comparison trimmomatic.xml @ 9:a775e9fda0ca draft

Uploaded version 0.36.4 for testing.
author pjbriggs
date Thu, 22 Jun 2017 08:57:22 -0400
parents a923b799c77c
children 3c9479ab24c3
comparison
equal deleted inserted replaced
8:a923b799c77c 9:a775e9fda0ca
1 <tool id="trimmomatic" name="Trimmomatic" version="0.36.3"> 1 <tool id="trimmomatic" name="Trimmomatic" version="0.36.4">
2 <description>flexible read trimming tool for Illumina NGS data</description> 2 <description>flexible read trimming tool for Illumina NGS data</description>
3 <macros> 3 <macros>
4 <import>trimmomatic_macros.xml</import> 4 <import>trimmomatic_macros.xml</import>
5 </macros> 5 </macros>
6 <requirements> 6 <requirements>
31 #else 31 #else
32 SE -threads \${GALAXY_SLOTS:-6} -phred33 fastq_in.'$fastq_in.extension' fastq_out.'$fastq_in.extension' 32 SE -threads \${GALAXY_SLOTS:-6} -phred33 fastq_in.'$fastq_in.extension' fastq_out.'$fastq_in.extension'
33 #end if 33 #end if
34 ## ILLUMINACLIP option 34 ## ILLUMINACLIP option
35 #if $illuminaclip.do_illuminaclip 35 #if $illuminaclip.do_illuminaclip
36 ILLUMINACLIP:\$TRIMMOMATIC_ADAPTERS_PATH/$illuminaclip.adapter_fasta:$illuminaclip.seed_mismatches:$illuminaclip.palindrome_clip_threshold:$illuminaclip.simple_clip_threshold 36 #if $illuminaclip.adapter_type.standard_or_custom == "custom"
37 #if $readtype.single_or_paired in ["pair_of_files","collection"]
38 ILLUMINACLIP:$adapter_file_from_text:$illuminaclip.seed_mismatches:$illuminaclip.palindrome_clip_threshold:$illuminaclip.simple_clip_threshold:$illuminaclip.min_adapter_len:$illuminaclip.keep_both_reads
39 #else
40 ILLUMINACLIP:$adapter_file_from_text:$illuminaclip.seed_mismatches:$illuminaclip.palindrome_clip_threshold:$illuminaclip.simple_clip_threshold
41 #end if
42 #else
43 #if $readtype.single_or_paired in ["pair_of_files","collection"]
44 ILLUMINACLIP:\$TRIMMOMATIC_ADAPTERS_PATH/$illuminaclip.adapter_type.adapter_fasta:$illuminaclip.seed_mismatches:$illuminaclip.palindrome_clip_threshold:$illuminaclip.simple_clip_threshold:$illuminaclip.min_adapter_len:$illuminaclip.keep_both_reads
45 #else
46 ILLUMINACLIP:\$TRIMMOMATIC_ADAPTERS_PATH/$illuminaclip.adapter_type.adapter_fasta:$illuminaclip.seed_mismatches:$illuminaclip.palindrome_clip_threshold:$illuminaclip.simple_clip_threshold
47 #end if
48 #end if
37 #end if 49 #end if
38 ## Other operations 50 ## Other operations
39 #for $op in $operations 51 #for $op in $operations
40 ## SLIDINGWINDOW 52 ## SLIDINGWINDOW
41 #if str( $op.operation.name ) == "SLIDINGWINDOW" 53 #if str( $op.operation.name ) == "SLIDINGWINDOW"
79 mv fastq_out_r2_unpaired.'$r2_ext' '${fastq_out_unpaired.reverse}' 91 mv fastq_out_r2_unpaired.'$r2_ext' '${fastq_out_unpaired.reverse}'
80 #else 92 #else
81 mv fastq_out.'$fastq_in.extension' '${fastq_out}' 93 mv fastq_out.'$fastq_in.extension' '${fastq_out}'
82 #end if 94 #end if
83 ]]></command> 95 ]]></command>
96 <configfiles>
97 <configfile name="adapter_file_from_text">#set from_text_area = ''
98 #if str( $illuminaclip.do_illuminaclip ) == "yes" and str( $illuminaclip.adapter_type.standard_or_custom ) == "custom":
99 #set from_text_area = $illuminaclip.adapter_type.adapter_text
100 #end if
101 ${from_text_area}</configfile>
102 </configfiles>
103
84 <inputs> 104 <inputs>
85 <conditional name="readtype"> 105 <conditional name="readtype">
86 <param name="single_or_paired" type="select" label="Single-end or paired-end reads?"> 106 <param name="single_or_paired" type="select" label="Single-end or paired-end reads?">
87 <option value="se" selected="true">Single-end</option> 107 <option value="se" selected="true">Single-end</option>
88 <option value="pair_of_files">Paired-end (two separate input files)</option> 108 <option value="pair_of_files">Paired-end (two separate input files)</option>
102 </when> 122 </when>
103 </conditional> 123 </conditional>
104 <conditional name="illuminaclip"> 124 <conditional name="illuminaclip">
105 <param name="do_illuminaclip" type="boolean" label="Perform initial ILLUMINACLIP step?" help="Cut adapter and other illumina-specific sequences from the read" truevalue="yes" falsevalue="no" checked="False" /> 125 <param name="do_illuminaclip" type="boolean" label="Perform initial ILLUMINACLIP step?" help="Cut adapter and other illumina-specific sequences from the read" truevalue="yes" falsevalue="no" checked="False" />
106 <when value="yes"> 126 <when value="yes">
107 <param name="adapter_fasta" type="select" label="Adapter sequences to use"> 127 <conditional name="adapter_type">
108 <option value="TruSeq2-SE.fa">TruSeq2 (single-ended, for Illumina GAII)</option> 128 <param name="standard_or_custom" type="select" label="Select standard adapter sequences or provide custom?">
109 <option value="TruSeq3-SE.fa">TruSeq3 (single-ended, for MiSeq and HiSeq)</option> 129 <option value="standard" selected="true">Standard</option>
110 <option value="TruSeq2-PE.fa">TruSeq2 (paired-ended, for Illumina GAII)</option> 130 <option value="custom">Custom</option>
111 <option value="TruSeq3-PE.fa">TruSeq3 (paired-ended, for MiSeq and HiSeq)</option> 131 </param>
112 <option value="TruSeq3-PE-2.fa">TruSeq3 (additional seqs) (paired-ended, for MiSeq and HiSeq)</option> 132 <when value="standard">
113 <option value="NexteraPE-PE.fa">Nextera (paired-ended)</option> 133 <param name="adapter_fasta" type="select" label="Adapter sequences to use">
114 </param> 134 <option value="TruSeq2-SE.fa">TruSeq2 (single-ended, for Illumina GAII)</option>
135 <option value="TruSeq3-SE.fa">TruSeq3 (single-ended, for MiSeq and HiSeq)</option>
136 <option value="TruSeq2-PE.fa">TruSeq2 (paired-ended, for Illumina GAII)</option>
137 <option value="TruSeq3-PE.fa">TruSeq3 (paired-ended, for MiSeq and HiSeq)</option>
138 <option value="TruSeq3-PE-2.fa">TruSeq3 (additional seqs) (paired-ended, for MiSeq and HiSeq)</option>
139 <option value="NexteraPE-PE.fa">Nextera (paired-ended)</option>
140 </param>
141 </when>
142 <when value="custom">
143 <param name="adapter_text" type="text" area="True" size="10x30" value=""
144 label="Custom adapter sequences in fasta format" help="Write sequences in the fasta format.">
145 <sanitizer>
146 <valid initial="string.printable"></valid>
147 <mapping initial="none"/>
148 </sanitizer>
149 </param>
150 </when>
151 </conditional>
115 <param name="seed_mismatches" type="integer" label="Maximum mismatch count which will still allow a full match to be performed" value="2" /> 152 <param name="seed_mismatches" type="integer" label="Maximum mismatch count which will still allow a full match to be performed" value="2" />
116 <param name="palindrome_clip_threshold" type="integer" label="How accurate the match between the two 'adapter ligated' reads must be for PE palindrome read alignment" value="30" /> 153 <param name="palindrome_clip_threshold" type="integer" label="How accurate the match between the two 'adapter ligated' reads must be for PE palindrome read alignment" value="30" />
117 <param name="simple_clip_threshold" type="integer" label="How accurate the match between any adapter etc. sequence must be against a read" value="10" /> 154 <param name="simple_clip_threshold" type="integer" label="How accurate the match between any adapter etc. sequence must be against a read" value="10" />
155 <param name="min_adapter_len" type="integer" label="Minimum length of adapter that needs to be detected (PE specific/palindrome mode)" value="8" />
156 <param name="keep_both_reads" type="boolean" label="Always keep both reads (PE specific/palindrome mode)?" truevalue="true" falsevalue="false" checked="true"
157 help="See help below"/>
118 </when> 158 </when>
119 <when value="no" /> <!-- empty clause to satisfy planemo lint --> 159 <when value="no" /> <!-- empty clause to satisfy planemo lint -->
120 </conditional> 160 </conditional>
121 <repeat name="operations" title="Trimmomatic Operation" min="1"> 161 <repeat name="operations" title="Trimmomatic Operation" min="1">
122 <conditional name="operation"> 162 <conditional name="operation">
285 <param name="operations_0|operation|name" value="MAXINFO" /> 325 <param name="operations_0|operation|name" value="MAXINFO" />
286 <param name="operations_0|operation|target_length" value="75" /> 326 <param name="operations_0|operation|target_length" value="75" />
287 <param name="operations_0|operation|strictness" value="0.8" /> 327 <param name="operations_0|operation|strictness" value="0.8" />
288 <output name="fastq_out" file="trimmomatic_maxinfo.fastq" /> 328 <output name="fastq_out" file="trimmomatic_maxinfo.fastq" />
289 </test> 329 </test>
330 <test>
331 <!-- Paired-end ILLUMINACLIP - this does not check valid clipping -->
332 <param name="single_or_paired" value="pair_of_files" />
333 <param name="fastq_r1_in" value="Illumina_SG_R1.fastq" ftype="fastqsanger" />
334 <param name="fastq_r2_in" value="Illumina_SG_R2.fastq" ftype="fastqsanger" />
335 <param name="do_illuminaclip" value="true"/>
336 <param name="adapter_fasta" value="TruSeq2-PE.fa"/>
337 <param name="operations_0|operation|name" value="SLIDINGWINDOW" />
338 <output name="fastq_out_r1_paired" file="trimmomatic_pe_r1_paired_out1_clip.fastq" />
339 <output name="fastq_out_r1_unpaired" file="trimmomatic_pe_r1_unpaired_out1.fastq" />
340 <output name="fastq_out_r2_paired" file="trimmomatic_pe_r2_paired_out1.fastq" />
341 <output name="fastq_out_r2_unpaired" file="trimmomatic_pe_r2_unpaired_out1_clip.fastq" />
342 </test>
343 <test>
344 <!-- Paired-end ILLUMINACLIP providing 'custom' adapters - this does not check valid clipping -->
345 <param name="single_or_paired" value="pair_of_files" />
346 <param name="fastq_r1_in" value="Illumina_SG_R1.fastq" ftype="fastqsanger" />
347 <param name="fastq_r2_in" value="Illumina_SG_R2.fastq" ftype="fastqsanger" />
348 <param name="do_illuminaclip" value="true"/>
349 <param name="standard_or_custom" value="custom"/>
350 <param name="adapter_text"
351 value=">PrefixPE/1&#10;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT&#10;>PrefixPE/2&#10;CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT&#10;>PCR_Primer1&#10;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT&#10;>PCR_Primer1_rc&#10;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT&#10;>PCR_Primer2&#10;CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT&#10;>PCR_Primer2_rc&#10;AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG&#10;>FlowCell1&#10;TTTTTTTTTTAATGATACGGCGACCACCGAGATCTACAC&#10;>FlowCell2&#10;TTTTTTTTTTCAAGCAGAAGACGGCATACGA&#10;"/>
352 <param name="adapter_fasta" value="TruSeq2-PE.fa"/>
353 <param name="operations_0|operation|name" value="SLIDINGWINDOW" />
354 <output name="fastq_out_r1_paired" file="trimmomatic_pe_r1_paired_out1_clip.fastq" />
355 <output name="fastq_out_r1_unpaired" file="trimmomatic_pe_r1_unpaired_out1.fastq" />
356 <output name="fastq_out_r2_paired" file="trimmomatic_pe_r2_paired_out1.fastq" />
357 <output name="fastq_out_r2_unpaired" file="trimmomatic_pe_r2_unpaired_out1_clip.fastq" />
358 </test>
290 </tests> 359 </tests>
291 <help><![CDATA[ 360 <help><![CDATA[
292 .. class:: infomark 361 .. class:: infomark
293 362
294 **What it does** 363 **What it does**
297 single ended data. 366 single ended data.
298 367
299 This tool allows the following trimming steps to be performed: 368 This tool allows the following trimming steps to be performed:
300 369
301 * **ILLUMINACLIP:** Cut adapter and other illumina-specific sequences from the read 370 * **ILLUMINACLIP:** Cut adapter and other illumina-specific sequences from the read
371
372 * If **Always keep both reads (PE specific/palindrome mode)** is True, the reverse read will also be retained in palindrome mode.
373 After read-though has been detected by palindrome mode, and the adapter sequence removed,
374 the reverse read contains the same sequence information as the forward read, albeit in reverse complement.
375 For this reason, the default behaviour is to entirely drop the reverse read.
376 Retaining the reverse read may be useful e.g. if the downstream tools cannot handle a combination of paired and unpaired reads.
302 * **SLIDINGWINDOW:** Perform a sliding window trimming, cutting once the average 377 * **SLIDINGWINDOW:** Perform a sliding window trimming, cutting once the average
303 quality within the window falls below a threshold 378 quality within the window falls below a threshold
304 * **MINLEN:** Drop the read if it is below a specified length 379 * **MINLEN:** Drop the read if it is below a specified length
305 * **LEADING:** Cut bases off the start of a read, if below a threshold quality 380 * **LEADING:** Cut bases off the start of a read, if below a threshold quality
306 * **TRAILING:** Cut bases off the end of a read, if below a threshold quality 381 * **TRAILING:** Cut bases off the end of a read, if below a threshold quality
357 .. class:: infomark 432 .. class:: infomark
358 433
359 **Credits** 434 **Credits**
360 435
361 This Galaxy tool has been developed within the Bioinformatics Core Facility at the 436 This Galaxy tool has been developed within the Bioinformatics Core Facility at the
362 University of Manchester, with contributions from Peter van Heusden and Marius 437 University of Manchester, with contributions from Peter van Heusden, Marius
363 van den Beek. 438 van den Beek, Jelle Scholtalbers and Charles Girardot.
364 439
365 It runs the Trimmomatic program which has been developed 440 It runs the Trimmomatic program which has been developed
366 within Bjorn Usadel's group at RWTH Aachen university. 441 within Bjorn Usadel's group at RWTH Aachen university.
367 442
368 Trimmomatic website (including documentation): 443 Trimmomatic website (including documentation):