Mercurial > repos > devteam > emboss_5
comparison emboss_needle.xml @ 11:0e2484b6829b draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/emboss_5 commit b583bbeb8fc90cd4b1e987a56982e7cf4aed1a68
| author | iuc |
|---|---|
| date | Mon, 30 Jan 2017 13:27:40 -0500 |
| parents | 9b98d3d903c6 |
| children | 27c43fb015f0 |
comparison
equal
deleted
inserted
replaced
| 10:9b98d3d903c6 | 11:0e2484b6829b |
|---|---|
| 1 <tool id="EMBOSS: needle56" name="needle" version="5.0.0"> | 1 <tool id="EMBOSS: needle56" name="needle" version="5.0.0.1"> |
| 2 <description>Needleman-Wunsch global alignment</description> | 2 <description>Needleman-Wunsch global alignment</description> |
| 3 <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements> | 3 <macros> |
| 4 <command>needle -asequence $input1 -bsequence $input2 -outfile $out_file1 -gapopen $gapopen -gapextend $gapextend -brief $brief -aformat3 $out_format1 -auto</command> | 4 <import>macros.xml</import> |
| 5 </macros> | |
| 6 <expand macro="requirements" /> | |
| 7 <code file="emboss_format_corrector.py" /> | |
| 8 <command>needle -asequence '$input1' -bsequence '$input2' -outfile '$out_file1' -gapopen $gapopen -gapextend $gapextend -brief $brief -aformat3 $out_format1 -auto</command> | |
| 5 <inputs> | 9 <inputs> |
| 6 <param format="fasta" name="input1" type="data"> | 10 <param name="input1" type="data" format="fasta" label="Sequence 1" /> |
| 7 <label>Sequence 1</label> | 11 <param name="input2" type="data" format="fasta" label="Sequence 2" /> |
| 8 </param> | 12 <param name="gapopen" type="float" value="10.0" label="Gap open penalty" /> |
| 9 <param format="fasta" name="input2" type="data"> | 13 <param name="gapextend" type="float" value="0.5" label="Gap extension penalty" /> |
| 10 <label>Sequence 2</label> | 14 <param name="brief" type="select" label="Brief identity and similarity"> |
| 11 </param> | |
| 12 <param name="gapopen" type="text" value="10.0"> | |
| 13 <label>Gap open penalty</label> | |
| 14 </param> | |
| 15 <param name="gapextend" type="text" value="0.5"> | |
| 16 <label>Gap extension penalty</label> | |
| 17 </param> | |
| 18 <param name="brief" type="select"> | |
| 19 <label>Brief identity and similarity</label> | |
| 20 <option value="yes">Yes</option> | 15 <option value="yes">Yes</option> |
| 21 <option value="no">No</option> | 16 <option value="no">No</option> |
| 22 </param> | 17 </param> |
| 23 <param name="out_format1" type="select"> | 18 <param name="out_format1" type="select" label="Output alignment file format"> |
| 24 <label>Output Alignment File Format</label> | |
| 25 <option value="srspair">SRS pair (p)</option> | 19 <option value="srspair">SRS pair (p)</option> |
| 26 <option value="simple">Simple (m)</option> | 20 <option value="simple">Simple (m)</option> |
| 27 <option value="fasta">FASTA (m)</option> | 21 <option value="fasta">FASTA (m)</option> |
| 28 <option value="msf">MSF (m)</option> | 22 <option value="msf">MSF (m)</option> |
| 29 <option value="srs">SRS (m)</option> | 23 <option value="srs">SRS (m)</option> |
| 35 <option value="markx10">Markx10 (p)</option> | 29 <option value="markx10">Markx10 (p)</option> |
| 36 <option value="score">Score (p)</option> | 30 <option value="score">Score (p)</option> |
| 37 </param> | 31 </param> |
| 38 </inputs> | 32 </inputs> |
| 39 <outputs> | 33 <outputs> |
| 40 <data format="needle" name="out_file1" /> | 34 <data name="out_file1" format="needle" /> |
| 41 </outputs> | 35 </outputs> |
| 42 <tests> | 36 <tests> |
| 43 <test> | 37 <test> |
| 44 <param name="input1" value="2.fasta"/> | 38 <param name="input1" value="2.fasta"/> |
| 45 <param name="input2" value="1.fasta"/> | 39 <param name="input2" value="1.fasta"/> |
| 48 <param name="brief" value="yes"/> | 42 <param name="brief" value="yes"/> |
| 49 <param name="out_format1" value="score"/> | 43 <param name="out_format1" value="score"/> |
| 50 <output name="out_file1" file="emboss_needle_out.score"/> | 44 <output name="out_file1" file="emboss_needle_out.score"/> |
| 51 </test> | 45 </test> |
| 52 </tests> | 46 </tests> |
| 53 <code file="emboss_format_corrector.py" /> | |
| 54 <help> | 47 <help> |
| 55 | |
| 56 .. class:: warningmark | 48 .. class:: warningmark |
| 57 | 49 |
| 58 needle reads any two sequences of the same type (DNA or protein). | 50 needle reads any two sequences of the same type (DNA or protein). |
| 59 | 51 |
| 60 ----- | 52 ----- |
| 61 | 53 |
| 62 **Syntax** | 54 **Syntax** |
| 63 | 55 |
| 64 This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length. | 56 This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length. |
| 65 | 57 |
| 66 - **Optimal alignment:** Dynamic programming methods ensure the optimal global alignment by exploring all possible alignments and choosing the best. | 58 - **Optimal alignment:** Dynamic programming methods ensure the optimal global alignment by exploring all possible alignments and choosing the best. |
| 67 | 59 |
| 68 - **The Needleman-Wunsch algorithm** is a member of the class of algorithms that can calculate the best score and alignment in the order of mn steps, (where 'n' and 'm' are the lengths of the two sequences). | 60 - **The Needleman-Wunsch algorithm** is a member of the class of algorithms that can calculate the best score and alignment in the order of mn steps, (where 'n' and 'm' are the lengths of the two sequences). |
| 69 | 61 |
| 70 - **Gap open penalty:** [10.0 for any sequence] The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. (Floating point number from 1.0 to 100.0) | 62 - **Gap open penalty:** [10.0 for any sequence] The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. (Floating point number from 1.0 to 100.0) |
| 71 | 63 |
| 72 - **Gap extension penalty:** [0.5 for any sequence] The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. (Floating point number from 0.0 to 10.0) | 64 - **Gap extension penalty:** [0.5 for any sequence] The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. (Floating point number from 0.0 to 10.0) |
| 73 | 65 |
| 74 You can view the original documentation here_. | 66 You can view the original documentation here_. |
| 75 | 67 |
| 76 .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/needle.html | 68 .. _here: http://galaxy-iuc.github.io/emboss-5.0-docs/needle.html |
| 77 | 69 |
| 78 ----- | 70 ----- |
| 79 | 71 |
| 80 **Example** | 72 **Example** |
| 81 | 73 |
| 83 | 75 |
| 84 >hg18_dna range=chrX:151073054-151073136 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none | 76 >hg18_dna range=chrX:151073054-151073136 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none |
| 85 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA | 77 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA |
| 86 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG | 78 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG |
| 87 | 79 |
| 88 - If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output Alignment File Format is set to SRS pairs, the output file is:: | 80 - If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output alignment file format is set to SRS pairs, the output file is:: |
| 89 | 81 |
| 90 ######################################## | 82 ######################################## |
| 91 # Program: needle | 83 # Program: needle |
| 92 # Rundate: Mon Apr 02 2007 14:23:16 | 84 # Rundate: Mon Apr 02 2007 14:23:16 |
| 93 # Align_format: srspair | 85 # Align_format: srspair |
| 94 # Report_file: ./database/files/dataset_7.dat | 86 # Report_file: ./database/files/dataset_7.dat |
| 95 ######################################## | 87 ######################################## |
| 96 | 88 |
| 97 #======================================= | 89 #======================================= |
| 98 # | 90 # |
| 99 # Aligned_sequences: 2 | 91 # Aligned_sequences: 2 |
| 100 # 1: hg18_dna | 92 # 1: hg18_dna |
| 101 # 2: hg18_dna | 93 # 2: hg18_dna |
| 112 #======================================= | 104 #======================================= |
| 113 | 105 |
| 114 hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50 | 106 hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50 |
| 115 |||||||||||||||||||||||||||||||||||||||||||||||||| | 107 |||||||||||||||||||||||||||||||||||||||||||||||||| |
| 116 hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50 | 108 hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50 |
| 117 | 109 |
| 118 hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83 | 110 hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83 |
| 119 ||||||||||||||||||||||||||||||||| | 111 ||||||||||||||||||||||||||||||||| |
| 120 hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83 | 112 hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83 |
| 121 | 113 |
| 122 #--------------------------------------- | 114 #--------------------------------------- |
| 123 #--------------------------------------- | 115 #--------------------------------------- |
| 124 | |
| 125 | |
| 126 ------ | |
| 127 | |
| 128 **Citation** | |
| 129 | |
| 130 For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_ | |
| 131 | |
| 132 If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_ | |
| 133 </help> | 116 </help> |
| 117 <expand macro="citations" /> | |
| 134 </tool> | 118 </tool> |
