Mercurial > repos > devteam > emboss_5
diff emboss_needle.xml @ 11:0e2484b6829b draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/emboss_5 commit b583bbeb8fc90cd4b1e987a56982e7cf4aed1a68
| author | iuc |
|---|---|
| date | Mon, 30 Jan 2017 13:27:40 -0500 |
| parents | 9b98d3d903c6 |
| children | 27c43fb015f0 |
line wrap: on
line diff
--- a/emboss_needle.xml Fri Aug 12 19:17:10 2016 -0400 +++ b/emboss_needle.xml Mon Jan 30 13:27:40 2017 -0500 @@ -1,43 +1,37 @@ -<tool id="EMBOSS: needle56" name="needle" version="5.0.0"> - <description>Needleman-Wunsch global alignment</description> - <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements> - <command>needle -asequence $input1 -bsequence $input2 -outfile $out_file1 -gapopen $gapopen -gapextend $gapextend -brief $brief -aformat3 $out_format1 -auto</command> - <inputs> - <param format="fasta" name="input1" type="data"> - <label>Sequence 1</label> - </param> - <param format="fasta" name="input2" type="data"> - <label>Sequence 2</label> - </param> - <param name="gapopen" type="text" value="10.0"> - <label>Gap open penalty</label> - </param> - <param name="gapextend" type="text" value="0.5"> - <label>Gap extension penalty</label> - </param> - <param name="brief" type="select"> - <label>Brief identity and similarity</label> - <option value="yes">Yes</option> - <option value="no">No</option> - </param> - <param name="out_format1" type="select"> - <label>Output Alignment File Format</label> - <option value="srspair">SRS pair (p)</option> - <option value="simple">Simple (m)</option> - <option value="fasta">FASTA (m)</option> - <option value="msf">MSF (m)</option> - <option value="srs">SRS (m)</option> - <option value="pair">Pair (p)</option> - <option value="markx0">Markx0 (p)</option> - <option value="markx1">Markx1 (p)</option> - <option value="markx2">Markx2 (p)</option> - <option value="markx3">Markx3 (p)</option> - <option value="markx10">Markx10 (p)</option> +<tool id="EMBOSS: needle56" name="needle" version="5.0.0.1"> + <description>Needleman-Wunsch global alignment</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <code file="emboss_format_corrector.py" /> + <command>needle -asequence '$input1' -bsequence '$input2' -outfile '$out_file1' -gapopen $gapopen -gapextend $gapextend -brief $brief -aformat3 $out_format1 -auto</command> + <inputs> + <param name="input1" type="data" format="fasta" label="Sequence 1" /> + <param name="input2" type="data" format="fasta" label="Sequence 2" /> + <param name="gapopen" type="float" value="10.0" label="Gap open penalty" /> + <param name="gapextend" type="float" value="0.5" label="Gap extension penalty" /> + <param name="brief" type="select" label="Brief identity and similarity"> + <option value="yes">Yes</option> + <option value="no">No</option> + </param> + <param name="out_format1" type="select" label="Output alignment file format"> + <option value="srspair">SRS pair (p)</option> + <option value="simple">Simple (m)</option> + <option value="fasta">FASTA (m)</option> + <option value="msf">MSF (m)</option> + <option value="srs">SRS (m)</option> + <option value="pair">Pair (p)</option> + <option value="markx0">Markx0 (p)</option> + <option value="markx1">Markx1 (p)</option> + <option value="markx2">Markx2 (p)</option> + <option value="markx3">Markx3 (p)</option> + <option value="markx10">Markx10 (p)</option> <option value="score">Score (p)</option> - </param> - </inputs> - <outputs> - <data format="needle" name="out_file1" /> + </param> + </inputs> + <outputs> + <data name="out_file1" format="needle" /> </outputs> <tests> <test> @@ -49,10 +43,8 @@ <param name="out_format1" value="score"/> <output name="out_file1" file="emboss_needle_out.score"/> </test> - </tests> - <code file="emboss_format_corrector.py" /> + </tests> <help> - .. class:: warningmark needle reads any two sequences of the same type (DNA or protein). @@ -61,7 +53,7 @@ **Syntax** -This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length. +This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length. - **Optimal alignment:** Dynamic programming methods ensure the optimal global alignment by exploring all possible alignments and choosing the best. @@ -72,8 +64,8 @@ - **Gap extension penalty:** [0.5 for any sequence] The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. (Floating point number from 0.0 to 10.0) You can view the original documentation here_. - - .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/needle.html + + .. _here: http://galaxy-iuc.github.io/emboss-5.0-docs/needle.html ----- @@ -85,7 +77,7 @@ TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG -- If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output Alignment File Format is set to SRS pairs, the output file is:: +- If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output alignment file format is set to SRS pairs, the output file is:: ######################################## # Program: needle @@ -93,7 +85,7 @@ # Align_format: srspair # Report_file: ./database/files/dataset_7.dat ######################################## - + #======================================= # # Aligned_sequences: 2 @@ -114,21 +106,13 @@ hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50 |||||||||||||||||||||||||||||||||||||||||||||||||| hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50 - + hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83 ||||||||||||||||||||||||||||||||| hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83 - + #--------------------------------------- #--------------------------------------- - - ------- - -**Citation** - -For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_ - -If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_ </help> + <expand macro="citations" /> </tool>
