Mercurial > repos > rnateam > mirdeep2_mapper
diff mapper.xml @ 0:80c9599143f7 draft
Uploaded
author | rnateam |
---|---|
date | Fri, 16 Jan 2015 08:43:27 -0500 |
parents | |
children | bda96b97c289 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/mapper.xml Fri Jan 16 08:43:27 2015 -0500 @@ -0,0 +1,208 @@ +<tool id="rbc_mirdeep2_mapper" name="MiRDeep2 Mapper" version="2.0.0"> + <macros> + <macro name="map_params"> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Map to genome. (-p)"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact your Galaxy admin."> + <options from_data_table="bowtie_indexes"> + <filter type="sort_by" column="2"/> + <validator type="no_options" message="No indexes are available for the selected input dataset"/> + </options> + </param> + </when> <!-- build-in --> + <when value="history"> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" /> + </when> <!-- history --> + </conditional> <!-- refGenomeSource --> + <param name="map_mismatch" type="boolean" truevalue="-q" falsevalue="" checked="false" label="Map with one mismatch in the seed (mapping takes longer)" help="(-q)"/> + <param name="map_threshold" value="5" type="integer" optional="false" label="A read is allowed to map up to this number of positions in the genome" help="Map threshold. (-r)"> + <validator type="in_range" min="1" message="Minimum value is 1"/> + </param> + </macro> + </macros> + <description> +<![CDATA[ +process and map reads to a reference genome +]]> + </description> + <requirements> + <requirement type="package" version="2.0">mirdeep2_mapper</requirement> + <requirement type="package" version="0.12.7">bowtie</requirement> + <requirement type="package" version="5.18.1">perl</requirement> + </requirements> + + <command> +<![CDATA[ + + #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map" + #if $operation.refGenomeSource.genomeSource == "history" + bowtie-build $operation.refGenomeSource.ownFile custom_bowtie_indices && + #end if + #end if + mapper.pl + + $reads + + #if $reads.extension.startswith("fasta") + -c + #else if $reads.extension.startswith("fastq") + -e -h + #end if + + $remove_non_canon + + $convert_rna_dna + + #if $clip_adapter.clip == "true" + -k $clip_adapter.adapter_seq + #end if + + -l $discard_short_reads + + #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_collapse" + -m -s $output_reads_collapsed + #end if + + #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map" + -p + + #if $operation.refGenomeSource.genomeSource == "history" + custom_bowtie_indices + #else + $index + #end if + + $operation.map_mismatch + + -r $operation.map_threshold + + -t $output_mapping + #end if + + -v -n +]]> + </command> + <stdio> + <!-- Anything other than zero is an error --> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <!-- In case the return code has not been set propery check stderr too --> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> + <inputs> + <param format="fastq, fasta" name="reads" type="data" optional="false" label="Deep sequencing reads" help="Reads in fastq or fasta format"/> + <param name="remove_non_canon" type="boolean" truevalue="-j" falsevalue="" checked="false" label="Remove reads with non-standard nucleotides" help="Remove all entries that have a sequence that contains letters other than a,c,g,t,u,n,A,C,G,T,U,N. (-j)"/> + <param name="convert_rna_dna" type="boolean" truevalue="-i" falsevalue="" checked="false" label="Convert RNA to DNA alphabet (to map against genome)" help="(-i)"/> + + <conditional name="clip_adapter"> + <param name="clip" type="select" label="Clip 3' Adapter Sequence" help="(-k)"> + <option value="false">Don't Clip</option> + <option value="true">Clip Sequence</option> + </param> + <when value="true"> + <param name="adapter_seq" value="" type="text" optional="false" label="Sequence to clip" help="Adapter Sequence can only contain a,c,g,t,u,n,A,C,G,T,U,N"> + <validator type="regex" message="Adapter can ONLY contain a,c,g,t,u,n,A,C,G,T,U,N">^[ACGTUacgtu]+$</validator> + </param> + </when> + <when value="false"/> + </conditional> + + <param name="discard_short_reads" value="18" type="integer" optional="false" label="Discard reads shorter than this length" help="Set to 0 to keep all reads. (-l)"> + <validator type="in_range" min="0" message="Minimum value is 0"/> + </param> + + <conditional name="operation"> + <param name="collapse_map" type="select" label="Collapse reads and/or Map" help="(-m) and/or (-p)"> + <option value="collapse_and_map">Collapse reads and Map</option> + <option value="only_map">Map</option> + <option value="only_collapse">Collapse</option> + </param> + <when value="collapse_and_map"> + <expand macro="map_params"/> + </when> + <when value="only_map"> + <expand macro="map_params"/> + </when> + <when value="only_collapse"/> + </conditional> + </inputs> + <outputs> + <data format="fasta" name="output_reads_collapsed" label="Collapsed reads of ${tool.name} on ${on_string}"> + <filter> + ( + operation['collapse_map'] == "collapse_and_map" or + operation['collapse_map'] == "only_collapse" + ) + </filter> + </data> + <data format="tabular" name="output_mapping" label="Mapping output of ${tool.name} on ${on_string} in ARF format"> + <filter> + ( + operation['collapse_map'] == "collapse_and_map" or + operation['collapse_map'] == "only_map" + ) + </filter> + </data> + </outputs> + <tests> + <test> + <param name="reads" value="reads.fa"/> + <param name="remove_non_canon" value="True"/> + <param name="clip" value="true"/> + <param name="adapter_seq" value="TCGTATGCCGTCTTCTGCTTGT"/> + <param name="discard_short_reads" value="18"/> + <param name="collapse_map" value="collapse_and_map"/> + <param name="genomeSource" value="history"/> + <param name="ownFile" value="cel_cluster.fa"/> + <output name="output_reads_collapsed"> + <assert_contents> + <has_text text=">seq_349713_x268"/> + <has_text text="TCACCGGGTGTANATCAGCTAA"/> + <has_text text=">seq_354255_x214"/> + <has_text text="TAACCGGGTGAACACTTGCAGT"/> + <has_text text=">seq_357284_x187"/> + </assert_contents> + </output> + <output name="output_mapping"> + <assert_contents> + <has_line_matching expression="^.*22\t1\t22\ttcaccgggtggaaactagcagt\tchrII:11534525-11540624\t22\t3060\t3081.*$"/> + <has_line_matching expression="^.*22\t1\t22\ttcaccgggtggaaactagtagt\tchrII:11534525-11540624\t22\t3060\t3081.*$"/> + <has_line_matching expression="^.*22\t1\t22\ttcaccgggtgtacatcagcgaa\tchrII:11534525-11540624\t22\t3631\t3652.*$"/> + <has_line_matching expression="^.*22\t1\t22\ttcaccgggagaaaaactggtgt\tchrII:11534525-11540624\t22\t3382\t3403.*$"/> + <has_line_matching expression="^.*25\t1\t25\ttcaccgggtggaaactagcagtggc\tchrII:11534525-11540624\t25\t3060\t3084.*$"/> + </assert_contents> + </output> + </test> + </tests> + <help> +<![CDATA[ +**What MiRDeep2 Mapper does** + +The mapper module is designed as a tool to process deep sequencing reads and/or map them to the reference genome. +The module works in sequence space, and can process or map data that is in sequence fasta format. +A number of the functions of the mapper module are implemented specifically with Solexa/Illumina data in mind. + +**Example** + +Processing reads and mapping them to a genome. + +The -c option designates that the input file is a fasta file. The -j options removes entries with +non-canonical letters (letters other than a,c,g,t,u,n,A,C,G,T,U,N). The -k option clips adapters. The -l option discards reads shorter than 18 nts. +The -m option collapses the reads. The -p option maps the processed reads against the previously indexed genome (cel_cluster). The -s option +designates the name of the output file of processed reads and the -t option designates the name of the output file of the genome mappings. Last, +-v gives verbose output to the screen. + + ``mapper.pl reads.fa -c -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p cel_cluster -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v`` + +]]> + </help> + <citations> + <citation type="doi">10.1093/nar/gkr688</citation> + <citation type="doi">10.1002/0471250953.bi1210s36</citation> + </citations> +</tool>