,5 @@
+## Regulation Databases for SnpEff 
+## These are from the list on: http://snpeff.sourceforge.net/download.html
+#genome	annotation_name description
+#GRCh37.71	nextprot	nextprot
+#GRCh37.71	motif	motif
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/snpeff_databases.loc.sample	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,5 @@
+## Available Databases for SnpEff 
+## These are from the list on: http://snpeff.sourceforge.net/download.html
+## the Description field in this sample is "Genome : Version" 
+#Version	Description
+#GRCh37.68	Homo sapiens : GRCh37.68
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/snpeff_genomedb.loc.sample	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,5 @@
+## Downloaded Databases for SnpEff 
+## These are from the list on: http://snpeff.sourceforge.net/download.html
+## the Description field in this sample is "Genome : Version" 
+#Version        Description	data_dir path
+#GRCh37.68      Homo sapiens : GRCh37.68	/home/galaxy/snpEff/data
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/snpeff_regulationdb.loc.sample	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,4 @@
+## Regulation Databases for SnpEff 
+## These are from the list on: http://snpeff.sourceforge.net/download.html
+#genome	regulation_name description
+#GRCh37.70	CD4	CD4
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,19 @@
+<tables>
+    <table name="snpeff_databases" comment_char="#">
+        <columns>value, name</columns>
+        <file path="tool-data/snpeff_databases.loc" />
+    </table>
+    <table name="snpeff_genomedb" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/snpeff_genomedb.loc" />
+    </table>
+    <table name="snpeff_regulationdb" comment_char="#">
+        <columns>genome, value, name</columns>
+        <file path="tool-data/snpeff_regulationdb.loc" />
+    </table>
+    <table name="snpeff_annotations" comment_char="#">
+        <columns>genome, value, name</columns>
+        <file path="tool-data/snpeff_annotations.loc" />
+    </table>
+</tables>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Fri Aug 15 06:00:47 2014 -0400
@@ -0,0 +1,6 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="snpEff" version="3.6">
+        <repository changeset_revision="d782e523a77b" name="package_snpeff_3_6" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+    </package>
+</tool_dependency>