Mercurial > repos > pjbriggs > pal_finder

view test-data/illuminaPE_microsats.out @ 1:288a74cd7a8d draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Explicitly build and use perl 5.16.3 as a tool dependency.
author pjbriggs
date Mon, 16 Mar 2015 12:23:20 -0400
parents 1dac42bb7aab
children 1cea7b4b838f
line wrap: on
line source

readPairID	Motifs(bases)	Bases in all Motifs	Possible Extended	Possible Spanning	Primers found (1=y,0=n)	F Primer Name	Forward Primer	R Primer Name	Reverse Primer	Amplicon Motifs	Number motif bases in amplicon	Primers on sep reads	Extend with primers	Spand with primers	Occurances of Forward Primer in Reads	Occurances of Reverse Primer in Reads	Occurances of Amplifiable Primer Pair in Reads	Occurances of Amplifiable Primer Pair in PALs
ILLUMINA-545855_0049_FC61RLR:2:1:8044:1926#0	AT(12) 	12			0													
ILLUMINA-545855_0049_FC61RLR:2:1:1978:1220#0	AC(12) 	12			1	test_3	GCAGTAAACAAAGGCAAAGGG	test_4	CCTGGGCAGAGGTGTTCC	AC(12) 	12	1			1	1	1	1
ILLUMINA-545855_0049_FC61RLR:2:1:5879:1238#0	AT(12) 	12			0													
ILLUMINA-545855_0049_FC61RLR:2:1:8899:1514#0	AC(12) AC(12) 	24			1	test_2	TCTTTATCTAAACACATCCTGAAATACC	test_1	AAACGCAATTATTTTGAGATGTCC	AC(12) AC(12) 	24	1			1	2	1	1
ILLUMINA-545855_0049_FC61RLR:2:1:10979:1695#0	TC(14) 	14			1	test_7	TTCTCCCACTATATTTTGCATTGG	test_8	TCCAGACTGAAGCTACCCTGG	TC(14) 	14	1			1	1	1	1
ILLUMINA-545855_0049_FC61RLR:2:1:5626:1554#0	AT(14) AC(16) AC(16) AT(12) 	58			0													
ILLUMINA-545855_0049_FC61RLR:2:1:8157:1636#0	AC(12) 	12			1	test_5	AAGTACAGTGGGGAGGCTGG	test_6	TTTTCTACACAGCTCAAGTAGCCC	AC(12) 	12	1			1	1	1	1
ILLUMINA-545855_0049_FC61RLR:2:1:19063:1614#0	AT(14) AT(14) AT(14) AT(14) 	56			0													
ILLUMINA-545855_0049_FC61RLR:2:1:17449:1584#0	AC(36) 	36			0													
ILLUMINA-545855_0049_FC61RLR:2:1:6204:1090#0	TC(12) 	12			0