Mercurial > repos > devteam > fastqc
diff test-data/fastqc_data_nogroup.txt @ 22:a35575615aa4 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 9aa395df821f0d3607867c83536ac97f9ffe8b29
| author | iuc |
|---|---|
| date | Thu, 08 Jun 2023 20:01:52 +0000 |
| parents | b44429593dd8 |
| children |
line wrap: on
line diff
--- a/test-data/fastqc_data_nogroup.txt Sun Sep 12 11:19:52 2021 +0000 +++ b/test-data/fastqc_data_nogroup.txt Thu Jun 08 20:01:52 2023 +0000 @@ -1,10 +1,11 @@ -##FastQC 0.11.9 +##FastQC 0.12.1 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4905 +Total Bases 254.2 kbp Sequences flagged as poor quality 0 Sequence length 1-108 %GC 40 @@ -577,125 +578,125 @@ >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.73598369011212 -#Duplication Level Percentage of deduplicated Percentage of total -1 99.44249432170142 98.1855249745158 -2 0.47491224447656405 0.9378185524974516 -3 0.041296716911005574 0.12232415902140673 -4 0.020648358455502787 0.08154943934760449 -5 0.0 0.0 -6 0.0 0.0 -7 0.0 0.0 -8 0.0 0.0 -9 0.0 0.0 ->10 0.020648358455502787 0.672782874617737 ->50 0.0 0.0 ->100 0.0 0.0 ->500 0.0 0.0 ->1k 0.0 0.0 ->5k 0.0 0.0 ->10k+ 0.0 0.0 +#Duplication Level Percentage of total +1 98.1855249745158 +2 0.9378185524974516 +3 0.12232415902140673 +4 0.08154943934760449 +5 0.0 +6 0.0 +7 0.0 +8 0.0 +9 0.0 +>10 0.672782874617737 +>50 0.0 +>100 0.0 +>500 0.0 +>1k 0.0 +>5k 0.0 +>10k+ 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672782874617737 No Hit >>END_MODULE >>Adapter Content pass -#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter -1 0.0 0.0 0.0 0.0 0.0 -2 0.0 0.0 0.0 0.0 0.0 -3 0.0 0.0 0.0 0.0 0.0 -4 0.0 0.0 0.0 0.0 0.0 -5 0.0 0.0 0.0 0.0 0.0 -6 0.0 0.0 0.0 0.0 0.0 -7 0.0 0.0 0.0 0.0 0.0 -8 0.0 0.0 0.0 0.0 0.0 -9 0.0 0.0 0.0 0.0 0.0 -10 0.0 0.0 0.0 0.0 0.0 -11 0.0 0.0 0.0 0.0 0.0 -12 0.0 0.0 0.0 0.0 0.0 -13 0.0 0.0 0.0 0.0 0.0 -14 0.0 0.0 0.0 0.0 0.0 -15 0.0 0.0 0.0 0.0 0.0 -16 0.0 0.0 0.0 0.0 0.0 -17 0.0 0.0 0.0 0.0 0.0 -18 0.0 0.0 0.0 0.0 0.0 -19 0.0 0.0 0.0 0.0 0.0 -20 0.12232415902140673 0.0 0.0 0.0 0.0 -21 0.12232415902140673 0.0 0.0 0.0 0.0 -22 0.12232415902140673 0.0 0.0 0.0 0.0 -23 0.12232415902140673 0.0 0.0 0.0 0.0 -24 0.12232415902140673 0.0 0.0 0.0 0.0 -25 0.12232415902140673 0.0 0.0 0.0 0.0 -26 0.12232415902140673 0.0 0.0 0.0 0.0 -27 0.14271151885830785 0.0 0.0 0.0 0.0 -28 0.1834862385321101 0.0 0.0 0.0 0.0 -29 0.22426095820591233 0.0 0.0 0.0 0.0 -30 0.22426095820591233 0.0 0.0 0.0 0.0 -31 0.22426095820591233 0.0 0.0 0.0 0.0 -32 0.22426095820591233 0.0 0.0 0.0 0.0 -33 0.22426095820591233 0.0 0.0 0.0 0.0 -34 0.22426095820591233 0.0 0.0 0.0 0.0 -35 0.2650356778797146 0.0 0.0 0.0 0.0 -36 0.2854230377166157 0.0 0.0 0.0 0.0 -37 0.32619775739041795 0.0 0.0 0.0 0.0 -38 0.4077471967380224 0.0 0.0 0.0 0.0 -39 0.4689092762487258 0.0 0.0 0.0 0.0 -40 0.4689092762487258 0.0 0.0 0.0 0.0 -41 0.4689092762487258 0.0 0.0 0.0 0.0 -42 0.4689092762487258 0.0 0.0 0.0 0.0 -43 0.4689092762487258 0.0 0.0 0.0 0.0 -44 0.4689092762487258 0.0 0.0 0.0 0.0 -45 0.4689092762487258 0.0 0.0 0.0 0.0 -46 0.4689092762487258 0.0 0.0 0.0 0.0 -47 0.4689092762487258 0.0 0.0 0.0 0.0 -48 0.4689092762487258 0.0 0.0 0.0 0.0 -49 0.4689092762487258 0.0 0.0 0.0 0.0 -50 0.4689092762487258 0.0 0.0 0.0 0.0 -51 0.4689092762487258 0.0 0.0 0.0 0.0 -52 0.4689092762487258 0.0 0.0 0.0 0.0 -53 0.4689092762487258 0.0 0.0 0.0 0.0 -54 0.4689092762487258 0.0 0.0 0.0 0.0 -55 0.4689092762487258 0.0 0.0 0.0 0.0 -56 0.4689092762487258 0.0 0.0 0.0 0.0 -57 0.4689092762487258 0.0 0.0 0.0 0.0 -58 0.4689092762487258 0.0 0.0 0.0 0.0 -59 0.4689092762487258 0.0 0.0 0.0 0.0 -60 0.4689092762487258 0.0 0.0 0.0 0.0 -61 0.4689092762487258 0.0 0.0 0.0 0.0 -62 0.4689092762487258 0.0 0.0 0.0 0.0 -63 0.4689092762487258 0.0 0.0 0.0 0.0 -64 0.4689092762487258 0.0 0.0 0.0 0.0 -65 0.4689092762487258 0.0 0.0 0.0 0.0 -66 0.4689092762487258 0.0 0.0 0.0 0.0 -67 0.4689092762487258 0.0 0.0 0.0 0.0 -68 0.4689092762487258 0.0 0.0 0.0 0.0 -69 0.4689092762487258 0.0 0.0 0.0 0.0 -70 0.4689092762487258 0.0 0.0 0.0 0.0 -71 0.4689092762487258 0.0 0.0 0.0 0.0 -72 0.4689092762487258 0.0 0.0 0.0 0.0 -73 0.4689092762487258 0.0 0.0 0.0 0.0 -74 0.4689092762487258 0.0 0.0 0.0 0.0 -75 0.4689092762487258 0.0 0.0 0.0 0.0 -76 0.4689092762487258 0.0 0.0 0.0 0.0 -77 0.4689092762487258 0.0 0.0 0.0 0.0 -78 0.4689092762487258 0.0 0.0 0.0 0.0 -79 0.4689092762487258 0.0 0.0 0.0 0.0 -80 0.4689092762487258 0.0 0.0 0.0 0.0 -81 0.4689092762487258 0.0 0.0 0.0 0.0 -82 0.4689092762487258 0.0 0.0 0.0 0.0 -83 0.4689092762487258 0.0 0.0 0.0 0.0 -84 0.4689092762487258 0.0 0.0 0.0 0.0 -85 0.4689092762487258 0.0 0.0 0.0 0.0 -86 0.4689092762487258 0.0 0.0 0.0 0.0 -87 0.4689092762487258 0.0 0.0 0.0 0.0 -88 0.4689092762487258 0.0 0.0 0.0 0.0 -89 0.4689092762487258 0.0 0.0 0.0 0.0 -90 0.4689092762487258 0.0 0.0 0.0 0.0 -91 0.4689092762487258 0.0 0.0 0.0 0.0 -92 0.4689092762487258 0.0 0.0 0.0 0.0 -93 0.4689092762487258 0.0 0.0 0.0 0.0 -94 0.4689092762487258 0.0 0.0 0.0 0.0 -95 0.4689092762487258 0.0 0.0 0.0 0.0 -96 0.4689092762487258 0.0 0.0 0.0 0.0 -97 0.4689092762487258 0.0 0.0 0.0 0.0 +#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG +1 0.0 0.0 0.0 0.0 0.020387359836901122 0.0 +2 0.0 0.0 0.0 0.0 0.06116207951070336 0.0 +3 0.0 0.0 0.0 0.0 0.06116207951070336 0.0 +4 0.0 0.0 0.0 0.0 0.06116207951070336 0.0 +5 0.0 0.0 0.0 0.0 0.12232415902140673 0.0 +6 0.0 0.0 0.0 0.0 0.12232415902140673 0.0 +7 0.0 0.0 0.0 0.0 0.12232415902140673 0.0 +8 0.0 0.0 0.0 0.0 0.14271151885830785 0.0 +9 0.0 0.0 0.0 0.0 0.14271151885830785 0.0 +10 0.0 0.0 0.0 0.0 0.14271151885830785 0.0 +11 0.0 0.0 0.0 0.0 0.14271151885830785 0.0 +12 0.0 0.0 0.0 0.0 0.14271151885830785 0.0 +13 0.0 0.0 0.0 0.0 0.16309887869520898 0.0 +14 0.0 0.0 0.0 0.0 0.16309887869520898 0.0 +15 0.0 0.0 0.0 0.0 0.1834862385321101 0.0 +16 0.0 0.0 0.0 0.0 0.2038735983690112 0.0 +17 0.0 0.0 0.0 0.0 0.22426095820591233 0.0 +18 0.0 0.0 0.0 0.0 0.22426095820591233 0.0 +19 0.0 0.0 0.0 0.0 0.22426095820591233 0.0 +20 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +21 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +22 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +23 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +24 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +25 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +26 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +27 0.14271151885830785 0.0 0.0 0.0 0.24464831804281345 0.0 +28 0.1834862385321101 0.0 0.0 0.0 0.24464831804281345 0.0 +29 0.22426095820591233 0.0 0.0 0.0 0.24464831804281345 0.0 +30 0.22426095820591233 0.0 0.0 0.0 0.24464831804281345 0.0 +31 0.22426095820591233 0.0 0.0 0.0 0.24464831804281345 0.0 +32 0.22426095820591233 0.0 0.0 0.0 0.24464831804281345 0.0 +33 0.22426095820591233 0.0 0.0 0.0 0.2854230377166157 0.0 +34 0.22426095820591233 0.0 0.0 0.0 0.2854230377166157 0.0 +35 0.2650356778797146 0.0 0.0 0.0 0.3058103975535168 0.0 +36 0.2854230377166157 0.0 0.0 0.0 0.3058103975535168 0.0 +37 0.32619775739041795 0.0 0.0 0.0 0.32619775739041795 0.0 +38 0.4077471967380224 0.0 0.0 0.0 0.32619775739041795 0.0 +39 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +40 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +41 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +42 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +43 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +44 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +45 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +46 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +47 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +48 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +49 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +50 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +51 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +52 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +53 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +54 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +55 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +56 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +57 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +58 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +59 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +60 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +61 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +62 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +63 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +64 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +65 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +66 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +67 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +68 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +69 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +70 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +71 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +72 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +73 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +74 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +75 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +76 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +77 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +78 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +79 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +80 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +81 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +82 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +83 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +84 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +85 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +86 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +87 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +88 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +89 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +90 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +91 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +92 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +93 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +94 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +95 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +96 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +97 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 >>END_MODULE
