Mercurial > repos > drosofff > msp_sr_size_histograms
annotate size_histogram.xml @ 2:9f75d887904d draft
planemo upload for repository https://bitbucket.org/drosofff/gedtools/
| author | mvdbeek |
|---|---|
| date | Sun, 21 Jun 2015 15:59:48 -0400 |
| parents | 6c72cf9a00df |
| children | afe1e306e2a8 |
| rev | line source |
|---|---|
| 0 | 1 <tool id="Size_histogram" name="Generate size histograms from alignment files" version="0.9.5"> |
| 2 <description>from sRbowtie aligment</description> | |
| 3 <requirements> | |
| 4 <requirement type="package" version="0.12.7">bowtie</requirement> | |
| 5 <requirement type="package" version="0.1.18">samtools</requirement> | |
| 6 <requirement type="package" version="0.7.7">pysam</requirement> | |
|
2
9f75d887904d
planemo upload for repository https://bitbucket.org/drosofff/gedtools/
mvdbeek
parents:
1
diff
changeset
|
7 <requirement type="package" version="3.1.2">R</requirement> |
| 0 | 8 <requirement type="package" version="2.14">biocbasics</requirement> |
| 1 | 9 <requirement type="package" version="1.9">numpy</requirement> |
| 0 | 10 </requirements> |
| 11 <command interpreter="python"> | |
| 12 size_histogram.py | |
| 13 #if $refGenomeSource.genomeSource == "history": | |
| 14 --reference_fasta ## sys.argv[2] | |
| 15 $refGenomeSource.ownFile ## index source | |
| 16 #else: | |
| 17 #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] | |
| 18 --reference_bowtie_index | |
| 19 $reference | |
| 20 #end if | |
| 21 --rcode | |
| 22 $plotCode | |
| 23 --output_size_distribution | |
| 24 $size_distribution_dataframe | |
| 25 --minquery | |
| 26 $minquery | |
| 27 --maxquery | |
| 28 $maxquery | |
| 29 --input | |
| 30 #for $i in $refGenomeSource.series | |
| 31 $i.input | |
| 32 #end for | |
| 33 --ext | |
| 34 #for $i in $refGenomeSource.series | |
| 35 $i.input.ext | |
| 36 #end for | |
| 37 --label | |
| 38 #for $i in $refGenomeSource.series | |
| 39 "$i.input.name" | |
| 40 #end for | |
| 41 --normalization_factor | |
| 42 #for $i in $refGenomeSource.series | |
| 43 $i.norm | |
| 44 #end for | |
| 45 #if $gff: | |
| 46 --gff | |
| 47 $gff | |
| 48 #end if | |
| 49 #if $global.value == 'yes': | |
| 50 --global_size | |
| 51 #end if | |
| 52 #if $collapsestrands.value == 'yes': | |
| 53 --collapse | |
| 54 #end if | |
| 55 | |
| 56 </command> | |
| 57 <inputs> | |
| 58 <conditional name="refGenomeSource"> | |
| 59 <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> | |
| 60 <option value="indexed">Use a built-in index</option> | |
| 61 <option value="history">Use one from the history</option> | |
| 62 </param> | |
| 63 <when value="indexed"> | |
| 64 <repeat name="series" title="Add alignment files"> | |
| 65 <param name="input" type="data" label="Select multiple alignments to parse"> | |
| 66 <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> | |
| 67 </param> | |
| 68 <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> | |
| 69 </repeat> | |
| 70 </when> | |
| 71 <when value="history"> | |
| 72 <param name="ownFile" type="data" format="fasta" label="Select a fasta file, to serve as index reference" /> | |
| 73 <repeat name="series" title="Add alignment files"> | |
| 74 <param name="input" type="data" label="Select multiple alignments to parse"/> | |
| 75 <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> | |
| 76 </repeat> | |
| 77 </when> | |
| 78 </conditional> | |
| 79 <param name="gff" type="data" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> | |
| 80 <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> | |
| 81 <param name="global" type="select" label="Generate size distribution for each item, or generate a global alignment"> | |
| 82 <option value="no">for each item</option> | |
| 83 <option value="yes">global</option> | |
| 84 </param> | |
| 85 <param name="collapsestrands" type="select" label="Whether + and - reads should be collapsed or not"> | |
| 86 <option value="no">Do not collapse</option> | |
| 87 <option value="yes">Collapse + and - reads</option> | |
| 88 </param> | |
| 89 <param name="minquery" type="integer" size="3" value="18" label="Min size of reads to plot" help="'15' = 15 nucleotides"/> | |
| 90 <param name="maxquery" type="integer" size="3" value="28" label="Max size of reads to plot" help="'30' = 30 nucleotides"/> | |
| 91 <param name="title" type="text" size="15" value="Size distribution" label="Main Titles"/> | |
| 92 <param name="xlabel" type="text" size="15" value="Size in nucleotides" label="x axis label"/> | |
| 93 <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> | |
| 94 <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> | |
| 95 <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> | |
| 96 </param> | |
| 97 </inputs> | |
| 98 <configfiles> | |
| 99 <configfile name="plotCode"> | |
| 100 ## Setup R error handling to go to stderr | |
| 101 options( show.error.messages=F, | |
| 102 error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) | |
| 103 library(RColorBrewer) | |
| 104 library(lattice) | |
| 105 library(latticeExtra) | |
| 106 library(grid) | |
| 107 library(gridExtra) | |
| 108 | |
| 109 ##cheetahtemplate data frame implementation | |
| 110 size=read.delim("${size_distribution_dataframe}", header=T, row.names=NULL) | |
| 111 n_samples = length(unique (size\$sample)) | |
| 112 n_genes = length (unique (levels(size\$gene))) | |
| 113 | |
| 114 par.settings.size=list(layout.heights=list(top.padding=1, bottom.padding=1), | |
| 115 strip.background = list(col = c("lightblue", "lightgreen")) | |
| 116 ) | |
| 117 | |
| 118 smR.prepanel=function(x,y,...){; yscale=c(-max(abs(y)), max(abs(y)));list(ylim=yscale);} # use if one want y axis in the middle of the plot | |
| 119 | |
| 120 plot_size_distribution= function(df, ...) { | |
| 121 bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample))+gene, data = df, origin = 0, | |
| 122 horizontal=FALSE, | |
| 123 group=polarity, | |
| 124 stack=TRUE, | |
| 125 col=c('red', 'blue'), | |
| 126 cex=0.75, | |
| 127 scales=list(y=list(tick.number=4, rot=90, relation="free", cex=0.5, alternating=T), x=list(cex=.6 ) ), | |
| 128 xlab = "readsize in nucleotides", | |
| 129 ylab = "${ylabel}", | |
| 130 main="${title}" , | |
| 131 par.strip.text = list(cex=0.75), | |
| 132 as.table=TRUE, | |
| 133 newpage = T, | |
| 134 ...) | |
| 135 | |
| 136 combineLimits(update(useOuterStrips(bc, | |
| 137 strip.left = strip.custom(par.strip.text = list(cex=0.5)) | |
| 138 ), | |
| 139 layout=c(n_samples,${rows_per_page})), | |
| 140 margin.x=F, margin.y=1) | |
| 141 } | |
| 142 | |
| 143 # per_gene_size=lapply(genes, function(x) subset(size, gene==x)) # no object in this script | |
| 144 | |
| 145 global = "no" | |
| 146 #if $global.value == 'yes': | |
| 147 global = "yes" | |
| 148 #end if | |
| 149 | |
| 150 if (global=="no") { | |
| 151 | |
| 152 options(warn=-1) | |
| 153 pdf(file="${size_PDF}", paper="special", height=11.69, width=8.2677*n_samples/4) | |
| 154 plot_size_distribution(size, par.settings=par.settings.size) # removed , prepanel=smR.prepanel | |
| 155 | |
| 156 } else { | |
| 157 | |
| 158 pdf(file="${size_PDF}", paper="special", height=11.69, width=8.2677) | |
| 159 bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample)), data = size, origin = 0, | |
| 160 horizontal=FALSE, | |
| 161 group=polarity, | |
| 162 stack=TRUE, | |
| 163 col=c('red', 'blue'), | |
| 164 # par.settings=list(fontsize = list(text=8, points=8)), | |
| 165 scales=list(y=list(tick.number=4, rot=90, relation="same"), cex=1), | |
| 166 xlab = "readsize in nucleotides", | |
| 167 ylab = "${ylabel}", | |
| 168 main="${title}" , as.table=TRUE, newpage = T, | |
| 169 aspect=0.5, | |
| 170 strip = strip.custom(par.strip.text = list(cex = 1), which.given=1, bg="lightblue") | |
| 171 ) | |
| 172 bc | |
| 173 } | |
| 174 devname=dev.off() | |
| 175 | |
| 176 </configfile> | |
| 177 </configfiles> | |
| 178 | |
| 179 <outputs> | |
| 180 <data format="tabular" name="size_distribution_dataframe" label="Size_distribution_dataframe.tab"/> | |
| 181 <data format="pdf" name="size_PDF" label="Size_distribution.pdf"/> | |
| 182 </outputs> | |
| 183 <help> | |
| 184 | |
| 185 **What it does** | |
| 186 | |
| 187 Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a histogram of read sizes, | |
| 188 where by default for each "chromosome" a histogram of read sizes is drawn. | |
| 189 Reads that map in sense are on the top (red), reads that map antisense are on the bottom (blue). | |
| 190 | |
| 191 | |
| 192 .. class:: warningmark | |
| 193 | |
| 194 '''TIP''' The input data can be produced using the sRbowtie tool. | |
| 195 | |
| 196 ---- | |
| 197 | |
| 198 '''Example''' | |
| 199 | |
| 200 Query sequence:: | |
| 201 For a SAM file as the following: | |
| 202 | |
| 203 5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 | |
| 204 | |
| 205 11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 | |
| 206 | |
| 207 2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 | |
| 208 | |
| 209 produce a plot like this: | |
| 210 | |
| 211 ---- | |
| 212 | |
| 213 .. image:: static/images/size_histogram.png | |
| 214 :height: 800 | |
| 215 :width: 500 | |
| 216 | |
| 217 </help> | |
| 1 | 218 <tests> |
| 0 | 219 <test> |
| 220 <param name="genomeSource" value="history" /> | |
| 1 | 221 <param name="ownFile" value="transposons.fasta" ftype="fasta" /> |
| 222 <param name="series_0|input" value="sample1.srbowtie_out" ftype="tabular"/> | |
| 223 <param name="series_0|norm" value="1" /> | |
| 224 <param name="series_1|input" value="sample2.srbowtie_out" ftype="tabular"/> | |
| 225 <param name="series_1|norm" value="1" /> | |
| 226 <param name="series_2|input" value="sample3.srbowtie_out" ftype="tabular"/> | |
| 227 <param name="series_2|norm" value="1" /> | |
| 0 | 228 <param name="global" value="no" /> |
| 229 <param name="collapsestrands" value="no" /> | |
| 230 <param name="minquery" value="18"/> | |
| 231 <param name="maxquery" value="30"/> | |
| 232 <param name="title" value="Size distribution"/> | |
| 233 <param name="xlabel" value="Size in nucleotides"/> | |
| 234 <param name="ylabel" value="Number of reads"/> | |
| 235 <param name="rows_per_page" value="10"/> | |
| 1 | 236 <output name="size_distribution_dataframe" ftype="tabular" file="Size_distribution_dataframe.tab" /> |
| 237 <output name="size_PDF" ftype="pdf" file="Size_distribution.pdf" /> | |
| 0 | 238 </test> |
| 1 | 239 </tests> |
| 0 | 240 </tool> |
| 241 |