--- a/yac.xml	Mon Nov 03 09:34:45 2014 -0500
+++ b/yac.xml	Mon Mar 30 11:40:52 2015 -0400
@@ -1,64 +1,79 @@
- <tool id="yac" name="Clip adapter" version="1.1.0">
-  <description></description>
-  <command interpreter="python">yac.py --input $input
+<tool id="yac" name="Clip adapter" version="1.3.3">
+    <description />
+    <command interpreter="python">yac.py --input $input
                                        --output $output
+                                       --output_format "$out_format"
                                        --adapter_to_clip $clip_source.clip_sequence
                                        --min $min
                                        --max $max
                                        --Nmode $Nmode
   </command>
-  <inputs>
-    <param format="fastq" name="input" type="data" label="Source file"/>
-    <param name="min" type="integer" size="4" value="15" label="min size"/>
-    <param name="max" type="integer" size="4" value="36" label="max size"/>
-    <param name="Nmode" type="select" label="Accept reads containing N?">
-        <option value="accept" selected="True">accept</option>
-        <option value="reject">reject</option>
-    </param>
-    <conditional name="clip_source">
-   	 <param name="clip_source_list" type="select" label="Source" help="Built-in adapters or User-provided">
-         	<option value="prebuilt" selected="True">Use a built-in adapter (select from the list below)</option>
-         	<option value="user">Use custom sequence</option>
-         </param>
-         <when value="prebuilt">
-         	<param name="clip_sequence" type="select" label="Select Adapter to clip" help="if your adapter is not listed, input your own sequence">
-                	<option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option>
-                        <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option>
-                        <option value="TGGAATTCTCGGGTGCCAAG" selected="True">Illumina TruSeq  TGGAATTCTCGGGTGCCAAG</option>
-                        <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option>
-		</param>
-	</when>
-        <when value="user">
-		 <param name="clip_sequence" type="text" size="35"  label="Enter your Sequence" value="GAATCC"/>
-	</when>
-    </conditional>
-  </inputs>
-  <outputs>
-    <data format="fasta" name="output"  metadata="input" />
-  </outputs>
+    <inputs>
+        <param format="fastq" label="Source file" name="input" type="data" />
+        <param label="min size" name="min" size="4" type="integer" value="15" />
+        <param label="max size" name="max" size="4" type="integer" value="36" />
+        <param label="Select output format" name="out_format" type="select">
+            <option selected="true" value="fasta">Fasta format</option>
+            <option value="fastq">Fastq format</option>
+        </param>
+        <param label="Accept reads containing N?" name="Nmode" type="select">
+            <option selected="True" value="accept">accept</option>
+            <option value="reject">reject</option>
+        </param>
+        <conditional name="clip_source">
+            <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select">
+                <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option>
+                <option value="user">Use custom sequence</option>
+            </param>
+            <when value="prebuilt">
+                <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select">
+                    <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option>
+                    <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option>
+                    <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq  TGGAATTCTCGGGTGCCAAG</option>
+                    <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option>
+                </param>
+            </when>
+            <when value="user">
+                <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" />
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="fasta" metadata="input" name="output" />
+        <change_format>
+            <when format="fastq" input="out_format" value="fastq" />
+        </change_format>
+    </outputs>
+    <tests>
+        <test>
+            <param ftype="fastqsanger" name="input" value="yac.fastq" />
+            <param name="min" value="18" />
+            <param name="max" value="29" />
+            <param name="clip_source_list" value="prebuilt" />
+            <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
+            <param name="Nmode" value="accept" />
+            <output file="yac.out" name="output" />
+        </test>
+        <test>
+            <param ftype="fastqsanger" name="input" value="yac.fastq" />
+            <param name="min" value="18" />
+            <param name="max" value="29" />
+            <param name="clip_source_list" value="prebuilt" />
+            <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
+            <param name="Nmode" value="accept" />
+            <param name="out_format" value="fastq" />
+            <output file="yac_fastq.out" name="output" />
+        </test>
+    </tests>
+    <help>
+This tool clips adapter sequences from a fastq file and outputs either a
+fasta or fastq file of clipped reads with renumbered fasta/fastq headers.
 
-  <help>
-<!-- write a decent doc ! -->
-This tool clips adapter sequences from a fastq file and fasta file of clipped reads with renumbered fasta headers.
-
-Clipped sequences with Ns can be discarded.
+By defualt clipped sequences with unknown nucleotides are kept, but 
+can be discarded by setting "Accept reads containing N?" to reject.
 
 Min size and max size filter clipped reads on their size.
 
 Note that unclipped reads that satisfy the min and max size conditions are kept.
   </help>
-
-<!-- write a <test> section -->
-	<tests>
-                <test>
-                        <param name="input" value="yac.fastq" ftype="fastqsanger"/>
-                        <param name="min" value="18" />
-                        <param name="max" value="29" />
-                        <param name="clip_source_list" value="prebuilt" />
-                        <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
-                        <param name="Nmode" value="accept" />
-                        <output name="output" file="yac.out" />
-                </test>
-        </tests>
-
 </tool>