Mercurial > repos > iuc > amas_concat
view macros.xml @ 0:fb24e1904d08 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/amas commit 158ec0e635067d354c425baf14b95cb616fd93c4
| author | iuc |
|---|---|
| date | Tue, 02 Dec 2025 09:26:01 +0000 |
| parents | |
| children |
line wrap: on
line source
<macros> <token name="@TOOL_VERSION@">1.0</token> <token name="@VERSION_SUFFIX@">0</token> <token name="@PROFILE@">25.0</token> <xml name="requirements"> <requirements> <requirement type="package" version="@TOOL_VERSION@">amas</requirement> </requirements> </xml> <xml name="version_command"> <version_command>python -c "import amas; print(amas.__version__)"</version_command> </xml> <token name="@SNIFF_INPUT_FORMAT@"><![CDATA[ #set $in_format = $input_files[0].ext #if $in_format == 'nex' #set $in_format = 'nexus' #end if ]]></token> <token name="@CHECK_INTERLEAVED@"><![CDATA[ ## Check if inputs are interleaved IN_FORMAT=\$(python '$__tool_directory__/check_interleaved.py' #for $f in $input_files '${f}' #end for --format '${in_format}') && ]]></token> <token name="@SYMLINK_INPUTS@"><![CDATA[ ## Create symlinks with original filename for consistent tests #for $f in $input_files #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) ln -s '${f}' '${safename_input}'; #end for ]]></token> <token name="@INPUT_FILENAMES@"><![CDATA[ #for $f in $input_files #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) '${safename_input}' #end for ]]></token> <xml name="output_format" token_name="out_format" token_label="Format of the output file"> <param name="out_format" type="select" label="@LABEL@"> <option value="fasta">fasta</option> <option value="phylip">phylip (sequential)</option> <option value="phylip-int">phylip (interleaved)</option> <option value="nexus">nexus (sequential)</option> <option value="nexus-int">nexus (interleaved)</option> </param> </xml> <xml name="data_type"> <param name="data_type" type="select" label="Data type"> <option value="aa">Protein alignments</option> <option value="dna">Nucleotide alignments</option> </param> </xml> <xml name="check_align"> <param argument="--check-align" type="boolean" label="Check if input sequences are aligned" checked="false" truevalue="--check-align" falsevalue="" /> </xml> <!-- Galaxy doesn't currently detect whether PHYLIP or NEXUS format is interleaved/sequential; if implemented update here and assoc in subcommands --> <xml name="collection_outputs" token_name="alignments" token_label="alignment files"> <collection name="@NAME@_fasta" type="list" label="${tool.name} on ${on_string}: fasta"> <discover_datasets pattern="(?P<name>.+-out\..+)" format="fasta" /> <filter>out_format == "fasta"</filter> </collection> <collection name="@NAME@_phylip" type="list" label="${tool.name} on ${on_string}: phylip"> <discover_datasets pattern="(?P<name>.+-out\..+)" format="phylip" /> <filter>out_format == "phylip" or out_format == "phylip-int"</filter> </collection> <collection name="@NAME@_nexus" type="list" label="${tool.name} on ${on_string}: nexus"> <discover_datasets pattern="(?P<name>.+-out\..+)" format="nex" /> <filter>out_format == "nexus" or out_format == "nexus-int"</filter> </collection> </xml> <token name="@PARTITIONS_HELP@"><![CDATA[ **What is a partitions file?** The partitions file maps each gene/locus to its position in the concatenated alignment. This is essential for downstream phylogenetic analyses (e.g., RAxML, IQ-TREE) that can apply different evolutionary models to different partitions. **Example:** If you concatenate three genes:: gene1.fasta (500 bp) gene2.fasta (700 bp) gene3.fasta (400 bp) The partitions file (unspecified format) will contain:: gene1 = 1-500 gene2 = 501-1200 gene3 = 1201-1600 **Partition formats:** - **Unspecified** :: gene1 = 1-500 gene2 = 501-1200 - **RAxML** :: DNA, gene1 = 1-500 DNA, gene2 = 501-1200 - **NEXUS** :: #NEXUS Begin sets; charset gene1 = 1-500; charset gene2 = 501-1200; End; ]]></token> <token name="@AMAS_SHARED_HELP@"><![CDATA[ **Sequential vs Interleaved Phylip Format** - **Sequential**: Each complete sequence is written in order, one after another. Easier for programmatic parsing. :: 4 60 Seq1 ATGCATGCATATGCATGCATATGCATGCAT... Seq2 ATGCATGCATATGCATGCATATGCATGCAT... Seq3 ATGCATGCATATGCATGCATATGCATGCAT... Seq4 ATGCATGCATATGCATGCATATGCATGCAT... - **Interleaved**: Sequences are written in aligned blocks, making it easier to visually compare positions across sequences. :: 4 60 Seq1 ATGCATGCATATGCATGCAT Seq2 ATGCATGCATATGCATGCAT Seq3 ATGCATGCATATGCATGCAT Seq4 ATGCATGCATATGCATGCAT Seq1 ATGCATGCAT... Seq2 ATGCATGCAT... Seq3 ATGCATGCAT... Seq4 ATGCATGCAT... **About AMAS** AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. Source code and manual: https://github.com/marekborowiec/AMAS ]]></token> <xml name="citations"> <citations> <citation type="doi">10.7717/peerj.1660</citation> </citations> </xml> </macros>
