Mercurial > repos > drosofff > mississipi_gcc2
view readmap.xml @ 0:de6a6afc5a79 draft default tip
Uploaded
| author | drosofff |
|---|---|
| date | Tue, 24 Jun 2014 12:16:43 -0400 |
| parents | |
| children |
line wrap: on
line source
<tool id="Readmap" name="Generate readmap and histograms from alignment files" version="0.9.2"> <description>from sRbowtie aligment</description> <requirements><requirement type='package'>bowtie-inspect</requirement></requirements> <parallelism method="basic"></parallelism> <command interpreter="python"> readmap.py #if $refGenomeSource.genomeSource == "history": --reference_fasta ## sys.argv[2] $refGenomeSource.ownFile ## index source #else: #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] --reference_bowtie_index $reference #end if --rcode $plotCode --output_readmap $readmap_dataframe --output_size_distribution $size_distribution_dataframe --minquery $minquery --maxquery $maxquery --input #for $i in $refGenomeSource.series $i.input #end for --ext #for $i in $refGenomeSource.series $i.input.ext #end for --label #for $i in $refGenomeSource.series "$i.input.name" #end for --normalization_factor #for $i in $refGenomeSource.series $i.norm #end for #if $gff: --gff $gff #end if </command> <inputs> <conditional name="refGenomeSource"> <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> <option value="indexed">Use a built-in index</option> <option value="history">Use one from the history</option> </param> <when value="indexed"> <repeat name="series" title="Add alignment files"> <param name="input" type="data" label="Select multiple alignments to parse"> <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> </param> <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> </repeat> </when> <when value="history"> <repeat name="series" title="Add alignment files"> <param name="input" type="data" label="Select multiple alignments to parse"/> <param name="norm" type="integer" value="1" label="Indicate a normalization factor to compare multiple aligments"/> </repeat> </when> </conditional> <param name="gff" type="data" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> <param name="minquery" type="integer" size="3" value="18" label="Min size of query small RNAs" help="'18' = 18 nucleotides"/> <param name="maxquery" type="integer" size="3" value="28" label="Max size of query small RNAs" help="'28' = 28 nucleotides"/> <param name="title" type="text" size="15" value= "Readmaps and size distributions" label="Main Titles"/> <param name="xlabel" type="text" size="15" value="Coordinates/read size" label="x axis label"/> <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> </param> </inputs> <configfiles> <configfile name="plotCode"> ## Setup R error handling to go to stderr options( show.error.messages=F, error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) library(RColorBrewer) library(lattice) library(latticeExtra) library(grid) library(gridExtra) ##cheetahtemplate data frame implementation rm=read.delim("${readmap_dataframe}", header=T, row.names=NULL) pdf(file="${readmap_PDF}", paper="special", height=11.69, width=8.2677) n_samples=length(unique(rm\$sample)) genes=unique(levels(rm\$gene)) per_gene_readmap=lapply(genes, function(x) subset(rm, gene==x)) n_genes=length(per_gene_readmap) par.settings.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-3), fontsize = list(text=96/${rows_per_page}, points=8)) par.settings.size=list(layout.heights=list(top.padding=-1, bottom.padding=-3), fontsize = list(text=96/${rows_per_page}, points=8)) par.settings.combination.readmap=list(layout.heights=list(top.padding=0, bottom.padding=-3), fontsize = list(text=96/${rows_per_page}, points=8)) par.settings.combination.size=list(layout.heights=list(top.padding=-2, bottom.padding=-0.5), fontsize = list(text=96/${rows_per_page}, points=8)) plot_readmap=function(df, ...) { combineLimits(xyplot(count~coord|factor(sample, levels=unique(sample))+reorder(gene, count, function(x) -sum(abs(x))), data=df, type='h', scales= list(relation="free", x=list(rot=0, cex=0.75, axs="i", tck=0.5), y=list(tick.number=4, rot=90, cex=0.75)), xlab=NULL, main=NULL, ylab=NULL, as.table=T, origin = 0, horizontal=FALSE, group=polarity, col=c("red","blue"), ...)) } plot_size_distribution= function(df, ...) { smR.prepanel=function(x,y,...){; yscale=c(-max(abs(y)), max(abs(y)));list(ylim=yscale);} bc= barchart(count~as.factor(size)|factor(sample, levels=unique(sample))+gene, data = df, origin = 0, horizontal=FALSE, group=polarity, stack=TRUE, col=c('red', 'blue'), cex=0.75, scales=list(y=list(tick.number=4, rot=90, relation="free"), cex=0.75), prepanel=smR.prepanel, xlab = NULL, ylab = NULL, # par.settings=list(layout.heights=list(top.padding=-2, bottom.padding=-3), fontsize = list(text=8, points=8)), main = NULL , as.table=TRUE, newpage = T, ...) combineLimits(bc) } for (i in seq(1,n_genes,${rows_per_page})) { start=i end=i+${rows_per_page}-1 if (end>n_genes) {end=n_genes} readmap_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.readmap)) args.list=c(readmap_plot.list, list(nrow=${rows_per_page}, ncol=1, main="readmaps", left="${ylabel}", sub="readmap coordinate")) do.call(grid.arrange, args.list) } devname=dev.off() size=read.delim("${size_distribution_dataframe}", header=T, row.names=NULL) per_gene_size=lapply(genes, function(x) subset(size, gene==x)) pdf(file="${size_PDF}", paper="special", height=11.69, width=8.2677) for (i in seq(1,n_genes,${rows_per_page})) { start=i end=i+${rows_per_page}-1 if (end>n_genes) {end=n_genes} plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, par.settings=par.settings.size)) args.list=c(plot.list, list(nrow=${rows_per_page}, ncol=1, main="size distribution", left="${ylabel}", sub="readsize in nucleotides")) do.call(grid.arrange, args.list) } devname=dev.off() pdf(file="${combi_PDF}", paper="special", height=11.69, width=8.2677) for (i in seq(1,n_genes,${rows_per_page}/2)) { start=i end=i+${rows_per_page}/2-1 if (end>n_genes) {end=n_genes} read_plot.list=lapply(per_gene_readmap[start:end], function(x) plot_readmap(x, par.settings=par.settings.combination.readmap)) size_plot.list=lapply(per_gene_size[start:end], function(x) plot_size_distribution(x, strip=FALSE, par.settings=par.settings.combination.size)) plot.list=rbind(read_plot.list, size_plot.list ) args.list=c(plot.list, list(nrow=${rows_per_page}, ncol=1, main="${title}", left="${ylabel}", sub="${xlabel}")) do.call(grid.arrange, args.list) } devname=dev.off() </configfile> </configfiles> <outputs> <data format="tabular" name="readmap_dataframe" label="Readmap dataframe"/> <data format="tabular" name="size_distribution_dataframe" label="Size distribution dataframe"/> <data format="pdf" name="readmap_PDF" label="Readmaps"/> <data format="pdf" name="size_PDF" label="Size distribution"/> <data format="pdf" name="combi_PDF" label="Size distribution and Readmaps"/> </outputs> <help> **What it does** Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a "Readmap", where by default for each "chromosome" the position of the read is recorded on the x-axis, and the y-axis indicates the number of reads per position. Reads that map in sense are on the top, reads that map antisense are on the bottom. .. class:: warningmark '''TIP''' The input data can be produced using the sRbowtie tool. ---- '''Example''' Query sequence:: For a SAM file as the following: 5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 produce a plot like this: ---- .. image:: static/images/readmap.png :height: 800 :width: 500 </help> </tool>
