Mercurial > repos > iuc > meme_fimo

changeset 5:6f4ba26d4659 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author iuc
date Wed, 29 Jun 2016 08:33:34 -0400
parents e5e9a09ac2de
children 3357222bd843
files meme.xml test-data/meme_input_1.fasta test-data/prior30.plib
diffstat 3 files changed, 0 insertions(+), 676 deletions(-) [+]
line wrap: on
line diff
--- a/meme.xml	Wed Jun 29 08:26:51 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,335 +0,0 @@
-<tool id="meme_meme" name="MEME" version="4.11.0.1">
-    <description>- Multiple Em for Motif Elicitation</description>
-    <requirements>
-        <requirement type="package" version="6.9.3">imagemagick</requirement>
-        <requirement type="package" version="4.11.0">meme</requirement>
-    </requirements>
-    <command>
-        <![CDATA[
-            meme "$input1"
-            -o "${html_outfile.files_path}"
-            -nostatus
-            -maxsize 1000000
-            #if str( $options_type.options_type_selector ) == 'advanced':
-                -sf "${ str( $options_type.sf ).replace( ' ', '_' ) }"
-                -${options_type.alphabet_type.alphabet_type_selector}
-                -mod "${options_type.mod_type.mod_type_selector}"
-                -nmotifs "${options_type.nmotifs}"
-                -wnsites "${options_type.wnsites}"
-                #if $options_type.evt < float('inf'):
-                    -evt "${options_type.evt}"
-                #end if
-                #if str( $options_type.mod_type.mod_type_selector ) != 'oops':
-                    #if str( $options_type.mod_type.motif_occurrence_type.motif_occurrence_type_selector ) == 'nsites':
-                        -nsites "${options_type.mod_type.motif_occurrence_type.nsites}"
-                    #elif str( $options_type.mod_type.motif_occurrence_type.motif_occurrence_type_selector ) == 'min_max_sites':
-                        -minsites "${options_type.mod_type.motif_occurrence_type.minsites}"
-                        -maxsites "${options_type.mod_type.motif_occurrence_type.maxsites}"
-                    #end if
-                #end if
-                #if str( $options_type.motif_width_type.motif_width_type_selector ) == 'exact':
-                    -w "${options_type.motif_width_type.width}"
-                #else
-                    -minw "${options_type.motif_width_type.minw}"
-                    -maxw "${options_type.motif_width_type.maxw}"
-                #end if
-                #if str( $options_type.motif_trim_type.motif_trim_type_selector ) == 'nomatrim':
-                    -nomatrim
-                #else
-                    -wg "${options_type.motif_trim_type.wg}"
-                    -ws "${options_type.motif_trim_type.ws}"
-                    ${options_type.motif_trim_type.noendgaps}
-                #end if
-                #if str( $options_type.bfile ) != 'None':
-                    -bfile "${options_type.bfile}"
-                #end if
-                #if str( $options_type.pspfile ) != 'None':
-                    -psp "${options_type.pspfile}"
-                #end if
-                #if str( $options_type.alphabet_type.alphabet_type_selector ) == "dna":
-                    ${options_type.alphabet_type.revcomp} ${options_type.alphabet_type.pal}
-                #end if
-                -maxiter "${options_type.maxiter}"
-                -distance "${options_type.distance}"
-                -prior "${options_type.alphabet_type.prior_type.prior_type_selector}"
-                #if str( $options_type.alphabet_type.prior_type.prior_type_selector ) != 'addone':
-                    -b "${options_type.alphabet_type.prior_type.prior_b}"
-                    #if str( $options_type.alphabet_type.prior_type.plib ) != 'None':
-                        -plib "${options_type.alphabet_type.prior_type.plib}"
-                    #end if
-                #end if
-                #if str( $options_type.alphabet_type.spmap_type.spmap_type_selector ) == 'cons':
-                    -cons "${options_type.alphabet_type.spmap_type.cons}"
-                #else
-                    -spmap "${options_type.alphabet_type.spmap_type.spmap_type_selector}"
-                    -spfuzz "${options_type.alphabet_type.spmap_type.spfuzz}"
-                #end if
-                #if str( $options_type.branching_type.branching_type_selector ) == 'x_branch':
-                    -x_branch
-                    -bfactor "${options_type.branching_type.bfactor}"
-                    -heapsize "${options_type.branching_type.heapsize}"
-                #end if
-            #end if
-            2>&1 || echo "Error running MEME."
-            && mv ${html_outfile.files_path}/meme.html ${html_outfile}
-            && mv ${html_outfile.files_path}/meme.txt ${txt_outfile}
-            && mv ${html_outfile.files_path}/meme.xml ${xml_outfile}
-        ]]>
-    </command>
-    <inputs>
-        <param format="fasta" name="input1" type="data" label="Sequences"/>
-        <conditional name="options_type">
-            <param name="options_type_selector" type="select" label="Options Configuration">
-                <option value="basic" selected="true">Basic</option>
-                <option value="advanced">Advanced</option>
-            </param>
-            <when value="basic" />
-            <when value="advanced">
-                <param name="sf" type="text" value="Galaxy FASTA Input" label="Name of sequence set" argument="-sf"/>
-                <conditional name="alphabet_type">
-                    <param name="alphabet_type_selector" type="select" label="Sequence Alphabet">
-                        <option value="protein">Protein</option>
-                        <option value="dna" selected="true">DNA</option>
-                    </param>
-                    <when value="protein">
-                        <conditional name="prior_type">
-                            <param name="prior_type_selector" type="select" label="Choice of prior" argument="-prior">
-                                <option value="dirichlet">simple Dirichlet prior</option>
-                                <option value="dmix" selected="true">mixture of Dirichlets prior</option>
-                                <option value="mega">extremely low variance dmix</option>
-                                <option value="megap">mega for all but last iteration of EM; dmix on last iteration</option>
-                                <option value="addone">add +1 to each observed count</option>
-                            </param>
-                            <when value="dirichlet">
-                                <param name="prior_b" type="float" value="0.01" label="strength of prior on model parameters" argument="-b"/>
-                                <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" argument="-plib"/>
-                            </when>
-                            <when value="dmix">
-                                <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" argument="-b"/>
-                                <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" argument="-plib"/>
-                            </when>
-                            <when value="mega">
-                                <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" argument="-b"/>
-                                <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" argument="-plib"/>
-                            </when>
-                            <when value="megap">
-                                <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" argument="-b"/>
-                                <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" argument="-plib"/>
-                            </when>
-                            <when value="addone" />
-                        </conditional>
-                        <conditional name="spmap_type">
-                            <param name="spmap_type_selector" type="select" label="EM starting points" argument="-spmap">
-                                <option value="uni">uni</option>
-                                <option value="pam" selected="true">pam</option>
-                                <option value="cons">Use starting point from string</option>
-                            </param>
-                            <when value="uni">
-                                <param name="spfuzz" type="float" value="0.5" label="Fuzziness of the mapping" argument="-spfuzz"/>
-                            </when>
-                            <when value="pam">
-                                <param name="spfuzz" type="integer" value="120" label="Fuzziness of the mapping" argument="-spfuzz"/>
-                            </when>
-                            <when value="cons">
-                                <param name="cons" type="text" value="" label="Starting point from string" argument="-cons"/>
-                            </when>
-                        </conditional>
-                    </when>
-                    <when value="dna">
-                        <param name="revcomp" label="Check reverse complement" type="boolean" truevalue="-revcomp" falsevalue="" checked="False"/>
-                        <param name="pal" label="Check for palindromes" type="boolean" truevalue="-pal" falsevalue="" checked="False"/>
-                        <conditional name="prior_type">
-                            <param name="prior_type_selector" type="select" label="Sequence Alphabet" argument="-prior">
-                                <option value="dirichlet" selected="true">simple Dirichlet prior</option>
-                                <option value="dmix">mixture of Dirichlets prior</option>
-                                <option value="mega">extremely low variance dmix</option>
-                                <option value="megap">mega for all but last iteration of EM; dmix on last iteration</option>
-                                <option value="addone">add +1 to each observed count</option>
-                            </param>
-                            <when value="dirichlet">
-                                <param name="prior_b" type="float" value="0.01" label="strength of prior on model parameters" argument="-b"/>
-                                <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" argument="-plib"/>
-                            </when>
-                            <when value="dmix">
-                                <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" argument="-b"/>
-                                <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" argument="-plib"/>
-                            </when>
-                            <when value="mega">
-                                <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" argument="-b"/>
-                                <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" argument="-plib"/>
-                            </when>
-                            <when value="megap">
-                                <param name="prior_b" type="float" value="0" label="strength of prior on model parameters" argument="-b"/>
-                                <param name="plib" type="data" format="txt" optional="True" label="Dirichlet prior file" argument="-plib"/>
-                            </when>
-                            <when value="addone" />
-                        </conditional>
-                        <conditional name="spmap_type">
-                            <param name="spmap_type_selector" type="select" label="EM starting points" argument="-spmap">
-                                <option value="uni" selected="true">uni</option>
-                                <option value="pam">pam</option>
-                                <option value="cons">Use starting point from string</option>
-                            </param>
-                            <when value="uni">
-                                <param name="spfuzz" type="float" value="0.5" label="Fuzziness of the mapping" argument="-spfuzz"/>
-                            </when>
-                            <when value="pam">
-                                <param name="spfuzz" type="integer" value="120" label="Fuzziness of the mapping" argument="-spfuzz"/>
-                            </when>
-                            <when value="cons">
-                                <param name="cons" type="text" value="" label="Starting point from string" argument="-cons"/>
-                            </when>
-                        </conditional>
-                    </when>
-                </conditional>
-                <param name="nmotifs" type="integer" value="1" label="Number of different motifs to search" argument="-nmotifs" />
-                <param name="evt" type="float" value="inf" label="E-value to stop looking for motifs" argument="-evt"/>
-                <conditional name="mod_type">
-                    <param name="mod_type_selector" type="select" label="Expected motif distribution" argument="-mod">
-                        <option value="oops">One Occurrence Per Sequence</option>
-                        <option value="zoops" selected="true">Zero or One Occurrence Per Sequence</option>
-                        <option value="anr">Any Number of Repetitions</option>
-                    </param>
-                    <when value="oops" />
-                    <when value="zoops">
-                        <conditional name="motif_occurrence_type">
-                            <param name="motif_occurrence_type_selector" type="select" label="Number of motif occurrences">
-                                <option value="default" selected="true">Use defaults</option>
-                                <option value="nsites">nsites</option>
-                                <option value="min_max_sites">min and max sites</option>
-                            </param>
-                            <when value="default" />
-                            <when value="nsites">
-                                <param name="nsites" type="integer" value="1" label="Search nsites number of occurrences" argument="-nsites"/>
-                            </when>
-                            <when value="min_max_sites">
-                                <param name="minsites" type="integer" value="1" label="minsites" argument="-minsites"/>
-                                <param name="maxsites" type="integer" value="50" label="maxsites" argument="-maxsites"/>
-                            </when>
-                        </conditional>
-                    </when>
-                    <when value="anr">
-                        <conditional name="motif_occurrence_type">
-                            <param name="motif_occurrence_type_selector" type="select" label="Number of motif occurrences">
-                                <option value="default" selected="true">Use defaults</option>
-                                <option value="nsites">nsites</option>
-                                <option value="min_max_sites">min and max sites</option>
-                            </param>
-                            <when value="default" />
-                            <when value="nsites">
-                                <param name="nsites" type="integer" value="1" label="Search nsites number of occurrences" argument="-nsites"/>
-                            </when>
-                            <when value="min_max_sites">
-                                <param name="minsites" type="integer" value="1" label="minsites" argument="-minsites"/>
-                                <param name="maxsites" type="integer" value="50" label="maxsites" argument="-maxsites"/>
-                            </when>
-                        </conditional>
-                    </when>
-                </conditional>
-                <param name="wnsites" type="float" value="0.8" label="Weight on the prior on nsites" argument="-wnsites"/>
-                <conditional name="motif_width_type">
-                    <param name="motif_width_type_selector" type="select" label="Motif width type">
-                        <option value="exact">Exact width</option>
-                        <option value="range" selected="true">Specify a range</option>
-                    </param>
-                    <when value="exact">
-                        <param name="width" type="integer" value="10" label="Width of motif to search" argument="-w"/>
-                    </when>
-                    <when value="range">
-                        <param name="minw" type="integer" value="8" label="Min width of motif to search" argument="-minw"/>
-                        <param name="maxw" type="integer" value="50" label="Max width of motif to search" argument="-maxw"/>
-                    </when>
-                </conditional>
-                <conditional name="motif_trim_type">
-                    <param name="motif_trim_type_selector" type="select" label="Motif trim type">
-                        <option value="nomatrim">No motif trim</option>
-                        <option value="trim" selected="true">Trim motif</option>
-                    </param>
-                    <when value="nomatrim" />
-                    <when value="trim">
-                        <param name="wg" type="integer" value="11" label="Gap cost" argument="-wg"/>
-                        <param name="ws" type="integer" value="1" label="Space cost" argument="-ws"/>
-                        <param name="noendgaps" label="Do not penalize endgaps" type="boolean" truevalue="-noendgaps" falsevalue="" checked="False"/>
-                    </when>
-                </conditional>
-                <param name="bfile" type="data" format="txt" optional="True" label="Background Model" argument="-bfile"/>
-                <param name="pspfile" type="data" format="txt" optional="True" label="Position-Specific Prior" argument="-psp"/>
-                <param name="maxiter" type="integer" value="50" label="Number of iterations of EM to run" argument="-maxiter"/>
-                <param name="distance" type="float" value="0.001" label="Convergence criterion" argument="-distance"/>
-                <conditional name="branching_type">
-                    <param name="branching_type_selector" type="select" label="x-branching type">
-                        <option value="x_branch">Perform x-branching</option>
-                        <option value="no_x_branch" selected="true">No x-branching</option>
-                    </param>
-                    <when value="no_x_branch" />
-                    <when value="x_branch">
-                        <param name="bfactor" type="integer" value="3" label="Number of iterations of branching" argument="-bfactor"/>
-                        <param name="heapsize" type="integer" value="64" label="Maximum number of heaps to use" argument="-heapsize"/>
-                    </when>
-                </conditional>
-            </when>
-        </conditional>
-        <param name="non_commercial_use" label="I certify that I am not using this tool for commercial purposes." type="boolean" truevalue="NON_COMMERCIAL_USE" falsevalue="COMMERCIAL_USE" checked="False">
-            <validator type="expression" message="This tool is only available for non-commercial use.">value == True</validator>
-        </param>
-    </inputs>
-    <outputs>
-        <data format="html" name="html_outfile" label="${tool.name} on ${on_string} (html)"/>
-        <data format="txt" name="txt_outfile" label="${tool.name} on ${on_string} (text)"/>
-        <data format="memexml" name="xml_outfile" label="${tool.name} on ${on_string} (xml)"/>
-    </outputs>
-    <tests>
-        <test>
-            <param name="input1" value="meme_input_1.fasta" ftype="fasta" dbkey="hg19"/>
-            <param name="options_type_selector" value="basic"/>
-            <param name="non_commercial_use" value="True"/>
-            <output name="html_outfile" file="meme_output_html_1.html" compare="contains"/>
-            <output name="txt_outfile" file="meme_output_txt_1.txt" lines_diff="12"/>
-            <output name="xml_outfile" file="meme_output_xml_1.xml" lines_diff="8"/>
-        </test>
-        <test>
-            <param name="input1" value="meme_input_1.fasta" ftype="fasta" dbkey="hg19"/>
-            <param name="options_type_selector" value="advanced"/>
-            <param name="plib" value="prior30.plib" ftype="txt"/>
-            <param name="non_commercial_use" value="True"/>
-            <output name="html_outfile" file="meme_output_html_2.html" compare="contains"/>
-            <output name="txt_outfile" file="meme_output_txt_2.txt" lines_diff="12"/>
-            <output name="xml_outfile" file="meme_output_xml_2.xml" lines_diff="8"/>
-        </test>
-    </tests>
-    <help>
-
-.. class:: warningmark
-
-**WARNING: This tool is only available for non-commercial use. Use for educational, research and non-profit purposes is permitted.
-Before using, be sure to review, agree, and comply with the license.**
-
-If you want to specify sequence weights, you must include them at the top of your input FASTA file.
-
-MEME discovers novel, ungapped motifs (recurring, fixed-length patterns) in your sequences (sample output from sequences).
-MEME splits variable-length patterns into two or more separate motifs.  A motif is a sequence pattern that occurs repeatedly
-in a group of related sequences.  MEME represents motifs as position-dependent letter-probability matrices which describe the
-probability of each possible letter at each position in the pattern.  Individual MEME motifs do not contain gaps.  Patterns
-with variable-length gaps are split by MEME into two or more separate motifs.  MEME takes as input a group of sequences and
-outputs as many motifs as requested.  MEME uses statistical modeling techniques to automatically choose the best width, number
-of occurrences, and description for each motif.
-
-.. class:: infomark
-
-For detailed information on MEME, click here_, or view the license_.
-
-.. _here: http://meme-suite.org/doc/meme.html?man_type=web
-.. _license: http://meme-suite.org/doc/copyright.html?man_type=web
-
-    </help>
-    <citations>
-        <citation type="bibtex">
-            @article{Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California,
-            author = {Bailey,Timothy L. and Elkan, Charles},
-            title = {Fitting a mixture model by expectation maximization to discover motifs in biopolymers},
-            year = {1994},
-            eprint = {None},
-            url = {http://www.sdsc.edu/~tbailey/papers/ismb94.pdf}
-        }</citation>
-    </citations>
-</tool>
--- a/test-data/meme_input_1.fasta	Wed Jun 29 08:26:51 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,66 +0,0 @@
->chr21_19617074_19617124_+
-AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA
->chr21_26934381_26934431_+
-GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT
->chr21_28217753_28217803_-
-CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA
->chr21_31710037_31710087_-
-AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT
->chr21_31744582_31744632_-
-CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA
->chr21_31768316_31768366_+
-AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT
->chr21_31914206_31914256_-
-TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC
->chr21_31933633_31933683_-
-TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT
->chr21_31962741_31962791_-
-ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA
->chr21_31964683_31964733_+
-TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC
->chr21_31973364_31973414_+
-aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC
->chr21_31992870_31992920_+
-CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT
->chr21_32185595_32185645_-
-TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA
->chr21_32202076_32202126_-
-TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT
->chr21_32253899_32253949_-
-AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC
->chr21_32410820_32410870_-
-TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG
->chr21_36411748_36411798_-
-ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt
->chr21_37838750_37838800_-
-gatggttttataaggggcctcaccctcggctcagccctcattcttctcct
->chr21_45705687_45705737_+
-CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC
->chr21_45971413_45971463_-
-CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca
->chr21_45978668_45978718_-
-CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca
->chr21_45993530_45993580_+
-CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC
->chr21_46020421_46020471_+
-GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc
->chr21_46031920_46031970_+
-GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC
->chr21_46046964_46047014_+
-ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca
->chr21_46057197_46057247_+
-ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC
->chr21_46086869_46086919_-
-GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC
->chr21_46102103_46102153_-
-AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT
->chr21_47517957_47518007_+
-CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
->chr21_47517957_47518007_+
-CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
->chr21_47517957_47518007_+
-CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
->chr21_47575506_47575556_-
-TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
->chr21_47575506_47575556_-
-TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
--- a/test-data/prior30.plib	Wed Jun 29 08:26:51 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,275 +0,0 @@
-Alphabet= ACDEFGHIKLMNPQRSTVWY
-NumDistr= 30
-Number= 0
-Mixture= 0.055795
-B= 5.623820
-Alpha= 0.0855491 0.0221831 0.0111063 0.0209959 0.0505726 0.025437 0.0155389 0.132951 0.0247865 0.150287 0.0577239 0.0209317 0.0166629 0.0220905 0.0244295 0.0497608 0.070277 0.157532 0.0102219 0.0309633 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=    HMM9.4 reestimated in henikoff29.2
-
-Number= 1
-Mixture= 0.198333
-B= 0.097240
-Alpha= 0.0562629 0.0329597 0.0692513 0.0385232 0.0400041 0.143573 0.0428939 0.0226244 0.0442102 0.0665467 0.0117853 0.0447655 0.0833299 0.0395825 0.0611271 0.0588852 0.0513472 0.0317153 0.0237865 0.0368161 
-FullUpdate= 1
-QUpdate= 1
-StructID=       24
-Comment=      Outside
-
-Number= 2
-Mixture= 0.043566
-B= 1.648336
-Alpha= 0.0144564 0.00845337 0.00785519 0.00864933 0.255959 0.0110815 0.0509526 0.0234533 0.0120443 0.0561967 0.015111 0.0190974 0.00857653 0.0167812 0.0164918 0.0197108 0.0151013 0.0252782 0.050139 0.364613 
-FullUpdate= 1
-QUpdate= 1
-StructID=       26
-Comment=       Inside
-
-Number= 3
-Mixture= 0.060170
-B= 2.595432
-Alpha= 0.0452144 0.00587917 0.169731 0.0751478 0.00749471 0.0845832 0.0369819 0.00610072 0.0548186 0.011029 0.00382749 0.212785 0.0206532 0.0416705 0.0280716 0.117267 0.0533742 0.00943157 0.00216149 0.0137784 
-FullUpdate= 1
-QUpdate= 1
-StructID=       19
-Comment=      Outside Alpha
-
-Number= 4
-Mixture= 0.065466
-B= 3.112271
-Alpha= 0.0361167 0.0049157 0.0134924 0.0461325 0.00557631 0.0209043 0.0302551 0.016425 0.307554 0.0338255 0.0139435 0.0360733 0.0127659 0.0873761 0.222668 0.0369042 0.0354442 0.0228891 0.00434827 0.0123906 
-FullUpdate= 1
-QUpdate= 1
-StructID=       21
-Comment=       Outside Beta
-
-Number= 5
-Mixture= 0.067614
-B= 2.053644
-Alpha= 0.0194362 0.00765176 0.00188738 0.00372898 0.0849894 0.00421787 0.00400459 0.152735 0.00407958 0.4568 0.106051 0.00304386 0.00545956 0.00900935 0.00605071 0.00519029 0.016255 0.0861045 0.00787965 0.0154248 
-FullUpdate= 1
-QUpdate= 1
-StructID=       22
-Comment=      Inside alpha
-
-Number= 6
-Mixture= 0.080724
-B= 2.138987
-Alpha= 0.0423172 0.0153891 0.00409306 0.00565735 0.0197117 0.00590607 0.00139926 0.307863 0.00544884 0.115721 0.0285808 0.00522771 0.00474851 0.00328193 0.00351054 0.00892385 0.0348922 0.380003 0.00117673 0.00614917 
-FullUpdate= 1
-QUpdate= 1
-StructID=       23
-Comment=       Inside beta
-
-Number= 7
-Mixture= 0.051030
-B= 3.878926
-Alpha= 0.0548123 0.000759746 0.144127 0.46019 0.00249502 0.0192754 0.0106535 0.00938765 0.0562429 0.0163148 0.00717389 0.0245612 0.0177482 0.0744802 0.0199233 0.0323535 0.0257651 0.018574 0.00087086 0.00429088 
-FullUpdate= 1
-QUpdate= 1
-StructID=       23
-Comment=      Alpha helix
-
-Number= 8
-Mixture= 0.103529
-B= 1.486325
-Alpha= 0.315754 0.0384546 0.0116388 0.0133665 0.0111126 0.107921 0.00752325 0.0154885 0.0111281 0.0231087 0.011626 0.0228375 0.0304785 0.0166632 0.0156345 0.186379 0.0954421 0.0546691 0.00351538 0.00725682 
-FullUpdate= 1
-QUpdate= 1
-StructID=       23
-Comment=      Beta strand
-
-Number= 9
-Mixture= 0.062940
-B= 8.221215
-Alpha= 0.0869919 0.00672577 0.0600995 0.10763 0.0153489 0.0378086 0.0325335 0.023388 0.113765 0.041623 0.0196906 0.0625344 0.0262599 0.0788667 0.0707399 0.0886634 0.0666777 0.0361472 0.00484308 0.0196629 
-FullUpdate= 1
-QUpdate= 1
-StructID=       23
-Comment=      Other
-
-Number= 10
-Mixture= 0.012518
-B= 38.955631
-Alpha= 0.732922 0.0145131 0.00623235 0.00951423 0.00717778 0.0289521 0.00351664 0.0125081 0.00886593 0.0183651 0.00832812 0.00670968 0.00364556 0.00622169 0.00812899 0.0582399 0.0205067 0.0394327 0.00207485 0.00414489 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      A
-
-Number= 11
-Mixture= 0.004953
-B= 381.562195
-Alpha= 0.00563239 0.959814 0.00144129 0.00213042 0.00158645 0.00168393 0.000989765 0.00325263 0.00148501 0.00343924 0.00168673 0.00159054 0.00121534 0.00129942 0.00195209 0.00296106 0.0039912 0.00266944 0.000327808 0.000851203 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      C
-
-Number= 12
-Mixture= 0.013849
-B= 90.727570
-Alpha= 0.00897115 0.00169015 0.859473 0.0360829 0.00269485 0.00606504 0.00469816 0.00400134 0.0047981 0.00514968 0.00208395 0.029754 0.00241276 0.0045506 0.00433816 0.0088208 0.00511143 0.00527448 0.00104469 0.00298475 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     D 
-
-Number= 13
-Mixture= 0.008388
-B= 404.591034
-Alpha= 0.00241514 0.000413991 0.0122981 0.96369 0.000665578 0.00187461 0.00106904 0.00149214 0.00121548 0.00129791 0.000554145 0.00253496 0.000624495 0.00316839 0.00115045 0.00171781 0.001468 0.0014564 0.000278652 0.000614791 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      E 
-
-Number= 14
-Mixture= 0.008064
-B= 83.323669
-Alpha= 0.00839779 0.00428348 0.00298116 0.00358128 0.850936 0.00329382 0.00196832 0.0130534 0.00320345 0.0351883 0.00729724 0.00287304 0.00358482 0.00218728 0.00264753 0.00833798 0.00418729 0.0120684 0.00448366 0.025446 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     F 
-
-Number= 15
-Mixture= 0.032205
-B= 32.644871
-Alpha= 0.0234448 0.00236512 0.0112957 0.00811395 0.00248143 0.868718 0.00345598 0.00342985 0.00859682 0.0040966 0.00239339 0.012342 0.00423123 0.00440054 0.00795347 0.0165095 0.0065024 0.00550512 0.00140604 0.00275817 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     G 
-
-Number= 16
-Mixture= 0.005033
-B= 35.520824
-Alpha= 0.0100058 0.00386024 0.0131498 0.0108984 0.0122851 0.00738691 0.722249 0.00521193 0.00686054 0.0150103 0.00673014 0.0367074 0.00625526 0.0429912 0.0234127 0.0187246 0.0128445 0.00837399 0.00390723 0.0331349 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     H 
-
-Number= 17
-Mixture= 0.007454
-B= 101.265472
-Alpha= 0.0106938 0.00267663 0.00404166 0.00466637 0.00838963 0.00372808 0.00182575 0.681615 0.0059102 0.0770333 0.0184335 0.004676 0.0027124 0.00372663 0.00418165 0.00773357 0.0109237 0.140679 0.00140417 0.00494911 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     I 
-
-Number= 18
-Mixture= 0.009400
-B= 150.415985
-Alpha= 0.00688657 0.00169711 0.00222738 0.00346887 0.00115861 0.00302866 0.00209171 0.00400905 0.903944 0.0037747 0.00186061 0.00449531 0.00249618 0.00324487 0.041775 0.00392196 0.00461714 0.00296607 0.000893256 0.00144282 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      K 
-
-Number= 19
-Mixture= 0.017057
-B= 31.896633
-Alpha= 0.0114646 0.00367926 0.00296188 0.00596126 0.0190009 0.00382486 0.00338381 0.0401936 0.00650072 0.790038 0.031659 0.00392791 0.0050046 0.00753591 0.00771818 0.00748621 0.0101555 0.0312597 0.00242405 0.00581952 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     L 
-
-Number= 20
-Mixture= 0.002761
-B= 201.346268
-Alpha= 0.00353933 0.00165628 0.0014931 0.00161065 0.00279831 0.00194259 0.00101868 0.00969101 0.00211316 0.0217036 0.928022 0.00162899 0.0015681 0.0015629 0.00138977 0.00294601 0.00311476 0.00723178 0.00156295 0.00340569 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     M 
-
-Number= 21
-Mixture= 0.005734
-B= 108.343185
-Alpha= 0.0067512 0.00239062 0.0140378 0.0043452 0.00365788 0.00689345 0.0148828 0.00715373 0.00789036 0.00614036 0.00289697 0.858995 0.00399721 0.00770961 0.00570515 0.0238176 0.011602 0.00591549 0.00167893 0.00353897 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     N 
-
-Number= 22
-Mixture= 0.022818
-B= 15.153304
-Alpha= 0.0417987 0.00360232 0.0113792 0.0152366 0.00564775 0.0123795 0.00606957 0.0091353 0.0165122 0.0167265 0.00490487 0.00915437 0.755604 0.0131375 0.012587 0.0283392 0.0189623 0.0140029 0.0012848 0.00353553 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     P 
-
-Number= 23
-Mixture= 0.005931
-B= 79.417511
-Alpha= 0.0142993 0.00266984 0.0053289 0.0321605 0.0028715 0.00426743 0.0257509 0.00565307 0.0106106 0.0161186 0.00955753 0.0104696 0.00638107 0.807311 0.0149106 0.0111968 0.00889459 0.00681482 0.00206658 0.00266624 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     Q 
-
-Number= 24
-Mixture= 0.011491
-B= 93.103897
-Alpha= 0.00756896 0.00314197 0.00296652 0.00327634 0.00194604 0.00467894 0.00721049 0.00406061 0.0277257 0.00663852 0.00217868 0.00577047 0.00473306 0.00953551 0.889701 0.00650859 0.00506022 0.00294281 0.00205549 0.00230062 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      R 
-
-Number= 25
-Mixture= 0.008219
-B= 47.504795
-Alpha= 0.0284818 0.00697155 0.00749796 0.00604665 0.00515171 0.00954817 0.00380684 0.00637929 0.0104463 0.00908885 0.00471437 0.0194592 0.00711823 0.00611827 0.00979722 0.707416 0.139256 0.00656298 0.0015377 0.00460086 
-FullUpdate= 1
-QUpdate= 1
-StructID=    0
-Comment=     S 
-
-Number= 26
-Mixture= 0.019050
-B= 14.027470
-Alpha= 0.0247201 0.00718027 0.00845584 0.0076239 0.00600101 0.0073401 0.00492149 0.0173757 0.0129878 0.0125773 0.0100452 0.0230424 0.00659406 0.0110314 0.0112037 0.107763 0.690341 0.0249364 0.00193884 0.00392074 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     T 
-
-Number= 27
-Mixture= 0.007047
-B= 76.958153
-Alpha= 0.0447488 0.00734525 0.00576457 0.00805666 0.00714188 0.00593389 0.0041663 0.0688592 0.00714299 0.0255115 0.00800708 0.00501678 0.00632646 0.00492002 0.00812967 0.0100074 0.0240134 0.745035 0.00126243 0.00261056 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     V 
-
-Number= 28
-Mixture= 0.003957
-B= 150.973328
-Alpha= 0.00517343 0.00213336 0.00350645 0.00390297 0.018439 0.0041919 0.0023655 0.00404231 0.00420998 0.0171406 0.00379068 0.00363696 0.00245861 0.00387467 0.00502035 0.00465674 0.00417283 0.00620977 0.888513 0.012561 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     W 
-
-Number= 29
-Mixture= 0.004904
-B= 30.653225
-Alpha= 0.0342049 0.00809912 0.0126852 0.0174701 0.156033 0.0118268 0.0431342 0.0204751 0.0164439 0.0363664 0.0129811 0.0131986 0.0103037 0.0116235 0.0159032 0.0287792 0.0176143 0.024986 0.0131845 0.494687 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     Y 
-
-/* $Header$ */
-/* $Header$ */
-/* $Header$ */