cufflinks: cufflinks_wrapper.xml annotate

annotate cufflinks_wrapper.xml @ 3:3afd198a1cf0 draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit 82ee6fc860c52c531b7a57bbb346ab1a67a434a5

author	devteam
date	Sun, 19 Feb 2017 12:11:40 -0500
parents	a6f581469476
children	f842d03b75c2

rev	line source
3 3afd198a1cf0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit 82ee6fc860c52c531b7a57bbb346ab1a67a434a5 devteam parents: 2 diff changeset	1 <tool id="cufflinks" name="Cufflinks" version="@VERSION@.2">
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	2 <description>transcript assembly and FPKM (RPKM) estimates for RNA-Seq data</description>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	3 <macros>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	4 <import>cuff_macros.xml</import>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	5 </macros>
3 3afd198a1cf0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit 82ee6fc860c52c531b7a57bbb346ab1a67a434a5 devteam parents: 2 diff changeset	6 <expand macro="requirements" />
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	7 <version_command>cufflinks 2>&1 \| head -n 1</version_command>
3 3afd198a1cf0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit 82ee6fc860c52c531b7a57bbb346ab1a67a434a5 devteam parents: 2 diff changeset	8 <command detect_errors="aggressive">
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	9 python '$__tool_directory__/cufflinks_wrapper.py'
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	10 --input '$input'
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	11 --assembled-isoforms-output '$assembled_isoforms'
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	12 --num-threads "\${GALAXY_SLOTS:-4}"
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	13 -I $max_intron_len
1fffcfe2fb35 Uploaded devteam parents: diff changeset	14 -F $min_isoform_fraction
1fffcfe2fb35 Uploaded devteam parents: diff changeset	15 -j $pre_mrna_fraction
1fffcfe2fb35 Uploaded devteam parents: diff changeset	16 $length_correction
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	17
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	18 ## Include reference annotation?
1fffcfe2fb35 Uploaded devteam parents: diff changeset	19 #if $reference_annotation.use_ref == "Use reference annotation":
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	20 -G '$reference_annotation.reference_annotation_file'
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	21 $reference_annotation.compatible_hits_norm
1fffcfe2fb35 Uploaded devteam parents: diff changeset	22 #end if
1fffcfe2fb35 Uploaded devteam parents: diff changeset	23 #if $reference_annotation.use_ref == "Use reference annotation guide":
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	24 -g '$reference_annotation.reference_annotation_guide_file'
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	25 --3-overhang-tolerance $reference_annotation.three_overhang_tolerance
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	26 --intron-overhang-tolerance $reference_annotation.intron_overhang_tolerance
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	27 $reference_annotation.no_faux_reads
1fffcfe2fb35 Uploaded devteam parents: diff changeset	28 #end if
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	29
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	30 ## Bias correction?
1fffcfe2fb35 Uploaded devteam parents: diff changeset	31 #if $bias_correction.do_bias_correction == "Yes":
1fffcfe2fb35 Uploaded devteam parents: diff changeset	32 -b
1fffcfe2fb35 Uploaded devteam parents: diff changeset	33 #if $bias_correction.seq_source.index_source == "history":
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	34 --ref_file '$bias_correction.seq_source.ref_file'
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	35 #else:
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	36 --index '${bias_correction.seq_source.index.fields.path}'
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	37 #end if
1fffcfe2fb35 Uploaded devteam parents: diff changeset	38 #end if
1fffcfe2fb35 Uploaded devteam parents: diff changeset	39
1fffcfe2fb35 Uploaded devteam parents: diff changeset	40 ## Multi-read correct?
1fffcfe2fb35 Uploaded devteam parents: diff changeset	41 #if str($multiread_correct) == "Yes":
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	42 -u
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	43 #end if
1fffcfe2fb35 Uploaded devteam parents: diff changeset	44
1fffcfe2fb35 Uploaded devteam parents: diff changeset	45 ## Include global model if available.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	46 #if $global_model:
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	47 --global_model '$global_model'
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	48 #end if
1fffcfe2fb35 Uploaded devteam parents: diff changeset	49
1fffcfe2fb35 Uploaded devteam parents: diff changeset	50 ## advanced settings
1fffcfe2fb35 Uploaded devteam parents: diff changeset	51 #if $advanced_settings.use_advanced_settings == "Yes":
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	52 --library-type $advanced_settings.library_type
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	53 #if $advanced_settings.mask_file:
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	54 --mask-file '$advanced_settings.mask_file'
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	55 #end if
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	56 --inner-mean-dist $advanced_settings.inner_mean_dist
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	57 --inner-dist-std-dev $advanced_settings.inner_dist_std_dev
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	58 --max-mle-iterations $advanced_settings.max_mle_iterations
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	59 --junc-alpha $advanced_settings.junc_alpha
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	60 --small-anchor-fraction $advanced_settings.small_anchor_fraction
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	61 --overhang-tolerance $advanced_settings.overhang_tolerance
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	62 --max-bundle-length $advanced_settings.max_bundle_length
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	63 --max-bundle-frags $advanced_settings.max_bundle_frags
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	64 --min-intron-length $advanced_settings.min_intron_length
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	65 --trim-3-avgcov-thresh $advanced_settings.trim_three_avgcov_thresh
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	66 --trim-3-dropoff-frac $advanced_settings.trim_three_dropoff_frac
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	67 #end if
1fffcfe2fb35 Uploaded devteam parents: diff changeset	68 </command>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	69 <inputs>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	70 <param format="sam,bam" name="input" type="data" label="SAM or BAM file of aligned RNA-Seq reads" help=""/>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	71 <param name="max_intron_len" type="integer" value="300000" min="1" max="600000" label="Max Intron Length" help="ignore alignments with gaps longer than this"/>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	72 <param name="min_isoform_fraction" type="float" value="0.10" min="0" max="1" label="Min Isoform Fraction" help="suppress transcripts below this abundance level"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	73 <param name="pre_mrna_fraction" type="float" value="0.15" min="0" max="1" label="Pre MRNA Fraction" help="suppress intra-intronic transcripts below this level"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	74 <conditional name="reference_annotation">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	75 <param name="use_ref" type="select" label="Use Reference Annotation">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	76 <option value="No" selected="true">No</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	77 <option value="Use reference annotation">Use reference annotation</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	78 <option value="Use reference annotation guide">Use reference annotation as guide</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	79 </param>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	80 <when value="No" />
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	81 <when value="Use reference annotation">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	82 <param format="gff3,gtf" name="reference_annotation_file" type="data" label="Reference Annotation" help="Gene annotation dataset in GTF or GFF3 format."/>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	83 <param name="compatible_hits_norm" type="select" label="Count hits compatible with reference RNAs only"
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	84 help="With this option, Cufflinks counts only those fragments compatible with some reference transcript towards the number of mapped hits used in the FPKM denominator. This option can only be used in combination with --GTF.">
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	85 <option value="" selected="True">No</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	86 <option value="--compatible-hits-norm">Yes</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	87 </param>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	88 </when>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	89 <when value="Use reference annotation guide">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	90 <param format="gff3,gtf" name="reference_annotation_guide_file" type="data" label="Reference Annotation" help="Gene annotation dataset in GTF or GFF3 format."/>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	91 <param name="three_overhang_tolerance" type="integer" value="600" label="3prime overhang tolerance"
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	92 help="The number of bp allowed to overhang the 3prime end of a reference transcript when determining if an assembled transcript should be merged with it (ie, the assembled transcript is not novel). The default is 600 bp." />
1fffcfe2fb35 Uploaded devteam parents: diff changeset	93 <param name="intron_overhang_tolerance" type="integer" value="50" label="Intronic overhang tolerance" help="The number of bp allowed to enter the intron of a reference transcript when determining if an assembled transcript should be merged with it (ie, the assembled transcript is not novel). The default is 50 bp." />
1fffcfe2fb35 Uploaded devteam parents: diff changeset	94 <param name="no_faux_reads" type="select" label="Disable tiling of reference transcripts" help="This option disables tiling of the reference transcripts with faux reads. Use this if you only want to use sequencing reads in assembly but do not want to output assembled transcripts that lay within reference transcripts. All reference transcripts in the input annotation will also be included in the output.">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	95 <option value="" selected="True">No</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	96 <option value="--no-faux-reads">Yes</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	97 </param>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	98 </when>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	99 </conditional>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	100 <conditional name="bias_correction">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	101 <param name="do_bias_correction" type="select" label="Perform Bias Correction"
1fffcfe2fb35 Uploaded devteam parents: diff changeset	102 help="Bias detection and correction can significantly improve accuracy of transcript abundance estimates.">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	103 <option value="No" selected="true">No</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	104 <option value="Yes">Yes</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	105 </param>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	106 <when value="Yes">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	107 <conditional name="seq_source">
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	108 <param name="index_source" type="select" label="Reference sequence data">
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	109 <option value="cached" selected="true">Locally cached</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	110 <option value="history">History</option>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	111 </param>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	112 <when value="cached">
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	113 <param name="index" type="select" label="Using reference genome">
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	114 <options from_data_table="fasta_indexes">
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	115 <filter type="data_meta" ref="input" key="dbkey" column="1" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	116 <validator type="no_options" message="No reference genome is available for the build associated with the selected input dataset" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	117 </options>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	118 </param>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	119 </when>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	120 <when value="history">
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	121 <param name="ref_file" type="data" format="fasta" label="Using reference file" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	122 </when>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	123 </conditional>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	124 </when>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	125 <when value="No" />
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	126 </conditional>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	127
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	128 <param name="multiread_correct" type="select" label="Use multi-read correct"
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	129 help="Tells Cufflinks to do an initial estimation procedure to more accurately weight reads mapping to multiple locations in the genome.">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	130 <option value="No" selected="true">No</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	131 <option value="Yes">Yes</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	132 </param>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	133
1fffcfe2fb35 Uploaded devteam parents: diff changeset	134 <param name="length_correction" type="select" label="Apply length correction" help="Mode of length normalization to transcript FPKM.">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	135 <option value="" selected="true">Cufflinks Effective Length Correction</option>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	136 <option value="--no-effective-length-correction">Standard Length Correction</option>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	137 <option value="--no-length-correction">No Length Correction at all (use raw counts)</option>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	138 </param>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	139
1fffcfe2fb35 Uploaded devteam parents: diff changeset	140 <param name="global_model" type="hidden_data" label="Global model (for use in Trackster)" optional="True"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	141
1fffcfe2fb35 Uploaded devteam parents: diff changeset	142 <!-- advanced settings -->
1fffcfe2fb35 Uploaded devteam parents: diff changeset	143 <conditional name="advanced_settings">
1fffcfe2fb35 Uploaded devteam parents: diff changeset	144 <param name="use_advanced_settings" type="select" label="Set advanced Cufflinks options" help="">
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	145 <option value="No" selected="true">No</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	146 <option value="Yes" >Yes</option>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	147 </param>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	148 <when value="No" />
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	149 <when value="Yes">
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	150 <param type="select" name="library_type" label="Library prep used for input reads" help="">
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	151 <option value="auto" selected="True">Auto Detect</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	152 <option value="ff-firststrand">ff-firststrand</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	153 <option value="ff-secondstrand">ff-secondstrand</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	154 <option value="ff-unstranded">ff-unstranded</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	155 <option value="fr-firststrand">fr-firststrand</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	156 <option value="fr-secondstrand">fr-secondstrand</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	157 <option value="fr-unstranded" >fr-unstranded</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	158 <option value="transfrags">transfrags</option>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	159 </param>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	160 <param name="mask_file" type="data" format="gff3,gtf" label="Mask File" help="Ignore all alignment within transcripts in this file " optional="True" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	161 <param name="inner_mean_dist" type="integer" value="45" label="Inner mean distance" help="This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments selected at 300bp,where each end is 50bp, you should set it as 200. The default is 45bp." />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	162 <param name="inner_dist_std_dev" type="integer" value="20" label="Inner distance standard deviation" help="The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp." />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	163 <param name="max_mle_iterations" type="integer" value="5000" label="Max MLE iterations" help="Sets the number of iterations allowed during maximum likelihood estimation of abundances. Default: 5000" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	164 <param name="junc_alpha" type="float" value="0.001" min="0" max="1" label="Alpha value for the binomial test used during false positive spliced alignment filtration" help="Default: 0.001" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	165 <param name="small_anchor_fraction" type="float" value="0.09" min="0" max="1" label="percent read overhang taken as suspiciously small" help="Spliced reads with less than this percent of their length on each side of the junction are considered suspicious and are candidates for filtering prior to assembly. Default: 0.09." />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	166 <param name="overhang_tolerance" type="integer" value="8" label="Intronic overhang tolerance" help="The number of bp allowed to enter the intron of a transcript when determining if a read or another transcript is mappable to/compatible with it. The default is 8 bp based on the default bowtie/TopHat parameters." />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	167 <param name="max_bundle_length" type="integer" value="3500000" label="Maximum genomic length of a given bundle" help="Default: 3,500,000bp" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	168 <param name="max_bundle_frags" type="integer" value="1000000" label="Maximum number of fragments per locus" help="Sets the maximum number of fragments a locus may have before being skipped. Skipped loci are listed in skipped.gtf. Default: 1,000,000" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	169 <param name="min_intron_length" type="integer" value="50" label="Minimal allowed intron size" help="Default: 50bp" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	170 <param name="trim_three_avgcov_thresh" type="integer" value="10" label="Minimum average coverage required to attempt 3prime trimming." help="Default: 10" />
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	171 <param name="trim_three_dropoff_frac" type="float" value="0.1" min="0" max="1" label="The fraction of average coverage below which to trim the 3prime end of an assembled transcript." help="Default: 0.1"/>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	172 </when>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	173 </conditional>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	174 </inputs>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	175 <outputs>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	176 <data format="tabular" name="genes_expression" label="${tool.name} on ${on_string}: gene expression" from_work_dir="genes.fpkm_tracking"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	177 <data format="tabular" name="transcripts_expression" label="${tool.name} on ${on_string}: transcript expression" from_work_dir="isoforms.fpkm_tracking"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	178 <data format="gtf" name="assembled_isoforms" label="${tool.name} on ${on_string}: assembled transcripts"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	179 <data format="txt" name="total_map_mass" label="${tool.name} on ${on_string}: total map mass" hidden="true" from_work_dir="global_model.txt"/>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	180 <data format="gtf" name="skipped" label="${tool.name} on ${on_string}: Skipped Transcripts" from_work_dir="skipped.gtf"/>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	181 </outputs>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	182
1fffcfe2fb35 Uploaded devteam parents: diff changeset	183 <trackster_conf>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	184 <action name="global_model" output_name="total_map_mass"/>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	185 </trackster_conf>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	186 <tests>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	187 <!--
1fffcfe2fb35 Uploaded devteam parents: diff changeset	188 Simple test that uses test data included with cufflinks.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	189 -->
1fffcfe2fb35 Uploaded devteam parents: diff changeset	190 <test>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	191 <param name="input" value="cufflinks_in.bam"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	192 <param name="max_intron_len" value="300000"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	193 <param name="min_isoform_fraction" value="0.05"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	194 <param name="pre_mrna_fraction" value="0.05"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	195 <param name="use_ref" value="No"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	196 <param name="do_bias_correction" value="No"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	197 <param name="multiread_correct" value="No"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	198 <param name="length_correction" value=""/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	199 <param name="use_advanced_settings" value="No" />
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	200 <output name="genes_expression" ftype="tabular" lines_diff="2" file="cufflinks_out3.fpkm_tracking"/>
a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	201 <output name="transcripts_expression" ftype="tabular" lines_diff="2" file="cufflinks_out2.fpkm_tracking"/>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	202 <output name="assembled_isoforms" file="cufflinks_out1.gtf"/>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	203 <output name="global_model" file="cufflinks_out4.txt"/>
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	204 <output name="skipped" file="cufflinks_out4.gtf"/>
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	205 </test>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	206 </tests>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	207
1fffcfe2fb35 Uploaded devteam parents: diff changeset	208 <help>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	209 Cufflinks Overview
1fffcfe2fb35 Uploaded devteam parents: diff changeset	210
1fffcfe2fb35 Uploaded devteam parents: diff changeset	211 Cufflinks_ assembles transcripts, estimates their abundances, and tests for differential expression and regulation in RNA-Seq samples. It accepts aligned RNA-Seq reads and assembles the alignments into a parsimonious set of transcripts. Cufflinks then estimates the relative abundances of these transcripts based on how many reads support each one. Please cite: Trapnell C, Williams BA, Pertea G, Mortazavi AM, Kwan G, van Baren MJ, Salzberg SL, Wold B, Pachter L. Transcript assembly and abundance estimation from RNA-Seq reveals thousands of new transcripts and switching among isoforms. Nature Biotechnology doi:10.1038/nbt.1621
1fffcfe2fb35 Uploaded devteam parents: diff changeset	212
1 b9d29fdd1190 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 0 diff changeset	213 .. _Cufflinks: http://cole-trapnell-lab.github.io/cufflinks/
b9d29fdd1190 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 0 diff changeset	214
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	215 ------
1fffcfe2fb35 Uploaded devteam parents: diff changeset	216
1fffcfe2fb35 Uploaded devteam parents: diff changeset	217 Know what you are doing
1fffcfe2fb35 Uploaded devteam parents: diff changeset	218
1fffcfe2fb35 Uploaded devteam parents: diff changeset	219 .. class:: warningmark
1fffcfe2fb35 Uploaded devteam parents: diff changeset	220
1fffcfe2fb35 Uploaded devteam parents: diff changeset	221 There is no such thing (yet) as an automated gearshift in expression analysis. It is all like stick-shift driving in San Francisco. In other words, running this tool with default parameters will probably not give you meaningful results. A way to deal with this is to understand the parameters by carefully reading the `documentation`__ and experimenting. Fortunately, Galaxy makes experimenting easy.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	222
1 b9d29fdd1190 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 0 diff changeset	223 .. __: http://cole-trapnell-lab.github.io/cufflinks/cufflinks/
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	224
1fffcfe2fb35 Uploaded devteam parents: diff changeset	225 ------
1fffcfe2fb35 Uploaded devteam parents: diff changeset	226
1fffcfe2fb35 Uploaded devteam parents: diff changeset	227 Input formats
1fffcfe2fb35 Uploaded devteam parents: diff changeset	228
1fffcfe2fb35 Uploaded devteam parents: diff changeset	229 Cufflinks takes a text file of SAM alignments as input. The RNA-Seq read mapper TopHat produces output in this format, and is recommended for use with Cufflinks. However Cufflinks will accept SAM alignments generated by any read mapper. Here's an example of an alignment Cufflinks will accept::
1fffcfe2fb35 Uploaded devteam parents: diff changeset	230
1fffcfe2fb35 Uploaded devteam parents: diff changeset	231 s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \
1fffcfe2fb35 Uploaded devteam parents: diff changeset	232 CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:-
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	233
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	234 Note the use of the custom tag XS. This attribute, which must have a value of "+" or "-", indicates which strand the RNA that produced this read came from. While this tag can be applied to any alignment, including unspliced ones, it must be present for all spliced alignment records (those with a 'N' operation in the CIGAR string).
1fffcfe2fb35 Uploaded devteam parents: diff changeset	235 The SAM file supplied to Cufflinks must be sorted by reference position. If you aligned your reads with TopHat, your alignments will be properly sorted already. If you used another tool, you may want to make sure they are properly sorted as follows::
1fffcfe2fb35 Uploaded devteam parents: diff changeset	236
1fffcfe2fb35 Uploaded devteam parents: diff changeset	237 sort -k 3,3 -k 4,4n hits.sam > hits.sam.sorted
1fffcfe2fb35 Uploaded devteam parents: diff changeset	238
1fffcfe2fb35 Uploaded devteam parents: diff changeset	239 NOTE: Cufflinks currently only supports SAM alignments with the CIGAR match ('M') and reference skip ('N') operations. Support for the other operations, such as insertions, deletions, and clipping, will be added in the future.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	240
1fffcfe2fb35 Uploaded devteam parents: diff changeset	241 ------
1fffcfe2fb35 Uploaded devteam parents: diff changeset	242
1fffcfe2fb35 Uploaded devteam parents: diff changeset	243 Outputs
1fffcfe2fb35 Uploaded devteam parents: diff changeset	244
1fffcfe2fb35 Uploaded devteam parents: diff changeset	245 Cufflinks produces three output files:
1fffcfe2fb35 Uploaded devteam parents: diff changeset	246
1fffcfe2fb35 Uploaded devteam parents: diff changeset	247 Transcripts and Genes:
1fffcfe2fb35 Uploaded devteam parents: diff changeset	248
1fffcfe2fb35 Uploaded devteam parents: diff changeset	249 This GTF file contains Cufflinks' assembled isoforms. The first 7 columns are standard GTF, and the last column contains attributes, some of which are also standardized (e.g. gene_id, transcript_id). There one GTF record per row, and each record represents either a transcript or an exon within a transcript. The columns are defined as follows::
1fffcfe2fb35 Uploaded devteam parents: diff changeset	250
1fffcfe2fb35 Uploaded devteam parents: diff changeset	251 Column number Column name Example Description
1fffcfe2fb35 Uploaded devteam parents: diff changeset	252 -----------------------------------------------------
1fffcfe2fb35 Uploaded devteam parents: diff changeset	253 1 seqname chrX Chromosome or contig name
1fffcfe2fb35 Uploaded devteam parents: diff changeset	254 2 source Cufflinks The name of the program that generated this file (always 'Cufflinks')
1fffcfe2fb35 Uploaded devteam parents: diff changeset	255 3 feature exon The type of record (always either "transcript" or "exon").
1fffcfe2fb35 Uploaded devteam parents: diff changeset	256 4 start 77696957 The leftmost coordinate of this record (where 0 is the leftmost possible coordinate)
1fffcfe2fb35 Uploaded devteam parents: diff changeset	257 5 end 77712009 The rightmost coordinate of this record, inclusive.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	258 6 score 77712009 The most abundant isoform for each gene is assigned a score of 1000. Minor isoforms are scored by the ratio (minor FPKM/major FPKM)
1fffcfe2fb35 Uploaded devteam parents: diff changeset	259 7 strand + Cufflinks' guess for which strand the isoform came from. Always one of '+', '-' '.'
1fffcfe2fb35 Uploaded devteam parents: diff changeset	260 7 frame . Cufflinks does not predict where the start and stop codons (if any) are located within each transcript, so this field is not used.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	261 8 attributes See below
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	262
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	263 Each GTF record is decorated with the following attributes::
1fffcfe2fb35 Uploaded devteam parents: diff changeset	264
1fffcfe2fb35 Uploaded devteam parents: diff changeset	265 Attribute Example Description
1fffcfe2fb35 Uploaded devteam parents: diff changeset	266 -----------------------------------------
1fffcfe2fb35 Uploaded devteam parents: diff changeset	267 gene_id CUFF.1 Cufflinks gene id
1fffcfe2fb35 Uploaded devteam parents: diff changeset	268 transcript_id CUFF.1.1 Cufflinks transcript id
1fffcfe2fb35 Uploaded devteam parents: diff changeset	269 FPKM 101.267 Isoform-level relative abundance in Reads Per Kilobase of exon model per Million mapped reads
1fffcfe2fb35 Uploaded devteam parents: diff changeset	270 frac 0.7647 Reserved. Please ignore, as this attribute may be deprecated in the future
1fffcfe2fb35 Uploaded devteam parents: diff changeset	271 conf_lo 0.07 Lower bound of the 95% confidence interval of the abundance of this isoform, as a fraction of the isoform abundance. That is, lower bound = FPKM * (1.0 - conf_lo)
1fffcfe2fb35 Uploaded devteam parents: diff changeset	272 conf_hi 0.1102 Upper bound of the 95% confidence interval of the abundance of this isoform, as a fraction of the isoform abundance. That is, upper bound = FPKM * (1.0 + conf_lo)
1fffcfe2fb35 Uploaded devteam parents: diff changeset	273 cov 100.765 Estimate for the absolute depth of read coverage across the whole transcript
1fffcfe2fb35 Uploaded devteam parents: diff changeset	274
1fffcfe2fb35 Uploaded devteam parents: diff changeset	275 Transcripts only:
1fffcfe2fb35 Uploaded devteam parents: diff changeset	276 This file is simply a tab delimited file containing one row per transcript and with columns containing the attributes above. There are a few additional attributes not in the table above, but these are reserved for debugging, and may change or disappear in the future.
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	277
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	278 Genes only:
1fffcfe2fb35 Uploaded devteam parents: diff changeset	279 This file contains gene-level coordinates and expression values.
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	280
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	281 -------
1fffcfe2fb35 Uploaded devteam parents: diff changeset	282
1fffcfe2fb35 Uploaded devteam parents: diff changeset	283 Cufflinks settings
1fffcfe2fb35 Uploaded devteam parents: diff changeset	284
1fffcfe2fb35 Uploaded devteam parents: diff changeset	285 All of the options have a default value. You can change any of them. Most of the options in Cufflinks have been implemented here.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	286
1fffcfe2fb35 Uploaded devteam parents: diff changeset	287 ------
1fffcfe2fb35 Uploaded devteam parents: diff changeset	288
1fffcfe2fb35 Uploaded devteam parents: diff changeset	289 Cufflinks parameter list
1fffcfe2fb35 Uploaded devteam parents: diff changeset	290
1fffcfe2fb35 Uploaded devteam parents: diff changeset	291 This is a list of implemented Cufflinks options::
1fffcfe2fb35 Uploaded devteam parents: diff changeset	292
1fffcfe2fb35 Uploaded devteam parents: diff changeset	293 -m INT This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments selected at 300bp, where each end is 50bp, you should set -r to be 200. The default is 45bp.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	294 -s INT The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	295 -I INT The minimum intron length. Cufflinks will not report transcripts with introns longer than this, and will ignore SAM alignments with REF_SKIP CIGAR operations longer than this. The default is 300,000.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	296 -F After calculating isoform abundance for a gene, Cufflinks filters out transcripts that it believes are very low abundance, because isoforms expressed at extremely low levels often cannot reliably be assembled, and may even be artifacts of incompletely spliced precursors of processed transcripts. This parameter is also used to filter out introns that have far fewer spliced alignments supporting them. The default is 0.05, or 5% of the most abundant isoform (the major isoform) of the gene.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	297 -j Some RNA-Seq protocols produce a significant amount of reads that originate from incompletely spliced transcripts, and these reads can confound the assembly of fully spliced mRNAs. Cufflinks uses this parameter to filter out alignments that lie within the intronic intervals implied by the spliced alignments. The minimum depth of coverage in the intronic region covered by the alignment is divided by the number of spliced reads, and if the result is lower than this parameter value, the intronic alignments are ignored. The default is 5%.
2 a6f581469476 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f devteam parents: 1 diff changeset	298 -G Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript.
0 1fffcfe2fb35 Uploaded devteam parents: diff changeset	299 -N With this option, Cufflinks excludes the contribution of the top 25 percent most highly expressed genes from the number of mapped fragments used in the FPKM denominator. This can improve robustness of differential expression calls for less abundant genes and transcripts.
1fffcfe2fb35 Uploaded devteam parents: diff changeset	300 </help>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	301 <citations>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	302 <citation type="doi">10.1038/nbt.1621</citation>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	303 </citations>
1fffcfe2fb35 Uploaded devteam parents: diff changeset	304 </tool>

Mercurial > repos > devteam > cufflinks

annotate cufflinks_wrapper.xml @ 3:3afd198a1cf0 draft