Mercurial > repos > devteam > fasta_nucleotide_changer
view fasta_nucleotide_changer.xml @ 7:2f4612cce126 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fasta_nucleotide_changer commit 17bcf78f445b2e515122330caccb591d8de2a5b4
author | iuc |
---|---|
date | Wed, 23 Apr 2025 05:17:27 +0000 |
parents | 5904fbde39ec |
children |
line wrap: on
line source
<tool id="cshl_fasta_nucleotides_changer" version="1.0.2+galaxy@VERSION_SUFFIX@" profile="22.05" name="RNA/DNA" > <description>converter</description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements" /> <command detect_errors="exit_code"><![CDATA[ @CATS@ fasta_nucleotide_changer -$mode -v @GZIP@ > '$output' ]]></command> <inputs> <expand macro="fasta_input" /> <param name="mode" type="select" label="Convert"> <option value="d">RNA to DNA (U to T)</option> <option value="r">DNA to RNA (T to U)</option> </param> </inputs> <outputs> <data name="output" format_source="input" metadata_source="input" /> </outputs> <tests> <test> <param name="input" value="fasta_nuc_changer1.fasta" /> <param name="mode" value="r" /> <output name="output" ftype="fasta" file="fasta_nuc_change1.out" /> </test> <test> <param name="input" value="fasta_nuc_changer2.fasta" /> <param name="mode" value="d" /> <output name="output" ftype="fasta" file="fasta_nuc_change2.out" /> </test> </tests> <help><![CDATA[ **What it does** This tool converts RNA FASTA files to DNA (and vice-versa). In **RNA-to-DNA** mode, U's are changed into T's. In **DNA-to-RNA** mode, T's are changed into U's. -------- **Example** Input RNA FASTA file ( from Sanger's mirBase ):: >cel-let-7 MIMAT0000001 Caenorhabditis elegans let-7 UGAGGUAGUAGGUUGUAUAGUU >cel-lin-4 MIMAT0000002 Caenorhabditis elegans lin-4 UCCCUGAGACCUCAAGUGUGA >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1 UGGAAUGUAAAGAAGUAUGUA Output DNA FASTA file (with RNA-to-DNA mode):: >cel-let-7 MIMAT0000001 Caenorhabditis elegans let-7 TGAGGTAGTAGGTTGTATAGTT >cel-lin-4 MIMAT0000002 Caenorhabditis elegans lin-4 TCCCTGAGACCTCAAGTGTGA >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1 TGGAATGTAAAGAAGTATGTA ]]></help> <expand macro="citations" /> </tool>