Mercurial > repos > iuc > meme_chip
changeset 7:c321ab02c2a0 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/meme_chip commit 9068afc3812495aaf88c9a2f5a224c634d634742
| author | iuc |
|---|---|
| date | Fri, 20 Apr 2018 09:03:24 -0400 |
| parents | 444093446b0b |
| children | 81c0806236ef |
| files | .shed.yml get_meme_motif_databases.py meme_chip.xml test-data/input1.fasta test-data/output1.html |
| diffstat | 5 files changed, 163 insertions(+), 43 deletions(-) [+] |
line wrap: on
line diff
--- a/.shed.yml Mon Apr 16 13:01:45 2018 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,23 +0,0 @@ -name: meme_chip -owner: iuc -description: | - Performs motif discovery, motif enrichment analysis and clustering on large nucleotide datasets. -homepage_url: http://meme-suite.org/ -long_description: | - MEME-ChIP performs motif discovery, motif enrichment analysis and clustering on large nucleotide datasets. - The MEME Suite supports motif-based analysis of DNA, RNA and protein sequences. It provides motif - discovery algorithms using both probabilistic (MEME) and discrete models (MEME), which have complementary - strengths. It also allows discovery of motifs with arbitrary insertions and deletions (GLAM2). In - addition to motif discovery, the MEME Suite provides tools for scanning sequences for matches to motifs - (FIMO, MAST and GLAM2Scan), scanning for clusters of motifs (MCAST), comparing motifs to known motifs - (Tomtom), finding preferred spacings between motifs (SpaMo), predicting the biological roles of motifs - (GOMo), measuring the positional enrichment of sequences for known motifs (CentriMo), and analyzing - ChIP-seq and other large datasets (MEME-ChIP). The MEME Suite is comprised of a collection of tools - that work together. -auto_tool_repositories: - name_template: "{{ tool_id }}" - description_template: "{{ tool_name }} tool from the meme package" -remote_repository_url: https://github.com/galaxyproject/tools-iuc/tree/master/tools/meme_chip -type: unrestricted -categories: - - ChIP-seq
--- a/get_meme_motif_databases.py Mon Apr 16 13:01:45 2018 -0400 +++ b/get_meme_motif_databases.py Fri Apr 20 09:03:24 2018 -0400 @@ -9,4 +9,3 @@ full_path = os.path.join(file_path, file_name) options.append((file_name, full_path, i == 0)) return options -
--- a/meme_chip.xml Mon Apr 16 13:01:45 2018 -0400 +++ b/meme_chip.xml Fri Apr 20 09:03:24 2018 -0400 @@ -8,7 +8,6 @@ <command detect_errors="exit_code"><![CDATA[ #import os #set primary_output = $os.path.join($output.files_path, "index.html") -#set options_type = $options_type_cond.options_type meme-chip '$input' -noecho #if $control: @@ -16,7 +15,7 @@ #end if $sequence_alphabet -o '$output.files_path' -#if str($options_type)=='advanced': +#if str($options_type_cond.options_type)=='advanced': ## FIXME: CentriMo cannot be run, See the comments in the input section. ## #set run_centrimo = $options_type_cond.run_centrimo_cond.run_centrimo ## #if str($run_centrimo) == "yes": @@ -40,14 +39,11 @@ ## -centrimo-flip ## #end if ## #end if - #if $options_type_cond.search_given_strand: - -norc - #end if + $options_type_cond.search_given_strand -order $options_type_cond.background_model_order #if str($options_type_cond.subsampling_cond.subsampling) == "no": -norand - #set seed = $options_type_cond.subsampling_cond.subsampling.seed - #if $seed: + #if $options_type_cond.subsampling_cond.subsampling.seed: -seed $options_type_cond.subsampling_cond.subsampling.seed #end if #end if @@ -58,13 +54,11 @@ -ccut $options_type_cond.ccut #end if -group-thresh $options_type_cond.group_threash - #if $options_type_cond.group_weak: + #if str($options_type_cond.group_weak): -group-weak $options_type_cond.group_weak #end if -filter-thresh $options_type_cond.filter_thresh - #if $options_type_cond.old_clustering: - -old-clustering - #end if + $options_type_cond.old_clustering -meme-mod $options_type_cond.meme_mod #if $options_type_cond.meme_minw: -meme-minw $options_type_cond.meme_minw @@ -81,9 +75,7 @@ #if $options_type_cond.meme_maxsites: -meme-maxsites $options_type_cond.meme_maxsites #end if - #if $options_type_cond.meme_pal: - -meme-pal - #end if + $options_type_cond.meme_pal -dreme-e $options_type_cond.dreme_e -dreme-m $options_type_cond.dreme_m -spamo-skip @@ -145,14 +137,14 @@ <option value="3">3rd order model of sequences</option> <option value="4">4th order model of sequences</option> </param> - <param name="nmeme" type="integer" optional="true" value="0" min="0" label="Limit of sequences to pass to MEME" help="Zero value has no effect"/> + <param name="nmeme" type="integer" optional="true" value="" min="1" label="Limit of sequences to pass to MEME"/> <conditional name="subsampling_cond"> <param name="subsampling" type="select" label="Should subsampling be random?" help="Select 'No' if your input sequences are sorted in order of confidence (best to worst)"> <option value="yes" selected="true">Yes</option> <option value="no">No</option> </param> <when value="yes"> - <param name="seed" type="integer" optional="true" value="0" min="0" label="Seed for the randomized selection of sequences" help="Zero value indicates random seeding"/> + <param name="seed" type="integer" optional="true" value="" min="1" label="Seed for the randomized selection of sequences"/> </when> <when value="no"/> </conditional> @@ -160,8 +152,8 @@ <param name="group_threash" type="float" value="0.05" min="0" label="Primary threshold for clustering motifs" /> <param name="group_weak" type="float" optional="true" value="0" min="0" label="Secondary threshold for clustering motifs" help="Zero value results in 2*primary threshold"/> <param name="filter_thresh" type="float" value="0.05" min="0" label="E-value threshold for including motifs"/> - <param name="search_given_strand" type="boolean" truevalue="true" falsevalue="" checked="False" label="Search given strand only"/> - <param name="old_clustering" type="boolean" truevalue="true" falsevalue="" checked="False" label="Pick cluster seed motifs based only on significance"/> + <param name="search_given_strand" type="boolean" truevalue="-norc" falsevalue="" checked="False" label="Search given strand only"/> + <param argument="-old_clustering" type="boolean" truevalue="-old_clustering" falsevalue="" checked="False" label="Pick cluster seed motifs based only on significance"/> <param name="meme_mod" type="select" label="What is the expected motif site distribution?"> <option value="oops" selected="True">One occurance per sequence</option> <option value="zoops">Zero or one occurances per sequence</option> @@ -172,7 +164,7 @@ <param name="meme_nmotifs" type="integer" optional="true" value="0" min="0" label="Maximum number of motifs to find"/> <param name="meme_minsites" type="integer" optional="true" value="0" min="0" label="Minimum number of sites per motif"/> <param name="meme_maxsites" type="integer" optional="true" value="0" label="Maximum number of sites per motif"/> - <param name="meme_pal" type="boolean" truevalue="true" falsevalue="" checked="False" label="Look for palindromes only"/> + <param argument="-meme_pal" type="boolean" truevalue="-meme-pal" falsevalue="" checked="False" label="Look for palindromes only"/> <param name="dreme_e" type="float" value="0.05" min="0" label="Stop DREME searching after reaching this E-value threshold"/> <param name="dreme_m" type="integer" value="10" min="1" label="Stop DREME searching after finding this many motifs" /> </when>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input1.fasta Fri Apr 20 09:03:24 2018 -0400 @@ -0,0 +1,66 @@ +>chr21_19617074_19617124_+ +AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA +>chr21_26934381_26934431_+ +GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT +>chr21_28217753_28217803_- +CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA +>chr21_31710037_31710087_- +AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT +>chr21_31744582_31744632_- +CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA +>chr21_31768316_31768366_+ +AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT +>chr21_31914206_31914256_- +TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC +>chr21_31933633_31933683_- +TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT +>chr21_31962741_31962791_- +ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA +>chr21_31964683_31964733_+ +TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC +>chr21_31973364_31973414_+ +aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC +>chr21_31992870_31992920_+ +CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT +>chr21_32185595_32185645_- +TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA +>chr21_32202076_32202126_- +TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT +>chr21_32253899_32253949_- +AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC +>chr21_32410820_32410870_- +TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG +>chr21_36411748_36411798_- +ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt +>chr21_37838750_37838800_- +gatggttttataaggggcctcaccctcggctcagccctcattcttctcct +>chr21_45705687_45705737_+ +CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC +>chr21_45971413_45971463_- +CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca +>chr21_45978668_45978718_- +CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca +>chr21_45993530_45993580_+ +CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC +>chr21_46020421_46020471_+ +GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc +>chr21_46031920_46031970_+ +GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC +>chr21_46046964_46047014_+ +ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca +>chr21_46057197_46057247_+ +ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC +>chr21_46086869_46086919_- +GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC +>chr21_46102103_46102153_- +AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/output1.html Fri Apr 20 09:03:24 2018 -0400 @@ -0,0 +1,86 @@ +<!doctype html> +<html> + <head> + <meta charset="UTF-8"> + <title>MEME ChIP</title> + </head> + <body onload="page_loaded()" onpageshow="page_shown(event)" + onresize="page_resize()" onscroll="delayed_process_draw_tasks()"> + <div class="prog_logo big"> + <h1>MEME-ChIP</h1> + <h2>Motif Analysis of Large Nucleotide Datasets</h2> + </div> + <p> + If you use MEME-ChIP in your research, please cite the following paper:<br /> + </p> + <!-- navigation --> + <div class="pad2"> + <a class="jump" href="#data_sec">Motifs</a> + | + <a class="jump" href="#programs_sec">Programs</a> + | + <a class="jump" href="#input_sec">Input Files</a> + | + <a class="jump" href="#info_sec">Program information</a> + </div> + <!-- alert the user when their browser is not up to the task --> + <noscript><h1 style="color:red">Javascript is required to view these results!</h1></noscript> + <h1 id="html5_warning" style="color:red; display:none;">Your browser does not support canvas!</h1> + <script>if (!window.HTMLCanvasElement) $("html5_warning").style.display = "block";</script> + <!-- write out the job description --> + <span id="ins_desc"></span> + <script>make_description($("ins_desc"), data["description"]);</script> + <!-- write out clustered motifs --> + <h2 class="mainh pad2" id="data_sec">Motifs</h2> + <div class="box"> + <p>The significant motifs + (E-value ≤ <span id="ins_filter_thresh"></span>) + found by the programs MEME, DREME and CentriMo; + clustered by similarity and ordered by E-value.</p> + <script>$("ins_filter_thresh").innerHTML = data["filter_thresh"]; </script> + <div class="motifbox"> + <span class="action" onclick="show_all(true)">Expand All Clusters</span> + <span class="action" onclick="show_all(false)">Collapse All Clusters</span> + </div> + <div id="logos"></div> + <script>make_clustered_motifs($("logos"));</script> + </div> + <!-- write out a list of all programs run --> + <h2 class="mainh pad2" id="programs_sec">Programs</h2> + <div class="box" id="program_listing"></div> + <script>make_program_listing($("program_listing"));</script> + <!-- write out input files --> + <h2 id="input_sec" class="mainh pad2">Input Files</h2> + <div id="input_files" class="box"> + <div id="sequence_db"></div> + <script>make_sequence_db_listing('sequence_db', "Primary Sequences");</script> + <div id="neg_sequence_db"></div> + <script>make_sequence_db_listing('neg_sequence_db', "Control Sequences");</script> + <h4 id="motif_dbs_header">Motifs</h4> + <div id="motif_dbs"></div> + <script>make_motif_db_listing($("motif_dbs"));</script> + </div> + <!-- list information on this program --> + <div id="info_sec" class="bar"> + <div class="subsection"> + <h5 id="version">MEME-ChIP version</h5> + <span id="ins_version"></span> + (Release date: <span id="ins_release"></span>)<br> + </div> + <script> + $("ins_version").innerHTML = data["version"]; + $("ins_release").innerHTML = data["release"]; + </script> + <div class="subsection"> + <h5 id="reference">Reference</h5> + <div class="subsection"> + <h5 id="command">Command line summary</h5> + <textarea id="cmd" rows="5" style="width:100%;" readonly="readonly"> + </textarea> + <script>$("cmd").value = data["cmd"].join(" ");</script> + </div> + </div> + </div> + <div id="scrollpad"></div> + </body> +</html>