# HG changeset patch
# User rnateam
# Date 1445026388 14400
# Node ID f6d6b62540f817f687a4ee509c893dcabc132f41
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/splitfasta commit 03f3cc2000e6ce876a3cb44c55c3fe878a2e7ce3-dirty
diff -r 000000000000 -r f6d6b62540f8 splitFasta.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/splitFasta.py Fri Oct 16 16:13:08 2015 -0400
@@ -0,0 +1,13 @@
+#!/usr/bin/env python
+import os
+import sys
+from Bio import SeqIO
+
+if __name__ == "__main__":
+ inpath = sys.argv[1]
+ os.mkdir('splits')
+ with open(inpath, 'r') as handle:
+ for record in SeqIO.parse(handle, 'fasta'):
+ header = os.path.join('splits', record.id + '.fasta')
+ with open(header, 'w') as handle2:
+ SeqIO.write([record], handle2, 'fasta')
diff -r 000000000000 -r f6d6b62540f8 splitFasta.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/splitFasta.xml Fri Oct 16 16:13:08 2015 -0400
@@ -0,0 +1,44 @@
+
+ files into a collection
+
+ biopython
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ @ARTICLE{bgruening_galaxytools,
+ Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche},
+ keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna},
+ title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}},
+ url = {https://github.com/bgruening/galaxytools}
+ }
+
+
+
diff -r 000000000000 -r f6d6b62540f8 test-data/ID1_result1.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ID1_result1.fasta Fri Oct 16 16:13:08 2015 -0400
@@ -0,0 +1,2 @@
+>ID1 desc
+GATACA
diff -r 000000000000 -r f6d6b62540f8 test-data/ID2_result1.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ID2_result1.fasta Fri Oct 16 16:13:08 2015 -0400
@@ -0,0 +1,2 @@
+>ID2 desc
+GATACAGATACAGATACAGATACAGATACA
diff -r 000000000000 -r f6d6b62540f8 test-data/ID3_result1.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ID3_result1.fasta Fri Oct 16 16:13:08 2015 -0400
@@ -0,0 +1,3 @@
+>ID3 desc
+GATACAGATACAGATACAGATACAGATACAGATACAGATACAGATACAGATACAGATACA
+GATACA
diff -r 000000000000 -r f6d6b62540f8 test-data/test.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.fasta Fri Oct 16 16:13:08 2015 -0400
@@ -0,0 +1,11 @@
+>ID1 desc
+GATACA
+
+
+>ID2 desc
+GATACAGATACA
+GATACAGA
+TACAGATACA
+>ID3 desc
+GATACAGATACAGATACAGATACAGATACAGATACAGATACAGATACAGATACAGA
+TACAGATACA
diff -r 000000000000 -r f6d6b62540f8 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Fri Oct 16 16:13:08 2015 -0400
@@ -0,0 +1,6 @@
+
+
+
+
+
+