Mercurial > repos > rnateam > graphclust_postprocessing
diff test-data/2.cluster.top5.alirna.ps @ 10:a9965909555e draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/GraphClust/CollectResults commit 4406735e44aba20859c252be39f4e99df28c7a92
| author | rnateam |
|---|---|
| date | Sat, 27 Oct 2018 13:13:33 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/2.cluster.top5.alirna.ps Sat Oct 27 13:13:33 2018 -0400 @@ -0,0 +1,425 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Creator: ViennaRNA-2.3.1 +%%CreationDate: Tue May 30 20:24:21 2017 +%%Title: RNA Secondary Structure Plot +%%BoundingBox: 0 0 700 700 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: --noLP +% to switch off outline pairs of sequence comment or +% delete the appropriate line near the end of the file + +%%BeginProlog +/RNAplot 100 dict def +RNAplot begin +/fsize 14 def +/outlinecolor {0.2 setgray} bind def +/paircolor {0.2 setgray} bind def +/seqcolor {0 setgray} bind def +/cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def +/min { 2 copy gt { exch } if pop } bind def +/max { 2 copy lt { exch } if pop } bind def +/arccoords { % i j arccoords + % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j + % onto the stack + dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if + dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup + 4 -2 roll 5 -1 roll {exch} if 4 2 roll + sequence length dup 2 div exch 3 1 roll lt + {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll} + { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if + 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll + exch add 4 -1 roll dup 5 1 roll sub 1 sub + 5 -1 roll not {4 -2 roll exch 4 2 roll} if + }ifelse + % compute the scalingfactor and prepare (1-sf) and sf*r + 2 mul exch cpr 3 1 roll div dup + 3 -1 roll mul exch 1 exch sub exch + % compute the coordinates + 3 -1 roll 1 sub coor exch get aload pop % get coord for i + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1 + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1 + 5 -1 roll 1 sub coor exch get aload pop % get coord for j + % duplicate j coord + dup 3 -1 roll dup 4 1 roll exch 8 2 roll + 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2 + 6 -1 roll mul 5 -1 roll add exch % calculate x2 + 6 -2 roll % reorder +} bind def +/drawoutline { + gsave outlinecolor newpath + coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence + currentdict /cutpoint known % check if cutpoint is defined + {coor 0 cutpoint getinterval + {aload pop lineto} forall % draw outline of 1st sequence + coor cutpoint 1 add get aload pop + 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence + coor cutpoint 1 add coor length cutpoint 1 add sub getinterval + {aload pop lineto} forall} % draw outline of 2nd sequence + {coor {aload pop lineto} forall} % draw outline as a whole + ifelse + stroke grestore +} bind def +/drawpairs { + paircolor + 0.7 setlinewidth + [9 3.01] 9 setdash + newpath + pairs {aload pop + currentdict (cpr) known + { exch dup + coor exch 1 sub get aload pop moveto + exch arccoords curveto + } + { coor exch 1 sub get aload pop moveto + coor exch 1 sub get aload pop lineto + }ifelse + } forall + stroke +} bind def +% draw bases +/drawbases { + [] 0 setdash + seqcolor + 0 + coor { + aload pop moveto + dup sequence exch 1 getinterval cshow + 1 add + } forall + pop +} bind def + +/init { + /Helvetica findfont fsize scalefont setfont + 1 setlinejoin + 1 setlinecap + 0.8 setlinewidth + % find the coordinate range + /xmax -1000 def /xmin 10000 def + /ymax -1000 def /ymin 10000 def + coor { + aload pop + dup ymin lt {dup /ymin exch def} if + dup ymax gt {/ymax exch def} {pop} ifelse + dup xmin lt {dup /xmin exch def} if + dup xmax gt {/xmax exch def} {pop} ifelse + } forall + /size {xmax xmin sub ymax ymin sub max} bind def + /width {xmax xmin sub} bind def + /height {ymax ymin sub} bind def + 10 10 translate + 680 size 10 add div dup scale + size width sub width xmin sub xmax sub add 2 div 5 add + size height sub height ymin sub ymax sub add 2 div 5 add + translate +} bind def +end +RNAplot begin +% extra definitions for standard anotations +/min { 2 copy gt { exch } if pop } bind def +/BLACK { 0 0 0 } def +/RED { 1 0 0 } def +/GREEN { 0 1 0 } def +/BLUE { 0 0 1 } def +/WHITE { 1 1 1 } def +/LabelFont { % font size LabelFont + exch findfont exch fsize mul scalefont setfont +} bind def +/Label { % i dx dy (text) Label + % write text at base i plus offset dx, dy + 4 3 roll 1 sub coor exch get aload pop moveto + 3 1 roll fsize mul exch fsize mul exch rmoveto + show +} bind def +/cmark { % i cmark draw circle around base i + newpath 1 sub coor exch get aload pop + fsize 2 div 0 360 arc stroke +} bind def +/gmark { % i j c gmark + % draw basepair i,j with c counter examples in gray + gsave + 3 min [0 0.33 0.66 0.9] exch get setgray + 1 sub dup coor exch get aload pop moveto + sequence exch 1 getinterval cshow + 1 sub dup coor exch get aload pop moveto + sequence exch 1 getinterval cshow + grestore +} bind def +/segmark { % f i j lw r g b segmark + % mark segment [i,j] with outline width lw and color rgb + % use omark and Fomark instead + gsave + setrgbcolor setlinewidth + newpath + 1 sub exch 1 sub dup + coor exch get aload pop moveto + currentdict (cpr) known + { + 3 -1 roll dup 4 1 roll dup + { + 3 1 roll dup 3 -1 roll dup + 4 1 roll exch 5 2 roll exch + } + { + 3 1 roll exch + } ifelse + 1 exch { coor exch get aload pop lineto } for + { + dup 3 1 roll 1 add exch 1 add arccoords pop pop + 4 2 roll 5 -1 roll coor exch get aload pop curveto + } if + } + { + exch 1 exch { + coor exch get aload pop lineto + } for + } ifelse + { closepath fill } if stroke + grestore +} bind def +/omark { % i j lw r g b omark + % stroke segment [i..j] with linewidth lw, color rgb + false 7 1 roll segmark +} bind def +/Fomark { % i j r g b Fomark + % fill segment [i..j] with color rgb + % should precede drawbases + 1 4 1 roll true 7 1 roll segmark +} bind def +/BFmark{ % i j k l r g b BFmark + % fill block between pairs (i,j) and (k,l) with color rgb + % should precede drawbases + gsave + setrgbcolor + newpath + currentdict (cpr) known + { + dup 1 sub coor exch get aload pop moveto % move to l + dup 1 sub 4 -1 roll dup 5 1 roll 1 sub 1 exch + { coor exch get aload pop lineto } for % lines from l to j + 3 -1 roll 4 -1 roll dup 5 1 roll arccoords curveto % curve from j to i + exch dup 4 -1 roll 1 sub exch 1 sub 1 exch + { coor exch get aload pop lineto } for % lines from i to k + exch arccoords curveto% curve from k to l + } + { exch 4 3 roll exch 1 sub exch 1 sub dup + coor exch get aload pop moveto + exch 1 exch { coor exch get aload pop lineto } for + exch 1 sub exch 1 sub dup + coor exch get aload pop lineto + exch 1 exch { coor exch get aload pop lineto } for + } ifelse + closepath fill stroke + grestore +} bind def +/hsb { + dup 0.3 mul 1 exch sub sethsbcolor +} bind def +/colorpair { % i j hue sat colorpair + % draw basepair i,j in color + % 1 index 0.00 ne { + gsave + newpath + hsb + fsize setlinewidth + currentdict (cpr) known + { + exch dup + coor exch 1 sub get aload pop moveto + exch arccoords curveto + } + { 1 sub coor exch get aload pop moveto + 1 sub coor exch get aload pop lineto + } ifelse + stroke + grestore + % } if +} bind def +end + +%%EndProlog +RNAplot begin +% data start here +/sequence (\ +ACCAUCCUUUUCUUGGGGUUGCACUACUGUCCAAUGAGCACAUAGUGAGGGCAGUACUGCUAACGCCUACACAACACACCCACAUCAACUAGAGCUUUGC\ +) def +/coor [ +[102.77672577 319.04476929] +[90.46199799 310.08557129] +[82.86160278 296.88882446] +[81.29235077 281.74096680] +[86.02611542 267.26647949] +[96.24275970 255.97311401] +[110.17218018 249.81752014] +[110.17218018 234.81752014] +[110.17218018 219.81752014] +[110.17218018 204.81752014] +[99.49130249 194.49984741] +[99.27762604 179.28770447] +[110.17218018 168.15458679] +[110.17218018 153.15458679] +[110.17218018 138.15458679] +[106.02764893 123.73851776] +[98.06128693 111.02880096] +[89.89822388 98.44451141] +[81.54043579 85.98868561] +[73.18265533 73.53286743] +[64.63217163 61.20853424] +[55.89105606 49.01866531] +[47.14994049 36.82879639] +[32.82023239 30.12281990] +[31.69130898 15.27105904] +[22.95019341 3.08119035] +[14.20907784 -9.10867786] +[5.46796179 -21.29854774] +[-3.27315354 -33.48841476] +[-12.01426888 -45.67828369] +[-20.75538445 -57.86815262] +[-29.49650002 -70.05802155] +[-40.43203354 -69.10051727] +[-50.66823959 -72.83345032] +[-58.30468369 -80.49013519] +[-61.95487976 -90.58245850] +[-60.99773407 -101.18975830] +[-55.68206024 -110.32431030] +[-63.24930573 -123.27563477] +[-78.33963013 -128.72189331] +[-83.35356903 -143.96131897] +[-74.44485474 -157.30351257] +[-58.44750214 -158.51351929] +[-47.63329697 -146.66308594] +[-50.29797745 -130.84288025] +[-42.73073578 -117.89155579] +[-23.69388771 -114.56418610] +[-12.84335899 -98.21372986] +[-17.30663109 -78.79914093] +[-8.56551647 -66.60926819] +[0.17559953 -54.41939926] +[8.91671467 -42.22953033] +[17.65783119 -30.03966331] +[26.39894676 -17.84979439] +[35.14006042 -5.65992498] +[43.88117599 6.52994347] +[57.58565903 12.36401939] +[59.33980942 28.08768082] +[68.08092499 40.27754974] +[76.82203674 52.46741867] +[83.39369965 56.13331604] +[85.63847351 65.17508698] +[93.99625397 77.63090515] +[102.35404205 90.08672333] +[109.22463226 94.59117126] +[110.77100372 103.06243134] +[118.73737335 115.77215576] +[120.40499115 100.86514282] +[126.48009491 87.15043640] +[136.39979553 75.89878845] +[149.24496460 68.15272522] +[163.82543945 64.62996674] +[178.79025269 65.65692139] +[192.75280762 71.13842010] +[204.41941833 80.56658936] +[212.70909119 93.06784058] +[216.85374451 107.48386383] +[216.46936035 122.47894287] +[211.59153748 136.66368103] +[202.67224121 148.72378540] +[190.53790283 157.54182434] +[176.31283569 162.30076599] +[161.31506348 162.55963135] +[146.93423462 158.29446411] +[134.50280762 149.90045166] +[125.17218018 138.15458679] +[125.17218018 153.15458679] +[125.17218018 168.15458679] +[136.06672668 179.28770447] +[135.85304260 194.49984741] +[125.17218018 204.81752014] +[125.17218018 219.81752014] +[125.17218018 234.81752014] +[125.17218018 249.81752014] +[139.10159302 255.97311401] +[149.31823730 267.26647949] +[154.05200195 281.74096680] +[152.48275757 296.88882446] +[144.88235474 310.08557129] +[132.56762695 319.04476929] +] def +/pairs [ +[7 94] +[8 93] +[9 92] +[10 91] +[13 88] +[14 87] +[15 86] +[16 67] +[17 66] +[18 64] +[19 63] +[20 62] +[21 60] +[22 59] +[23 58] +[25 56] +[26 55] +[27 54] +[28 53] +[29 52] +[30 51] +[31 50] +[32 49] +[38 46] +[39 45] +] def + +init + +% Start Annotations +7 94 0.0 0.6 colorpair +8 93 0.0 1 colorpair +9 92 0.0 1 colorpair +10 91 0.0 1 colorpair +13 88 0.0 1 colorpair +14 87 0.0 1 colorpair +15 86 0.0 1 colorpair +16 67 0.0 1 colorpair +17 66 0.16 1 colorpair +18 64 0.0 1 colorpair +19 63 0.0 1 colorpair +20 62 0.0 1 colorpair +21 60 0.0 1 colorpair +22 59 0.0 1 colorpair +23 58 0.16 1 colorpair +25 56 0.0 1 colorpair +26 55 0.0 1 colorpair +27 54 0.0 1 colorpair +28 53 0.0 1 colorpair +29 52 0.0 1 colorpair +30 51 0.0 1 colorpair +31 50 0.0 1 colorpair +32 49 0.16 1 colorpair +38 46 0.0 1 colorpair +39 45 0.32 1 colorpair + +% End Annotations +% switch off outline pairs or bases by removing these lines +drawoutline +drawpairs +drawbases +% Start Annotations +7 94 1 gmark +66 cmark +23 cmark +32 cmark +39 cmark +45 cmark + +% End Annotations +% show it +showpage +end +%%EOF
