Mercurial > repos > drosofff > bowtie_for_smallrna
changeset 0:324c3142ca0f draft
Uploaded
| author | drosofff |
|---|---|
| date | Mon, 19 May 2014 17:33:06 -0400 |
| parents | |
| children | f7b9ce3a5470 |
| files | sRbowtie/sRbowtie.py sRbowtie/sRbowtie.xml sRbowtie/test-data/sRbowtie.fa sRbowtie/test-data/sRbowtie.out |
| diffstat | 4 files changed, 346 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/sRbowtie/sRbowtie.py Mon May 19 17:33:06 2014 -0400 @@ -0,0 +1,109 @@ +#!/usr/bin/env python +# small RNA oriented bowtie wrapper +# version 1 19-5-2014 +# Usage sRbowtie.py <1 input_fasta_file> <2 alignment method> <3 -v mismatches> <4 out_type> <5 buildIndexIfHistory> <6 fasta/bowtie index> <7 bowtie output> <8 ali_fasta> <9 unali_fasta> <10 --num-threads \${GALAXY_SLOTS:-4}> +# To Do: +# implement number of bowtie processes as a Galaxy env variable +# implement an arg parser +# Christophe Antoniewski <drosofff@gmail.com> + +import sys, os, subprocess, tempfile, shutil + +def stop_err( msg ): + sys.stderr.write( '%s\n' % msg ) + sys.exit() + +def bowtieCommandLiner (alignment_method, v_mis, out_type, aligned, unaligned, input, index, output, pslots="12"): + if alignment_method=="RNA": + x = "-v %s -M 1 --best --strata -p %s --norc --suppress 2,6,7,8" % (v_mis, pslots) + elif alignment_method=="unique": + x = "-v %s -m 1 -p %s --suppress 6,7,8" % (v_mis, pslots) + elif alignment_method=="multiple": + x = "-v %s -M 1 --best --strata -p %s --suppress 6,7,8" % (v_mis, pslots) + elif alignment_method=="k_option": + x = "-v %s -k 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots) + elif alignment_method=="n_option": + x = "-n %s -M 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots) + elif alignment_method=="a_option": + x = "-v %s -a --best -p %s --suppress 6,7,8" % (v_mis, pslots) + if aligned == "None" and unaligned == "None": fasta_command = "" + elif aligned != "None" and unaligned == "None": fasta_command= " --al %s" % aligned + elif aligned == "None" and unaligned != "None": fasta_command = " --un %s" % unaligned + else: fasta_command = " --al %s --un %s" % (aligned, unaligned) + x = x + fasta_command + if out_type == "tabular": + return "bowtie %s %s -f %s > %s" % (x, index, input, output) + elif out_type=="sam": + return "bowtie %s -S %s -f %s > %s" % (x, index, input, output) + elif out_type=="bam": + return "bowtie %s -S %s -f %s |samtools view -bS - > %s" % (x, index, input, output) + +def bowtie_squash(fasta): + tmp_index_dir = tempfile.mkdtemp() # make temp directory for bowtie indexes + ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir ) + ref_file_name = ref_file.name + ref_file.close() # by default, delete the temporary file, but ref_file.name is now stored in ref_file_name + os.symlink( fasta, ref_file_name ) # symlink between the fasta source file and the deleted ref_file name + cmd1 = 'bowtie-build -f %s %s' % (ref_file_name, ref_file_name ) # bowtie command line, which will work after changing dir (cwd=tmp_index_dir) + try: + FNULL = open(os.devnull, 'w') + tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name # a path string for a temp file in tmp_index_dir. Just a string + tmp_stderr = open( tmp, 'wb' ) # creates and open a file handler pointing to the temp file + proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=FNULL, stdout=FNULL ) # both stderr and stdout of bowtie-build are redirected in dev/null + returncode = proc.wait() + tmp_stderr.close() + FNULL.close() + sys.stdout.write(cmd1 + "\n") + except Exception, e: + # clean up temp dir + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stop_err( 'Error indexing reference sequence\n' + str( e ) ) + # no Cleaning if no Exception, tmp_index_dir has to be cleaned after bowtie_alignment() + index_full_path = os.path.join(tmp_index_dir, ref_file_name) # bowtie fashion path without extention + return tmp_index_dir, index_full_path + +def bowtie_alignment(command_line, flyPreIndexed=''): + # make temp directory just for stderr + tmp_index_dir = tempfile.mkdtemp() + tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name + tmp_stderr = open( tmp, 'wb' ) + # conditional statement for sorted bam generation viewable in Trackster + if "samtools" in command_line: + target_file = command_line.split()[-1] # recover the final output file name + path_to_unsortedBam = os.path.join(tmp_index_dir, "unsorted.bam") + path_to_sortedBam = os.path.join(tmp_index_dir, "unsorted.bam.sorted") + first_command_line = " ".join(command_line.split()[:-3]) + " -o " + path_to_unsortedBam + " - " + # example: bowtie -v 0 -M 1 --best --strata -p 12 --suppress 6,7,8 -S /home/galaxy/galaxy-dist/bowtie/Dmel/dmel-all-chromosome-r5.49 -f /home/galaxy/galaxy-dist/database/files/003/dataset_3460.dat |samtools view -bS -o /tmp/tmp_PgMT0/unsorted.bam - + second_command_line = "samtools sort %s %s" % (path_to_unsortedBam, path_to_sortedBam) # generates an "unsorted.bam.sorted.bam file", NOT an "unsorted.bam.sorted" file + p = subprocess.Popen(args=first_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) # fileno() method return the file descriptor number of tmp_stderr + returncode = p.wait() + sys.stdout.write("%s\n" % first_command_line + str(returncode)) + p = subprocess.Popen(args=second_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) + returncode = p.wait() + sys.stdout.write("\n%s\n" % second_command_line + str(returncode)) + if os.path.isfile(path_to_sortedBam + ".bam"): + shutil.copy2(path_to_sortedBam + ".bam", target_file) + else: + p = subprocess.Popen(args=command_line, shell=True, stderr=tmp_stderr.fileno()) + returncode = p.wait() + sys.stdout.write(command_line + "\n") + tmp_stderr.close() + ## cleaning if the index was created in the fly + if os.path.exists( flyPreIndexed ): + shutil.rmtree( flyPreIndexed ) + # cleaning tmp files and directories + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + return + +def __main__(): + F = open (sys.argv[7], "w") + if sys.argv[5] == "history": + tmp_dir, index_path = bowtie_squash(sys.argv[6]) + else: + tmp_dir, index_path = "dummy/dymmy", sys.argv[6] + command_line = bowtieCommandLiner(sys.argv[2], sys.argv[3], sys.argv[4], sys.argv[8], sys.argv[9], sys.argv[1], index_path, sys.argv[7], sys.argv[10]) + bowtie_alignment(command_line, flyPreIndexed=tmp_dir) + F.close() +if __name__=="__main__": __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/sRbowtie/sRbowtie.xml Mon May 19 17:33:06 2014 -0400 @@ -0,0 +1,192 @@ +<tool id="bowtieForSmallRNA" name="sRbowtie" version="1.0.0"> + <description>for FASTA small reads</description> + <requirements> + <requirement type='package'>bowtie</requirement> + </requirements> + <parallelism method="basic"></parallelism> + <command interpreter="python"> sRbowtie.py $input + $method + $v_mismatches + $output_type + $refGenomeSource.genomeSource + ## the very source of the index (indexed or fasta file) + #if $refGenomeSource.genomeSource == "history": + $refGenomeSource.ownFile + #else: + $refGenomeSource.index.fields.path + #end if + $output + $aligned + $unaligned + \${GALAXY_SLOTS:-4} ## number of processors to be handled by bowtie + </command> + <inputs> + <param name="input" type="data" format="fasta" label="Input fasta file: reads clipped from their adapter" help="Only with clipped, raw fasta files"/> +<!-- which method will be used --> + <param name="method" type="select" label="What kind of matching do you want to do?" help="bowtie parameters adjusted to the type of matching. RNA option match to only one strand"> + <option value="RNA">Match on sense strand RNA reference index, multiple mappers randomly matched at a single position</option> + <option value="unique">Match unique mappers on DNA reference index</option> + <option value="multiple" selected="true">Match on DNA, multiple mappers randomly matched at a single position</option> + <option value="k_option">Match on DNA as fast as possible, without taking care of mapping issues (for raw annotation of reads)</option> + <option value="n_option">Match on DNA - RNAseq mode (-n bowtie option)</option> + <option value="a_option">Match and report all valid alignments</option> + </param> +<!-- END of which method will be used --> + <param name="v_mismatches" type="select" label="Number of mismatches allowed" help="specify the -v bowtie option"> + <option value="0">0</option> + <option value="1" selected="true">1</option> + <option value="2">2</option> + <option value="3">3</option> + </param> +<!-- bowtie index selection --> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param name="index" type="select" label="Select a DNA reference index" help="if your genome of interest is not listed - contact GED team"> + <options from_data_table="bowtie_indexes"> + <!-- <filter type="sort_by" column="2" /> + <validator type="no_options" message="No indexes are available" /> --> + </options> + </param> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" label="Select a fasta file, to serve as index reference" /> + </when> + </conditional> +<!-- END bowtie index selection --> + <param name="output_type" type="select" label="Select output format" help="Note that the BAM will be viewable in trackster only if you choose a full genome referenced for Trackster usage. see the doc below"> + <option value="tabular" select="true">tabular</option> + <option value="sam">sam</option> + <option value="bam">bam</option> + </param> + <param name="additional_fasta" type="select" label="additional fasta output" help="to get aligned and unaligned reads in fasta format"> + <option value="No" select="true">No</option> + <option value="al">aligned</option> + <option value="unal">unaligned</option> + <option value="al_and_unal">both aligned and unaligned</option> + </param> + </inputs> + <outputs> + <data format="tabular" name="output" label="Bowtie Output"> + <change_format> + <when input="output_type" value="sam" format="sam" /> + <when input="output_type" value="bam" format="bam" /> + </change_format> + </data> + <data format="fasta" name="aligned" label="Matched reads"> + <filter>additional_fasta == "al" or additional_fasta == "al_and_unal"</filter> + </data> + <data format="fasta" name="unaligned" label ="Unmatched reads"> + <filter>additional_fasta == "unal" or additional_fasta == "al_and_unal"</filter> + </data> + </outputs> + + <test> + <param name="genomeSource" value="indexed" /> + <param name="index" value="/home/galaxy/galaxy-dist/bowtie/Dmel/dmel-all-chromosome-r5.49" /> + <param name="method" value="multiple" /> + <param name="input" ftype="fasta" value="sRbowtie.fa" /> + <param name="v_mismatches" value="1" /> + <param name="output_type" value="tabular" /> + <output name="output" ftype="tabular" value="sRbowtie.out" /> + <output name="aligned" value="None" /> + <output name="unaligned" value="None" /> + </test> + + <help> + +**What it does** + +Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. It is developed by Ben Langmead and Cole Trapnell. Please cite: Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25. + +.. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml + +A generic "Map with Bowtie for Illumina" Galaxy tool is available in the main Galaxy distribution. + +However, this Bowtie wrapper tool only takes FASTQ files as inputs. + +The sRbowtie wrapper specifically works with short reads FASTA inputs (-v bowtie mode) + +------ + +**OPTIONS** + +.. class:: infomark + +This script uses Bowtie to match reads on a reference index. + +Depending on the type of matching, different bowtie options are used: + +**Match on sense strand RNA reference index, multiple mappers randomly matched at a single position** + +Match on RNA reference, SENSE strand, randomly attributing multiple mapper to target with least mismatches, the polarity column is suppressed in the bowtie tabular report: + +*-v [0,1,2,3] -M 1 --best --strata -p 12 --norc --suppress 2,6,7,8* + +**Match unique mappers on DNA reference index** + +Match ONLY unique mappers on DNA reference index + +*-v [0,1,2,3] -m 1 -p 12 --suppress 6,7,8* + +Note that using this option with -v values other than 0 is questionnable... + +**Match on DNA, multiple mappers randomly matched at a single position** + +Match multiple mappers, randomly attributing multiple mapper to target with least mismatches, number of mismatch allowed specified by -v option: + +*-v [0,1,2,3] -M 1 --best --strata -p 12 --suppress 6,7,8* + +**Match on DNA as fast as possible, without taking care of mapping issues (for raw annotation of reads)** + +Match with highest speed, not guaranteeing best hit for speed gain: + +*-v [0,1,2,3] -k 1 --best -p 12 --suppress 6,7,8* + + +----- + +**Input formats** + +.. class:: warningmark + +*The only accepted format for the script is a raw fasta list of reads, clipped from their adapter* + +----- + +**OUTPUTS** + +If you choose tabular as the output format, you will obtain the matched reads in standard bowtie output format, having the following columns:: + + Column Description + -------- -------------------------------------------------------- + 1 FastaID fasta identifier + 2 polarity + or - depending whether the match was reported on the forward or reverse strand + 3 target name of the matched target + 4 Offset O-based coordinate of the miR on the miRBase pre-miR sequence + 5 Seq sequence of the matched Read + +If you choose SAM, you will get the output in unordered SAM format. + +.. class:: warningmark + +if you choose BAM, the output will be in sorted BAM format. +To be viewable in Trackster, several condition must be fulfilled: + +.. class:: infomark + +Reads must have been matched to a genome whose chromosome names are compatible with Trackster genome indexes + +.. class:: infomark + +the database/Build (dbkey) which is indicated for the dataset (Pencil - Database/Build field) must match a Trackster genome index. + +Please contact the Galaxy instance administrator if your genome is not referenced + +**Matched and unmatched fasta reads can be retrieved, for further analyses** + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/sRbowtie/test-data/sRbowtie.fa Mon May 19 17:33:06 2014 -0400 @@ -0,0 +1,40 @@ +>1 +GTATTGTAAGTGGCAGAGTGGC +>2 +TGGAATGTAAAGAAGTATGGAG +>3 +GTGGGGAGTTTGGATGGGGCGGCA +>4 +AATGGCACTGGAAGAATTCACGG +>5 +GTACGGACAAGGGGAATC +>6 +TTGGGTTCTGGGGGGAGTATGG +>7 +GTGGGGAGTTTCGCTGGGGCGGCA +>8 +TAAGGGTCGGGTAGTGAGGGC +>9 +AGCTGGGACTGAGGACTG +>10 +AGCTGGGACTGAGGACTGC +>11 +AAGGGTCGGGTAGTGAGG +>12 +GTCGGGTAGTGAGGGCCTT +>13 +TGGTGGGGCTTGGAACAATTGGAGGGC +>14 +TGACGGAAGGGCACCACC +>15 +TGGAATGTAAAGAAGTATGGAG +>16 +TTGGGTTCTGGGGGGAGT +>17 +TCAGGTGGGGAGTTTGGCTGGGGCGGCACA +>18 +TTGGGTATAGGGGCGAAAGA +>19 +AGCGGGCGTGCTTGTGGAC +>20 +GTCGAATTTGGGTATAGGGGC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/sRbowtie/test-data/sRbowtie.out Mon May 19 17:33:06 2014 -0400 @@ -0,0 +1,5 @@ +2 + 2L 20487495 TGGAATGTAAAGAAGTATGGAG +4 - 2L 11953463 CCGTGAATTCTTCCAGTGCCATT +15 + 2L 20487495 TGGAATGTAAAGAAGTATGGAG +14 - Uextra 7115665 GGTGGTGCCCTTCCGTCA +18 + Uextra 7726410 TTGGGTATAGGGGCGAAAGA
