Mercurial > repos > dfornika > snippy

changeset 22:0bf16c8aca73 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit 60e2302cfac90d0c909ef61815aaaafaaad5816a-dirty
author dfornika
date Mon, 17 Jun 2019 16:42:39 -0400
parents 0e733df972b5
children cbf0c0afc133
files snippy-core.xml snippy.xml snippy_core_wrapper.pl snippy_core_wrapper.py test-data/a.dat test-data/a.tgz test-data/a_b_c.core.txt test-data/a_fna_ref_mincov_2_minqual_60.snps.gff test-data/a_fna_ref_mincov_2_minqual_60.snps.txt test-data/b.dat test-data/b.tgz test-data/b_2_fna_ref_mincov_2_minqual_60.snps.gff test-data/b_fna_ref_mincov_2_minqual_60.snps.gff test-data/b_fna_ref_mincov_2_minqual_60.snps.txt test-data/b_out_dev/ref.fa test-data/b_out_dev/ref.fa.fai test-data/b_out_dev/reference/genomes/ref.fa test-data/b_out_dev/reference/ref.fa test-data/b_out_dev/reference/ref.fa.amb test-data/b_out_dev/reference/ref.fa.ann test-data/b_out_dev/reference/ref.fa.bwt test-data/b_out_dev/reference/ref.fa.fai test-data/b_out_dev/reference/ref.fa.pac test-data/b_out_dev/reference/ref.fa.sa test-data/b_out_dev/reference/ref.gff test-data/b_out_dev/reference/ref.txt test-data/b_out_dev/reference/ref/genes.gff.gz test-data/b_out_dev/snps.aligned.fa test-data/b_out_dev/snps.bam test-data/b_out_dev/snps.bam.bai test-data/b_out_dev/snps.bed test-data/b_out_dev/snps.consensus.fa test-data/b_out_dev/snps.consensus.subs.fa test-data/b_out_dev/snps.csv test-data/b_out_dev/snps.filt.vcf test-data/b_out_dev/snps.gff test-data/b_out_dev/snps.html test-data/b_out_dev/snps.log test-data/b_out_dev/snps.raw.vcf test-data/b_out_dev/snps.subs.vcf test-data/b_out_dev/snps.tab test-data/b_out_dev/snps.txt test-data/b_out_dev/snps.vcf test-data/b_out_dev/snps.vcf.gz test-data/b_out_dev/snps.vcf.gz.csi test-data/c.dat test-data/c.tgz test-data/core/core.txt test-data/fna_ref_a/snps.gff test-data/fna_ref_a/snps.txt test-data/fna_ref_b/snps.gff test-data/fna_ref_b/snps.txt
diffstat 51 files changed, 65 insertions(+), 707 deletions(-) [+]
line wrap: on
line diff
--- a/snippy-core.xml	Tue Mar 12 17:37:29 2019 -0400
+++ b/snippy-core.xml	Mon Jun 17 16:42:39 2019 -0400
@@ -1,3 +1,4 @@
+<?xml version="1.0" encoding="utf-8"?>
 <tool id="snippy_core" name="snippy-core" version="@VERSION@">
     <description>
         Combine multiple Snippy outputs into a core SNP alignment
@@ -7,15 +8,16 @@
     </macros>
     <expand macro="requirements" />
     <command detect_errors="exit_code"><![CDATA[
-
-        python '$__tool_directory__/snippy_core_wrapper.py'
+        #for $indir in $indirs
+            tar -xf '$indir' &&
+        #end for
+        snippy-core
             --ref '$ref'
-            --indirs '$indirs'
-
+            `ls -1 -I "*.dat" -I "*.log" | tr '\n' ' '`
     ]]></command>
 
     <inputs>
-        <param name="indirs" type="data" multiple="true" format="zip" label="Snippy input zipped dirs" help="Select all the snippy inputs for alignment" />
+        <param name="indirs" type="data" multiple="true" format="tar" label="Snippy input zipped dirs" help="Select all the snippy inputs for alignment" />
         <param name="ref" type="data" format="fasta,genbank" label="Reference File (either in fasta or genbank format)" help="Fasta or Genbank file to use as the reference" />
         <param name="outputs" type="select" multiple="true" display="checkboxes" label="Output selection">
             <option value="outaln" selected="True">A core SNP alignment in the fasta format</option>
@@ -43,10 +45,10 @@
 
     <tests>
         <test><!-- Test #1 - test with 3 zipped directories -->
-            <param name="indirs" value="a.tgz,b.tgz,c.tgz" />
+            <param name="indirs" value="a.dat,b.dat,c.dat" />
             <param name="ref" value="reference.fasta" />
             <param name="outputs" value="outtxt" />
-            <output name="alignment_summary" ftype="txt" file="core/core.txt" />
+            <output name="alignment_summary" ftype="txt" file="a_b_c.core.txt" />
         </test>
     </tests>
 
@@ -71,6 +73,5 @@
 snippy **must** have been run with --cleanup False
 
     ]]></help>
-
     <expand macro="citations" />
 </tool>
--- a/snippy.xml	Tue Mar 12 17:37:29 2019 -0400
+++ b/snippy.xml	Mon Jun 17 16:42:39 2019 -0400
@@ -1,4 +1,4 @@
-<tool id="snippy" name="snippy" version="@VERSION@+galaxy1">
+<tool id="snippy" name="snippy" version="@VERSION@+galaxy2">
   <description>
       Snippy finds SNPs between a haploid reference genome and your NGS sequence reads.
   </description>
@@ -18,7 +18,8 @@
         #end if
         snippy
             --outdir 'out'
-            --cpus "\${GALAXY_SLOTS:-1}"
+            --cpus \${GALAXY_SLOTS:-1}
+            --ram \$((\${GALAXY_MEMORY_MB:-4096}/1024))
             #if $ref.is_of_type("fasta")
                 --ref 'ref.fna'
             #end if
@@ -33,22 +34,19 @@
                 --rgid '$adv.rgid'
             #end if
             #if $adv.bwaopt
-                --bwaopt '$advanced.bwaopt'
+                --bwaopt '$adv.bwaopt'
             #end if
 
             #if str( $fastq_input.fastq_input_selector ) == "paired"
                 --R1 '$fastq_input.fastq_input1'
                 --R2 '$fastq_input.fastq_input2'
-            #end if
-            #if str( $fastq_input.fastq_input_selector ) == "paired_collection"
+            #elif str( $fastq_input.fastq_input_selector ) == "paired_collection"
                 --R1 '$fastq_input.fastq_input.forward'
                 --R2 '$fastq_input.fastq_input.reverse'
-            #end if
-            #if str( $fastq_input.fastq_input_selector ) == "single"
-                --se '$fastq_input.fastq_input'
-            #end if
-            #if str( $fastq_input.fastq_input_selector ) == "paired_iv"
-                --peil '$fastq_input.fastq_input'
+            #elif str( $fastq_input.fastq_input_selector ) == "single"
+                --se '$fastq_input.fastq_input_single'
+            #elif str( $fastq_input.fastq_input_selector ) == "paired_iv"
+                --peil '$fastq_input.fastq_input_interleaved'
             #end if
 
         &&
@@ -58,8 +56,10 @@
             #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fastq_input1.element_identifier)
         #elif str( $fastq_input.fastq_input_selector ) == "paired_collection"
             #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fastq_input.name)
-        #else
-            #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fastq_input.element_identifier)
+        #elif str( $fastq_input.fastq_input_selector ) == "single"
+            #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fastq_input_single.element_identifier)
+        #elif str( $fastq_input.fastq_input_selector ) == "paired_iv"
+            #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fastq_input_interleaved.element_identifier)
         #end if
 
         mkdir -p ${dir_name} && cp -r out/reference out/snps.tab out/snps.aligned.fa out/snps.vcf ${dir_name}/ &&
@@ -87,13 +87,13 @@
                 <param name="fastq_input2" type="data" format="fastqsanger,fasta" label="Select second set of reads" help="Specify dataset with reverse reads"/>
             </when>
             <when value="single">
-                <param name="fastq_input" type="data" format="fastqsanger,fasta" label="Select fastq dataset" help="Specify dataset with single reads"/>
+                <param name="fastq_input_single" type="data" format="fastqsanger,fasta" label="Select fastq dataset" help="Specify dataset with single reads"/>
             </when>
             <when value="paired_collection">
                 <param name="fastq_input" format="fastqsanger,fasta" type="data_collection" collection_type="paired" label="Select a paired collection" help="See help section for an explanation of dataset collections"/>
             </when>
             <when value="paired_iv">
-                <param name="fastq_input" type="data" format="fastqsanger" label="Select fastq dataset" help="Specify dataset with interleaved reads"/>
+                <param name="fastq_input_interleaved" type="data" format="fastqsanger" label="Select fastq dataset" help="Specify dataset with interleaved reads"/>
             </when>
         </conditional>
 
@@ -101,10 +101,10 @@
             <param name="mapqual" type="integer" value="60" label="Minimum mapping quality" help="Minimum mapping quality to allow" />
             <param name="mincov" type="integer" value="10" label="Minimum coverage" help="Minimum coverage to call a snp" />
             <param name="minfrac" type="float" value="0.9" label="Minumum proportion for variant evidence" help="Minumum proportion for variant evidence" />
-	    <param name="minqual" type="float" value="100.0" label="Minumum QUALITY in VCF column 6" help="Minumum QUALITY in VCF column 6" />
+            <param name="minqual" type="float" value="100.0" label="Minumum QUALITY in VCF column 6" help="Minumum QUALITY in VCF column 6" />
             <param name="rgid" type="text" value="" label="Bam header @RG ID" help="Use this @RG ID: in the BAM header" />
             <param name="bwaopt" type="text" value="" label="Extra BWA MEM options" help="Extra BWA MEM options, eg. -x pacbio" />
-	    <param name="rename_cons" type="boolean" truevalue="rename_cons" falsevalue="" help="When producing an output of the reference genome with variants instantiated, edit the header so that it is named after the input VCF" />
+            <param name="rename_cons" type="boolean" truevalue="rename_cons" falsevalue="" help="When producing an output of the reference genome with variants instantiated, edit the header so that it is named after the input VCF" />
         </section>
 
         <param name="outputs" type="select" multiple="true" display="checkboxes" label="Output selection">
@@ -167,8 +167,8 @@
             <param name="mincov" value="2" />
             <param name="minqual" value="60" />
             <param name="outputs" value="outgff,outsum" />
-            <output name="snpsum" ftype="tabular" file="fna_ref_a/snps.txt" lines_diff="6" />
-            <output name="snpgff" ftype="gff3" file="fna_ref_a/snps.gff" />
+            <output name="snpsum" ftype="tabular" file="a_fna_ref_mincov_2_minqual_60.snps.txt" lines_diff="6" />
+            <output name="snpgff" ftype="gff3" file="a_fna_ref_mincov_2_minqual_60.snps.gff" />
         </test>
 
         <test> <!-- test 1 - fasta ref one snp -->
@@ -179,8 +179,8 @@
             <param name="mincov" value="2" />
             <param name="minqual" value="60" />
             <param name="outputs" value="outgff,outsum" />
-            <output name="snpsum" ftype="tabular" file="fna_ref_b/snps.txt" lines_diff="6" />
-            <output name="snpgff" ftype="gff3" file="fna_ref_b/snps.gff" />
+            <output name="snpsum" ftype="tabular" file="b_fna_ref_mincov_2_minqual_60.snps.txt" lines_diff="6" />
+            <output name="snpgff" ftype="gff3" file="b_fna_ref_mincov_2_minqual_60.snps.gff" />
         </test>
 
         <test> <!-- test 2 - fasta ref one snp paired_collection -->
@@ -195,10 +195,20 @@
             <param name="mincov" value="2" />
             <param name="minqual" value="60" />
             <param name="outputs" value="outgff,outsum" />
-            <output name="snpsum" ftype="tabular" file="fna_ref_b/snps.txt" lines_diff="6" />
-            <output name="snpgff" ftype="gff3" file="fna_ref_b/snps.gff" />
+            <output name="snpsum" ftype="tabular" file="b_fna_ref_mincov_2_minqual_60.snps.txt" lines_diff="6" />
+            <output name="snpgff" ftype="gff3" file="b_fna_ref_mincov_2_minqual_60.snps.gff" />
         </test>
 
+        <test> <!-- test 3 - fasta ref one snp single -->
+            <param name="ref" value="reference.fasta" ftype="fasta" />
+            <param name="fastq_input_selector" value="single" />
+            <param name="fastq_input_single" value="b_2.fastq" ftype="fastqsanger" />
+            <param name="mincov" value="2" />
+            <param name="minqual" value="60" />
+            <param name="outputs" value="outgff,outsum" />
+            <output name="snpsum" ftype="tabular" file="b_fna_ref_mincov_2_minqual_60.snps.txt" lines_diff="6" />
+            <output name="snpgff" ftype="gff3" file="b_2_fna_ref_mincov_2_minqual_60.snps.gff" />
+        </test>
     </tests>
 
 
--- a/snippy_core_wrapper.pl	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,82 +0,0 @@
-#!/usr/bin/env perl
-
-#--------------------------------------
-#
-#        snippy_core_wrapper.pl
-#
-# This is an intermediary script between snippy-core.xml and snippy-core
-# It:
-#   - Copys the supplied zipped snippy output files to the working dir
-#   - Untars them to their datafile name
-#   - Builds the snippy-core command
-#   - Runs the snippy-core command
-#
-#--------------------------------------
-
-use warnings;
-use strict;
-use File::Copy;
-use File::Basename;
-
-my(@Options, $indirs, $ref);
-setOptions();
-
-my @list_of_dirs = split /\s+/, $indirs;
-
-#The list of final directories to be passed to snippy-core will be stored here.
-my @snippy_outs;
-
-foreach my $d (@list_of_dirs){
-  print STDERR "$d\n";
-  my $bn = basename($d);
-  my ($name, $dir, $ext) = fileparse($d, '\..*');
-  copy($d, $bn);
-  print STDERR "$d, $bn, $name, $dir, $ext\n";
-  `tar -xf $bn`;
-}
-
-my $test_list = `ls -d */`;
-$test_list =~ s/\///g;
-print STDERR "$test_list\n";
-
-@snippy_outs = split /\s+/, $test_list;
-
-
-my $commandline = "snippy-core ";
-
-$commandline .= " --ref $ref " if $ref;
-$commandline .= join(" ", @snippy_outs);
-print STDERR "snippy-core commandline: $commandline\n";
-
-my $ok = system($commandline);
-
-#----------------------------------------------------------------------
-# Option setting routines
-
-sub setOptions {
-  use Getopt::Long;
-
-  @Options = (
-    {OPT=>"help",    VAR=>\&usage,             DESC=>"This help"},
-    {OPT=>"ref=s", VAR=>\$ref, DEFAULT=>"", DESC=>"Reference genome."},
-    {OPT=>"indirs=s", VAR=>\$indirs, DEFAULT=>"", DESC=>"A whitespace delimited list of the snippy output zipped dirs."},
-  );
-
-  &GetOptions(map {$_->{OPT}, $_->{VAR}} @Options) || usage();
-
-  # Now setup default values.
-  foreach (@Options) {
-    if (defined($_->{DEFAULT}) && !defined(${$_->{VAR}})) {
-      ${$_->{VAR}} = $_->{DEFAULT};
-    }
-  }
-}
-
-sub usage {
-  print "Usage: $0 [options] -i inputfile > ... \n";
-  foreach (@Options) {
-    printf "  --%-13s %s%s.\n",$_->{OPT},$_->{DESC},
-           defined($_->{DEFAULT}) ? " (default '$_->{DEFAULT}')" : "";
-  }
-  exit(1);
-}
--- a/snippy_core_wrapper.py	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,44 +0,0 @@
-#!/usr/bin/env python
-
-# --------------------------------------
-#
-#        snippy_core_wrapper.py
-#
-# This is an intermediary script between snippy-core.xml and snippy-core
-# It:
-#   - Copys the supplied zipped snippy output files to the working dir
-#   - Untars them to their datafile name
-#   - Builds the snippy-core command
-#   - Runs the snippy-core command
-#
-# --------------------------------------
-
-import argparse
-import os
-import subprocess
-from shutil import copyfile
-
-
-def main():
-
-    parser = argparse.ArgumentParser()
-    parser.add_argument('-r', '--ref', help='Reference fasta', required=True)
-    parser.add_argument('-i', '--indirs', help='Comma-separated list of input datasets')
-    args = parser.parse_args()
-
-    snippy_core_command_line = ['snippy-core', '--ref', args.ref]
-
-    for input_dataset in args.indirs.split(','):
-        base_name = os.path.basename(input_dataset)
-        copyfile(input_dataset, base_name)
-        subprocess.Popen(['tar', '-xf', base_name]).wait()
-
-    extracted_dirs = [f for f in os.listdir('.') if os.path.isdir(f) ]
-    for extracted_dir in extracted_dirs:
-        snippy_core_command_line.append(extracted_dir)
-
-    subprocess.Popen(snippy_core_command_line).wait()
-
-
-if __name__ == '__main__':
-    main()
Binary file test-data/a.dat has changed
Binary file test-data/a.tgz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/a_b_c.core.txt	Mon Jun 17 16:42:39 2019 -0400
@@ -0,0 +1,5 @@
+ID	LENGTH	ALIGNED	UNALIGNED	VARIANT	HET	MASKED	LOWCOV
+a	700	51	649	0	0	0	0
+b	700	51	649	1	0	0	0
+c	700	51	649	1	0	0	0
+Reference	700	700	0	0	0	0	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/a_fna_ref_mincov_2_minqual_60.snps.gff	Mon Jun 17 16:42:39 2019 -0400
@@ -0,0 +1,1 @@
+##gff-version 3
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/a_fna_ref_mincov_2_minqual_60.snps.txt	Mon Jun 17 16:42:39 2019 -0400
@@ -0,0 +1,6 @@
+DateTime	1970-01-01T00:00:00
+ReadFiles	a_1.fastq a_2.fastq
+Reference	reference.fasta
+ReferenceSize	700
+Software	snippy 4.3.6
+VariantTotal	0
Binary file test-data/b.dat has changed
Binary file test-data/b.tgz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/b_2_fna_ref_mincov_2_minqual_60.snps.gff	Mon Jun 17 16:42:39 2019 -0400
@@ -0,0 +1,2 @@
+##gff-version 3
+reference	snippy:4.3.6	variation	4	4	.	.	0	note=snp A=>T T:5 A:0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/b_fna_ref_mincov_2_minqual_60.snps.gff	Mon Jun 17 16:42:39 2019 -0400
@@ -0,0 +1,2 @@
+##gff-version 3
+reference	snippy:4.3.6	variation	4	4	.	.	0	note=snp A=>T T:10 A:0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/b_fna_ref_mincov_2_minqual_60.snps.txt	Mon Jun 17 16:42:39 2019 -0400
@@ -0,0 +1,7 @@
+DateTime	1970-01-01T00:00:00
+ReadFiles	b_1.fastq b_2.fastq
+Reference	reference.fasta
+ReferenceSize	700
+Software	snippy 4.3.6
+Variant-SNP	1
+VariantTotal	1
--- a/test-data/b_out_dev/ref.fa	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,13 +0,0 @@
->reference
-TCCACAAGCCATTGTGTGTAATTAACCACTAATTGTGTATAAGTTTAAACTAATTGAAAA
-GGTTATCCACAATAAAAAGGCGTTATTCAGGAGTTATCCACACTTTCTAGGAAAGGATTT
-CATTGCGCCAATGTGTTAAACTATTTACCGAATACGAAAAAAAGACAAATAAATGAGGTT
-GTGAAAAATGATATTTCAACGGCTTTTGAAAACTAGAGATACAGAGTTTTATCGAGTTAT
-ACAAAACAGGAATATTGACGACGTATTTGGATACTTATTAATTCACGATAAACGGGAACC
-AGCAGAAATTGACGATTTTAAGGTATTTGCAAAAAGTAATATAAATAAAGAAGCTTTTTC
-AGTGAATATCAAAAAAAATCATATTTACACGATGTTTTTCCACTTTACTGATTTAGAGGA
-AGAACAGGAAATTCCAAAATTTACTAAAGTTATTCGTTTTATAGAAGGACTTTTATCTTT
-TCAGCCAGAAACAAGCCATTACGTTGATAACTATTTAATAAAGGAAAAACTAATTTTTGA
-ATATCCTGCTGAATTTGAGAAAATCGGGGAGTTTGCTAAATATTTAGTAAAGCTTTCGGG
-TCGTAAAATTACTATTCCAGACACAACGAGAGAAAAATATATCTATTTAACGCAATAATT
-TTCGAAAAATGGTTTTTCTCTCTATAAAAATATGATATGA
--- a/test-data/b_out_dev/ref.fa.fai	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-reference	700	11	60	61
--- a/test-data/b_out_dev/reference/genomes/ref.fa	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,13 +0,0 @@
->reference
-TCCACAAGCCATTGTGTGTAATTAACCACTAATTGTGTATAAGTTTAAACTAATTGAAAA
-GGTTATCCACAATAAAAAGGCGTTATTCAGGAGTTATCCACACTTTCTAGGAAAGGATTT
-CATTGCGCCAATGTGTTAAACTATTTACCGAATACGAAAAAAAGACAAATAAATGAGGTT
-GTGAAAAATGATATTTCAACGGCTTTTGAAAACTAGAGATACAGAGTTTTATCGAGTTAT
-ACAAAACAGGAATATTGACGACGTATTTGGATACTTATTAATTCACGATAAACGGGAACC
-AGCAGAAATTGACGATTTTAAGGTATTTGCAAAAAGTAATATAAATAAAGAAGCTTTTTC
-AGTGAATATCAAAAAAAATCATATTTACACGATGTTTTTCCACTTTACTGATTTAGAGGA
-AGAACAGGAAATTCCAAAATTTACTAAAGTTATTCGTTTTATAGAAGGACTTTTATCTTT
-TCAGCCAGAAACAAGCCATTACGTTGATAACTATTTAATAAAGGAAAAACTAATTTTTGA
-ATATCCTGCTGAATTTGAGAAAATCGGGGAGTTTGCTAAATATTTAGTAAAGCTTTCGGG
-TCGTAAAATTACTATTCCAGACACAACGAGAGAAAAATATATCTATTTAACGCAATAATT
-TTCGAAAAATGGTTTTTCTCTCTATAAAAATATGATATGA
--- a/test-data/b_out_dev/reference/ref.fa	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,13 +0,0 @@
->reference
-TCCACAAGCCATTGTGTGTAATTAACCACTAATTGTGTATAAGTTTAAACTAATTGAAAA
-GGTTATCCACAATAAAAAGGCGTTATTCAGGAGTTATCCACACTTTCTAGGAAAGGATTT
-CATTGCGCCAATGTGTTAAACTATTTACCGAATACGAAAAAAAGACAAATAAATGAGGTT
-GTGAAAAATGATATTTCAACGGCTTTTGAAAACTAGAGATACAGAGTTTTATCGAGTTAT
-ACAAAACAGGAATATTGACGACGTATTTGGATACTTATTAATTCACGATAAACGGGAACC
-AGCAGAAATTGACGATTTTAAGGTATTTGCAAAAAGTAATATAAATAAAGAAGCTTTTTC
-AGTGAATATCAAAAAAAATCATATTTACACGATGTTTTTCCACTTTACTGATTTAGAGGA
-AGAACAGGAAATTCCAAAATTTACTAAAGTTATTCGTTTTATAGAAGGACTTTTATCTTT
-TCAGCCAGAAACAAGCCATTACGTTGATAACTATTTAATAAAGGAAAAACTAATTTTTGA
-ATATCCTGCTGAATTTGAGAAAATCGGGGAGTTTGCTAAATATTTAGTAAAGCTTTCGGG
-TCGTAAAATTACTATTCCAGACACAACGAGAGAAAAATATATCTATTTAACGCAATAATT
-TTCGAAAAATGGTTTTTCTCTCTATAAAAATATGATATGA
--- a/test-data/b_out_dev/reference/ref.fa.amb	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-700 1 0
--- a/test-data/b_out_dev/reference/ref.fa.ann	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,3 +0,0 @@
-700 1 11
-0 reference (null)
-0 700 0
Binary file test-data/b_out_dev/reference/ref.fa.bwt has changed
--- a/test-data/b_out_dev/reference/ref.fa.fai	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-reference	700	11	60	61
Binary file test-data/b_out_dev/reference/ref.fa.pac has changed
Binary file test-data/b_out_dev/reference/ref.fa.sa has changed
--- a/test-data/b_out_dev/reference/ref.txt	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-reference:0-700
Binary file test-data/b_out_dev/reference/ref/genes.gff.gz has changed
--- a/test-data/b_out_dev/snps.aligned.fa	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,13 +0,0 @@
->reference
-TCCTCAAGCCATTGTGTGTAATTAACCACTAATTGTGTATAAGTTTAAACT---------
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-----------------------------------------
Binary file test-data/b_out_dev/snps.bam has changed
Binary file test-data/b_out_dev/snps.bam.bai has changed
--- a/test-data/b_out_dev/snps.bed	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-reference	3	4
--- a/test-data/b_out_dev/snps.consensus.fa	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,13 +0,0 @@
->reference
-TCCTCAAGCCATTGTGTGTAATTAACCACTAATTGTGTATAAGTTTAAACTAATTGAAAA
-GGTTATCCACAATAAAAAGGCGTTATTCAGGAGTTATCCACACTTTCTAGGAAAGGATTT
-CATTGCGCCAATGTGTTAAACTATTTACCGAATACGAAAAAAAGACAAATAAATGAGGTT
-GTGAAAAATGATATTTCAACGGCTTTTGAAAACTAGAGATACAGAGTTTTATCGAGTTAT
-ACAAAACAGGAATATTGACGACGTATTTGGATACTTATTAATTCACGATAAACGGGAACC
-AGCAGAAATTGACGATTTTAAGGTATTTGCAAAAAGTAATATAAATAAAGAAGCTTTTTC
-AGTGAATATCAAAAAAAATCATATTTACACGATGTTTTTCCACTTTACTGATTTAGAGGA
-AGAACAGGAAATTCCAAAATTTACTAAAGTTATTCGTTTTATAGAAGGACTTTTATCTTT
-TCAGCCAGAAACAAGCCATTACGTTGATAACTATTTAATAAAGGAAAAACTAATTTTTGA
-ATATCCTGCTGAATTTGAGAAAATCGGGGAGTTTGCTAAATATTTAGTAAAGCTTTCGGG
-TCGTAAAATTACTATTCCAGACACAACGAGAGAAAAATATATCTATTTAACGCAATAATT
-TTCGAAAAATGGTTTTTCTCTCTATAAAAATATGATATGA
--- a/test-data/b_out_dev/snps.consensus.subs.fa	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,13 +0,0 @@
->reference
-TCCTCAAGCCATTGTGTGTAATTAACCACTAATTGTGTATAAGTTTAAACTAATTGAAAA
-GGTTATCCACAATAAAAAGGCGTTATTCAGGAGTTATCCACACTTTCTAGGAAAGGATTT
-CATTGCGCCAATGTGTTAAACTATTTACCGAATACGAAAAAAAGACAAATAAATGAGGTT
-GTGAAAAATGATATTTCAACGGCTTTTGAAAACTAGAGATACAGAGTTTTATCGAGTTAT
-ACAAAACAGGAATATTGACGACGTATTTGGATACTTATTAATTCACGATAAACGGGAACC
-AGCAGAAATTGACGATTTTAAGGTATTTGCAAAAAGTAATATAAATAAAGAAGCTTTTTC
-AGTGAATATCAAAAAAAATCATATTTACACGATGTTTTTCCACTTTACTGATTTAGAGGA
-AGAACAGGAAATTCCAAAATTTACTAAAGTTATTCGTTTTATAGAAGGACTTTTATCTTT
-TCAGCCAGAAACAAGCCATTACGTTGATAACTATTTAATAAAGGAAAAACTAATTTTTGA
-ATATCCTGCTGAATTTGAGAAAATCGGGGAGTTTGCTAAATATTTAGTAAAGCTTTCGGG
-TCGTAAAATTACTATTCCAGACACAACGAGAGAAAAATATATCTATTTAACGCAATAATT
-TTCGAAAAATGGTTTTTCTCTCTATAAAAATATGATATGA
--- a/test-data/b_out_dev/snps.csv	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-CHROM,POS,TYPE,REF,ALT,EVIDENCE,FTYPE,STRAND,NT_POS,AA_POS,EFFECT,LOCUS_TAG,GENE,PRODUCT
-reference,4,snp,A,T,T:10 A:0
--- a/test-data/b_out_dev/snps.filt.vcf	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,28 +0,0 @@
-##fileformat=VCFv4.2
-##FILTER=<ID=PASS,Description="All filters passed">
-##fileDate=20190312
-##source=freeBayes v1.2.0-dirty
-##reference=reference/ref.fa
-##contig=<ID=reference,length=700>
-##phasing=none
-##commandline="freebayes -p 2 -P 0 -C 2 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 2 -F 0.05 -f reference/ref.fa snps.bam --region reference:0-700"
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
-##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype.">
-##INFO=<ID=AO,Number=A,Type=Integer,Description="Count of full observations of this alternate haplotype.">
-##INFO=<ID=QR,Number=1,Type=Integer,Description="Reference allele quality sum in phred">
-##INFO=<ID=QA,Number=A,Type=Integer,Description="Alternate allele quality sum in phred">
-##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
-##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
-##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
-##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
-##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
-##bcftools_viewVersion=1.9+htslib-1.9
-##bcftools_viewCommand=view --include 'FMT/GT="1/1" && QUAL>=60.0 && FMT/DP>=2 && (FMT/AO)/(FMT/DP)>=0.9' snps.raw.vcf; Date=Tue Mar 12 14:35:28 2019
-##bcftools_annotateVersion=1.9+htslib-1.9
-##bcftools_annotateCommand=annotate --remove ^INFO/TYPE,^INFO/DP,^INFO/RO,^INFO/AO,^INFO/AB,^FORMAT/GT,^FORMAT/DP,^FORMAT/RO,^FORMAT/AO,^FORMAT/QR,^FORMAT/QA,^FORMAT/GL; Date=Tue Mar 12 14:35:28 2019
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	b
-reference	4	.	A	T	321.326	.	AB=0;AO=10;DP=10;QA=400;QR=0;RO=0;TYPE=snp	GT:DP:RO:QR:AO:QA:GL	1/1:10:0:0:10:400:-36.3607,-3.0103,0
--- a/test-data/b_out_dev/snps.gff	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-##gff-version 3
-reference	snippy:4.3.6	variation	4	4	.	.	0	note=snp A=>T T:10 A:0
--- a/test-data/b_out_dev/snps.html	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,24 +0,0 @@
-<TABLE ID='snps' BORDER=1>
-<TR>
-<TH>CHROM
-<TH>POS
-<TH>TYPE
-<TH>REF
-<TH>ALT
-<TH>EVIDENCE
-<TH>FTYPE
-<TH>STRAND
-<TH>NT_POS
-<TH>AA_POS
-<TH>EFFECT
-<TH>LOCUS_TAG
-<TH>GENE
-<TH>PRODUCT
-<TR>
-<TD>reference
-<TD>4
-<TD>snp
-<TD>A
-<TD>T
-<TD>T:10 A:0
-</TABLE>
--- a/test-data/b_out_dev/snps.log	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,261 +0,0 @@
-### cd /home/dfornika/Code/tools-iuc/tools/snippy/test-data
-
-### /home/dfornika/miniconda3/envs/snippy-4.3.6/bin/snippy --outdir b_out_dev --ref ref.fna --mapqual 60 --mincov 2 --minfrac 0.9 --minqual 60.0 --R1 b_1.fastq --R2 b_2.fastq
-
-### samtools faidx reference/ref.fa
-
-
-### bwa index reference/ref.fa
-
-[bwa_index] Pack FASTA... 0.00 sec
-[bwa_index] Construct BWT for the packed sequence...
-[bwa_index] 0.00 seconds elapse.
-[bwa_index] Update BWT... 0.00 sec
-[bwa_index] Pack forward-only FASTA... 0.00 sec
-[bwa_index] Construct SA from BWT and Occ... 0.00 sec
-[main] Version: 0.7.17-r1188
-[main] CMD: bwa index reference/ref.fa
-[main] Real time: 0.009 sec; CPU: 0.003 sec
-
-### mkdir -p reference/genomes && cp -f reference/ref.fa reference/genomes/ref.fa
-
-
-### ln -sf reference/ref.fa .
-
-
-### ln -sf reference/ref.fa.fai .
-
-
-### mkdir -p reference/ref && gzip -c reference/ref.gff > reference/ref/genes.gff.gz
-
-
-### bwa mem  -Y -M -R '@RG\tID:b_out_dev\tSM:b_out_dev' -t 8 reference/ref.fa /home/dfornika/Code/tools-iuc/tools/snippy/test-data/b_1.fastq /home/dfornika/Code/tools-iuc/tools/snippy/test-data/b_2.fastq | samclip --max 10 --ref reference/ref.fa.fai | samtools sort -n -l 0 -T /tmp/snippy.9396. --threads 8 -m 1000M | samtools fixmate -m - - | samtools sort -l 0 -T /tmp/snippy.9396. --threads 8 -m 1000M | samtools markdup -T /tmp/snippy.9396. -r -s - - > snps.bam
-
-READ 10 WRITTEN 10 
-EXCLUDED 0 EXAMINED 10
-PAIRED 10 SINGLE 0
-DULPICATE PAIR 0 DUPLICATE SINGLE 0
-DUPLICATE TOTAL 0
-
-### samtools index snps.bam
-
-
-### fasta_generate_regions.py reference/ref.fa.fai 1000 > reference/ref.txt
-
-
-### freebayes-parallel reference/ref.txt 8 -p 2 -P 0 -C 2 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 2 -F 0.05  -f reference/ref.fa snps.bam > snps.raw.vcf
-
-
-### bcftools view --include 'FMT/GT="1/1" && QUAL>=60.0 && FMT/DP>=2 && (FMT/AO)/(FMT/DP)>=0.9' snps.raw.vcf  | vt normalize -r reference/ref.fa - | bcftools annotate --remove '^INFO/TYPE,^INFO/DP,^INFO/RO,^INFO/AO,^INFO/AB,^FORMAT/GT,^FORMAT/DP,^FORMAT/RO,^FORMAT/AO,^FORMAT/QR,^FORMAT/QA,^FORMAT/GL' > snps.filt.vcf
-
-
-### cp snps.filt.vcf snps.vcf
-
-
-### /home/dfornika/miniconda3/envs/snippy-4.3.6/bin/snippy-vcf_to_tab --gff reference/ref.gff --ref reference/ref.fa --vcf snps.vcf > snps.tab
-
-Loading reference: reference/ref.fa
-Loaded 1 sequences.
-Loading features: reference/ref.gff
-Parsing variants: snps.vcf
-Converted 1 SNPs to TAB format.
-
-### /home/dfornika/miniconda3/envs/snippy-4.3.6/bin/snippy-vcf_extract_subs snps.filt.vcf > snps.subs.vcf
-
-
-### bcftools convert -Oz -o snps.vcf.gz snps.vcf
-
-
-### bcftools index -f snps.vcf.gz
-
-
-### bcftools consensus -f reference/ref.fa -o snps.consensus.fa snps.vcf.gz
-
-Note: the --sample option not given, applying all records regardless of the genotype
-
-### bcftools convert -Oz -o snps.subs.vcf.gz snps.subs.vcf
-
-
-### bcftools index -f snps.subs.vcf.gz
-
-
-### bcftools consensus -f reference/ref.fa -o snps.consensus.subs.fa snps.subs.vcf.gz
-
-Note: the --sample option not given, applying all records regardless of the genotype
-
-### rm -f snps.subs.vcf.gz snps.subs.vcf.gz.csi snps.subs.vcf.gz.tbi
-
-### cd /home/dfornika/Code/tools-iuc/tools/snippy/test-data
-
-### /home/dfornika/miniconda3/envs/snippy-4.3.6/bin/snippy --force --outdir b_out_dev --rgid b --ref ref.fna --mapqual 60 --mincov 2 --minfrac 0.9 --minqual 60.0 --R1 b_1.fastq --R2 b_2.fastq
-
-### samtools faidx reference/ref.fa
-
-
-### bwa index reference/ref.fa
-
-[bwa_index] Pack FASTA... 0.00 sec
-[bwa_index] Construct BWT for the packed sequence...
-[bwa_index] 0.00 seconds elapse.
-[bwa_index] Update BWT... 0.00 sec
-[bwa_index] Pack forward-only FASTA... 0.00 sec
-[bwa_index] Construct SA from BWT and Occ... 0.00 sec
-[main] Version: 0.7.17-r1188
-[main] CMD: bwa index reference/ref.fa
-[main] Real time: 0.008 sec; CPU: 0.002 sec
-
-### mkdir -p reference/genomes && cp -f reference/ref.fa reference/genomes/ref.fa
-
-
-### ln -sf reference/ref.fa .
-
-
-### ln -sf reference/ref.fa.fai .
-
-
-### mkdir -p reference/ref && gzip -c reference/ref.gff > reference/ref/genes.gff.gz
-
-
-### bwa mem  -Y -M -R '@RG\tID:b\tSM:b' -t 8 reference/ref.fa /home/dfornika/Code/tools-iuc/tools/snippy/test-data/b_1.fastq /home/dfornika/Code/tools-iuc/tools/snippy/test-data/b_2.fastq | samclip --max 10 --ref reference/ref.fa.fai | samtools sort -n -l 0 -T /tmp/snippy.10001. --threads 8 -m 1000M | samtools fixmate -m - - | samtools sort -l 0 -T /tmp/snippy.10001. --threads 8 -m 1000M | samtools markdup -T /tmp/snippy.10001. -r -s - - > snps.bam
-
-READ 10 WRITTEN 10 
-EXCLUDED 0 EXAMINED 10
-PAIRED 10 SINGLE 0
-DULPICATE PAIR 0 DUPLICATE SINGLE 0
-DUPLICATE TOTAL 0
-
-### samtools index snps.bam
-
-
-### fasta_generate_regions.py reference/ref.fa.fai 1000 > reference/ref.txt
-
-
-### freebayes-parallel reference/ref.txt 8 -p 2 -P 0 -C 2 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 2 -F 0.05  -f reference/ref.fa snps.bam > snps.raw.vcf
-
-
-### bcftools view --include 'FMT/GT="1/1" && QUAL>=60.0 && FMT/DP>=2 && (FMT/AO)/(FMT/DP)>=0.9' snps.raw.vcf  | vt normalize -r reference/ref.fa - | bcftools annotate --remove '^INFO/TYPE,^INFO/DP,^INFO/RO,^INFO/AO,^INFO/AB,^FORMAT/GT,^FORMAT/DP,^FORMAT/RO,^FORMAT/AO,^FORMAT/QR,^FORMAT/QA,^FORMAT/GL' > snps.filt.vcf
-
-
-### cp snps.filt.vcf snps.vcf
-
-
-### /home/dfornika/miniconda3/envs/snippy-4.3.6/bin/snippy-vcf_to_tab --gff reference/ref.gff --ref reference/ref.fa --vcf snps.vcf > snps.tab
-
-Loading reference: reference/ref.fa
-Loaded 1 sequences.
-Loading features: reference/ref.gff
-Parsing variants: snps.vcf
-Converted 1 SNPs to TAB format.
-
-### /home/dfornika/miniconda3/envs/snippy-4.3.6/bin/snippy-vcf_extract_subs snps.filt.vcf > snps.subs.vcf
-
-
-### bcftools convert -Oz -o snps.vcf.gz snps.vcf
-
-
-### bcftools index -f snps.vcf.gz
-
-
-### bcftools consensus -f reference/ref.fa -o snps.consensus.fa snps.vcf.gz
-
-Note: the --sample option not given, applying all records regardless of the genotype
-
-### bcftools convert -Oz -o snps.subs.vcf.gz snps.subs.vcf
-
-
-### bcftools index -f snps.subs.vcf.gz
-
-
-### bcftools consensus -f reference/ref.fa -o snps.consensus.subs.fa snps.subs.vcf.gz
-
-Note: the --sample option not given, applying all records regardless of the genotype
-
-### rm -f snps.subs.vcf.gz snps.subs.vcf.gz.csi snps.subs.vcf.gz.tbi
-
-### cd /home/dfornika/Code/tools-iuc/tools/snippy/test-data
-
-### /home/dfornika/miniconda3/envs/snippy-4.3.6/bin/snippy --force --outdir b_out_dev --rgid b --ref ref.fna --mapqual 60 --mincov 2 --minfrac 0.9 --minqual 60.0 --R1 b_1.fastq --R2 b_2.fastq
-
-### samtools faidx reference/ref.fa
-
-
-### bwa index reference/ref.fa
-
-[bwa_index] Pack FASTA... 0.00 sec
-[bwa_index] Construct BWT for the packed sequence...
-[bwa_index] 0.00 seconds elapse.
-[bwa_index] Update BWT... 0.00 sec
-[bwa_index] Pack forward-only FASTA... 0.00 sec
-[bwa_index] Construct SA from BWT and Occ... 0.00 sec
-[main] Version: 0.7.17-r1188
-[main] CMD: bwa index reference/ref.fa
-[main] Real time: 0.009 sec; CPU: 0.003 sec
-
-### mkdir -p reference/genomes && cp -f reference/ref.fa reference/genomes/ref.fa
-
-
-### ln -sf reference/ref.fa .
-
-
-### ln -sf reference/ref.fa.fai .
-
-
-### mkdir -p reference/ref && gzip -c reference/ref.gff > reference/ref/genes.gff.gz
-
-
-### bwa mem  -Y -M -R '@RG\tID:b\tSM:b' -t 8 reference/ref.fa /home/dfornika/Code/tools-iuc/tools/snippy/test-data/b_1.fastq /home/dfornika/Code/tools-iuc/tools/snippy/test-data/b_2.fastq | samclip --max 10 --ref reference/ref.fa.fai | samtools sort -n -l 0 -T /tmp/snippy.22109. --threads 8 -m 1000M | samtools fixmate -m - - | samtools sort -l 0 -T /tmp/snippy.22109. --threads 8 -m 1000M | samtools markdup -T /tmp/snippy.22109. -r -s - - > snps.bam
-
-READ 10 WRITTEN 10 
-EXCLUDED 0 EXAMINED 10
-PAIRED 10 SINGLE 0
-DULPICATE PAIR 0 DUPLICATE SINGLE 0
-DUPLICATE TOTAL 0
-
-### samtools index snps.bam
-
-
-### fasta_generate_regions.py reference/ref.fa.fai 1000 > reference/ref.txt
-
-
-### freebayes-parallel reference/ref.txt 8 -p 2 -P 0 -C 2 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 2 -F 0.05  -f reference/ref.fa snps.bam > snps.raw.vcf
-
-
-### bcftools view --include 'FMT/GT="1/1" && QUAL>=60.0 && FMT/DP>=2 && (FMT/AO)/(FMT/DP)>=0.9' snps.raw.vcf  | vt normalize -r reference/ref.fa - | bcftools annotate --remove '^INFO/TYPE,^INFO/DP,^INFO/RO,^INFO/AO,^INFO/AB,^FORMAT/GT,^FORMAT/DP,^FORMAT/RO,^FORMAT/AO,^FORMAT/QR,^FORMAT/QA,^FORMAT/GL' > snps.filt.vcf
-
-
-### cp snps.filt.vcf snps.vcf
-
-
-### /home/dfornika/miniconda3/envs/snippy-4.3.6/bin/snippy-vcf_to_tab --gff reference/ref.gff --ref reference/ref.fa --vcf snps.vcf > snps.tab
-
-Loading reference: reference/ref.fa
-Loaded 1 sequences.
-Loading features: reference/ref.gff
-Parsing variants: snps.vcf
-Converted 1 SNPs to TAB format.
-
-### /home/dfornika/miniconda3/envs/snippy-4.3.6/bin/snippy-vcf_extract_subs snps.filt.vcf > snps.subs.vcf
-
-
-### bcftools convert -Oz -o snps.vcf.gz snps.vcf
-
-
-### bcftools index -f snps.vcf.gz
-
-
-### bcftools consensus -f reference/ref.fa -o snps.consensus.fa snps.vcf.gz
-
-Note: the --sample option not given, applying all records regardless of the genotype
-
-### bcftools convert -Oz -o snps.subs.vcf.gz snps.subs.vcf
-
-
-### bcftools index -f snps.subs.vcf.gz
-
-
-### bcftools consensus -f reference/ref.fa -o snps.consensus.subs.fa snps.subs.vcf.gz
-
-Note: the --sample option not given, applying all records regardless of the genotype
-
-### rm -f snps.subs.vcf.gz snps.subs.vcf.gz.csi snps.subs.vcf.gz.tbi
-
--- a/test-data/b_out_dev/snps.raw.vcf	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,62 +0,0 @@
-##fileformat=VCFv4.2
-##fileDate=20190312
-##source=freeBayes v1.2.0-dirty
-##reference=reference/ref.fa
-##contig=<ID=reference,length=700>
-##phasing=none
-##commandline="freebayes -p 2 -P 0 -C 2 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 2 -F 0.05 -f reference/ref.fa snps.bam --region reference:0-700"
-##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
-##INFO=<ID=DPB,Number=1,Type=Float,Description="Total read depth per bp at the locus; bases in reads overlapping / bases in haplotype">
-##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
-##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
-##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1]">
-##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype.">
-##INFO=<ID=AO,Number=A,Type=Integer,Description="Count of full observations of this alternate haplotype.">
-##INFO=<ID=PRO,Number=1,Type=Float,Description="Reference allele observation count, with partial observations recorded fractionally">
-##INFO=<ID=PAO,Number=A,Type=Float,Description="Alternate allele observations, with partial observations recorded fractionally">
-##INFO=<ID=QR,Number=1,Type=Integer,Description="Reference allele quality sum in phred">
-##INFO=<ID=QA,Number=A,Type=Integer,Description="Alternate allele quality sum in phred">
-##INFO=<ID=PQR,Number=1,Type=Float,Description="Reference allele quality sum in phred for partial observations">
-##INFO=<ID=PQA,Number=A,Type=Float,Description="Alternate allele quality sum in phred for partial observations">
-##INFO=<ID=SRF,Number=1,Type=Integer,Description="Number of reference observations on the forward strand">
-##INFO=<ID=SRR,Number=1,Type=Integer,Description="Number of reference observations on the reverse strand">
-##INFO=<ID=SAF,Number=A,Type=Integer,Description="Number of alternate observations on the forward strand">
-##INFO=<ID=SAR,Number=A,Type=Integer,Description="Number of alternate observations on the reverse strand">
-##INFO=<ID=SRP,Number=1,Type=Float,Description="Strand balance probability for the reference allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SRF and SRR given E(SRF/SRR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=SAP,Number=A,Type=Float,Description="Strand balance probability for the alternate allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SAF and SAR given E(SAF/SAR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
-##INFO=<ID=ABP,Number=A,Type=Float,Description="Allele balance probability at heterozygous sites: Phred-scaled upper-bounds estimate of the probability of observing the deviation between ABR and ABA given E(ABR/ABA) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=RUN,Number=A,Type=Integer,Description="Run length: the number of consecutive repeats of the alternate allele in the reference genome">
-##INFO=<ID=RPP,Number=A,Type=Float,Description="Read Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=RPPR,Number=1,Type=Float,Description="Read Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=RPL,Number=A,Type=Float,Description="Reads Placed Left: number of reads supporting the alternate balanced to the left (5') of the alternate allele">
-##INFO=<ID=RPR,Number=A,Type=Float,Description="Reads Placed Right: number of reads supporting the alternate balanced to the right (3') of the alternate allele">
-##INFO=<ID=EPP,Number=A,Type=Float,Description="End Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=EPPR,Number=1,Type=Float,Description="End Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
-##INFO=<ID=DPRA,Number=A,Type=Float,Description="Alternate allele depth ratio.  Ratio between depth in samples with each called alternate allele and those without.">
-##INFO=<ID=ODDS,Number=1,Type=Float,Description="The log odds ratio of the best genotype combination to the second-best.">
-##INFO=<ID=GTI,Number=1,Type=Integer,Description="Number of genotyping iterations required to reach convergence or bailout.">
-##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
-##INFO=<ID=CIGAR,Number=A,Type=String,Description="The extended CIGAR representation of each alternate allele, with the exception that '=' is replaced by 'M' to ease VCF parsing.  Note that INDEL alleles do not have the first matched base (which is provided by default, per the spec) referred to by the CIGAR.">
-##INFO=<ID=NUMALT,Number=1,Type=Integer,Description="Number of unique non-reference alleles in called genotypes at this position.">
-##INFO=<ID=MEANALT,Number=A,Type=Float,Description="Mean number of unique non-reference allele observations per sample with the corresponding alternate alleles.">
-##INFO=<ID=LEN,Number=A,Type=Integer,Description="allele length">
-##INFO=<ID=MQM,Number=A,Type=Float,Description="Mean mapping quality of observed alternate alleles">
-##INFO=<ID=MQMR,Number=1,Type=Float,Description="Mean mapping quality of observed reference alleles">
-##INFO=<ID=PAIRED,Number=A,Type=Float,Description="Proportion of observed alternate alleles which are supported by properly paired read fragments">
-##INFO=<ID=PAIREDR,Number=1,Type=Float,Description="Proportion of observed reference alleles which are supported by properly paired read fragments">
-##INFO=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum depth in gVCF output block.">
-##INFO=<ID=END,Number=1,Type=Integer,Description="Last position (inclusive) in gVCF output record.">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype">
-##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Number of observation for each allele">
-##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
-##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
-##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
-##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
-##FORMAT=<ID=MIN_DP,Number=1,Type=Integer,Description="Minimum depth in gVCF output block.">
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	b
-reference	4	.	A	T	321.326	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=10;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=18.4681;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=400;QR=0;RO=0;RPL=0;RPP=24.725;RPPR=0;RPR=10;RUN=1;SAF=5;SAP=3.0103;SAR=5;SRF=0;SRP=0;SRR=0;TYPE=snp	GT:DP:AD:RO:QR:AO:QA:GL	1/1:10:0,10:0:0:10:400:-36.3607,-3.0103,0
--- a/test-data/b_out_dev/snps.subs.vcf	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,27 +0,0 @@
-##fileformat=VCFv4.2
-##snippy="snippy-vcf_extract_subs snps.filt.vcf"
-##fileformat=VCFv4.2
-##FILTER=<ID=PASS,Description="All filters passed">
-##fileDate=20190312
-##source=freeBayes v1.2.0-dirty
-##reference=reference/ref.fa
-##contig=<ID=reference,length=700>
-##phasing=none
-##commandline="freebayes -p 2 -P 0 -C 2 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 2 -F 0.05 -f reference/ref.fa snps.bam --region reference:0-700"
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
-##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype.">
-##INFO=<ID=AO,Number=A,Type=Integer,Description="Count of full observations of this alternate haplotype.">
-##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
-##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
-##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
-##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
-##bcftools_viewVersion=1.9+htslib-1.9
-##bcftools_viewCommand=view --include 'FMT/GT="1/1" && QUAL>=60.0 && FMT/DP>=2 && (FMT/AO)/(FMT/DP)>=0.9' snps.raw.vcf; Date=Tue Mar 12 14:35:28 2019
-##bcftools_annotateVersion=1.9+htslib-1.9
-##bcftools_annotateCommand=annotate --remove ^INFO/TYPE,^INFO/DP,^INFO/RO,^INFO/AO,^INFO/AB,^FORMAT/GT,^FORMAT/DP,^FORMAT/RO,^FORMAT/AO,^FORMAT/QR,^FORMAT/QA,^FORMAT/GL; Date=Tue Mar 12 14:35:28 2019
-##INFO=<ID=OLDVAR,Number=R,Type=String,Description="Original REF,ALT before decomposition">
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	b
-reference	4	.	A	T	321.326	.	TYPE=snp;DP=10;RO=0;AO=10	GT:DP:RO:AO:QR:QA	1/1:10:0:10:0:400
--- a/test-data/b_out_dev/snps.tab	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-CHROM	POS	TYPE	REF	ALT	EVIDENCE	FTYPE	STRAND	NT_POS	AA_POS	EFFECT	LOCUS_TAG	GENE	PRODUCT
-reference	4	snp	A	T	T:10 A:0								
--- a/test-data/b_out_dev/snps.txt	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-DateTime	2019-03-12T14:35:28
-ReadFiles	/home/dfornika/Code/tools-iuc/tools/snippy/test-data/b_1.fastq /home/dfornika/Code/tools-iuc/tools/snippy/test-data/b_2.fastq
-Reference	/home/dfornika/Code/tools-iuc/tools/snippy/test-data/ref.fna
-ReferenceSize	700
-Software	snippy 4.3.6
-Variant-SNP	1
-VariantTotal	1
--- a/test-data/b_out_dev/snps.vcf	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,28 +0,0 @@
-##fileformat=VCFv4.2
-##FILTER=<ID=PASS,Description="All filters passed">
-##fileDate=20190312
-##source=freeBayes v1.2.0-dirty
-##reference=reference/ref.fa
-##contig=<ID=reference,length=700>
-##phasing=none
-##commandline="freebayes -p 2 -P 0 -C 2 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 2 -F 0.05 -f reference/ref.fa snps.bam --region reference:0-700"
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
-##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype.">
-##INFO=<ID=AO,Number=A,Type=Integer,Description="Count of full observations of this alternate haplotype.">
-##INFO=<ID=QR,Number=1,Type=Integer,Description="Reference allele quality sum in phred">
-##INFO=<ID=QA,Number=A,Type=Integer,Description="Alternate allele quality sum in phred">
-##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
-##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
-##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
-##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
-##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
-##bcftools_viewVersion=1.9+htslib-1.9
-##bcftools_viewCommand=view --include 'FMT/GT="1/1" && QUAL>=60.0 && FMT/DP>=2 && (FMT/AO)/(FMT/DP)>=0.9' snps.raw.vcf; Date=Tue Mar 12 14:35:28 2019
-##bcftools_annotateVersion=1.9+htslib-1.9
-##bcftools_annotateCommand=annotate --remove ^INFO/TYPE,^INFO/DP,^INFO/RO,^INFO/AO,^INFO/AB,^FORMAT/GT,^FORMAT/DP,^FORMAT/RO,^FORMAT/AO,^FORMAT/QR,^FORMAT/QA,^FORMAT/GL; Date=Tue Mar 12 14:35:28 2019
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	b
-reference	4	.	A	T	321.326	.	AB=0;AO=10;DP=10;QA=400;QR=0;RO=0;TYPE=snp	GT:DP:RO:QR:AO:QA:GL	1/1:10:0:0:10:400:-36.3607,-3.0103,0
Binary file test-data/b_out_dev/snps.vcf.gz has changed
Binary file test-data/b_out_dev/snps.vcf.gz.csi has changed
Binary file test-data/c.dat has changed
Binary file test-data/c.tgz has changed
--- a/test-data/core/core.txt	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,5 +0,0 @@
-ID	LENGTH	ALIGNED	UNALIGNED	VARIANT	HET	MASKED	LOWCOV
-a	700	51	649	0	0	0	0
-b	700	51	649	1	0	0	0
-c	700	51	649	1	0	0	0
-Reference	700	700	0	0	0	0	0
--- a/test-data/fna_ref_a/snps.gff	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-##gff-version 3
--- a/test-data/fna_ref_a/snps.txt	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,6 +0,0 @@
-DateTime	1970-01-01T00:00:00
-ReadFiles	a_1.fastq a_2.fastq
-Reference	reference.fasta
-ReferenceSize	700
-Software	snippy 4.3.6
-VariantTotal	0
--- a/test-data/fna_ref_b/snps.gff	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-##gff-version 3
-reference	snippy:4.3.6	variation	4	4	.	.	0	note=snp A=>T T:10 A:0
--- a/test-data/fna_ref_b/snps.txt	Tue Mar 12 17:37:29 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-DateTime	1970-01-01T00:00:00
-ReadFiles	b_1.fastq b_2.fastq
-Reference	reference.fasta
-ReferenceSize	700
-Software	snippy 4.3.6
-Variant-SNP	1
-VariantTotal	1