Mercurial > repos > drosofff > yac_clipper

comparison yac.xml @ 1:e5ef40107f54 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author mvdbeek
date Mon, 30 Mar 2015 11:40:52 -0400
parents 2445856981a1
children a70911a01f36
comparison
equal deleted inserted replaced
0:2445856981a1 1:e5ef40107f54
1 <tool id="yac" name="Clip adapter" version="1.1.0"> 1 <tool id="yac" name="Clip adapter" version="1.3.3">
2 <description></description> 2 <description />
3 <command interpreter="python">yac.py --input $input 3 <command interpreter="python">yac.py --input $input
4 --output $output 4 --output $output
5 --output_format "$out_format"
5 --adapter_to_clip $clip_source.clip_sequence 6 --adapter_to_clip $clip_source.clip_sequence
6 --min $min 7 --min $min
7 --max $max 8 --max $max
8 --Nmode $Nmode 9 --Nmode $Nmode
9 </command> 10 </command>
10 <inputs> 11 <inputs>
11 <param format="fastq" name="input" type="data" label="Source file"/> 12 <param format="fastq" label="Source file" name="input" type="data" />
12 <param name="min" type="integer" size="4" value="15" label="min size"/> 13 <param label="min size" name="min" size="4" type="integer" value="15" />
13 <param name="max" type="integer" size="4" value="36" label="max size"/> 14 <param label="max size" name="max" size="4" type="integer" value="36" />
14 <param name="Nmode" type="select" label="Accept reads containing N?"> 15 <param label="Select output format" name="out_format" type="select">
15 <option value="accept" selected="True">accept</option> 16 <option selected="true" value="fasta">Fasta format</option>
16 <option value="reject">reject</option> 17 <option value="fastq">Fastq format</option>
17 </param> 18 </param>
18 <conditional name="clip_source"> 19 <param label="Accept reads containing N?" name="Nmode" type="select">
19 <param name="clip_source_list" type="select" label="Source" help="Built-in adapters or User-provided"> 20 <option selected="True" value="accept">accept</option>
20 <option value="prebuilt" selected="True">Use a built-in adapter (select from the list below)</option> 21 <option value="reject">reject</option>
21 <option value="user">Use custom sequence</option> 22 </param>
22 </param> 23 <conditional name="clip_source">
23 <when value="prebuilt"> 24 <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select">
24 <param name="clip_sequence" type="select" label="Select Adapter to clip" help="if your adapter is not listed, input your own sequence"> 25 <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option>
25 <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option> 26 <option value="user">Use custom sequence</option>
26 <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option> 27 </param>
27 <option value="TGGAATTCTCGGGTGCCAAG" selected="True">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option> 28 <when value="prebuilt">
28 <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option> 29 <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select">
29 </param> 30 <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option>
30 </when> 31 <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option>
31 <when value="user"> 32 <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option>
32 <param name="clip_sequence" type="text" size="35" label="Enter your Sequence" value="GAATCC"/> 33 <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option>
33 </when> 34 </param>
34 </conditional> 35 </when>
35 </inputs> 36 <when value="user">
36 <outputs> 37 <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" />
37 <data format="fasta" name="output" metadata="input" /> 38 </when>
38 </outputs> 39 </conditional>
40 </inputs>
41 <outputs>
42 <data format="fasta" metadata="input" name="output" />
43 <change_format>
44 <when format="fastq" input="out_format" value="fastq" />
45 </change_format>
46 </outputs>
47 <tests>
48 <test>
49 <param ftype="fastqsanger" name="input" value="yac.fastq" />
50 <param name="min" value="18" />
51 <param name="max" value="29" />
52 <param name="clip_source_list" value="prebuilt" />
53 <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
54 <param name="Nmode" value="accept" />
55 <output file="yac.out" name="output" />
56 </test>
57 <test>
58 <param ftype="fastqsanger" name="input" value="yac.fastq" />
59 <param name="min" value="18" />
60 <param name="max" value="29" />
61 <param name="clip_source_list" value="prebuilt" />
62 <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
63 <param name="Nmode" value="accept" />
64 <param name="out_format" value="fastq" />
65 <output file="yac_fastq.out" name="output" />
66 </test>
67 </tests>
68 <help>
69 This tool clips adapter sequences from a fastq file and outputs either a
70 fasta or fastq file of clipped reads with renumbered fasta/fastq headers.
39 71
40 <help> 72 By defualt clipped sequences with unknown nucleotides are kept, but
41 <!-- write a decent doc ! --> 73 can be discarded by setting "Accept reads containing N?" to reject.
42 This tool clips adapter sequences from a fastq file and fasta file of clipped reads with renumbered fasta headers.
43
44 Clipped sequences with Ns can be discarded.
45 74
46 Min size and max size filter clipped reads on their size. 75 Min size and max size filter clipped reads on their size.
47 76
48 Note that unclipped reads that satisfy the min and max size conditions are kept. 77 Note that unclipped reads that satisfy the min and max size conditions are kept.
49 </help> 78 </help>
50
51 <!-- write a <test> section -->
52 <tests>
53 <test>
54 <param name="input" value="yac.fastq" ftype="fastqsanger"/>
55 <param name="min" value="18" />
56 <param name="max" value="29" />
57 <param name="clip_source_list" value="prebuilt" />
58 <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
59 <param name="Nmode" value="accept" />
60 <output name="output" file="yac.out" />
61 </test>
62 </tests>
63
64 </tool> 79 </tool>