Mercurial > repos > pimarin > bakta
comparison test-data/TEST_4/TEST_4.gff3 @ 0:4d315de96666 draft
"planemo upload for repository https://github.com/mesocentre-clermont-auvergne/galaxy-tools/tree/master/tools/bakta commit bf30715c881a622947d3d099d7a22e323e2ceef3-dirty"
| author | pimarin |
|---|---|
| date | Wed, 18 May 2022 11:13:45 +0000 |
| parents | |
| children | ca9e2125c5de |
comparison
equal
deleted
inserted
replaced
| -1:000000000000 | 0:4d315de96666 |
|---|---|
| 1 ##gff-version 3 | |
| 2 ##feature-ontology https://github.com/The-Sequence-Ontology/SO-Ontologies/blob/v3.1/so.obo | |
| 3 # Annotated with Bakta | |
| 4 # Software: v1.4.0 | |
| 5 # Database: v3.0 | |
| 6 # DOI: 10.1099/mgen.0.000685 | |
| 7 # URL: github.com/oschwengers/bakta | |
| 8 ##sequence-region c1 1 5498578 | |
| 9 c1 Bakta region 1 5498578 . + . ID=c1;Name=c1;Is_circular=true | |
| 10 c1 Prodigal gene 3 98 . + . ID=BALIOE_00005_gene;locus_tag=BALIOE_00005 | |
| 11 c1 Prodigal CDS 3 98 . + 0 ID=BALIOE_00005;Name=hypothetical protein;locus_tag=BALIOE_00005;product=hypothetical protein;Parent=BALIOE_00005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 12 c1 Infernal regulatory_region 215 328 3.3e-20 + . ID=BALIOELGAO_173;Name=Threonine operon leader;product=Threonine operon leader;Dbxref=RFAM:RF00506;Note=SO:0000140;regulatory_class=attenuator | |
| 13 c1 Prodigal gene 354 2816 . + . ID=BALIOE_00010_gene;locus_tag=BALIOE_00010 | |
| 14 c1 Prodigal CDS 354 2816 . + 0 ID=BALIOE_00010;Name=hypothetical protein;locus_tag=BALIOE_00010;product=hypothetical protein;Parent=BALIOE_00010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 15 c1 Prodigal gene 2818 3750 . + . ID=BALIOE_00015_gene;locus_tag=BALIOE_00015 | |
| 16 c1 Prodigal CDS 2818 3750 . + 0 ID=BALIOE_00015;Name=hypothetical protein;locus_tag=BALIOE_00015;product=hypothetical protein;Parent=BALIOE_00015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 17 c1 Prodigal gene 3751 5037 . + . ID=BALIOE_00020_gene;locus_tag=BALIOE_00020 | |
| 18 c1 Prodigal CDS 3751 5037 . + 0 ID=BALIOE_00020;Name=hypothetical protein;locus_tag=BALIOE_00020;product=hypothetical protein;Parent=BALIOE_00020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 19 c1 Prodigal gene 5251 5547 . + . ID=BALIOE_00025_gene;locus_tag=BALIOE_00025 | |
| 20 c1 Prodigal CDS 5251 5547 . + 0 ID=BALIOE_00025;Name=hypothetical protein;locus_tag=BALIOE_00025;product=hypothetical protein;Parent=BALIOE_00025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 21 c1 Prodigal gene 5700 6476 . - . ID=BALIOE_00030_gene;locus_tag=BALIOE_00030 | |
| 22 c1 Prodigal CDS 5700 6476 . - 0 ID=BALIOE_00030;Name=hypothetical protein;locus_tag=BALIOE_00030;product=hypothetical protein;Parent=BALIOE_00030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 23 c1 Prodigal gene 6546 7976 . - . ID=BALIOE_00035_gene;locus_tag=BALIOE_00035 | |
| 24 c1 Prodigal CDS 6546 7976 . - 0 ID=BALIOE_00035;Name=hypothetical protein;locus_tag=BALIOE_00035;product=hypothetical protein;Parent=BALIOE_00035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 25 c1 Prodigal gene 8255 9208 . + . ID=BALIOE_00040_gene;locus_tag=BALIOE_00040 | |
| 26 c1 Prodigal CDS 8255 9208 . + 0 ID=BALIOE_00040;Name=hypothetical protein;locus_tag=BALIOE_00040;product=hypothetical protein;Parent=BALIOE_00040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 27 c1 Prodigal gene 9323 9910 . + . ID=BALIOE_00045_gene;locus_tag=BALIOE_00045 | |
| 28 c1 Prodigal CDS 9323 9910 . + 0 ID=BALIOE_00045;Name=hypothetical protein;locus_tag=BALIOE_00045;product=hypothetical protein;Parent=BALIOE_00045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 29 c1 Prodigal gene 9945 10511 . - . ID=BALIOE_00050_gene;locus_tag=BALIOE_00050 | |
| 30 c1 Prodigal CDS 9945 10511 . - 0 ID=BALIOE_00050;Name=hypothetical protein;locus_tag=BALIOE_00050;product=hypothetical protein;Parent=BALIOE_00050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 31 c1 Prodigal gene 10660 11373 . - . ID=BALIOE_00055_gene;locus_tag=BALIOE_00055 | |
| 32 c1 Prodigal CDS 10660 11373 . - 0 ID=BALIOE_00055;Name=hypothetical protein;locus_tag=BALIOE_00055;product=hypothetical protein;Parent=BALIOE_00055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 33 c1 Prodigal gene 11399 11803 . - . ID=BALIOE_00060_gene;locus_tag=BALIOE_00060 | |
| 34 c1 Prodigal CDS 11399 11803 . - 0 ID=BALIOE_00060;Name=hypothetical protein;locus_tag=BALIOE_00060;product=hypothetical protein;Parent=BALIOE_00060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 35 c1 Prodigal gene 12180 14096 . + . ID=BALIOE_00065_gene;locus_tag=BALIOE_00065 | |
| 36 c1 Prodigal CDS 12180 14096 . + 0 ID=BALIOE_00065;Name=hypothetical protein;locus_tag=BALIOE_00065;product=hypothetical protein;Parent=BALIOE_00065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 37 c1 Prodigal gene 14185 15315 . + . ID=BALIOE_00070_gene;locus_tag=BALIOE_00070 | |
| 38 c1 Prodigal CDS 14185 15315 . + 0 ID=BALIOE_00070;Name=hypothetical protein;locus_tag=BALIOE_00070;product=hypothetical protein;Parent=BALIOE_00070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 39 c1 Prodigal gene 15419 15628 . - . ID=BALIOE_00075_gene;locus_tag=BALIOE_00075 | |
| 40 c1 Prodigal CDS 15419 15628 . - 0 ID=BALIOE_00075;Name=hypothetical protein;locus_tag=BALIOE_00075;product=hypothetical protein;Parent=BALIOE_00075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 41 c1 Prodigal gene 16157 17323 . + . ID=BALIOE_00080_gene;locus_tag=BALIOE_00080 | |
| 42 c1 Prodigal CDS 16157 17323 . + 0 ID=BALIOE_00080;Name=hypothetical protein;locus_tag=BALIOE_00080;product=hypothetical protein;Parent=BALIOE_00080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 43 c1 Prodigal gene 17389 18288 . + . ID=BALIOE_00085_gene;locus_tag=BALIOE_00085 | |
| 44 c1 Prodigal CDS 17389 18288 . + 0 ID=BALIOE_00085;Name=hypothetical protein;locus_tag=BALIOE_00085;product=hypothetical protein;Parent=BALIOE_00085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 45 c1 Prodigal gene 18326 18751 . - . ID=BALIOE_00090_gene;locus_tag=BALIOE_00090 | |
| 46 c1 Prodigal CDS 18326 18751 . - 0 ID=BALIOE_00090;Name=hypothetical protein;locus_tag=BALIOE_00090;product=hypothetical protein;Parent=BALIOE_00090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 47 c1 Prodigal gene 18960 19286 . - . ID=BALIOE_00095_gene;locus_tag=BALIOE_00095 | |
| 48 c1 Prodigal CDS 18960 19286 . - 0 ID=BALIOE_00095;Name=hypothetical protein;locus_tag=BALIOE_00095;product=hypothetical protein;Parent=BALIOE_00095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 49 c1 Prodigal gene 19299 21749 . - . ID=BALIOE_00100_gene;locus_tag=BALIOE_00100 | |
| 50 c1 Prodigal CDS 19299 21749 . - 0 ID=BALIOE_00100;Name=hypothetical protein;locus_tag=BALIOE_00100;product=hypothetical protein;Parent=BALIOE_00100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 51 c1 Prodigal gene 21762 22445 . - . ID=BALIOE_00105_gene;locus_tag=BALIOE_00105 | |
| 52 c1 Prodigal CDS 21762 22445 . - 0 ID=BALIOE_00105;Name=hypothetical protein;locus_tag=BALIOE_00105;product=hypothetical protein;Parent=BALIOE_00105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 53 c1 Prodigal gene 22495 23028 . - . ID=BALIOE_00110_gene;locus_tag=BALIOE_00110 | |
| 54 c1 Prodigal CDS 22495 23028 . - 0 ID=BALIOE_00110;Name=hypothetical protein;locus_tag=BALIOE_00110;product=hypothetical protein;Parent=BALIOE_00110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 55 c1 Prodigal gene 23330 24751 . - . ID=BALIOE_00115_gene;locus_tag=BALIOE_00115 | |
| 56 c1 Prodigal CDS 23330 24751 . - 0 ID=BALIOE_00115;Name=hypothetical protein;locus_tag=BALIOE_00115;product=hypothetical protein;Parent=BALIOE_00115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 57 c1 Prodigal gene 25221 25484 . - . ID=BALIOE_00120_gene;locus_tag=BALIOE_00120 | |
| 58 c1 Prodigal CDS 25221 25484 . - 0 ID=BALIOE_00120;Name=hypothetical protein;locus_tag=BALIOE_00120;product=hypothetical protein;Parent=BALIOE_00120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 59 c1 Prodigal gene 25819 26760 . + . ID=BALIOE_00125_gene;locus_tag=BALIOE_00125 | |
| 60 c1 Prodigal CDS 25819 26760 . + 0 ID=BALIOE_00125;Name=hypothetical protein;locus_tag=BALIOE_00125;product=hypothetical protein;Parent=BALIOE_00125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 61 c1 Prodigal gene 26803 29619 . + . ID=BALIOE_00130_gene;locus_tag=BALIOE_00130 | |
| 62 c1 Prodigal CDS 26803 29619 . + 0 ID=BALIOE_00130;Name=hypothetical protein;locus_tag=BALIOE_00130;product=hypothetical protein;Parent=BALIOE_00130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 63 c1 Prodigal gene 29619 30113 . + . ID=BALIOE_00135_gene;locus_tag=BALIOE_00135 | |
| 64 c1 Prodigal CDS 29619 30113 . + 0 ID=BALIOE_00135;Name=hypothetical protein;locus_tag=BALIOE_00135;product=hypothetical protein;Parent=BALIOE_00135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 65 c1 Prodigal gene 30201 30650 . + . ID=BALIOE_00140_gene;locus_tag=BALIOE_00140 | |
| 66 c1 Prodigal CDS 30201 30650 . + 0 ID=BALIOE_00140;Name=hypothetical protein;locus_tag=BALIOE_00140;product=hypothetical protein;Parent=BALIOE_00140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 67 c1 Prodigal gene 30652 31602 . + . ID=BALIOE_00145_gene;locus_tag=BALIOE_00145 | |
| 68 c1 Prodigal CDS 30652 31602 . + 0 ID=BALIOE_00145;Name=hypothetical protein;locus_tag=BALIOE_00145;product=hypothetical protein;Parent=BALIOE_00145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 69 c1 Prodigal gene 31668 32582 . + . ID=BALIOE_00150_gene;locus_tag=BALIOE_00150 | |
| 70 c1 Prodigal CDS 31668 32582 . + 0 ID=BALIOE_00150;Name=hypothetical protein;locus_tag=BALIOE_00150;product=hypothetical protein;Parent=BALIOE_00150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 71 c1 Prodigal gene 32749 33570 . + . ID=BALIOE_00155_gene;locus_tag=BALIOE_00155 | |
| 72 c1 Prodigal CDS 32749 33570 . + 0 ID=BALIOE_00155;Name=hypothetical protein;locus_tag=BALIOE_00155;product=hypothetical protein;Parent=BALIOE_00155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 73 c1 Prodigal gene 34026 35174 . + . ID=BALIOE_00160_gene;locus_tag=BALIOE_00160 | |
| 74 c1 Prodigal CDS 34026 35174 . + 0 ID=BALIOE_00160;Name=hypothetical protein;locus_tag=BALIOE_00160;product=hypothetical protein;Parent=BALIOE_00160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 75 c1 Prodigal gene 35192 38413 . + . ID=BALIOE_00165_gene;locus_tag=BALIOE_00165 | |
| 76 c1 Prodigal CDS 35192 38413 . + 0 ID=BALIOE_00165;Name=hypothetical protein;locus_tag=BALIOE_00165;product=hypothetical protein;Parent=BALIOE_00165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 77 c1 Prodigal gene 38421 38639 . - . ID=BALIOE_00170_gene;locus_tag=BALIOE_00170 | |
| 78 c1 Prodigal CDS 38421 38639 . - 0 ID=BALIOE_00170;Name=hypothetical protein;locus_tag=BALIOE_00170;product=hypothetical protein;Parent=BALIOE_00170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 79 c1 Prodigal gene 38674 39069 . + . ID=BALIOE_00175_gene;locus_tag=BALIOE_00175 | |
| 80 c1 Prodigal CDS 38674 39069 . + 0 ID=BALIOE_00175;Name=hypothetical protein;locus_tag=BALIOE_00175;product=hypothetical protein;Parent=BALIOE_00175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 81 c1 Prodigal gene 39188 39778 . - . ID=BALIOE_00180_gene;locus_tag=BALIOE_00180 | |
| 82 c1 Prodigal CDS 39188 39778 . - 0 ID=BALIOE_00180;Name=hypothetical protein;locus_tag=BALIOE_00180;product=hypothetical protein;Parent=BALIOE_00180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 83 c1 Prodigal gene 39784 40569 . - . ID=BALIOE_00185_gene;locus_tag=BALIOE_00185 | |
| 84 c1 Prodigal CDS 39784 40569 . - 0 ID=BALIOE_00185;Name=hypothetical protein;locus_tag=BALIOE_00185;product=hypothetical protein;Parent=BALIOE_00185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 85 c1 Prodigal gene 40678 42231 . - . ID=BALIOE_00190_gene;locus_tag=BALIOE_00190 | |
| 86 c1 Prodigal CDS 40678 42231 . - 0 ID=BALIOE_00190;Name=hypothetical protein;locus_tag=BALIOE_00190;product=hypothetical protein;Parent=BALIOE_00190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 87 c1 Prodigal gene 42305 43522 . - . ID=BALIOE_00195_gene;locus_tag=BALIOE_00195 | |
| 88 c1 Prodigal CDS 42305 43522 . - 0 ID=BALIOE_00195;Name=hypothetical protein;locus_tag=BALIOE_00195;product=hypothetical protein;Parent=BALIOE_00195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 89 c1 Prodigal gene 43651 44793 . - . ID=BALIOE_00200_gene;locus_tag=BALIOE_00200 | |
| 90 c1 Prodigal CDS 43651 44793 . - 0 ID=BALIOE_00200;Name=hypothetical protein;locus_tag=BALIOE_00200;product=hypothetical protein;Parent=BALIOE_00200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 91 c1 Prodigal gene 44824 46338 . - . ID=BALIOE_00205_gene;locus_tag=BALIOE_00205 | |
| 92 c1 Prodigal CDS 44824 46338 . - 0 ID=BALIOE_00205;Name=hypothetical protein;locus_tag=BALIOE_00205;product=hypothetical protein;Parent=BALIOE_00205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 93 c1 PILER-CR repeat_region 46595 46726 . ? . ID=BALIOELGAO_174;Name=CRISPR array with 3 repeats of length 17%2C consensus sequence TTTTCAATATTGGTGAT and spacer length 41;product=CRISPR array with 3 repeats of length 17%2C consensus sequence TTTTCAATATTGGTGAT and spacer length 41;Note=SO:0001459;rpt_family=CRISPR;rpt_type=direct;rpt_unit_seq=TTTTCAATATTGGTGAT | |
| 94 c1 Prodigal gene 46817 47587 . + . ID=BALIOE_00210_gene;locus_tag=BALIOE_00210 | |
| 95 c1 Prodigal CDS 46817 47587 . + 0 ID=BALIOE_00210;Name=hypothetical protein;locus_tag=BALIOE_00210;product=hypothetical protein;Parent=BALIOE_00210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 96 c1 Prodigal gene 47602 48543 . + . ID=BALIOE_00215_gene;locus_tag=BALIOE_00215 | |
| 97 c1 Prodigal CDS 47602 48543 . + 0 ID=BALIOE_00215;Name=hypothetical protein;locus_tag=BALIOE_00215;product=hypothetical protein;Parent=BALIOE_00215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 98 c1 Prodigal gene 48594 49880 . + . ID=BALIOE_00220_gene;locus_tag=BALIOE_00220 | |
| 99 c1 Prodigal CDS 48594 49880 . + 0 ID=BALIOE_00220;Name=hypothetical protein;locus_tag=BALIOE_00220;product=hypothetical protein;Parent=BALIOE_00220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 100 c1 Prodigal gene 49877 50164 . + . ID=BALIOE_00225_gene;locus_tag=BALIOE_00225 | |
| 101 c1 Prodigal CDS 49877 50164 . + 0 ID=BALIOE_00225;Name=hypothetical protein;locus_tag=BALIOE_00225;product=hypothetical protein;Parent=BALIOE_00225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 102 c1 Prodigal gene 50222 51553 . + . ID=BALIOE_00230_gene;locus_tag=BALIOE_00230 | |
| 103 c1 Prodigal CDS 50222 51553 . + 0 ID=BALIOE_00230;Name=hypothetical protein;locus_tag=BALIOE_00230;product=hypothetical protein;Parent=BALIOE_00230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 104 c1 Prodigal gene 51661 52191 . + . ID=BALIOE_00235_gene;locus_tag=BALIOE_00235 | |
| 105 c1 Prodigal CDS 51661 52191 . + 0 ID=BALIOE_00235;Name=hypothetical protein;locus_tag=BALIOE_00235;product=hypothetical protein;Parent=BALIOE_00235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 106 c1 Prodigal gene 52184 54046 . + . ID=BALIOE_00240_gene;locus_tag=BALIOE_00240 | |
| 107 c1 Prodigal CDS 52184 54046 . + 0 ID=BALIOE_00240;Name=hypothetical protein;locus_tag=BALIOE_00240;product=hypothetical protein;Parent=BALIOE_00240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 108 c1 Prodigal gene 54127 54717 . + . ID=BALIOE_00245_gene;locus_tag=BALIOE_00245 | |
| 109 c1 Prodigal CDS 54127 54717 . + 0 ID=BALIOE_00245;Name=hypothetical protein;locus_tag=BALIOE_00245;product=hypothetical protein;Parent=BALIOE_00245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 110 c1 Prodigal gene 54803 55036 . + . ID=BALIOE_00250_gene;locus_tag=BALIOE_00250 | |
| 111 c1 Prodigal CDS 54803 55036 . + 0 ID=BALIOE_00250;Name=hypothetical protein;locus_tag=BALIOE_00250;product=hypothetical protein;Parent=BALIOE_00250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 112 c1 Prodigal gene 55039 55353 . + . ID=BALIOE_00255_gene;locus_tag=BALIOE_00255 | |
| 113 c1 Prodigal CDS 55039 55353 . + 0 ID=BALIOE_00255;Name=hypothetical protein;locus_tag=BALIOE_00255;product=hypothetical protein;Parent=BALIOE_00255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 114 c1 Prodigal gene 55350 56198 . - . ID=BALIOE_00260_gene;locus_tag=BALIOE_00260 | |
| 115 c1 Prodigal CDS 55350 56198 . - 0 ID=BALIOE_00260;Name=hypothetical protein;locus_tag=BALIOE_00260;product=hypothetical protein;Parent=BALIOE_00260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 116 c1 Prodigal gene 56205 56582 . - . ID=BALIOE_00265_gene;locus_tag=BALIOE_00265 | |
| 117 c1 Prodigal CDS 56205 56582 . - 0 ID=BALIOE_00265;Name=hypothetical protein;locus_tag=BALIOE_00265;product=hypothetical protein;Parent=BALIOE_00265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 118 c1 Prodigal gene 56585 57406 . - . ID=BALIOE_00270_gene;locus_tag=BALIOE_00270 | |
| 119 c1 Prodigal CDS 56585 57406 . - 0 ID=BALIOE_00270;Name=hypothetical protein;locus_tag=BALIOE_00270;product=hypothetical protein;Parent=BALIOE_00270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 120 c1 Prodigal gene 57403 58392 . - . ID=BALIOE_00275_gene;locus_tag=BALIOE_00275 | |
| 121 c1 Prodigal CDS 57403 58392 . - 0 ID=BALIOE_00275;Name=hypothetical protein;locus_tag=BALIOE_00275;product=hypothetical protein;Parent=BALIOE_00275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 122 c1 Prodigal gene 58392 59678 . - . ID=BALIOE_00280_gene;locus_tag=BALIOE_00280 | |
| 123 c1 Prodigal CDS 58392 59678 . - 0 ID=BALIOE_00280;Name=hypothetical protein;locus_tag=BALIOE_00280;product=hypothetical protein;Parent=BALIOE_00280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 124 c1 Prodigal gene 59731 62085 . - . ID=BALIOE_00285_gene;locus_tag=BALIOE_00285 | |
| 125 c1 Prodigal CDS 59731 62085 . - 0 ID=BALIOE_00285;Name=hypothetical protein;locus_tag=BALIOE_00285;product=hypothetical protein;Parent=BALIOE_00285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 126 c1 Prodigal gene 62340 63155 . + . ID=BALIOE_00290_gene;locus_tag=BALIOE_00290 | |
| 127 c1 Prodigal CDS 62340 63155 . + 0 ID=BALIOE_00290;Name=hypothetical protein;locus_tag=BALIOE_00290;product=hypothetical protein;Parent=BALIOE_00290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 128 c1 Prodigal gene 63450 64202 . + . ID=BALIOE_00295_gene;locus_tag=BALIOE_00295 | |
| 129 c1 Prodigal CDS 63450 64202 . + 0 ID=BALIOE_00295;Name=hypothetical protein;locus_tag=BALIOE_00295;product=hypothetical protein;Parent=BALIOE_00295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 130 c1 Prodigal gene 64620 65279 . - . ID=BALIOE_00300_gene;locus_tag=BALIOE_00300 | |
| 131 c1 Prodigal CDS 64620 65279 . - 0 ID=BALIOE_00300;Name=hypothetical protein;locus_tag=BALIOE_00300;product=hypothetical protein;Parent=BALIOE_00300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 132 c1 Prodigal gene 65291 68197 . - . ID=BALIOE_00305_gene;locus_tag=BALIOE_00305 | |
| 133 c1 Prodigal CDS 65291 68197 . - 0 ID=BALIOE_00305;Name=hypothetical protein;locus_tag=BALIOE_00305;product=hypothetical protein;Parent=BALIOE_00305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 134 c1 Prodigal gene 68361 70712 . - . ID=BALIOE_00310_gene;locus_tag=BALIOE_00310 | |
| 135 c1 Prodigal CDS 68361 70712 . - 0 ID=BALIOE_00310;Name=hypothetical protein;locus_tag=BALIOE_00310;product=hypothetical protein;Parent=BALIOE_00310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 136 c1 Prodigal gene 70787 71482 . - . ID=BALIOE_00315_gene;locus_tag=BALIOE_00315 | |
| 137 c1 Prodigal CDS 70787 71482 . - 0 ID=BALIOE_00315;Name=hypothetical protein;locus_tag=BALIOE_00315;product=hypothetical protein;Parent=BALIOE_00315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 138 c1 Prodigal gene 71682 73184 . - . ID=BALIOE_00320_gene;locus_tag=BALIOE_00320 | |
| 139 c1 Prodigal CDS 71682 73184 . - 0 ID=BALIOE_00320;Name=hypothetical protein;locus_tag=BALIOE_00320;product=hypothetical protein;Parent=BALIOE_00320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 140 c1 Prodigal gene 73195 74895 . - . ID=BALIOE_00325_gene;locus_tag=BALIOE_00325 | |
| 141 c1 Prodigal CDS 73195 74895 . - 0 ID=BALIOE_00325;Name=hypothetical protein;locus_tag=BALIOE_00325;product=hypothetical protein;Parent=BALIOE_00325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 142 c1 Prodigal gene 75234 76112 . + . ID=BALIOE_00330_gene;locus_tag=BALIOE_00330 | |
| 143 c1 Prodigal CDS 75234 76112 . + 0 ID=BALIOE_00330;Name=hypothetical protein;locus_tag=BALIOE_00330;product=hypothetical protein;Parent=BALIOE_00330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 144 c1 Prodigal gene 76198 76962 . + . ID=BALIOE_00335_gene;locus_tag=BALIOE_00335 | |
| 145 c1 Prodigal CDS 76198 76962 . + 0 ID=BALIOE_00335;Name=hypothetical protein;locus_tag=BALIOE_00335;product=hypothetical protein;Parent=BALIOE_00335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 146 c1 Prodigal gene 77049 77747 . - . ID=BALIOE_00340_gene;locus_tag=BALIOE_00340 | |
| 147 c1 Prodigal CDS 77049 77747 . - 0 ID=BALIOE_00340;Name=hypothetical protein;locus_tag=BALIOE_00340;product=hypothetical protein;Parent=BALIOE_00340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 148 c1 Prodigal gene 77731 79341 . - . ID=BALIOE_00345_gene;locus_tag=BALIOE_00345 | |
| 149 c1 Prodigal CDS 77731 79341 . - 0 ID=BALIOE_00345;Name=hypothetical protein;locus_tag=BALIOE_00345;product=hypothetical protein;Parent=BALIOE_00345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 150 c1 Prodigal gene 79317 80300 . - . ID=BALIOE_00350_gene;locus_tag=BALIOE_00350 | |
| 151 c1 Prodigal CDS 79317 80300 . - 0 ID=BALIOE_00350;Name=hypothetical protein;locus_tag=BALIOE_00350;product=hypothetical protein;Parent=BALIOE_00350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 152 c1 Prodigal gene 80672 81241 . + . ID=BALIOE_00355_gene;locus_tag=BALIOE_00355 | |
| 153 c1 Prodigal CDS 80672 81241 . + 0 ID=BALIOE_00355;Name=hypothetical protein;locus_tag=BALIOE_00355;product=hypothetical protein;Parent=BALIOE_00355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 154 c1 Prodigal gene 81207 81314 . + . ID=BALIOE_00360_gene;locus_tag=BALIOE_00360 | |
| 155 c1 Prodigal CDS 81207 81314 . + 0 ID=BALIOE_00360;Name=hypothetical protein;locus_tag=BALIOE_00360;product=hypothetical protein;Parent=BALIOE_00360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 156 c1 Prodigal gene 81470 83128 . - . ID=BALIOE_00365_gene;locus_tag=BALIOE_00365 | |
| 157 c1 Prodigal CDS 81470 83128 . - 0 ID=BALIOE_00365;Name=hypothetical protein;locus_tag=BALIOE_00365;product=hypothetical protein;Parent=BALIOE_00365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 158 c1 Prodigal gene 83456 84061 . - . ID=BALIOE_00370_gene;locus_tag=BALIOE_00370 | |
| 159 c1 Prodigal CDS 83456 84061 . - 0 ID=BALIOE_00370;Name=hypothetical protein;locus_tag=BALIOE_00370;product=hypothetical protein;Parent=BALIOE_00370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 160 c1 Prodigal gene 84072 85472 . - . ID=BALIOE_00375_gene;locus_tag=BALIOE_00375 | |
| 161 c1 Prodigal CDS 84072 85472 . - 0 ID=BALIOE_00375;Name=hypothetical protein;locus_tag=BALIOE_00375;product=hypothetical protein;Parent=BALIOE_00375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 162 c1 Prodigal gene 85475 86566 . - . ID=BALIOE_00380_gene;locus_tag=BALIOE_00380 | |
| 163 c1 Prodigal CDS 85475 86566 . - 0 ID=BALIOE_00380;Name=hypothetical protein;locus_tag=BALIOE_00380;product=hypothetical protein;Parent=BALIOE_00380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 164 c1 Prodigal gene 86566 88137 . - . ID=BALIOE_00385_gene;locus_tag=BALIOE_00385 | |
| 165 c1 Prodigal CDS 86566 88137 . - 0 ID=BALIOE_00385;Name=hypothetical protein;locus_tag=BALIOE_00385;product=hypothetical protein;Parent=BALIOE_00385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 166 c1 Prodigal gene 88974 89918 . + . ID=BALIOE_00390_gene;locus_tag=BALIOE_00390 | |
| 167 c1 Prodigal CDS 88974 89918 . + 0 ID=BALIOE_00390;Name=hypothetical protein;locus_tag=BALIOE_00390;product=hypothetical protein;Parent=BALIOE_00390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 168 c1 Prodigal gene 90236 91960 . + . ID=BALIOE_00395_gene;locus_tag=BALIOE_00395 | |
| 169 c1 Prodigal CDS 90236 91960 . + 0 ID=BALIOE_00395;Name=hypothetical protein;locus_tag=BALIOE_00395;product=hypothetical protein;Parent=BALIOE_00395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 170 c1 Prodigal gene 91963 92454 . + . ID=BALIOE_00400_gene;locus_tag=BALIOE_00400 | |
| 171 c1 Prodigal CDS 91963 92454 . + 0 ID=BALIOE_00400;Name=hypothetical protein;locus_tag=BALIOE_00400;product=hypothetical protein;Parent=BALIOE_00400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 172 c1 Prodigal gene 92634 93638 . + . ID=BALIOE_00405_gene;locus_tag=BALIOE_00405 | |
| 173 c1 Prodigal CDS 92634 93638 . + 0 ID=BALIOE_00405;Name=hypothetical protein;locus_tag=BALIOE_00405;product=hypothetical protein;Parent=BALIOE_00405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 174 c1 Prodigal gene 94240 94698 . + . ID=BALIOE_00410_gene;locus_tag=BALIOE_00410 | |
| 175 c1 Prodigal CDS 94240 94698 . + 0 ID=BALIOE_00410;Name=hypothetical protein;locus_tag=BALIOE_00410;product=hypothetical protein;Parent=BALIOE_00410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 176 c1 Prodigal gene 94700 95641 . + . ID=BALIOE_00415_gene;locus_tag=BALIOE_00415 | |
| 177 c1 Prodigal CDS 94700 95641 . + 0 ID=BALIOE_00415;Name=hypothetical protein;locus_tag=BALIOE_00415;product=hypothetical protein;Parent=BALIOE_00415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 178 c1 Prodigal gene 95638 96003 . + . ID=BALIOE_00420_gene;locus_tag=BALIOE_00420 | |
| 179 c1 Prodigal CDS 95638 96003 . + 0 ID=BALIOE_00420;Name=hypothetical protein;locus_tag=BALIOE_00420;product=hypothetical protein;Parent=BALIOE_00420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 180 c1 Prodigal gene 96019 97785 . + . ID=BALIOE_00425_gene;locus_tag=BALIOE_00425 | |
| 181 c1 Prodigal CDS 96019 97785 . + 0 ID=BALIOE_00425;Name=hypothetical protein;locus_tag=BALIOE_00425;product=hypothetical protein;Parent=BALIOE_00425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 182 c1 Prodigal gene 97772 99259 . + . ID=BALIOE_00430_gene;locus_tag=BALIOE_00430 | |
| 183 c1 Prodigal CDS 97772 99259 . + 0 ID=BALIOE_00430;Name=hypothetical protein;locus_tag=BALIOE_00430;product=hypothetical protein;Parent=BALIOE_00430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 184 c1 Prodigal gene 99256 100614 . + . ID=BALIOE_00435_gene;locus_tag=BALIOE_00435 | |
| 185 c1 Prodigal CDS 99256 100614 . + 0 ID=BALIOE_00435;Name=hypothetical protein;locus_tag=BALIOE_00435;product=hypothetical protein;Parent=BALIOE_00435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 186 c1 Prodigal gene 100608 101690 . + . ID=BALIOE_00440_gene;locus_tag=BALIOE_00440 | |
| 187 c1 Prodigal CDS 100608 101690 . + 0 ID=BALIOE_00440;Name=hypothetical protein;locus_tag=BALIOE_00440;product=hypothetical protein;Parent=BALIOE_00440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 188 c1 Prodigal gene 101693 103009 . + . ID=BALIOE_00445_gene;locus_tag=BALIOE_00445 | |
| 189 c1 Prodigal CDS 101693 103009 . + 0 ID=BALIOE_00445;Name=hypothetical protein;locus_tag=BALIOE_00445;product=hypothetical protein;Parent=BALIOE_00445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 190 c1 Prodigal gene 103009 104253 . + . ID=BALIOE_00450_gene;locus_tag=BALIOE_00450 | |
| 191 c1 Prodigal CDS 103009 104253 . + 0 ID=BALIOE_00450;Name=hypothetical protein;locus_tag=BALIOE_00450;product=hypothetical protein;Parent=BALIOE_00450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 192 c1 Prodigal gene 104250 105317 . + . ID=BALIOE_00455_gene;locus_tag=BALIOE_00455 | |
| 193 c1 Prodigal CDS 104250 105317 . + 0 ID=BALIOE_00455;Name=hypothetical protein;locus_tag=BALIOE_00455;product=hypothetical protein;Parent=BALIOE_00455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 194 c1 Prodigal gene 105371 106846 . + . ID=BALIOE_00460_gene;locus_tag=BALIOE_00460 | |
| 195 c1 Prodigal CDS 105371 106846 . + 0 ID=BALIOE_00460;Name=hypothetical protein;locus_tag=BALIOE_00460;product=hypothetical protein;Parent=BALIOE_00460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 196 c1 Prodigal gene 106839 107759 . + . ID=BALIOE_00465_gene;locus_tag=BALIOE_00465 | |
| 197 c1 Prodigal CDS 106839 107759 . + 0 ID=BALIOE_00465;Name=hypothetical protein;locus_tag=BALIOE_00465;product=hypothetical protein;Parent=BALIOE_00465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 198 c1 Prodigal gene 107761 108591 . + . ID=BALIOE_00470_gene;locus_tag=BALIOE_00470 | |
| 199 c1 Prodigal CDS 107761 108591 . + 0 ID=BALIOE_00470;Name=hypothetical protein;locus_tag=BALIOE_00470;product=hypothetical protein;Parent=BALIOE_00470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 200 c1 Prodigal gene 108588 109850 . + . ID=BALIOE_00475_gene;locus_tag=BALIOE_00475 | |
| 201 c1 Prodigal CDS 108588 109850 . + 0 ID=BALIOE_00475;Name=hypothetical protein;locus_tag=BALIOE_00475;product=hypothetical protein;Parent=BALIOE_00475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 202 c1 Prodigal gene 109911 111062 . + . ID=BALIOE_00480_gene;locus_tag=BALIOE_00480 | |
| 203 c1 Prodigal CDS 109911 111062 . + 0 ID=BALIOE_00480;Name=hypothetical protein;locus_tag=BALIOE_00480;product=hypothetical protein;Parent=BALIOE_00480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 204 c1 Prodigal gene 111163 112080 . + . ID=BALIOE_00485_gene;locus_tag=BALIOE_00485 | |
| 205 c1 Prodigal CDS 111163 112080 . + 0 ID=BALIOE_00485;Name=hypothetical protein;locus_tag=BALIOE_00485;product=hypothetical protein;Parent=BALIOE_00485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 206 c1 Prodigal gene 112236 112823 . + . ID=BALIOE_00490_gene;locus_tag=BALIOE_00490 | |
| 207 c1 Prodigal CDS 112236 112823 . + 0 ID=BALIOE_00490;Name=hypothetical protein;locus_tag=BALIOE_00490;product=hypothetical protein;Parent=BALIOE_00490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 208 c1 Prodigal gene 112885 115590 . + . ID=BALIOE_00495_gene;locus_tag=BALIOE_00495 | |
| 209 c1 Prodigal CDS 112885 115590 . + 0 ID=BALIOE_00495;Name=hypothetical protein;locus_tag=BALIOE_00495;product=hypothetical protein;Parent=BALIOE_00495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 210 c1 Prodigal gene 115650 116048 . + . ID=BALIOE_00500_gene;locus_tag=BALIOE_00500 | |
| 211 c1 Prodigal CDS 115650 116048 . + 0 ID=BALIOE_00500;Name=hypothetical protein;locus_tag=BALIOE_00500;product=hypothetical protein;Parent=BALIOE_00500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 212 c1 Infernal gene 116039 116116 . + . ID=BALIOE_00505_gene;locus_tag=BALIOE_00505;gene=naRNA4 | |
| 213 c1 Infernal ncRNA 116039 116116 4.4e-11 + . ID=BALIOE_00505;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_00505;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_00505_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 214 c1 Prodigal gene 116139 116336 . - . ID=BALIOE_00510_gene;locus_tag=BALIOE_00510 | |
| 215 c1 Prodigal CDS 116139 116336 . - 0 ID=BALIOE_00510;Name=hypothetical protein;locus_tag=BALIOE_00510;product=hypothetical protein;Parent=BALIOE_00510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 216 c1 Prodigal gene 116346 117089 . - . ID=BALIOE_00515_gene;locus_tag=BALIOE_00515 | |
| 217 c1 Prodigal CDS 116346 117089 . - 0 ID=BALIOE_00515;Name=hypothetical protein;locus_tag=BALIOE_00515;product=hypothetical protein;Parent=BALIOE_00515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 218 c1 Prodigal gene 117089 117709 . - . ID=BALIOE_00520_gene;locus_tag=BALIOE_00520 | |
| 219 c1 Prodigal CDS 117089 117709 . - 0 ID=BALIOE_00520;Name=hypothetical protein;locus_tag=BALIOE_00520;product=hypothetical protein;Parent=BALIOE_00520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 220 c1 Prodigal gene 117934 118977 . + . ID=BALIOE_00525_gene;locus_tag=BALIOE_00525 | |
| 221 c1 Prodigal CDS 117934 118977 . + 0 ID=BALIOE_00525;Name=hypothetical protein;locus_tag=BALIOE_00525;product=hypothetical protein;Parent=BALIOE_00525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 222 c1 Prodigal gene 119012 120214 . - . ID=BALIOE_00530_gene;locus_tag=BALIOE_00530 | |
| 223 c1 Prodigal CDS 119012 120214 . - 0 ID=BALIOE_00530;Name=hypothetical protein;locus_tag=BALIOE_00530;product=hypothetical protein;Parent=BALIOE_00530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 224 c1 Prodigal gene 120204 121589 . - . ID=BALIOE_00535_gene;locus_tag=BALIOE_00535 | |
| 225 c1 Prodigal CDS 120204 121589 . - 0 ID=BALIOE_00535;Name=hypothetical protein;locus_tag=BALIOE_00535;product=hypothetical protein;Parent=BALIOE_00535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 226 c1 Prodigal gene 121599 122039 . - . ID=BALIOE_00540_gene;locus_tag=BALIOE_00540 | |
| 227 c1 Prodigal CDS 121599 122039 . - 0 ID=BALIOE_00540;Name=hypothetical protein;locus_tag=BALIOE_00540;product=hypothetical protein;Parent=BALIOE_00540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 228 c1 Prodigal gene 122242 123135 . - . ID=BALIOE_00545_gene;locus_tag=BALIOE_00545 | |
| 229 c1 Prodigal CDS 122242 123135 . - 0 ID=BALIOE_00545;Name=hypothetical protein;locus_tag=BALIOE_00545;product=hypothetical protein;Parent=BALIOE_00545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 230 c1 Prodigal gene 123223 123774 . + . ID=BALIOE_00550_gene;locus_tag=BALIOE_00550 | |
| 231 c1 Prodigal CDS 123223 123774 . + 0 ID=BALIOE_00550;Name=hypothetical protein;locus_tag=BALIOE_00550;product=hypothetical protein;Parent=BALIOE_00550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 232 c1 Prodigal gene 123771 124625 . + . ID=BALIOE_00555_gene;locus_tag=BALIOE_00555 | |
| 233 c1 Prodigal CDS 123771 124625 . + 0 ID=BALIOE_00555;Name=hypothetical protein;locus_tag=BALIOE_00555;product=hypothetical protein;Parent=BALIOE_00555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 234 c1 Prodigal gene 124668 126038 . - . ID=BALIOE_00560_gene;locus_tag=BALIOE_00560 | |
| 235 c1 Prodigal CDS 124668 126038 . - 0 ID=BALIOE_00560;Name=hypothetical protein;locus_tag=BALIOE_00560;product=hypothetical protein;Parent=BALIOE_00560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 236 c1 Prodigal gene 126582 127346 . + . ID=BALIOE_00565_gene;locus_tag=BALIOE_00565 | |
| 237 c1 Prodigal CDS 126582 127346 . + 0 ID=BALIOE_00565;Name=hypothetical protein;locus_tag=BALIOE_00565;product=hypothetical protein;Parent=BALIOE_00565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 238 c1 Prodigal gene 127507 130170 . + . ID=BALIOE_00570_gene;locus_tag=BALIOE_00570 | |
| 239 c1 Prodigal CDS 127507 130170 . + 0 ID=BALIOE_00570;Name=hypothetical protein;locus_tag=BALIOE_00570;product=hypothetical protein;Parent=BALIOE_00570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 240 c1 Prodigal gene 130185 132077 . + . ID=BALIOE_00575_gene;locus_tag=BALIOE_00575 | |
| 241 c1 Prodigal CDS 130185 132077 . + 0 ID=BALIOE_00575;Name=hypothetical protein;locus_tag=BALIOE_00575;product=hypothetical protein;Parent=BALIOE_00575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 242 c1 Prodigal gene 132285 133709 . + . ID=BALIOE_00580_gene;locus_tag=BALIOE_00580 | |
| 243 c1 Prodigal CDS 132285 133709 . + 0 ID=BALIOE_00580;Name=hypothetical protein;locus_tag=BALIOE_00580;product=hypothetical protein;Parent=BALIOE_00580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 244 c1 Prodigal gene 133780 135633 . - . ID=BALIOE_00585_gene;locus_tag=BALIOE_00585 | |
| 245 c1 Prodigal CDS 133780 135633 . - 0 ID=BALIOE_00585;Name=hypothetical protein;locus_tag=BALIOE_00585;product=hypothetical protein;Parent=BALIOE_00585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 246 c1 Prodigal gene 135988 138585 . + . ID=BALIOE_00590_gene;locus_tag=BALIOE_00590 | |
| 247 c1 Prodigal CDS 135988 138585 . + 0 ID=BALIOE_00590;Name=hypothetical protein;locus_tag=BALIOE_00590;product=hypothetical protein;Parent=BALIOE_00590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 248 c1 Prodigal gene 138761 139123 . + . ID=BALIOE_00595_gene;locus_tag=BALIOE_00595 | |
| 249 c1 Prodigal CDS 138761 139123 . + 0 ID=BALIOE_00595;Name=hypothetical protein;locus_tag=BALIOE_00595;product=hypothetical protein;Parent=BALIOE_00595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 250 c1 Prodigal gene 139161 139955 . - . ID=BALIOE_00600_gene;locus_tag=BALIOE_00600 | |
| 251 c1 Prodigal CDS 139161 139955 . - 0 ID=BALIOE_00600;Name=hypothetical protein;locus_tag=BALIOE_00600;product=hypothetical protein;Parent=BALIOE_00600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 252 c1 Prodigal gene 139971 140837 . - . ID=BALIOE_00605_gene;locus_tag=BALIOE_00605 | |
| 253 c1 Prodigal CDS 139971 140837 . - 0 ID=BALIOE_00605;Name=hypothetical protein;locus_tag=BALIOE_00605;product=hypothetical protein;Parent=BALIOE_00605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 254 c1 Prodigal gene 140943 141251 . - . ID=BALIOE_00610_gene;locus_tag=BALIOE_00610 | |
| 255 c1 Prodigal CDS 140943 141251 . - 0 ID=BALIOE_00610;Name=hypothetical protein;locus_tag=BALIOE_00610;product=hypothetical protein;Parent=BALIOE_00610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 256 c1 Prodigal gene 141456 143006 . + . ID=BALIOE_00615_gene;locus_tag=BALIOE_00615 | |
| 257 c1 Prodigal CDS 141456 143006 . + 0 ID=BALIOE_00615;Name=hypothetical protein;locus_tag=BALIOE_00615;product=hypothetical protein;Parent=BALIOE_00615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 258 c1 Prodigal gene 143208 145598 . - . ID=BALIOE_00620_gene;locus_tag=BALIOE_00620 | |
| 259 c1 Prodigal CDS 143208 145598 . - 0 ID=BALIOE_00620;Name=hypothetical protein;locus_tag=BALIOE_00620;product=hypothetical protein;Parent=BALIOE_00620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 260 c1 Prodigal gene 145804 146340 . + . ID=BALIOE_00625_gene;locus_tag=BALIOE_00625 | |
| 261 c1 Prodigal CDS 145804 146340 . + 0 ID=BALIOE_00625;Name=hypothetical protein;locus_tag=BALIOE_00625;product=hypothetical protein;Parent=BALIOE_00625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 262 c1 Prodigal gene 146381 147043 . - . ID=BALIOE_00630_gene;locus_tag=BALIOE_00630 | |
| 263 c1 Prodigal CDS 146381 147043 . - 0 ID=BALIOE_00630;Name=hypothetical protein;locus_tag=BALIOE_00630;product=hypothetical protein;Parent=BALIOE_00630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 264 c1 Prodigal gene 147152 148078 . + . ID=BALIOE_00635_gene;locus_tag=BALIOE_00635 | |
| 265 c1 Prodigal CDS 147152 148078 . + 0 ID=BALIOE_00635;Name=hypothetical protein;locus_tag=BALIOE_00635;product=hypothetical protein;Parent=BALIOE_00635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 266 c1 Prodigal gene 148078 148845 . + . ID=BALIOE_00640_gene;locus_tag=BALIOE_00640 | |
| 267 c1 Prodigal CDS 148078 148845 . + 0 ID=BALIOE_00640;Name=hypothetical protein;locus_tag=BALIOE_00640;product=hypothetical protein;Parent=BALIOE_00640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 268 c1 Prodigal gene 148950 149390 . + . ID=BALIOE_00645_gene;locus_tag=BALIOE_00645 | |
| 269 c1 Prodigal CDS 148950 149390 . + 0 ID=BALIOE_00645;Name=hypothetical protein;locus_tag=BALIOE_00645;product=hypothetical protein;Parent=BALIOE_00645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 270 c1 Prodigal gene 149454 150683 . + . ID=BALIOE_00650_gene;locus_tag=BALIOE_00650 | |
| 271 c1 Prodigal CDS 149454 150683 . + 0 ID=BALIOE_00650;Name=hypothetical protein;locus_tag=BALIOE_00650;product=hypothetical protein;Parent=BALIOE_00650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 272 c1 Prodigal gene 150687 151067 . - . ID=BALIOE_00655_gene;locus_tag=BALIOE_00655 | |
| 273 c1 Prodigal CDS 150687 151067 . - 0 ID=BALIOE_00655;Name=hypothetical protein;locus_tag=BALIOE_00655;product=hypothetical protein;Parent=BALIOE_00655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 274 c1 Prodigal gene 151341 152237 . + . ID=BALIOE_00660_gene;locus_tag=BALIOE_00660 | |
| 275 c1 Prodigal CDS 151341 152237 . + 0 ID=BALIOE_00660;Name=hypothetical protein;locus_tag=BALIOE_00660;product=hypothetical protein;Parent=BALIOE_00660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 276 c1 Prodigal gene 152536 153387 . - . ID=BALIOE_00665_gene;locus_tag=BALIOE_00665 | |
| 277 c1 Prodigal CDS 152536 153387 . - 0 ID=BALIOE_00665;Name=hypothetical protein;locus_tag=BALIOE_00665;product=hypothetical protein;Parent=BALIOE_00665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 278 c1 Prodigal gene 153399 154193 . - . ID=BALIOE_00670_gene;locus_tag=BALIOE_00670 | |
| 279 c1 Prodigal CDS 153399 154193 . - 0 ID=BALIOE_00670;Name=hypothetical protein;locus_tag=BALIOE_00670;product=hypothetical protein;Parent=BALIOE_00670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 280 c1 Prodigal gene 154328 155437 . - . ID=BALIOE_00675_gene;locus_tag=BALIOE_00675 | |
| 281 c1 Prodigal CDS 154328 155437 . - 0 ID=BALIOE_00675;Name=hypothetical protein;locus_tag=BALIOE_00675;product=hypothetical protein;Parent=BALIOE_00675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 282 c1 Prodigal gene 155449 156039 . - . ID=BALIOE_00680_gene;locus_tag=BALIOE_00680 | |
| 283 c1 Prodigal CDS 155449 156039 . - 0 ID=BALIOE_00680;Name=hypothetical protein;locus_tag=BALIOE_00680;product=hypothetical protein;Parent=BALIOE_00680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 284 c1 Prodigal gene 156060 156665 . - . ID=BALIOE_00685_gene;locus_tag=BALIOE_00685 | |
| 285 c1 Prodigal CDS 156060 156665 . - 0 ID=BALIOE_00685;Name=hypothetical protein;locus_tag=BALIOE_00685;product=hypothetical protein;Parent=BALIOE_00685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 286 c1 Prodigal gene 156680 157228 . - . ID=BALIOE_00690_gene;locus_tag=BALIOE_00690 | |
| 287 c1 Prodigal CDS 156680 157228 . - 0 ID=BALIOE_00690;Name=hypothetical protein;locus_tag=BALIOE_00690;product=hypothetical protein;Parent=BALIOE_00690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 288 c1 Prodigal gene 157242 159842 . - . ID=BALIOE_00695_gene;locus_tag=BALIOE_00695 | |
| 289 c1 Prodigal CDS 157242 159842 . - 0 ID=BALIOE_00695;Name=hypothetical protein;locus_tag=BALIOE_00695;product=hypothetical protein;Parent=BALIOE_00695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 290 c1 Prodigal gene 159884 160609 . - . ID=BALIOE_00700_gene;locus_tag=BALIOE_00700 | |
| 291 c1 Prodigal CDS 159884 160609 . - 0 ID=BALIOE_00700;Name=hypothetical protein;locus_tag=BALIOE_00700;product=hypothetical protein;Parent=BALIOE_00700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 292 c1 Prodigal gene 160696 161292 . - . ID=BALIOE_00705_gene;locus_tag=BALIOE_00705 | |
| 293 c1 Prodigal CDS 160696 161292 . - 0 ID=BALIOE_00705;Name=hypothetical protein;locus_tag=BALIOE_00705;product=hypothetical protein;Parent=BALIOE_00705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 294 c1 Prodigal gene 161573 162055 . - . ID=BALIOE_00710_gene;locus_tag=BALIOE_00710 | |
| 295 c1 Prodigal CDS 161573 162055 . - 0 ID=BALIOE_00710;Name=hypothetical protein;locus_tag=BALIOE_00710;product=hypothetical protein;Parent=BALIOE_00710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 296 c1 Prodigal gene 162052 163416 . - . ID=BALIOE_00715_gene;locus_tag=BALIOE_00715 | |
| 297 c1 Prodigal CDS 162052 163416 . - 0 ID=BALIOE_00715;Name=hypothetical protein;locus_tag=BALIOE_00715;product=hypothetical protein;Parent=BALIOE_00715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 298 c1 Prodigal gene 163509 164435 . - . ID=BALIOE_00720_gene;locus_tag=BALIOE_00720 | |
| 299 c1 Prodigal CDS 163509 164435 . - 0 ID=BALIOE_00720;Name=hypothetical protein;locus_tag=BALIOE_00720;product=hypothetical protein;Parent=BALIOE_00720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 300 c1 Prodigal gene 164472 164927 . - . ID=BALIOE_00725_gene;locus_tag=BALIOE_00725 | |
| 301 c1 Prodigal CDS 164472 164927 . - 0 ID=BALIOE_00725;Name=hypothetical protein;locus_tag=BALIOE_00725;product=hypothetical protein;Parent=BALIOE_00725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 302 c1 Prodigal gene 165105 165809 . - . ID=BALIOE_00730_gene;locus_tag=BALIOE_00730 | |
| 303 c1 Prodigal CDS 165105 165809 . - 0 ID=BALIOE_00730;Name=hypothetical protein;locus_tag=BALIOE_00730;product=hypothetical protein;Parent=BALIOE_00730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 304 c1 Prodigal gene 165824 166354 . - . ID=BALIOE_00735_gene;locus_tag=BALIOE_00735 | |
| 305 c1 Prodigal CDS 165824 166354 . - 0 ID=BALIOE_00735;Name=hypothetical protein;locus_tag=BALIOE_00735;product=hypothetical protein;Parent=BALIOE_00735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 306 c1 Prodigal gene 166428 168857 . + . ID=BALIOE_00740_gene;locus_tag=BALIOE_00740 | |
| 307 c1 Prodigal CDS 166428 168857 . + 0 ID=BALIOE_00740;Name=hypothetical protein;locus_tag=BALIOE_00740;product=hypothetical protein;Parent=BALIOE_00740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 308 c1 Prodigal gene 169053 171587 . + . ID=BALIOE_00745_gene;locus_tag=BALIOE_00745 | |
| 309 c1 Prodigal CDS 169053 171587 . + 0 ID=BALIOE_00745;Name=hypothetical protein;locus_tag=BALIOE_00745;product=hypothetical protein;Parent=BALIOE_00745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 310 c1 Prodigal gene 171807 174050 . + . ID=BALIOE_00750_gene;locus_tag=BALIOE_00750 | |
| 311 c1 Prodigal CDS 171807 174050 . + 0 ID=BALIOE_00750;Name=hypothetical protein;locus_tag=BALIOE_00750;product=hypothetical protein;Parent=BALIOE_00750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 312 c1 Prodigal gene 174101 174898 . + . ID=BALIOE_00755_gene;locus_tag=BALIOE_00755 | |
| 313 c1 Prodigal CDS 174101 174898 . + 0 ID=BALIOE_00755;Name=hypothetical protein;locus_tag=BALIOE_00755;product=hypothetical protein;Parent=BALIOE_00755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 314 c1 Prodigal gene 174898 175788 . + . ID=BALIOE_00760_gene;locus_tag=BALIOE_00760 | |
| 315 c1 Prodigal CDS 174898 175788 . + 0 ID=BALIOE_00760;Name=hypothetical protein;locus_tag=BALIOE_00760;product=hypothetical protein;Parent=BALIOE_00760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 316 c1 Prodigal gene 175785 177767 . + . ID=BALIOE_00765_gene;locus_tag=BALIOE_00765 | |
| 317 c1 Prodigal CDS 175785 177767 . + 0 ID=BALIOE_00765;Name=hypothetical protein;locus_tag=BALIOE_00765;product=hypothetical protein;Parent=BALIOE_00765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 318 c1 Prodigal gene 177802 179082 . - . ID=BALIOE_00770_gene;locus_tag=BALIOE_00770 | |
| 319 c1 Prodigal CDS 177802 179082 . - 0 ID=BALIOE_00770;Name=hypothetical protein;locus_tag=BALIOE_00770;product=hypothetical protein;Parent=BALIOE_00770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 320 c1 Prodigal gene 179307 180728 . + . ID=BALIOE_00775_gene;locus_tag=BALIOE_00775 | |
| 321 c1 Prodigal CDS 179307 180728 . + 0 ID=BALIOE_00775;Name=hypothetical protein;locus_tag=BALIOE_00775;product=hypothetical protein;Parent=BALIOE_00775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 322 c1 Prodigal gene 180810 181154 . + . ID=BALIOE_00780_gene;locus_tag=BALIOE_00780 | |
| 323 c1 Prodigal CDS 180810 181154 . + 0 ID=BALIOE_00780;Name=hypothetical protein;locus_tag=BALIOE_00780;product=hypothetical protein;Parent=BALIOE_00780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 324 c1 Prodigal gene 181201 181824 . - . ID=BALIOE_00785_gene;locus_tag=BALIOE_00785 | |
| 325 c1 Prodigal CDS 181201 181824 . - 0 ID=BALIOE_00785;Name=hypothetical protein;locus_tag=BALIOE_00785;product=hypothetical protein;Parent=BALIOE_00785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 326 c1 Prodigal gene 181862 182662 . - . ID=BALIOE_00790_gene;locus_tag=BALIOE_00790 | |
| 327 c1 Prodigal CDS 181862 182662 . - 0 ID=BALIOE_00790;Name=hypothetical protein;locus_tag=BALIOE_00790;product=hypothetical protein;Parent=BALIOE_00790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 328 c1 Prodigal gene 182655 183353 . - . ID=BALIOE_00795_gene;locus_tag=BALIOE_00795 | |
| 329 c1 Prodigal CDS 182655 183353 . - 0 ID=BALIOE_00795;Name=hypothetical protein;locus_tag=BALIOE_00795;product=hypothetical protein;Parent=BALIOE_00795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 330 c1 Prodigal gene 183437 184954 . + . ID=BALIOE_00800_gene;locus_tag=BALIOE_00800 | |
| 331 c1 Prodigal CDS 183437 184954 . + 0 ID=BALIOE_00800;Name=hypothetical protein;locus_tag=BALIOE_00800;product=hypothetical protein;Parent=BALIOE_00800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 332 c1 Prodigal gene 185084 186508 . + . ID=BALIOE_00805_gene;locus_tag=BALIOE_00805 | |
| 333 c1 Prodigal CDS 185084 186508 . + 0 ID=BALIOE_00805;Name=hypothetical protein;locus_tag=BALIOE_00805;product=hypothetical protein;Parent=BALIOE_00805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 334 c1 Prodigal gene 186663 187820 . + . ID=BALIOE_00810_gene;locus_tag=BALIOE_00810 | |
| 335 c1 Prodigal CDS 186663 187820 . + 0 ID=BALIOE_00810;Name=hypothetical protein;locus_tag=BALIOE_00810;product=hypothetical protein;Parent=BALIOE_00810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 336 c1 Prodigal gene 187909 188295 . - . ID=BALIOE_00815_gene;locus_tag=BALIOE_00815 | |
| 337 c1 Prodigal CDS 187909 188295 . - 0 ID=BALIOE_00815;Name=hypothetical protein;locus_tag=BALIOE_00815;product=hypothetical protein;Parent=BALIOE_00815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 338 c1 Prodigal gene 188610 189434 . - . ID=BALIOE_00820_gene;locus_tag=BALIOE_00820 | |
| 339 c1 Prodigal CDS 188610 189434 . - 0 ID=BALIOE_00820;Name=hypothetical protein;locus_tag=BALIOE_00820;product=hypothetical protein;Parent=BALIOE_00820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 340 c1 Prodigal gene 189465 192137 . - . ID=BALIOE_00825_gene;locus_tag=BALIOE_00825 | |
| 341 c1 Prodigal CDS 189465 192137 . - 0 ID=BALIOE_00825;Name=hypothetical protein;locus_tag=BALIOE_00825;product=hypothetical protein;Parent=BALIOE_00825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 342 c1 Prodigal gene 192199 192993 . - . ID=BALIOE_00830_gene;locus_tag=BALIOE_00830 | |
| 343 c1 Prodigal CDS 192199 192993 . - 0 ID=BALIOE_00830;Name=hypothetical protein;locus_tag=BALIOE_00830;product=hypothetical protein;Parent=BALIOE_00830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 344 c1 Prodigal gene 193361 194086 . + . ID=BALIOE_00835_gene;locus_tag=BALIOE_00835 | |
| 345 c1 Prodigal CDS 193361 194086 . + 0 ID=BALIOE_00835;Name=hypothetical protein;locus_tag=BALIOE_00835;product=hypothetical protein;Parent=BALIOE_00835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 346 c1 Prodigal gene 194344 195195 . + . ID=BALIOE_00840_gene;locus_tag=BALIOE_00840 | |
| 347 c1 Prodigal CDS 194344 195195 . + 0 ID=BALIOE_00840;Name=hypothetical protein;locus_tag=BALIOE_00840;product=hypothetical protein;Parent=BALIOE_00840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 348 c1 Prodigal gene 195342 196067 . + . ID=BALIOE_00845_gene;locus_tag=BALIOE_00845 | |
| 349 c1 Prodigal CDS 195342 196067 . + 0 ID=BALIOE_00845;Name=hypothetical protein;locus_tag=BALIOE_00845;product=hypothetical protein;Parent=BALIOE_00845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 350 c1 Prodigal gene 196217 196774 . + . ID=BALIOE_00850_gene;locus_tag=BALIOE_00850 | |
| 351 c1 Prodigal CDS 196217 196774 . + 0 ID=BALIOE_00850;Name=hypothetical protein;locus_tag=BALIOE_00850;product=hypothetical protein;Parent=BALIOE_00850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 352 c1 Prodigal gene 196866 198062 . + . ID=BALIOE_00855_gene;locus_tag=BALIOE_00855 | |
| 353 c1 Prodigal CDS 196866 198062 . + 0 ID=BALIOE_00855;Name=hypothetical protein;locus_tag=BALIOE_00855;product=hypothetical protein;Parent=BALIOE_00855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 354 c1 Prodigal gene 198251 199009 . + . ID=BALIOE_00860_gene;locus_tag=BALIOE_00860 | |
| 355 c1 Prodigal CDS 198251 199009 . + 0 ID=BALIOE_00860;Name=hypothetical protein;locus_tag=BALIOE_00860;product=hypothetical protein;Parent=BALIOE_00860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 356 c1 Prodigal gene 199009 199161 . + . ID=BALIOE_00865_gene;locus_tag=BALIOE_00865 | |
| 357 c1 Prodigal CDS 199009 199161 . + 0 ID=BALIOE_00865;Name=hypothetical protein;locus_tag=BALIOE_00865;product=hypothetical protein;Parent=BALIOE_00865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 358 c1 Prodigal gene 199130 199879 . + . ID=BALIOE_00870_gene;locus_tag=BALIOE_00870 | |
| 359 c1 Prodigal CDS 199130 199879 . + 0 ID=BALIOE_00870;Name=hypothetical protein;locus_tag=BALIOE_00870;product=hypothetical protein;Parent=BALIOE_00870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 360 c1 Prodigal gene 199891 201243 . + . ID=BALIOE_00875_gene;locus_tag=BALIOE_00875 | |
| 361 c1 Prodigal CDS 199891 201243 . + 0 ID=BALIOE_00875;Name=hypothetical protein;locus_tag=BALIOE_00875;product=hypothetical protein;Parent=BALIOE_00875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 362 c1 Prodigal gene 201273 203705 . + . ID=BALIOE_00880_gene;locus_tag=BALIOE_00880 | |
| 363 c1 Prodigal CDS 201273 203705 . + 0 ID=BALIOE_00880;Name=hypothetical protein;locus_tag=BALIOE_00880;product=hypothetical protein;Parent=BALIOE_00880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 364 c1 Prodigal gene 203826 204311 . + . ID=BALIOE_00885_gene;locus_tag=BALIOE_00885 | |
| 365 c1 Prodigal CDS 203826 204311 . + 0 ID=BALIOE_00885;Name=hypothetical protein;locus_tag=BALIOE_00885;product=hypothetical protein;Parent=BALIOE_00885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 366 c1 Prodigal gene 204315 205340 . + . ID=BALIOE_00890_gene;locus_tag=BALIOE_00890 | |
| 367 c1 Prodigal CDS 204315 205340 . + 0 ID=BALIOE_00890;Name=hypothetical protein;locus_tag=BALIOE_00890;product=hypothetical protein;Parent=BALIOE_00890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 368 c1 Prodigal gene 205445 205900 . + . ID=BALIOE_00895_gene;locus_tag=BALIOE_00895 | |
| 369 c1 Prodigal CDS 205445 205900 . + 0 ID=BALIOE_00895;Name=hypothetical protein;locus_tag=BALIOE_00895;product=hypothetical protein;Parent=BALIOE_00895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 370 c1 Prodigal gene 205904 206692 . + . ID=BALIOE_00900_gene;locus_tag=BALIOE_00900 | |
| 371 c1 Prodigal CDS 205904 206692 . + 0 ID=BALIOE_00900;Name=hypothetical protein;locus_tag=BALIOE_00900;product=hypothetical protein;Parent=BALIOE_00900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 372 c1 Prodigal gene 206692 207840 . + . ID=BALIOE_00905_gene;locus_tag=BALIOE_00905 | |
| 373 c1 Prodigal CDS 206692 207840 . + 0 ID=BALIOE_00905;Name=hypothetical protein;locus_tag=BALIOE_00905;product=hypothetical protein;Parent=BALIOE_00905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 374 c1 Prodigal gene 207837 208433 . + . ID=BALIOE_00910_gene;locus_tag=BALIOE_00910 | |
| 375 c1 Prodigal CDS 207837 208433 . + 0 ID=BALIOE_00910;Name=hypothetical protein;locus_tag=BALIOE_00910;product=hypothetical protein;Parent=BALIOE_00910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 376 c1 Prodigal gene 208470 211952 . + . ID=BALIOE_00915_gene;locus_tag=BALIOE_00915 | |
| 377 c1 Prodigal CDS 208470 211952 . + 0 ID=BALIOE_00915;Name=hypothetical protein;locus_tag=BALIOE_00915;product=hypothetical protein;Parent=BALIOE_00915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 378 c1 Prodigal gene 211965 212924 . + . ID=BALIOE_00920_gene;locus_tag=BALIOE_00920 | |
| 379 c1 Prodigal CDS 211965 212924 . + 0 ID=BALIOE_00920;Name=hypothetical protein;locus_tag=BALIOE_00920;product=hypothetical protein;Parent=BALIOE_00920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 380 c1 Prodigal gene 213023 215164 . + . ID=BALIOE_00925_gene;locus_tag=BALIOE_00925 | |
| 381 c1 Prodigal CDS 213023 215164 . + 0 ID=BALIOE_00925;Name=hypothetical protein;locus_tag=BALIOE_00925;product=hypothetical protein;Parent=BALIOE_00925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 382 c1 Prodigal gene 215221 215610 . + . ID=BALIOE_00930_gene;locus_tag=BALIOE_00930 | |
| 383 c1 Prodigal CDS 215221 215610 . + 0 ID=BALIOE_00930;Name=hypothetical protein;locus_tag=BALIOE_00930;product=hypothetical protein;Parent=BALIOE_00930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 384 c1 Prodigal gene 215675 216970 . + . ID=BALIOE_00935_gene;locus_tag=BALIOE_00935 | |
| 385 c1 Prodigal CDS 215675 216970 . + 0 ID=BALIOE_00935;Name=hypothetical protein;locus_tag=BALIOE_00935;product=hypothetical protein;Parent=BALIOE_00935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 386 c1 Prodigal gene 217023 217283 . - . ID=BALIOE_00940_gene;locus_tag=BALIOE_00940 | |
| 387 c1 Prodigal CDS 217023 217283 . - 0 ID=BALIOE_00940;Name=hypothetical protein;locus_tag=BALIOE_00940;product=hypothetical protein;Parent=BALIOE_00940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 388 c1 Prodigal gene 217270 217470 . - . ID=BALIOE_00945_gene;locus_tag=BALIOE_00945 | |
| 389 c1 Prodigal CDS 217270 217470 . - 0 ID=BALIOE_00945;Name=hypothetical protein;locus_tag=BALIOE_00945;product=hypothetical protein;Parent=BALIOE_00945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 390 c1 Prodigal gene 217636 218094 . + . ID=BALIOE_00950_gene;locus_tag=BALIOE_00950 | |
| 391 c1 Prodigal CDS 217636 218094 . + 0 ID=BALIOE_00950;Name=hypothetical protein;locus_tag=BALIOE_00950;product=hypothetical protein;Parent=BALIOE_00950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 392 c1 Prodigal gene 218178 218588 . + . ID=BALIOE_00955_gene;locus_tag=BALIOE_00955 | |
| 393 c1 Prodigal CDS 218178 218588 . + 0 ID=BALIOE_00955;Name=hypothetical protein;locus_tag=BALIOE_00955;product=hypothetical protein;Parent=BALIOE_00955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 394 c1 Prodigal gene 218602 219312 . + . ID=BALIOE_00960_gene;locus_tag=BALIOE_00960 | |
| 395 c1 Prodigal CDS 218602 219312 . + 0 ID=BALIOE_00960;Name=hypothetical protein;locus_tag=BALIOE_00960;product=hypothetical protein;Parent=BALIOE_00960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 396 c1 Infernal gene 219391 219467 . + . ID=BALIOE_00965_gene;locus_tag=BALIOE_00965;gene=naRNA4 | |
| 397 c1 Infernal ncRNA 219391 219467 3.5e-14 + . ID=BALIOE_00965;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_00965;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_00965_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 398 c1 Prodigal gene 219512 220336 . - . ID=BALIOE_00970_gene;locus_tag=BALIOE_00970 | |
| 399 c1 Prodigal CDS 219512 220336 . - 0 ID=BALIOE_00970;Name=hypothetical protein;locus_tag=BALIOE_00970;product=hypothetical protein;Parent=BALIOE_00970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 400 c1 Prodigal gene 220389 222107 . - . ID=BALIOE_00975_gene;locus_tag=BALIOE_00975 | |
| 401 c1 Prodigal CDS 220389 222107 . - 0 ID=BALIOE_00975;Name=hypothetical protein;locus_tag=BALIOE_00975;product=hypothetical protein;Parent=BALIOE_00975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 402 c1 Prodigal gene 222218 222925 . - . ID=BALIOE_00980_gene;locus_tag=BALIOE_00980 | |
| 403 c1 Prodigal CDS 222218 222925 . - 0 ID=BALIOE_00980;Name=hypothetical protein;locus_tag=BALIOE_00980;product=hypothetical protein;Parent=BALIOE_00980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 404 c1 Prodigal gene 222922 223326 . - . ID=BALIOE_00985_gene;locus_tag=BALIOE_00985 | |
| 405 c1 Prodigal CDS 222922 223326 . - 0 ID=BALIOE_00985;Name=hypothetical protein;locus_tag=BALIOE_00985;product=hypothetical protein;Parent=BALIOE_00985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 406 c1 Prodigal gene 223444 224259 . - . ID=BALIOE_00990_gene;locus_tag=BALIOE_00990 | |
| 407 c1 Prodigal CDS 223444 224259 . - 0 ID=BALIOE_00990;Name=hypothetical protein;locus_tag=BALIOE_00990;product=hypothetical protein;Parent=BALIOE_00990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 408 c1 Prodigal gene 224299 224952 . - . ID=BALIOE_00995_gene;locus_tag=BALIOE_00995 | |
| 409 c1 Prodigal CDS 224299 224952 . - 0 ID=BALIOE_00995;Name=hypothetical protein;locus_tag=BALIOE_00995;product=hypothetical protein;Parent=BALIOE_00995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 410 c1 Prodigal gene 224945 225976 . - . ID=BALIOE_01000_gene;locus_tag=BALIOE_01000 | |
| 411 c1 Prodigal CDS 224945 225976 . - 0 ID=BALIOE_01000;Name=hypothetical protein;locus_tag=BALIOE_01000;product=hypothetical protein;Parent=BALIOE_01000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 412 c1 Prodigal gene 226164 226739 . + . ID=BALIOE_01005_gene;locus_tag=BALIOE_01005 | |
| 413 c1 Prodigal CDS 226164 226739 . + 0 ID=BALIOE_01005;Name=hypothetical protein;locus_tag=BALIOE_01005;product=hypothetical protein;Parent=BALIOE_01005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 414 c1 Infernal gene 227103 228644 . + . ID=BALIOE_01010_gene;locus_tag=BALIOE_01010;gene=16S_rrna | |
| 415 c1 Infernal rRNA 227103 228644 9.6e-49 + . ID=BALIOE_01010;Name=16S ribosomal RNA;locus_tag=BALIOE_01010;gene=16S_rrna;product=16S ribosomal RNA;Dbxref=GO:0005840,GO:0003735,RFAM:RF00177;Parent=BALIOE_01010_gene;inference=profile:Rfam:RF00177;Note=SO:0001000 | |
| 416 c1 tRNAscan-SE gene 228713 228789 . + . ID=BALIOE_01015_gene;locus_tag=BALIOE_01015;gene=Ile_trna | |
| 417 c1 tRNAscan-SE tRNA 228713 228789 . + . ID=BALIOE_01015;Name=tRNA-Ile;locus_tag=BALIOE_01015;product=tRNA-Ile;gene=Ile_trna;Parent=BALIOE_01015_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 418 c1 tRNAscan-SE gene 228832 228907 . + . ID=BALIOE_01020_gene;locus_tag=BALIOE_01020;gene=Ala_trna | |
| 419 c1 tRNAscan-SE tRNA 228832 228907 . + . ID=BALIOE_01020;Name=tRNA-Ala;locus_tag=BALIOE_01020;product=tRNA-Ala;gene=Ala_trna;Parent=BALIOE_01020_gene;inference=profile:tRNAscan:2.0;Note=SO:0000254 | |
| 420 c1 tRNAscan-SE gene 232258 232334 . + . ID=BALIOE_01025_gene;locus_tag=BALIOE_01025;gene=Asp_trna | |
| 421 c1 tRNAscan-SE tRNA 232258 232334 . + . ID=BALIOE_01025;Name=tRNA-Asp;locus_tag=BALIOE_01025;product=tRNA-Asp;gene=Asp_trna;Parent=BALIOE_01025_gene;inference=profile:tRNAscan:2.0;Note=SO:0000256 | |
| 422 c1 Prodigal gene 232497 233300 . + . ID=BALIOE_01030_gene;locus_tag=BALIOE_01030 | |
| 423 c1 Prodigal CDS 232497 233300 . + 0 ID=BALIOE_01030;Name=hypothetical protein;locus_tag=BALIOE_01030;product=hypothetical protein;Parent=BALIOE_01030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 424 c1 Prodigal gene 233297 234211 . - . ID=BALIOE_01035_gene;locus_tag=BALIOE_01035 | |
| 425 c1 Prodigal CDS 233297 234211 . - 0 ID=BALIOE_01035;Name=hypothetical protein;locus_tag=BALIOE_01035;product=hypothetical protein;Parent=BALIOE_01035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 426 c1 Prodigal gene 234473 235252 . + . ID=BALIOE_01040_gene;locus_tag=BALIOE_01040 | |
| 427 c1 Prodigal CDS 234473 235252 . + 0 ID=BALIOE_01040;Name=hypothetical protein;locus_tag=BALIOE_01040;product=hypothetical protein;Parent=BALIOE_01040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 428 c1 Prodigal gene 235330 236100 . + . ID=BALIOE_01045_gene;locus_tag=BALIOE_01045 | |
| 429 c1 Prodigal CDS 235330 236100 . + 0 ID=BALIOE_01045;Name=hypothetical protein;locus_tag=BALIOE_01045;product=hypothetical protein;Parent=BALIOE_01045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 430 c1 Prodigal gene 236148 237368 . - . ID=BALIOE_01050_gene;locus_tag=BALIOE_01050 | |
| 431 c1 Prodigal CDS 236148 237368 . - 0 ID=BALIOE_01050;Name=hypothetical protein;locus_tag=BALIOE_01050;product=hypothetical protein;Parent=BALIOE_01050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 432 c1 Prodigal gene 237578 238333 . - . ID=BALIOE_01055_gene;locus_tag=BALIOE_01055 | |
| 433 c1 Prodigal CDS 237578 238333 . - 0 ID=BALIOE_01055;Name=hypothetical protein;locus_tag=BALIOE_01055;product=hypothetical protein;Parent=BALIOE_01055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 434 c1 Prodigal gene 238367 239089 . + . ID=BALIOE_01060_gene;locus_tag=BALIOE_01060 | |
| 435 c1 Prodigal CDS 238367 239089 . + 0 ID=BALIOE_01060;Name=hypothetical protein;locus_tag=BALIOE_01060;product=hypothetical protein;Parent=BALIOE_01060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 436 c1 Prodigal gene 239086 239553 . - . ID=BALIOE_01065_gene;locus_tag=BALIOE_01065 | |
| 437 c1 Prodigal CDS 239086 239553 . - 0 ID=BALIOE_01065;Name=hypothetical protein;locus_tag=BALIOE_01065;product=hypothetical protein;Parent=BALIOE_01065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 438 c1 Prodigal gene 239609 240349 . + . ID=BALIOE_01070_gene;locus_tag=BALIOE_01070 | |
| 439 c1 Prodigal CDS 239609 240349 . + 0 ID=BALIOE_01070;Name=hypothetical protein;locus_tag=BALIOE_01070;product=hypothetical protein;Parent=BALIOE_01070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 440 c1 tRNAscan-SE gene 240482 240558 . + . ID=BALIOE_01075_gene;locus_tag=BALIOE_01075;gene=Asp_trna | |
| 441 c1 tRNAscan-SE tRNA 240482 240558 . + . ID=BALIOE_01075;Name=tRNA-Asp;locus_tag=BALIOE_01075;product=tRNA-Asp;gene=Asp_trna;Parent=BALIOE_01075_gene;inference=profile:tRNAscan:2.0;Note=SO:0000256 | |
| 442 c1 Prodigal gene 240887 241687 . + . ID=BALIOE_01080_gene;locus_tag=BALIOE_01080 | |
| 443 c1 Prodigal CDS 240887 241687 . + 0 ID=BALIOE_01080;Name=hypothetical protein;locus_tag=BALIOE_01080;product=hypothetical protein;Parent=BALIOE_01080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 444 c1 Prodigal gene 241872 242168 . - . ID=BALIOE_01085_gene;locus_tag=BALIOE_01085 | |
| 445 c1 Prodigal CDS 241872 242168 . - 0 ID=BALIOE_01085;Name=hypothetical protein;locus_tag=BALIOE_01085;product=hypothetical protein;Parent=BALIOE_01085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 446 c1 Prodigal gene 242165 242614 . - . ID=BALIOE_01090_gene;locus_tag=BALIOE_01090 | |
| 447 c1 Prodigal CDS 242165 242614 . - 0 ID=BALIOE_01090;Name=hypothetical protein;locus_tag=BALIOE_01090;product=hypothetical protein;Parent=BALIOE_01090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 448 c1 Prodigal gene 242617 243213 . - . ID=BALIOE_01095_gene;locus_tag=BALIOE_01095 | |
| 449 c1 Prodigal CDS 242617 243213 . - 0 ID=BALIOE_01095;Name=hypothetical protein;locus_tag=BALIOE_01095;product=hypothetical protein;Parent=BALIOE_01095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 450 c1 Prodigal gene 243292 243513 . - . ID=BALIOE_01100_gene;locus_tag=BALIOE_01100 | |
| 451 c1 Prodigal CDS 243292 243513 . - 0 ID=BALIOE_01100;Name=hypothetical protein;locus_tag=BALIOE_01100;product=hypothetical protein;Parent=BALIOE_01100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 452 c1 Prodigal gene 243534 244013 . - . ID=BALIOE_01105_gene;locus_tag=BALIOE_01105 | |
| 453 c1 Prodigal CDS 243534 244013 . - 0 ID=BALIOE_01105;Name=hypothetical protein;locus_tag=BALIOE_01105;product=hypothetical protein;Parent=BALIOE_01105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 454 c1 Prodigal gene 243979 245388 . - . ID=BALIOE_01110_gene;locus_tag=BALIOE_01110 | |
| 455 c1 Prodigal CDS 243979 245388 . - 0 ID=BALIOE_01110;Name=hypothetical protein;locus_tag=BALIOE_01110;product=hypothetical protein;Parent=BALIOE_01110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 456 c1 Prodigal gene 245399 248833 . - . ID=BALIOE_01115_gene;locus_tag=BALIOE_01115 | |
| 457 c1 Prodigal CDS 245399 248833 . - 0 ID=BALIOE_01115;Name=hypothetical protein;locus_tag=BALIOE_01115;product=hypothetical protein;Parent=BALIOE_01115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 458 c1 Prodigal gene 248970 249764 . - . ID=BALIOE_01120_gene;locus_tag=BALIOE_01120 | |
| 459 c1 Prodigal CDS 248970 249764 . - 0 ID=BALIOE_01120;Name=hypothetical protein;locus_tag=BALIOE_01120;product=hypothetical protein;Parent=BALIOE_01120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 460 c1 Prodigal gene 249761 250381 . - . ID=BALIOE_01125_gene;locus_tag=BALIOE_01125 | |
| 461 c1 Prodigal CDS 249761 250381 . - 0 ID=BALIOE_01125;Name=hypothetical protein;locus_tag=BALIOE_01125;product=hypothetical protein;Parent=BALIOE_01125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 462 c1 Prodigal gene 250386 251129 . - . ID=BALIOE_01130_gene;locus_tag=BALIOE_01130 | |
| 463 c1 Prodigal CDS 250386 251129 . - 0 ID=BALIOE_01130;Name=hypothetical protein;locus_tag=BALIOE_01130;product=hypothetical protein;Parent=BALIOE_01130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 464 c1 Prodigal gene 251126 253897 . - . ID=BALIOE_01135_gene;locus_tag=BALIOE_01135 | |
| 465 c1 Prodigal CDS 251126 253897 . - 0 ID=BALIOE_01135;Name=hypothetical protein;locus_tag=BALIOE_01135;product=hypothetical protein;Parent=BALIOE_01135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 466 c1 Prodigal gene 253906 254667 . - . ID=BALIOE_01140_gene;locus_tag=BALIOE_01140 | |
| 467 c1 Prodigal CDS 253906 254667 . - 0 ID=BALIOE_01140;Name=hypothetical protein;locus_tag=BALIOE_01140;product=hypothetical protein;Parent=BALIOE_01140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 468 c1 Prodigal gene 254672 256003 . - . ID=BALIOE_01145_gene;locus_tag=BALIOE_01145 | |
| 469 c1 Prodigal CDS 254672 256003 . - 0 ID=BALIOE_01145;Name=hypothetical protein;locus_tag=BALIOE_01145;product=hypothetical protein;Parent=BALIOE_01145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 470 c1 Prodigal gene 256006 256530 . - . ID=BALIOE_01150_gene;locus_tag=BALIOE_01150 | |
| 471 c1 Prodigal CDS 256006 256530 . - 0 ID=BALIOE_01150;Name=hypothetical protein;locus_tag=BALIOE_01150;product=hypothetical protein;Parent=BALIOE_01150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 472 c1 Prodigal gene 256527 257807 . - . ID=BALIOE_01155_gene;locus_tag=BALIOE_01155 | |
| 473 c1 Prodigal CDS 256527 257807 . - 0 ID=BALIOE_01155;Name=hypothetical protein;locus_tag=BALIOE_01155;product=hypothetical protein;Parent=BALIOE_01155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 474 c1 Prodigal gene 257832 258914 . - . ID=BALIOE_01160_gene;locus_tag=BALIOE_01160 | |
| 475 c1 Prodigal CDS 257832 258914 . - 0 ID=BALIOE_01160;Name=hypothetical protein;locus_tag=BALIOE_01160;product=hypothetical protein;Parent=BALIOE_01160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 476 c1 Prodigal gene 258878 260728 . - . ID=BALIOE_01165_gene;locus_tag=BALIOE_01165 | |
| 477 c1 Prodigal CDS 258878 260728 . - 0 ID=BALIOE_01165;Name=hypothetical protein;locus_tag=BALIOE_01165;product=hypothetical protein;Parent=BALIOE_01165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 478 c1 Prodigal gene 260732 261145 . - . ID=BALIOE_01170_gene;locus_tag=BALIOE_01170 | |
| 479 c1 Prodigal CDS 260732 261145 . - 0 ID=BALIOE_01170;Name=hypothetical protein;locus_tag=BALIOE_01170;product=hypothetical protein;Parent=BALIOE_01170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 480 c1 Prodigal gene 261236 262627 . - . ID=BALIOE_01175_gene;locus_tag=BALIOE_01175 | |
| 481 c1 Prodigal CDS 261236 262627 . - 0 ID=BALIOE_01175;Name=hypothetical protein;locus_tag=BALIOE_01175;product=hypothetical protein;Parent=BALIOE_01175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 482 c1 Prodigal gene 262678 262902 . - . ID=BALIOE_01180_gene;locus_tag=BALIOE_01180 | |
| 483 c1 Prodigal CDS 262678 262902 . - 0 ID=BALIOE_01180;Name=hypothetical protein;locus_tag=BALIOE_01180;product=hypothetical protein;Parent=BALIOE_01180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 484 c1 Prodigal gene 262937 263437 . - . ID=BALIOE_01185_gene;locus_tag=BALIOE_01185 | |
| 485 c1 Prodigal CDS 262937 263437 . - 0 ID=BALIOE_01185;Name=hypothetical protein;locus_tag=BALIOE_01185;product=hypothetical protein;Parent=BALIOE_01185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 486 c1 Prodigal gene 264134 264652 . + . ID=BALIOE_01190_gene;locus_tag=BALIOE_01190 | |
| 487 c1 Prodigal CDS 264134 264652 . + 0 ID=BALIOE_01190;Name=hypothetical protein;locus_tag=BALIOE_01190;product=hypothetical protein;Parent=BALIOE_01190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 488 c1 Prodigal gene 264862 267003 . + . ID=BALIOE_01195_gene;locus_tag=BALIOE_01195 | |
| 489 c1 Prodigal CDS 264862 267003 . + 0 ID=BALIOE_01195;Name=hypothetical protein;locus_tag=BALIOE_01195;product=hypothetical protein;Parent=BALIOE_01195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 490 c1 Prodigal gene 267079 271293 . + . ID=BALIOE_01200_gene;locus_tag=BALIOE_01200 | |
| 491 c1 Prodigal CDS 267079 271293 . + 0 ID=BALIOE_01200;Name=hypothetical protein;locus_tag=BALIOE_01200;product=hypothetical protein;Parent=BALIOE_01200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 492 c1 Prodigal gene 271362 271907 . + . ID=BALIOE_01205_gene;locus_tag=BALIOE_01205 | |
| 493 c1 Prodigal CDS 271362 271907 . + 0 ID=BALIOE_01205;Name=hypothetical protein;locus_tag=BALIOE_01205;product=hypothetical protein;Parent=BALIOE_01205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 494 c1 Prodigal gene 272653 273789 . + . ID=BALIOE_01210_gene;locus_tag=BALIOE_01210 | |
| 495 c1 Prodigal CDS 272653 273789 . + 0 ID=BALIOE_01210;Name=hypothetical protein;locus_tag=BALIOE_01210;product=hypothetical protein;Parent=BALIOE_01210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 496 c1 Prodigal gene 273792 275552 . + . ID=BALIOE_01215_gene;locus_tag=BALIOE_01215 | |
| 497 c1 Prodigal CDS 273792 275552 . + 0 ID=BALIOE_01215;Name=hypothetical protein;locus_tag=BALIOE_01215;product=hypothetical protein;Parent=BALIOE_01215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 498 c1 Prodigal gene 275536 275706 . + . ID=BALIOE_01220_gene;locus_tag=BALIOE_01220 | |
| 499 c1 Prodigal CDS 275536 275706 . + 0 ID=BALIOE_01220;Name=hypothetical protein;locus_tag=BALIOE_01220;product=hypothetical protein;Parent=BALIOE_01220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 500 c1 Prodigal gene 275754 276017 . + . ID=BALIOE_01225_gene;locus_tag=BALIOE_01225 | |
| 501 c1 Prodigal CDS 275754 276017 . + 0 ID=BALIOE_01225;Name=hypothetical protein;locus_tag=BALIOE_01225;product=hypothetical protein;Parent=BALIOE_01225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 502 c1 Prodigal gene 276198 277370 . + . ID=BALIOE_01230_gene;locus_tag=BALIOE_01230 | |
| 503 c1 Prodigal CDS 276198 277370 . + 0 ID=BALIOE_01230;Name=hypothetical protein;locus_tag=BALIOE_01230;product=hypothetical protein;Parent=BALIOE_01230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 504 c1 Prodigal gene 277488 278258 . - . ID=BALIOE_01235_gene;locus_tag=BALIOE_01235 | |
| 505 c1 Prodigal CDS 277488 278258 . - 0 ID=BALIOE_01235;Name=hypothetical protein;locus_tag=BALIOE_01235;product=hypothetical protein;Parent=BALIOE_01235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 506 c1 Prodigal gene 278439 278885 . + . ID=BALIOE_01240_gene;locus_tag=BALIOE_01240 | |
| 507 c1 Prodigal CDS 278439 278885 . + 0 ID=BALIOE_01240;Name=hypothetical protein;locus_tag=BALIOE_01240;product=hypothetical protein;Parent=BALIOE_01240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 508 c1 Prodigal gene 278928 281372 . - . ID=BALIOE_01245_gene;locus_tag=BALIOE_01245 | |
| 509 c1 Prodigal CDS 278928 281372 . - 0 ID=BALIOE_01245;Name=hypothetical protein;locus_tag=BALIOE_01245;product=hypothetical protein;Parent=BALIOE_01245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 510 c1 Prodigal gene 281612 282190 . + . ID=BALIOE_01250_gene;locus_tag=BALIOE_01250 | |
| 511 c1 Prodigal CDS 281612 282190 . + 0 ID=BALIOE_01250;Name=hypothetical protein;locus_tag=BALIOE_01250;product=hypothetical protein;Parent=BALIOE_01250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 512 c1 Prodigal gene 282295 283062 . + . ID=BALIOE_01255_gene;locus_tag=BALIOE_01255 | |
| 513 c1 Prodigal CDS 282295 283062 . + 0 ID=BALIOE_01255;Name=hypothetical protein;locus_tag=BALIOE_01255;product=hypothetical protein;Parent=BALIOE_01255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 514 c1 Prodigal gene 283033 283773 . - . ID=BALIOE_01260_gene;locus_tag=BALIOE_01260 | |
| 515 c1 Prodigal CDS 283033 283773 . - 0 ID=BALIOE_01260;Name=hypothetical protein;locus_tag=BALIOE_01260;product=hypothetical protein;Parent=BALIOE_01260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 516 c1 Prodigal gene 284208 284468 . - . ID=BALIOE_01265_gene;locus_tag=BALIOE_01265 | |
| 517 c1 Prodigal CDS 284208 284468 . - 0 ID=BALIOE_01265;Name=hypothetical protein;locus_tag=BALIOE_01265;product=hypothetical protein;Parent=BALIOE_01265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 518 c1 Prodigal gene 284654 285427 . + . ID=BALIOE_01270_gene;locus_tag=BALIOE_01270 | |
| 519 c1 Prodigal CDS 284654 285427 . + 0 ID=BALIOE_01270;Name=hypothetical protein;locus_tag=BALIOE_01270;product=hypothetical protein;Parent=BALIOE_01270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 520 c1 Infernal gene 285427 285504 . + . ID=BALIOE_01275_gene;locus_tag=BALIOE_01275;gene=naRNA4 | |
| 521 c1 Infernal ncRNA 285427 285504 4.3e-09 + . ID=BALIOE_01275;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01275;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01275_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 522 c1 Prodigal gene 285603 285899 . + . ID=BALIOE_01280_gene;locus_tag=BALIOE_01280 | |
| 523 c1 Prodigal CDS 285603 285899 . + 0 ID=BALIOE_01280;Name=hypothetical protein;locus_tag=BALIOE_01280;product=hypothetical protein;Parent=BALIOE_01280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 524 c1 Prodigal gene 286245 287984 . - . ID=BALIOE_01285_gene;locus_tag=BALIOE_01285 | |
| 525 c1 Prodigal CDS 286245 287984 . - 0 ID=BALIOE_01285;Name=hypothetical protein;locus_tag=BALIOE_01285;product=hypothetical protein;Parent=BALIOE_01285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 526 c1 Prodigal gene 288079 288714 . + . ID=BALIOE_01290_gene;locus_tag=BALIOE_01290 | |
| 527 c1 Prodigal CDS 288079 288714 . + 0 ID=BALIOE_01290;Name=hypothetical protein;locus_tag=BALIOE_01290;product=hypothetical protein;Parent=BALIOE_01290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 528 c1 Prodigal gene 288785 289840 . + . ID=BALIOE_01295_gene;locus_tag=BALIOE_01295 | |
| 529 c1 Prodigal CDS 288785 289840 . + 0 ID=BALIOE_01295;Name=hypothetical protein;locus_tag=BALIOE_01295;product=hypothetical protein;Parent=BALIOE_01295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 530 c1 Prodigal gene 289892 290185 . + . ID=BALIOE_01300_gene;locus_tag=BALIOE_01300 | |
| 531 c1 Prodigal CDS 289892 290185 . + 0 ID=BALIOE_01300;Name=hypothetical protein;locus_tag=BALIOE_01300;product=hypothetical protein;Parent=BALIOE_01300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 532 c1 Prodigal gene 290188 290586 . + . ID=BALIOE_01305_gene;locus_tag=BALIOE_01305 | |
| 533 c1 Prodigal CDS 290188 290586 . + 0 ID=BALIOE_01305;Name=hypothetical protein;locus_tag=BALIOE_01305;product=hypothetical protein;Parent=BALIOE_01305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 534 c1 Prodigal gene 290671 291048 . + . ID=BALIOE_01310_gene;locus_tag=BALIOE_01310 | |
| 535 c1 Prodigal CDS 290671 291048 . + 0 ID=BALIOE_01310;Name=hypothetical protein;locus_tag=BALIOE_01310;product=hypothetical protein;Parent=BALIOE_01310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 536 c1 Prodigal gene 291355 291621 . + . ID=BALIOE_01315_gene;locus_tag=BALIOE_01315 | |
| 537 c1 Prodigal CDS 291355 291621 . + 0 ID=BALIOE_01315;Name=hypothetical protein;locus_tag=BALIOE_01315;product=hypothetical protein;Parent=BALIOE_01315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 538 c1 Prodigal gene 291590 292090 . + . ID=BALIOE_01320_gene;locus_tag=BALIOE_01320 | |
| 539 c1 Prodigal CDS 291590 292090 . + 0 ID=BALIOE_01320;Name=hypothetical protein;locus_tag=BALIOE_01320;product=hypothetical protein;Parent=BALIOE_01320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 540 c1 Prodigal gene 292147 293604 . - . ID=BALIOE_01325_gene;locus_tag=BALIOE_01325 | |
| 541 c1 Prodigal CDS 292147 293604 . - 0 ID=BALIOE_01325;Name=hypothetical protein;locus_tag=BALIOE_01325;product=hypothetical protein;Parent=BALIOE_01325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 542 c1 Prodigal gene 293865 294323 . + . ID=BALIOE_01330_gene;locus_tag=BALIOE_01330 | |
| 543 c1 Prodigal CDS 293865 294323 . + 0 ID=BALIOE_01330;Name=hypothetical protein;locus_tag=BALIOE_01330;product=hypothetical protein;Parent=BALIOE_01330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 544 c1 Prodigal gene 294415 295659 . + . ID=BALIOE_01335_gene;locus_tag=BALIOE_01335 | |
| 545 c1 Prodigal CDS 294415 295659 . + 0 ID=BALIOE_01335;Name=hypothetical protein;locus_tag=BALIOE_01335;product=hypothetical protein;Parent=BALIOE_01335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 546 c1 Prodigal gene 295717 296118 . + . ID=BALIOE_01340_gene;locus_tag=BALIOE_01340 | |
| 547 c1 Prodigal CDS 295717 296118 . + 0 ID=BALIOE_01340;Name=hypothetical protein;locus_tag=BALIOE_01340;product=hypothetical protein;Parent=BALIOE_01340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 548 c1 Prodigal gene 296157 297212 . - . ID=BALIOE_01345_gene;locus_tag=BALIOE_01345 | |
| 549 c1 Prodigal CDS 296157 297212 . - 0 ID=BALIOE_01345;Name=hypothetical protein;locus_tag=BALIOE_01345;product=hypothetical protein;Parent=BALIOE_01345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 550 c1 Prodigal gene 297500 298603 . + . ID=BALIOE_01350_gene;locus_tag=BALIOE_01350 | |
| 551 c1 Prodigal CDS 297500 298603 . + 0 ID=BALIOE_01350;Name=hypothetical protein;locus_tag=BALIOE_01350;product=hypothetical protein;Parent=BALIOE_01350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 552 c1 Prodigal gene 298615 299868 . + . ID=BALIOE_01355_gene;locus_tag=BALIOE_01355 | |
| 553 c1 Prodigal CDS 298615 299868 . + 0 ID=BALIOE_01355;Name=hypothetical protein;locus_tag=BALIOE_01355;product=hypothetical protein;Parent=BALIOE_01355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 554 c1 tRNAscan-SE gene 299983 300058 . + . ID=BALIOE_01360_gene;locus_tag=BALIOE_01360;gene=Thr_trna | |
| 555 c1 tRNAscan-SE tRNA 299983 300058 . + . ID=BALIOE_01360;Name=tRNA-Thr;locus_tag=BALIOE_01360;product=tRNA-Thr;gene=Thr_trna;Parent=BALIOE_01360_gene;inference=profile:tRNAscan:2.0;Note=SO:0000270 | |
| 556 c1 Prodigal gene 300073 301047 . - . ID=BALIOE_01365_gene;locus_tag=BALIOE_01365 | |
| 557 c1 Prodigal CDS 300073 301047 . - 0 ID=BALIOE_01365;Name=hypothetical protein;locus_tag=BALIOE_01365;product=hypothetical protein;Parent=BALIOE_01365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 558 c1 Prodigal gene 301423 301812 . - . ID=BALIOE_01370_gene;locus_tag=BALIOE_01370 | |
| 559 c1 Prodigal CDS 301423 301812 . - 0 ID=BALIOE_01370;Name=hypothetical protein;locus_tag=BALIOE_01370;product=hypothetical protein;Parent=BALIOE_01370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 560 c1 Prodigal gene 301940 302653 . - . ID=BALIOE_01375_gene;locus_tag=BALIOE_01375 | |
| 561 c1 Prodigal CDS 301940 302653 . - 0 ID=BALIOE_01375;Name=hypothetical protein;locus_tag=BALIOE_01375;product=hypothetical protein;Parent=BALIOE_01375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 562 c1 Prodigal gene 302754 302954 . + . ID=BALIOE_01380_gene;locus_tag=BALIOE_01380 | |
| 563 c1 Prodigal CDS 302754 302954 . + 0 ID=BALIOE_01380;Name=hypothetical protein;locus_tag=BALIOE_01380;product=hypothetical protein;Parent=BALIOE_01380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 564 c1 Prodigal gene 303073 303366 . + . ID=BALIOE_01385_gene;locus_tag=BALIOE_01385 | |
| 565 c1 Prodigal CDS 303073 303366 . + 0 ID=BALIOE_01385;Name=hypothetical protein;locus_tag=BALIOE_01385;product=hypothetical protein;Parent=BALIOE_01385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 566 c1 Prodigal gene 303399 304007 . + . ID=BALIOE_01390_gene;locus_tag=BALIOE_01390 | |
| 567 c1 Prodigal CDS 303399 304007 . + 0 ID=BALIOE_01390;Name=hypothetical protein;locus_tag=BALIOE_01390;product=hypothetical protein;Parent=BALIOE_01390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 568 c1 Prodigal gene 303947 304321 . + . ID=BALIOE_01395_gene;locus_tag=BALIOE_01395 | |
| 569 c1 Prodigal CDS 303947 304321 . + 0 ID=BALIOE_01395;Name=hypothetical protein;locus_tag=BALIOE_01395;product=hypothetical protein;Parent=BALIOE_01395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 570 c1 Prodigal gene 304318 304629 . + . ID=BALIOE_01400_gene;locus_tag=BALIOE_01400 | |
| 571 c1 Prodigal CDS 304318 304629 . + 0 ID=BALIOE_01400;Name=hypothetical protein;locus_tag=BALIOE_01400;product=hypothetical protein;Parent=BALIOE_01400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 572 c1 Prodigal gene 304629 305423 . + . ID=BALIOE_01405_gene;locus_tag=BALIOE_01405 | |
| 573 c1 Prodigal CDS 304629 305423 . + 0 ID=BALIOE_01405;Name=hypothetical protein;locus_tag=BALIOE_01405;product=hypothetical protein;Parent=BALIOE_01405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 574 c1 Prodigal gene 305423 306016 . + . ID=BALIOE_01410_gene;locus_tag=BALIOE_01410 | |
| 575 c1 Prodigal CDS 305423 306016 . + 0 ID=BALIOE_01410;Name=hypothetical protein;locus_tag=BALIOE_01410;product=hypothetical protein;Parent=BALIOE_01410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 576 c1 Prodigal gene 305988 306431 . - . ID=BALIOE_01415_gene;locus_tag=BALIOE_01415 | |
| 577 c1 Prodigal CDS 305988 306431 . - 0 ID=BALIOE_01415;Name=hypothetical protein;locus_tag=BALIOE_01415;product=hypothetical protein;Parent=BALIOE_01415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 578 c1 Prodigal gene 306452 306862 . - . ID=BALIOE_01420_gene;locus_tag=BALIOE_01420 | |
| 579 c1 Prodigal CDS 306452 306862 . - 0 ID=BALIOE_01420;Name=hypothetical protein;locus_tag=BALIOE_01420;product=hypothetical protein;Parent=BALIOE_01420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 580 c1 Prodigal gene 306892 307446 . + . ID=BALIOE_01425_gene;locus_tag=BALIOE_01425 | |
| 581 c1 Prodigal CDS 306892 307446 . + 0 ID=BALIOE_01425;Name=hypothetical protein;locus_tag=BALIOE_01425;product=hypothetical protein;Parent=BALIOE_01425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 582 c1 Prodigal gene 307504 308277 . - . ID=BALIOE_01430_gene;locus_tag=BALIOE_01430 | |
| 583 c1 Prodigal CDS 307504 308277 . - 0 ID=BALIOE_01430;Name=hypothetical protein;locus_tag=BALIOE_01430;product=hypothetical protein;Parent=BALIOE_01430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 584 c1 tRNAscan-SE gene 308435 308518 . + . ID=BALIOE_01435_gene;locus_tag=BALIOE_01435 | |
| 585 c1 tRNAscan-SE tRNA 308435 308518 . + . ID=BALIOE_01435;Name=tRNA-Xxx;locus_tag=BALIOE_01435;product=tRNA-Xxx;Parent=BALIOE_01435_gene;inference=profile:tRNAscan:2.0 | |
| 586 c1 Prodigal gene 309101 309844 . + . ID=BALIOE_01440_gene;locus_tag=BALIOE_01440 | |
| 587 c1 Prodigal CDS 309101 309844 . + 0 ID=BALIOE_01440;Name=hypothetical protein;locus_tag=BALIOE_01440;product=hypothetical protein;Parent=BALIOE_01440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 588 c1 Prodigal gene 309886 310239 . - . ID=BALIOE_01445_gene;locus_tag=BALIOE_01445 | |
| 589 c1 Prodigal CDS 309886 310239 . - 0 ID=BALIOE_01445;Name=hypothetical protein;locus_tag=BALIOE_01445;product=hypothetical protein;Parent=BALIOE_01445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 590 c1 Prodigal gene 310807 311988 . + . ID=BALIOE_01450_gene;locus_tag=BALIOE_01450 | |
| 591 c1 Prodigal CDS 310807 311988 . + 0 ID=BALIOE_01450;Name=hypothetical protein;locus_tag=BALIOE_01450;product=hypothetical protein;Parent=BALIOE_01450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 592 c1 Prodigal gene 311992 312408 . + . ID=BALIOE_01455_gene;locus_tag=BALIOE_01455 | |
| 593 c1 Prodigal CDS 311992 312408 . + 0 ID=BALIOE_01455;Name=hypothetical protein;locus_tag=BALIOE_01455;product=hypothetical protein;Parent=BALIOE_01455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 594 c1 Prodigal gene 312381 312998 . + . ID=BALIOE_01460_gene;locus_tag=BALIOE_01460 | |
| 595 c1 Prodigal CDS 312381 312998 . + 0 ID=BALIOE_01460;Name=hypothetical protein;locus_tag=BALIOE_01460;product=hypothetical protein;Parent=BALIOE_01460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 596 c1 Prodigal gene 312998 313456 . + . ID=BALIOE_01465_gene;locus_tag=BALIOE_01465 | |
| 597 c1 Prodigal CDS 312998 313456 . + 0 ID=BALIOE_01465;Name=hypothetical protein;locus_tag=BALIOE_01465;product=hypothetical protein;Parent=BALIOE_01465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 598 c1 Prodigal gene 313449 314081 . + . ID=BALIOE_01470_gene;locus_tag=BALIOE_01470 | |
| 599 c1 Prodigal CDS 313449 314081 . + 0 ID=BALIOE_01470;Name=hypothetical protein;locus_tag=BALIOE_01470;product=hypothetical protein;Parent=BALIOE_01470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 600 c1 Prodigal gene 314112 314702 . + . ID=BALIOE_01475_gene;locus_tag=BALIOE_01475 | |
| 601 c1 Prodigal CDS 314112 314702 . + 0 ID=BALIOE_01475;Name=hypothetical protein;locus_tag=BALIOE_01475;product=hypothetical protein;Parent=BALIOE_01475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 602 c1 Prodigal gene 314702 315268 . + . ID=BALIOE_01480_gene;locus_tag=BALIOE_01480 | |
| 603 c1 Prodigal CDS 314702 315268 . + 0 ID=BALIOE_01480;Name=hypothetical protein;locus_tag=BALIOE_01480;product=hypothetical protein;Parent=BALIOE_01480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 604 c1 Prodigal gene 315678 315950 . - . ID=BALIOE_01485_gene;locus_tag=BALIOE_01485 | |
| 605 c1 Prodigal CDS 315678 315950 . - 0 ID=BALIOE_01485;Name=hypothetical protein;locus_tag=BALIOE_01485;product=hypothetical protein;Parent=BALIOE_01485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 606 c1 Prodigal gene 315956 316507 . - . ID=BALIOE_01490_gene;locus_tag=BALIOE_01490 | |
| 607 c1 Prodigal CDS 315956 316507 . - 0 ID=BALIOE_01490;Name=hypothetical protein;locus_tag=BALIOE_01490;product=hypothetical protein;Parent=BALIOE_01490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 608 c1 Prodigal gene 316504 317256 . - . ID=BALIOE_01495_gene;locus_tag=BALIOE_01495 | |
| 609 c1 Prodigal CDS 316504 317256 . - 0 ID=BALIOE_01495;Name=hypothetical protein;locus_tag=BALIOE_01495;product=hypothetical protein;Parent=BALIOE_01495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 610 c1 Prodigal gene 318190 318450 . + . ID=BALIOE_01500_gene;locus_tag=BALIOE_01500 | |
| 611 c1 Prodigal CDS 318190 318450 . + 0 ID=BALIOE_01500;Name=hypothetical protein;locus_tag=BALIOE_01500;product=hypothetical protein;Parent=BALIOE_01500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 612 c1 Prodigal gene 318447 319004 . + . ID=BALIOE_01505_gene;locus_tag=BALIOE_01505 | |
| 613 c1 Prodigal CDS 318447 319004 . + 0 ID=BALIOE_01505;Name=hypothetical protein;locus_tag=BALIOE_01505;product=hypothetical protein;Parent=BALIOE_01505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 614 c1 Prodigal gene 319001 319222 . + . ID=BALIOE_01510_gene;locus_tag=BALIOE_01510 | |
| 615 c1 Prodigal CDS 319001 319222 . + 0 ID=BALIOE_01510;Name=hypothetical protein;locus_tag=BALIOE_01510;product=hypothetical protein;Parent=BALIOE_01510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 616 c1 Prodigal gene 319222 319545 . + . ID=BALIOE_01515_gene;locus_tag=BALIOE_01515 | |
| 617 c1 Prodigal CDS 319222 319545 . + 0 ID=BALIOE_01515;Name=hypothetical protein;locus_tag=BALIOE_01515;product=hypothetical protein;Parent=BALIOE_01515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 618 c1 Prodigal gene 319559 321892 . + . ID=BALIOE_01520_gene;locus_tag=BALIOE_01520 | |
| 619 c1 Prodigal CDS 319559 321892 . + 0 ID=BALIOE_01520;Name=hypothetical protein;locus_tag=BALIOE_01520;product=hypothetical protein;Parent=BALIOE_01520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 620 c1 Prodigal gene 322025 322981 . - . ID=BALIOE_01525_gene;locus_tag=BALIOE_01525 | |
| 621 c1 Prodigal CDS 322025 322981 . - 0 ID=BALIOE_01525;Name=hypothetical protein;locus_tag=BALIOE_01525;product=hypothetical protein;Parent=BALIOE_01525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 622 c1 Prodigal gene 323657 324556 . - . ID=BALIOE_01530_gene;locus_tag=BALIOE_01530 | |
| 623 c1 Prodigal CDS 323657 324556 . - 0 ID=BALIOE_01530;Name=hypothetical protein;locus_tag=BALIOE_01530;product=hypothetical protein;Parent=BALIOE_01530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 624 c1 Prodigal gene 324655 325377 . + . ID=BALIOE_01535_gene;locus_tag=BALIOE_01535 | |
| 625 c1 Prodigal CDS 324655 325377 . + 0 ID=BALIOE_01535;Name=hypothetical protein;locus_tag=BALIOE_01535;product=hypothetical protein;Parent=BALIOE_01535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 626 c1 Prodigal gene 325544 325822 . + . ID=BALIOE_01540_gene;locus_tag=BALIOE_01540 | |
| 627 c1 Prodigal CDS 325544 325822 . + 0 ID=BALIOE_01540;Name=hypothetical protein;locus_tag=BALIOE_01540;product=hypothetical protein;Parent=BALIOE_01540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 628 c1 Prodigal gene 326525 327427 . - . ID=BALIOE_01545_gene;locus_tag=BALIOE_01545 | |
| 629 c1 Prodigal CDS 326525 327427 . - 0 ID=BALIOE_01545;Name=hypothetical protein;locus_tag=BALIOE_01545;product=hypothetical protein;Parent=BALIOE_01545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 630 c1 Prodigal gene 327673 328731 . + . ID=BALIOE_01550_gene;locus_tag=BALIOE_01550 | |
| 631 c1 Prodigal CDS 327673 328731 . + 0 ID=BALIOE_01550;Name=hypothetical protein;locus_tag=BALIOE_01550;product=hypothetical protein;Parent=BALIOE_01550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 632 c1 Prodigal gene 328873 330000 . + . ID=BALIOE_01555_gene;locus_tag=BALIOE_01555 | |
| 633 c1 Prodigal CDS 328873 330000 . + 0 ID=BALIOE_01555;Name=hypothetical protein;locus_tag=BALIOE_01555;product=hypothetical protein;Parent=BALIOE_01555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 634 c1 Prodigal gene 330179 331135 . - . ID=BALIOE_01560_gene;locus_tag=BALIOE_01560 | |
| 635 c1 Prodigal CDS 330179 331135 . - 0 ID=BALIOE_01560;Name=hypothetical protein;locus_tag=BALIOE_01560;product=hypothetical protein;Parent=BALIOE_01560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 636 c1 Prodigal gene 331145 333343 . - . ID=BALIOE_01565_gene;locus_tag=BALIOE_01565 | |
| 637 c1 Prodigal CDS 331145 333343 . - 0 ID=BALIOE_01565;Name=hypothetical protein;locus_tag=BALIOE_01565;product=hypothetical protein;Parent=BALIOE_01565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 638 c1 Prodigal gene 333340 334296 . - . ID=BALIOE_01570_gene;locus_tag=BALIOE_01570 | |
| 639 c1 Prodigal CDS 333340 334296 . - 0 ID=BALIOE_01570;Name=hypothetical protein;locus_tag=BALIOE_01570;product=hypothetical protein;Parent=BALIOE_01570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 640 c1 Prodigal gene 334293 334982 . - . ID=BALIOE_01575_gene;locus_tag=BALIOE_01575 | |
| 641 c1 Prodigal CDS 334293 334982 . - 0 ID=BALIOE_01575;Name=hypothetical protein;locus_tag=BALIOE_01575;product=hypothetical protein;Parent=BALIOE_01575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 642 c1 Prodigal gene 335400 336014 . + . ID=BALIOE_01580_gene;locus_tag=BALIOE_01580 | |
| 643 c1 Prodigal CDS 335400 336014 . + 0 ID=BALIOE_01580;Name=hypothetical protein;locus_tag=BALIOE_01580;product=hypothetical protein;Parent=BALIOE_01580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 644 c1 Prodigal gene 336904 337614 . - . ID=BALIOE_01585_gene;locus_tag=BALIOE_01585 | |
| 645 c1 Prodigal CDS 336904 337614 . - 0 ID=BALIOE_01585;Name=hypothetical protein;locus_tag=BALIOE_01585;product=hypothetical protein;Parent=BALIOE_01585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 646 c1 Prodigal gene 337583 339226 . - . ID=BALIOE_01590_gene;locus_tag=BALIOE_01590 | |
| 647 c1 Prodigal CDS 337583 339226 . - 0 ID=BALIOE_01590;Name=hypothetical protein;locus_tag=BALIOE_01590;product=hypothetical protein;Parent=BALIOE_01590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 648 c1 Prodigal gene 339216 341741 . - . ID=BALIOE_01595_gene;locus_tag=BALIOE_01595 | |
| 649 c1 Prodigal CDS 339216 341741 . - 0 ID=BALIOE_01595;Name=hypothetical protein;locus_tag=BALIOE_01595;product=hypothetical protein;Parent=BALIOE_01595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 650 c1 Prodigal gene 341767 342435 . - . ID=BALIOE_01600_gene;locus_tag=BALIOE_01600 | |
| 651 c1 Prodigal CDS 341767 342435 . - 0 ID=BALIOE_01600;Name=hypothetical protein;locus_tag=BALIOE_01600;product=hypothetical protein;Parent=BALIOE_01600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 652 c1 Prodigal gene 342493 343080 . - . ID=BALIOE_01605_gene;locus_tag=BALIOE_01605 | |
| 653 c1 Prodigal CDS 342493 343080 . - 0 ID=BALIOE_01605;Name=hypothetical protein;locus_tag=BALIOE_01605;product=hypothetical protein;Parent=BALIOE_01605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 654 c1 Prodigal gene 343155 343697 . - . ID=BALIOE_01610_gene;locus_tag=BALIOE_01610 | |
| 655 c1 Prodigal CDS 343155 343697 . - 0 ID=BALIOE_01610;Name=hypothetical protein;locus_tag=BALIOE_01610;product=hypothetical protein;Parent=BALIOE_01610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 656 c1 Prodigal gene 344522 344713 . + . ID=BALIOE_01615_gene;locus_tag=BALIOE_01615 | |
| 657 c1 Prodigal CDS 344522 344713 . + 0 ID=BALIOE_01615;Name=hypothetical protein;locus_tag=BALIOE_01615;product=hypothetical protein;Parent=BALIOE_01615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 658 c1 Prodigal gene 344783 344923 . - . ID=BALIOE_01620_gene;locus_tag=BALIOE_01620 | |
| 659 c1 Prodigal CDS 344783 344923 . - 0 ID=BALIOE_01620;Name=hypothetical protein;locus_tag=BALIOE_01620;product=hypothetical protein;Parent=BALIOE_01620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 660 c1 Prodigal gene 344923 345189 . - . ID=BALIOE_01625_gene;locus_tag=BALIOE_01625 | |
| 661 c1 Prodigal CDS 344923 345189 . - 0 ID=BALIOE_01625;Name=hypothetical protein;locus_tag=BALIOE_01625;product=hypothetical protein;Parent=BALIOE_01625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 662 c1 Prodigal gene 345450 345830 . + . ID=BALIOE_01630_gene;locus_tag=BALIOE_01630 | |
| 663 c1 Prodigal CDS 345450 345830 . + 0 ID=BALIOE_01630;Name=hypothetical protein;locus_tag=BALIOE_01630;product=hypothetical protein;Parent=BALIOE_01630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 664 c1 Prodigal gene 345827 346174 . + . ID=BALIOE_01635_gene;locus_tag=BALIOE_01635 | |
| 665 c1 Prodigal CDS 345827 346174 . + 0 ID=BALIOE_01635;Name=hypothetical protein;locus_tag=BALIOE_01635;product=hypothetical protein;Parent=BALIOE_01635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 666 c1 Prodigal gene 346224 347762 . + . ID=BALIOE_01640_gene;locus_tag=BALIOE_01640 | |
| 667 c1 Prodigal CDS 346224 347762 . + 0 ID=BALIOE_01640;Name=hypothetical protein;locus_tag=BALIOE_01640;product=hypothetical protein;Parent=BALIOE_01640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 668 c1 Prodigal gene 348574 349716 . - . ID=BALIOE_01645_gene;locus_tag=BALIOE_01645 | |
| 669 c1 Prodigal CDS 348574 349716 . - 0 ID=BALIOE_01645;Name=hypothetical protein;locus_tag=BALIOE_01645;product=hypothetical protein;Parent=BALIOE_01645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 670 c1 Prodigal gene 349951 350871 . - . ID=BALIOE_01650_gene;locus_tag=BALIOE_01650 | |
| 671 c1 Prodigal CDS 349951 350871 . - 0 ID=BALIOE_01650;Name=hypothetical protein;locus_tag=BALIOE_01650;product=hypothetical protein;Parent=BALIOE_01650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 672 c1 Prodigal gene 351028 351954 . + . ID=BALIOE_01655_gene;locus_tag=BALIOE_01655 | |
| 673 c1 Prodigal CDS 351028 351954 . + 0 ID=BALIOE_01655;Name=hypothetical protein;locus_tag=BALIOE_01655;product=hypothetical protein;Parent=BALIOE_01655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 674 c1 Prodigal gene 352242 352598 . - . ID=BALIOE_01660_gene;locus_tag=BALIOE_01660 | |
| 675 c1 Prodigal CDS 352242 352598 . - 0 ID=BALIOE_01660;Name=hypothetical protein;locus_tag=BALIOE_01660;product=hypothetical protein;Parent=BALIOE_01660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 676 c1 Prodigal gene 352791 353366 . - . ID=BALIOE_01665_gene;locus_tag=BALIOE_01665 | |
| 677 c1 Prodigal CDS 352791 353366 . - 0 ID=BALIOE_01665;Name=hypothetical protein;locus_tag=BALIOE_01665;product=hypothetical protein;Parent=BALIOE_01665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 678 c1 Prodigal gene 353932 358185 . + . ID=BALIOE_01670_gene;locus_tag=BALIOE_01670 | |
| 679 c1 Prodigal CDS 353932 358185 . + 0 ID=BALIOE_01670;Name=hypothetical protein;locus_tag=BALIOE_01670;product=hypothetical protein;Parent=BALIOE_01670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 680 c1 Prodigal gene 358306 359163 . - . ID=BALIOE_01675_gene;locus_tag=BALIOE_01675 | |
| 681 c1 Prodigal CDS 358306 359163 . - 0 ID=BALIOE_01675;Name=hypothetical protein;locus_tag=BALIOE_01675;product=hypothetical protein;Parent=BALIOE_01675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 682 c1 Prodigal gene 359412 360281 . + . ID=BALIOE_01680_gene;locus_tag=BALIOE_01680 | |
| 683 c1 Prodigal CDS 359412 360281 . + 0 ID=BALIOE_01680;Name=hypothetical protein;locus_tag=BALIOE_01680;product=hypothetical protein;Parent=BALIOE_01680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 684 c1 Prodigal gene 360441 361034 . - . ID=BALIOE_01685_gene;locus_tag=BALIOE_01685 | |
| 685 c1 Prodigal CDS 360441 361034 . - 0 ID=BALIOE_01685;Name=hypothetical protein;locus_tag=BALIOE_01685;product=hypothetical protein;Parent=BALIOE_01685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 686 c1 Prodigal gene 361391 362716 . - . ID=BALIOE_01690_gene;locus_tag=BALIOE_01690 | |
| 687 c1 Prodigal CDS 361391 362716 . - 0 ID=BALIOE_01690;Name=hypothetical protein;locus_tag=BALIOE_01690;product=hypothetical protein;Parent=BALIOE_01690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 688 c1 Prodigal gene 362942 363796 . + . ID=BALIOE_01695_gene;locus_tag=BALIOE_01695 | |
| 689 c1 Prodigal CDS 362942 363796 . + 0 ID=BALIOE_01695;Name=hypothetical protein;locus_tag=BALIOE_01695;product=hypothetical protein;Parent=BALIOE_01695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 690 c1 Prodigal gene 364323 365042 . + . ID=BALIOE_01700_gene;locus_tag=BALIOE_01700 | |
| 691 c1 Prodigal CDS 364323 365042 . + 0 ID=BALIOE_01700;Name=hypothetical protein;locus_tag=BALIOE_01700;product=hypothetical protein;Parent=BALIOE_01700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 692 c1 Prodigal gene 365053 366480 . + . ID=BALIOE_01705_gene;locus_tag=BALIOE_01705 | |
| 693 c1 Prodigal CDS 365053 366480 . + 0 ID=BALIOE_01705;Name=hypothetical protein;locus_tag=BALIOE_01705;product=hypothetical protein;Parent=BALIOE_01705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 694 c1 Prodigal gene 366473 367168 . + . ID=BALIOE_01710_gene;locus_tag=BALIOE_01710 | |
| 695 c1 Prodigal CDS 366473 367168 . + 0 ID=BALIOE_01710;Name=hypothetical protein;locus_tag=BALIOE_01710;product=hypothetical protein;Parent=BALIOE_01710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 696 c1 Prodigal gene 367663 368079 . - . ID=BALIOE_01715_gene;locus_tag=BALIOE_01715 | |
| 697 c1 Prodigal CDS 367663 368079 . - 0 ID=BALIOE_01715;Name=hypothetical protein;locus_tag=BALIOE_01715;product=hypothetical protein;Parent=BALIOE_01715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 698 c1 Prodigal gene 368261 368473 . - . ID=BALIOE_01720_gene;locus_tag=BALIOE_01720 | |
| 699 c1 Prodigal CDS 368261 368473 . - 0 ID=BALIOE_01720;Name=hypothetical protein;locus_tag=BALIOE_01720;product=hypothetical protein;Parent=BALIOE_01720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 700 c1 Prodigal gene 368427 369521 . - . ID=BALIOE_01725_gene;locus_tag=BALIOE_01725 | |
| 701 c1 Prodigal CDS 368427 369521 . - 0 ID=BALIOE_01725;Name=hypothetical protein;locus_tag=BALIOE_01725;product=hypothetical protein;Parent=BALIOE_01725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 702 c1 Prodigal gene 369563 370324 . - . ID=BALIOE_01730_gene;locus_tag=BALIOE_01730 | |
| 703 c1 Prodigal CDS 369563 370324 . - 0 ID=BALIOE_01730;Name=hypothetical protein;locus_tag=BALIOE_01730;product=hypothetical protein;Parent=BALIOE_01730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 704 c1 Prodigal gene 370341 370481 . - . ID=BALIOE_01735_gene;locus_tag=BALIOE_01735 | |
| 705 c1 Prodigal CDS 370341 370481 . - 0 ID=BALIOE_01735;Name=hypothetical protein;locus_tag=BALIOE_01735;product=hypothetical protein;Parent=BALIOE_01735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 706 c1 Prodigal gene 371105 371272 . - . ID=BALIOE_01740_gene;locus_tag=BALIOE_01740 | |
| 707 c1 Prodigal CDS 371105 371272 . - 0 ID=BALIOE_01740;Name=hypothetical protein;locus_tag=BALIOE_01740;product=hypothetical protein;Parent=BALIOE_01740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 708 c1 Prodigal gene 372408 372542 . + . ID=BALIOE_01745_gene;locus_tag=BALIOE_01745 | |
| 709 c1 Prodigal CDS 372408 372542 . + 0 ID=BALIOE_01745;Name=hypothetical protein;locus_tag=BALIOE_01745;product=hypothetical protein;Parent=BALIOE_01745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 710 c1 Prodigal gene 372971 373222 . + . ID=BALIOE_01750_gene;locus_tag=BALIOE_01750 | |
| 711 c1 Prodigal CDS 372971 373222 . + 0 ID=BALIOE_01750;Name=hypothetical protein;locus_tag=BALIOE_01750;product=hypothetical protein;Parent=BALIOE_01750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 712 c1 Prodigal gene 373224 374912 . - . ID=BALIOE_01755_gene;locus_tag=BALIOE_01755 | |
| 713 c1 Prodigal CDS 373224 374912 . - 0 ID=BALIOE_01755;Name=hypothetical protein;locus_tag=BALIOE_01755;product=hypothetical protein;Parent=BALIOE_01755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 714 c1 Prodigal gene 374926 376398 . - . ID=BALIOE_01760_gene;locus_tag=BALIOE_01760 | |
| 715 c1 Prodigal CDS 374926 376398 . - 0 ID=BALIOE_01760;Name=hypothetical protein;locus_tag=BALIOE_01760;product=hypothetical protein;Parent=BALIOE_01760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 716 c1 Prodigal gene 376412 376999 . - . ID=BALIOE_01765_gene;locus_tag=BALIOE_01765 | |
| 717 c1 Prodigal CDS 376412 376999 . - 0 ID=BALIOE_01765;Name=hypothetical protein;locus_tag=BALIOE_01765;product=hypothetical protein;Parent=BALIOE_01765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 718 c1 Prodigal gene 377128 379161 . + . ID=BALIOE_01770_gene;locus_tag=BALIOE_01770 | |
| 719 c1 Prodigal CDS 377128 379161 . + 0 ID=BALIOE_01770;Name=hypothetical protein;locus_tag=BALIOE_01770;product=hypothetical protein;Parent=BALIOE_01770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 720 c1 Prodigal gene 379735 383718 . + . ID=BALIOE_01775_gene;locus_tag=BALIOE_01775 | |
| 721 c1 Prodigal CDS 379735 383718 . + 0 ID=BALIOE_01775;Name=hypothetical protein;locus_tag=BALIOE_01775;product=hypothetical protein;Parent=BALIOE_01775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 722 c1 Prodigal gene 383860 384948 . + . ID=BALIOE_01780_gene;locus_tag=BALIOE_01780 | |
| 723 c1 Prodigal CDS 383860 384948 . + 0 ID=BALIOE_01780;Name=hypothetical protein;locus_tag=BALIOE_01780;product=hypothetical protein;Parent=BALIOE_01780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 724 c1 Prodigal gene 384990 385250 . - . ID=BALIOE_01785_gene;locus_tag=BALIOE_01785 | |
| 725 c1 Prodigal CDS 384990 385250 . - 0 ID=BALIOE_01785;Name=hypothetical protein;locus_tag=BALIOE_01785;product=hypothetical protein;Parent=BALIOE_01785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 726 c1 Prodigal gene 385211 385921 . - . ID=BALIOE_01790_gene;locus_tag=BALIOE_01790 | |
| 727 c1 Prodigal CDS 385211 385921 . - 0 ID=BALIOE_01790;Name=hypothetical protein;locus_tag=BALIOE_01790;product=hypothetical protein;Parent=BALIOE_01790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 728 c1 Prodigal gene 386013 386315 . - . ID=BALIOE_01795_gene;locus_tag=BALIOE_01795 | |
| 729 c1 Prodigal CDS 386013 386315 . - 0 ID=BALIOE_01795;Name=hypothetical protein;locus_tag=BALIOE_01795;product=hypothetical protein;Parent=BALIOE_01795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 730 c1 Prodigal gene 386778 387383 . + . ID=BALIOE_01800_gene;locus_tag=BALIOE_01800 | |
| 731 c1 Prodigal CDS 386778 387383 . + 0 ID=BALIOE_01800;Name=hypothetical protein;locus_tag=BALIOE_01800;product=hypothetical protein;Parent=BALIOE_01800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 732 c1 Prodigal gene 387423 388286 . + . ID=BALIOE_01805_gene;locus_tag=BALIOE_01805 | |
| 733 c1 Prodigal CDS 387423 388286 . + 0 ID=BALIOE_01805;Name=hypothetical protein;locus_tag=BALIOE_01805;product=hypothetical protein;Parent=BALIOE_01805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 734 c1 Prodigal gene 388276 389823 . + . ID=BALIOE_01810_gene;locus_tag=BALIOE_01810 | |
| 735 c1 Prodigal CDS 388276 389823 . + 0 ID=BALIOE_01810;Name=hypothetical protein;locus_tag=BALIOE_01810;product=hypothetical protein;Parent=BALIOE_01810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 736 c1 Prodigal gene 389823 391241 . + . ID=BALIOE_01815_gene;locus_tag=BALIOE_01815 | |
| 737 c1 Prodigal CDS 389823 391241 . + 0 ID=BALIOE_01815;Name=hypothetical protein;locus_tag=BALIOE_01815;product=hypothetical protein;Parent=BALIOE_01815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 738 c1 Prodigal gene 391267 391587 . + . ID=BALIOE_01820_gene;locus_tag=BALIOE_01820 | |
| 739 c1 Prodigal CDS 391267 391587 . + 0 ID=BALIOE_01820;Name=hypothetical protein;locus_tag=BALIOE_01820;product=hypothetical protein;Parent=BALIOE_01820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 740 c1 Infernal gene 391309 391378 . - . ID=BALIOE_01825_gene;locus_tag=BALIOE_01825;gene=naRNA4 | |
| 741 c1 Infernal ncRNA 391309 391378 2.1e-11 - . ID=BALIOE_01825;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01825;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01825_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 742 c1 Infernal gene 391402 391471 . - . ID=BALIOE_01830_gene;locus_tag=BALIOE_01830;gene=naRNA4 | |
| 743 c1 Infernal ncRNA 391402 391471 4.2e-11 - . ID=BALIOE_01830;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01830;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01830_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 744 c1 Infernal gene 391495 391564 . - . ID=BALIOE_01835_gene;locus_tag=BALIOE_01835;gene=naRNA4 | |
| 745 c1 Infernal ncRNA 391495 391564 2.1e-11 - . ID=BALIOE_01835;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01835;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01835_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 746 c1 Infernal gene 391587 391656 . - . ID=BALIOE_01840_gene;locus_tag=BALIOE_01840;gene=naRNA4 | |
| 747 c1 Infernal ncRNA 391587 391656 2.1e-11 - . ID=BALIOE_01840;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01840;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01840_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 748 c1 Prodigal gene 391756 392706 . + . ID=BALIOE_01845_gene;locus_tag=BALIOE_01845 | |
| 749 c1 Prodigal CDS 391756 392706 . + 0 ID=BALIOE_01845;Name=hypothetical protein;locus_tag=BALIOE_01845;product=hypothetical protein;Parent=BALIOE_01845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 750 c1 Prodigal gene 392716 394098 . + . ID=BALIOE_01850_gene;locus_tag=BALIOE_01850 | |
| 751 c1 Prodigal CDS 392716 394098 . + 0 ID=BALIOE_01850;Name=hypothetical protein;locus_tag=BALIOE_01850;product=hypothetical protein;Parent=BALIOE_01850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 752 c1 Prodigal gene 394397 394807 . + . ID=BALIOE_01855_gene;locus_tag=BALIOE_01855 | |
| 753 c1 Prodigal CDS 394397 394807 . + 0 ID=BALIOE_01855;Name=hypothetical protein;locus_tag=BALIOE_01855;product=hypothetical protein;Parent=BALIOE_01855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 754 c1 Prodigal gene 395058 396044 . + . ID=BALIOE_01860_gene;locus_tag=BALIOE_01860 | |
| 755 c1 Prodigal CDS 395058 396044 . + 0 ID=BALIOE_01860;Name=hypothetical protein;locus_tag=BALIOE_01860;product=hypothetical protein;Parent=BALIOE_01860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 756 c1 Prodigal gene 396093 396353 . + . ID=BALIOE_01865_gene;locus_tag=BALIOE_01865 | |
| 757 c1 Prodigal CDS 396093 396353 . + 0 ID=BALIOE_01865;Name=hypothetical protein;locus_tag=BALIOE_01865;product=hypothetical protein;Parent=BALIOE_01865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 758 c1 Prodigal gene 396399 397577 . + . ID=BALIOE_01870_gene;locus_tag=BALIOE_01870 | |
| 759 c1 Prodigal CDS 396399 397577 . + 0 ID=BALIOE_01870;Name=hypothetical protein;locus_tag=BALIOE_01870;product=hypothetical protein;Parent=BALIOE_01870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 760 c1 Prodigal gene 397570 398541 . + . ID=BALIOE_01875_gene;locus_tag=BALIOE_01875 | |
| 761 c1 Prodigal CDS 397570 398541 . + 0 ID=BALIOE_01875;Name=hypothetical protein;locus_tag=BALIOE_01875;product=hypothetical protein;Parent=BALIOE_01875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 762 c1 Prodigal gene 398538 399494 . + . ID=BALIOE_01880_gene;locus_tag=BALIOE_01880 | |
| 763 c1 Prodigal CDS 398538 399494 . + 0 ID=BALIOE_01880;Name=hypothetical protein;locus_tag=BALIOE_01880;product=hypothetical protein;Parent=BALIOE_01880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 764 c1 Prodigal gene 399581 400630 . + . ID=BALIOE_01885_gene;locus_tag=BALIOE_01885 | |
| 765 c1 Prodigal CDS 399581 400630 . + 0 ID=BALIOE_01885;Name=hypothetical protein;locus_tag=BALIOE_01885;product=hypothetical protein;Parent=BALIOE_01885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 766 c1 Prodigal gene 400873 401688 . + . ID=BALIOE_01890_gene;locus_tag=BALIOE_01890 | |
| 767 c1 Prodigal CDS 400873 401688 . + 0 ID=BALIOE_01890;Name=hypothetical protein;locus_tag=BALIOE_01890;product=hypothetical protein;Parent=BALIOE_01890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 768 c1 Prodigal gene 402366 402998 . - . ID=BALIOE_01895_gene;locus_tag=BALIOE_01895 | |
| 769 c1 Prodigal CDS 402366 402998 . - 0 ID=BALIOE_01895;Name=hypothetical protein;locus_tag=BALIOE_01895;product=hypothetical protein;Parent=BALIOE_01895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 770 c1 Prodigal gene 403184 403459 . + . ID=BALIOE_01900_gene;locus_tag=BALIOE_01900 | |
| 771 c1 Prodigal CDS 403184 403459 . + 0 ID=BALIOE_01900;Name=hypothetical protein;locus_tag=BALIOE_01900;product=hypothetical protein;Parent=BALIOE_01900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 772 c1 Prodigal gene 403557 405143 . - . ID=BALIOE_01905_gene;locus_tag=BALIOE_01905 | |
| 773 c1 Prodigal CDS 403557 405143 . - 0 ID=BALIOE_01905;Name=hypothetical protein;locus_tag=BALIOE_01905;product=hypothetical protein;Parent=BALIOE_01905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 774 c1 Prodigal gene 405382 406272 . + . ID=BALIOE_01910_gene;locus_tag=BALIOE_01910 | |
| 775 c1 Prodigal CDS 405382 406272 . + 0 ID=BALIOE_01910;Name=hypothetical protein;locus_tag=BALIOE_01910;product=hypothetical protein;Parent=BALIOE_01910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 776 c1 Prodigal gene 406428 407597 . + . ID=BALIOE_01915_gene;locus_tag=BALIOE_01915 | |
| 777 c1 Prodigal CDS 406428 407597 . + 0 ID=BALIOE_01915;Name=hypothetical protein;locus_tag=BALIOE_01915;product=hypothetical protein;Parent=BALIOE_01915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 778 c1 Prodigal gene 407631 409082 . + . ID=BALIOE_01920_gene;locus_tag=BALIOE_01920 | |
| 779 c1 Prodigal CDS 407631 409082 . + 0 ID=BALIOE_01920;Name=hypothetical protein;locus_tag=BALIOE_01920;product=hypothetical protein;Parent=BALIOE_01920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 780 c1 Prodigal gene 409122 411008 . + . ID=BALIOE_01925_gene;locus_tag=BALIOE_01925 | |
| 781 c1 Prodigal CDS 409122 411008 . + 0 ID=BALIOE_01925;Name=hypothetical protein;locus_tag=BALIOE_01925;product=hypothetical protein;Parent=BALIOE_01925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 782 c1 Infernal gene 411107 411183 . + . ID=BALIOE_01930_gene;locus_tag=BALIOE_01930;gene=naRNA4 | |
| 783 c1 Infernal ncRNA 411107 411183 1.9e-09 + . ID=BALIOE_01930;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01930;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01930_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 784 c1 Infernal gene 411295 411371 . + . ID=BALIOE_01935_gene;locus_tag=BALIOE_01935;gene=naRNA4 | |
| 785 c1 Infernal ncRNA 411295 411371 3.7e-09 + . ID=BALIOE_01935;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01935;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01935_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 786 c1 Infernal gene 411389 411465 . + . ID=BALIOE_01940_gene;locus_tag=BALIOE_01940;gene=naRNA4 | |
| 787 c1 Infernal ncRNA 411389 411465 1.9e-09 + . ID=BALIOE_01940;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01940;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01940_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 788 c1 Infernal gene 411483 411558 . + . ID=BALIOE_01945_gene;locus_tag=BALIOE_01945;gene=naRNA4 | |
| 789 c1 Infernal ncRNA 411483 411558 2.9e-09 + . ID=BALIOE_01945;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01945;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01945_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 790 c1 Infernal gene 411576 411652 . + . ID=BALIOE_01950_gene;locus_tag=BALIOE_01950;gene=naRNA4 | |
| 791 c1 Infernal ncRNA 411576 411652 6.6e-10 + . ID=BALIOE_01950;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01950;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01950_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 792 c1 Infernal gene 411670 411746 . + . ID=BALIOE_01955_gene;locus_tag=BALIOE_01955;gene=naRNA4 | |
| 793 c1 Infernal ncRNA 411670 411746 7.3e-10 + . ID=BALIOE_01955;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_01955;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_01955_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 794 c1 Prodigal gene 411902 413161 . + . ID=BALIOE_01960_gene;locus_tag=BALIOE_01960 | |
| 795 c1 Prodigal CDS 411902 413161 . + 0 ID=BALIOE_01960;Name=hypothetical protein;locus_tag=BALIOE_01960;product=hypothetical protein;Parent=BALIOE_01960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 796 c1 Prodigal gene 413151 414434 . + . ID=BALIOE_01965_gene;locus_tag=BALIOE_01965 | |
| 797 c1 Prodigal CDS 413151 414434 . + 0 ID=BALIOE_01965;Name=hypothetical protein;locus_tag=BALIOE_01965;product=hypothetical protein;Parent=BALIOE_01965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 798 c1 Prodigal gene 414567 415466 . - . ID=BALIOE_01970_gene;locus_tag=BALIOE_01970 | |
| 799 c1 Prodigal CDS 414567 415466 . - 0 ID=BALIOE_01970;Name=hypothetical protein;locus_tag=BALIOE_01970;product=hypothetical protein;Parent=BALIOE_01970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 800 c1 Prodigal gene 415576 416235 . + . ID=BALIOE_01975_gene;locus_tag=BALIOE_01975 | |
| 801 c1 Prodigal CDS 415576 416235 . + 0 ID=BALIOE_01975;Name=hypothetical protein;locus_tag=BALIOE_01975;product=hypothetical protein;Parent=BALIOE_01975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 802 c1 Prodigal gene 416266 416736 . + . ID=BALIOE_01980_gene;locus_tag=BALIOE_01980 | |
| 803 c1 Prodigal CDS 416266 416736 . + 0 ID=BALIOE_01980;Name=hypothetical protein;locus_tag=BALIOE_01980;product=hypothetical protein;Parent=BALIOE_01980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 804 c1 Prodigal gene 416742 417923 . + . ID=BALIOE_01985_gene;locus_tag=BALIOE_01985 | |
| 805 c1 Prodigal CDS 416742 417923 . + 0 ID=BALIOE_01985;Name=hypothetical protein;locus_tag=BALIOE_01985;product=hypothetical protein;Parent=BALIOE_01985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 806 c1 Prodigal gene 418026 418637 . - . ID=BALIOE_01990_gene;locus_tag=BALIOE_01990 | |
| 807 c1 Prodigal CDS 418026 418637 . - 0 ID=BALIOE_01990;Name=hypothetical protein;locus_tag=BALIOE_01990;product=hypothetical protein;Parent=BALIOE_01990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 808 c1 Prodigal gene 418703 419956 . - . ID=BALIOE_01995_gene;locus_tag=BALIOE_01995 | |
| 809 c1 Prodigal CDS 418703 419956 . - 0 ID=BALIOE_01995;Name=hypothetical protein;locus_tag=BALIOE_01995;product=hypothetical protein;Parent=BALIOE_01995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 810 c1 Prodigal gene 420008 423082 . - . ID=BALIOE_02000_gene;locus_tag=BALIOE_02000 | |
| 811 c1 Prodigal CDS 420008 423082 . - 0 ID=BALIOE_02000;Name=hypothetical protein;locus_tag=BALIOE_02000;product=hypothetical protein;Parent=BALIOE_02000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 812 c1 Prodigal gene 423205 424296 . - . ID=BALIOE_02005_gene;locus_tag=BALIOE_02005 | |
| 813 c1 Prodigal CDS 423205 424296 . - 0 ID=BALIOE_02005;Name=hypothetical protein;locus_tag=BALIOE_02005;product=hypothetical protein;Parent=BALIOE_02005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 814 c1 Prodigal gene 424324 425277 . - . ID=BALIOE_02010_gene;locus_tag=BALIOE_02010 | |
| 815 c1 Prodigal CDS 424324 425277 . - 0 ID=BALIOE_02010;Name=hypothetical protein;locus_tag=BALIOE_02010;product=hypothetical protein;Parent=BALIOE_02010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 816 c1 Prodigal gene 425297 426073 . - . ID=BALIOE_02015_gene;locus_tag=BALIOE_02015 | |
| 817 c1 Prodigal CDS 425297 426073 . - 0 ID=BALIOE_02015;Name=hypothetical protein;locus_tag=BALIOE_02015;product=hypothetical protein;Parent=BALIOE_02015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 818 c1 Prodigal gene 426188 427135 . - . ID=BALIOE_02020_gene;locus_tag=BALIOE_02020 | |
| 819 c1 Prodigal CDS 426188 427135 . - 0 ID=BALIOE_02020;Name=hypothetical protein;locus_tag=BALIOE_02020;product=hypothetical protein;Parent=BALIOE_02020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 820 c1 Prodigal gene 427212 428876 . + . ID=BALIOE_02025_gene;locus_tag=BALIOE_02025 | |
| 821 c1 Prodigal CDS 427212 428876 . + 0 ID=BALIOE_02025;Name=hypothetical protein;locus_tag=BALIOE_02025;product=hypothetical protein;Parent=BALIOE_02025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 822 c1 Prodigal gene 428878 429822 . + . ID=BALIOE_02030_gene;locus_tag=BALIOE_02030 | |
| 823 c1 Prodigal CDS 428878 429822 . + 0 ID=BALIOE_02030;Name=hypothetical protein;locus_tag=BALIOE_02030;product=hypothetical protein;Parent=BALIOE_02030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 824 c1 Prodigal gene 429840 430706 . + . ID=BALIOE_02035_gene;locus_tag=BALIOE_02035 | |
| 825 c1 Prodigal CDS 429840 430706 . + 0 ID=BALIOE_02035;Name=hypothetical protein;locus_tag=BALIOE_02035;product=hypothetical protein;Parent=BALIOE_02035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 826 c1 Prodigal gene 430716 431525 . + . ID=BALIOE_02040_gene;locus_tag=BALIOE_02040 | |
| 827 c1 Prodigal CDS 430716 431525 . + 0 ID=BALIOE_02040;Name=hypothetical protein;locus_tag=BALIOE_02040;product=hypothetical protein;Parent=BALIOE_02040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 828 c1 Prodigal gene 431522 432472 . + . ID=BALIOE_02045_gene;locus_tag=BALIOE_02045 | |
| 829 c1 Prodigal CDS 431522 432472 . + 0 ID=BALIOE_02045;Name=hypothetical protein;locus_tag=BALIOE_02045;product=hypothetical protein;Parent=BALIOE_02045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 830 c1 Prodigal gene 432469 433482 . + . ID=BALIOE_02050_gene;locus_tag=BALIOE_02050 | |
| 831 c1 Prodigal CDS 432469 433482 . + 0 ID=BALIOE_02050;Name=hypothetical protein;locus_tag=BALIOE_02050;product=hypothetical protein;Parent=BALIOE_02050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 832 c1 Prodigal gene 433658 434869 . + . ID=BALIOE_02055_gene;locus_tag=BALIOE_02055 | |
| 833 c1 Prodigal CDS 433658 434869 . + 0 ID=BALIOE_02055;Name=hypothetical protein;locus_tag=BALIOE_02055;product=hypothetical protein;Parent=BALIOE_02055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 834 c1 Prodigal gene 434971 435510 . + . ID=BALIOE_02060_gene;locus_tag=BALIOE_02060 | |
| 835 c1 Prodigal CDS 434971 435510 . + 0 ID=BALIOE_02060;Name=hypothetical protein;locus_tag=BALIOE_02060;product=hypothetical protein;Parent=BALIOE_02060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 836 c1 Prodigal gene 435635 436468 . - . ID=BALIOE_02065_gene;locus_tag=BALIOE_02065 | |
| 837 c1 Prodigal CDS 435635 436468 . - 0 ID=BALIOE_02065;Name=hypothetical protein;locus_tag=BALIOE_02065;product=hypothetical protein;Parent=BALIOE_02065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 838 c1 Prodigal gene 436561 437670 . - . ID=BALIOE_02070_gene;locus_tag=BALIOE_02070 | |
| 839 c1 Prodigal CDS 436561 437670 . - 0 ID=BALIOE_02070;Name=hypothetical protein;locus_tag=BALIOE_02070;product=hypothetical protein;Parent=BALIOE_02070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 840 c1 Prodigal gene 437705 437980 . - . ID=BALIOE_02075_gene;locus_tag=BALIOE_02075 | |
| 841 c1 Prodigal CDS 437705 437980 . - 0 ID=BALIOE_02075;Name=hypothetical protein;locus_tag=BALIOE_02075;product=hypothetical protein;Parent=BALIOE_02075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 842 c1 Prodigal gene 438140 439186 . - . ID=BALIOE_02080_gene;locus_tag=BALIOE_02080 | |
| 843 c1 Prodigal CDS 438140 439186 . - 0 ID=BALIOE_02080;Name=hypothetical protein;locus_tag=BALIOE_02080;product=hypothetical protein;Parent=BALIOE_02080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 844 c1 Prodigal gene 439198 441276 . - . ID=BALIOE_02085_gene;locus_tag=BALIOE_02085 | |
| 845 c1 Prodigal CDS 439198 441276 . - 0 ID=BALIOE_02085;Name=hypothetical protein;locus_tag=BALIOE_02085;product=hypothetical protein;Parent=BALIOE_02085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 846 c1 Prodigal gene 441345 442376 . - . ID=BALIOE_02090_gene;locus_tag=BALIOE_02090 | |
| 847 c1 Prodigal CDS 441345 442376 . - 0 ID=BALIOE_02090;Name=hypothetical protein;locus_tag=BALIOE_02090;product=hypothetical protein;Parent=BALIOE_02090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 848 c1 Prodigal gene 442373 443677 . - . ID=BALIOE_02095_gene;locus_tag=BALIOE_02095 | |
| 849 c1 Prodigal CDS 442373 443677 . - 0 ID=BALIOE_02095;Name=hypothetical protein;locus_tag=BALIOE_02095;product=hypothetical protein;Parent=BALIOE_02095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 850 c1 Prodigal gene 443762 445303 . - . ID=BALIOE_02100_gene;locus_tag=BALIOE_02100 | |
| 851 c1 Prodigal CDS 443762 445303 . - 0 ID=BALIOE_02100;Name=hypothetical protein;locus_tag=BALIOE_02100;product=hypothetical protein;Parent=BALIOE_02100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 852 c1 Prodigal gene 445303 445932 . - . ID=BALIOE_02105_gene;locus_tag=BALIOE_02105 | |
| 853 c1 Prodigal CDS 445303 445932 . - 0 ID=BALIOE_02105;Name=hypothetical protein;locus_tag=BALIOE_02105;product=hypothetical protein;Parent=BALIOE_02105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 854 c1 Prodigal gene 446235 447197 . + . ID=BALIOE_02110_gene;locus_tag=BALIOE_02110 | |
| 855 c1 Prodigal CDS 446235 447197 . + 0 ID=BALIOE_02110;Name=hypothetical protein;locus_tag=BALIOE_02110;product=hypothetical protein;Parent=BALIOE_02110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 856 c1 Prodigal gene 447210 447977 . + . ID=BALIOE_02115_gene;locus_tag=BALIOE_02115 | |
| 857 c1 Prodigal CDS 447210 447977 . + 0 ID=BALIOE_02115;Name=hypothetical protein;locus_tag=BALIOE_02115;product=hypothetical protein;Parent=BALIOE_02115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 858 c1 Prodigal gene 447974 448801 . + . ID=BALIOE_02120_gene;locus_tag=BALIOE_02120 | |
| 859 c1 Prodigal CDS 447974 448801 . + 0 ID=BALIOE_02120;Name=hypothetical protein;locus_tag=BALIOE_02120;product=hypothetical protein;Parent=BALIOE_02120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 860 c1 Prodigal gene 448798 449649 . + . ID=BALIOE_02125_gene;locus_tag=BALIOE_02125 | |
| 861 c1 Prodigal CDS 448798 449649 . + 0 ID=BALIOE_02125;Name=hypothetical protein;locus_tag=BALIOE_02125;product=hypothetical protein;Parent=BALIOE_02125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 862 c1 Prodigal gene 449756 450730 . - . ID=BALIOE_02130_gene;locus_tag=BALIOE_02130 | |
| 863 c1 Prodigal CDS 449756 450730 . - 0 ID=BALIOE_02130;Name=hypothetical protein;locus_tag=BALIOE_02130;product=hypothetical protein;Parent=BALIOE_02130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 864 c1 Prodigal gene 451256 454198 . + . ID=BALIOE_02135_gene;locus_tag=BALIOE_02135 | |
| 865 c1 Prodigal CDS 451256 454198 . + 0 ID=BALIOE_02135;Name=hypothetical protein;locus_tag=BALIOE_02135;product=hypothetical protein;Parent=BALIOE_02135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 866 c1 Prodigal gene 454286 454909 . + . ID=BALIOE_02140_gene;locus_tag=BALIOE_02140 | |
| 867 c1 Prodigal CDS 454286 454909 . + 0 ID=BALIOE_02140;Name=hypothetical protein;locus_tag=BALIOE_02140;product=hypothetical protein;Parent=BALIOE_02140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 868 c1 Prodigal gene 454910 456067 . - . ID=BALIOE_02145_gene;locus_tag=BALIOE_02145 | |
| 869 c1 Prodigal CDS 454910 456067 . - 0 ID=BALIOE_02145;Name=hypothetical protein;locus_tag=BALIOE_02145;product=hypothetical protein;Parent=BALIOE_02145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 870 c1 Prodigal gene 456419 457639 . + . ID=BALIOE_02150_gene;locus_tag=BALIOE_02150 | |
| 871 c1 Prodigal CDS 456419 457639 . + 0 ID=BALIOE_02150;Name=hypothetical protein;locus_tag=BALIOE_02150;product=hypothetical protein;Parent=BALIOE_02150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 872 c1 Prodigal gene 457652 458746 . + . ID=BALIOE_02155_gene;locus_tag=BALIOE_02155 | |
| 873 c1 Prodigal CDS 457652 458746 . + 0 ID=BALIOE_02155;Name=hypothetical protein;locus_tag=BALIOE_02155;product=hypothetical protein;Parent=BALIOE_02155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 874 c1 Prodigal gene 458805 459113 . - . ID=BALIOE_02160_gene;locus_tag=BALIOE_02160 | |
| 875 c1 Prodigal CDS 458805 459113 . - 0 ID=BALIOE_02160;Name=hypothetical protein;locus_tag=BALIOE_02160;product=hypothetical protein;Parent=BALIOE_02160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 876 c1 Prodigal gene 459373 459585 . + . ID=BALIOE_02165_gene;locus_tag=BALIOE_02165 | |
| 877 c1 Prodigal CDS 459373 459585 . + 0 ID=BALIOE_02165;Name=hypothetical protein;locus_tag=BALIOE_02165;product=hypothetical protein;Parent=BALIOE_02165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 878 c1 Prodigal gene 459609 460703 . - . ID=BALIOE_02170_gene;locus_tag=BALIOE_02170 | |
| 879 c1 Prodigal CDS 459609 460703 . - 0 ID=BALIOE_02170;Name=hypothetical protein;locus_tag=BALIOE_02170;product=hypothetical protein;Parent=BALIOE_02170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 880 c1 Prodigal gene 461166 461426 . + . ID=BALIOE_02175_gene;locus_tag=BALIOE_02175 | |
| 881 c1 Prodigal CDS 461166 461426 . + 0 ID=BALIOE_02175;Name=hypothetical protein;locus_tag=BALIOE_02175;product=hypothetical protein;Parent=BALIOE_02175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 882 c1 Prodigal gene 461527 462942 . + . ID=BALIOE_02180_gene;locus_tag=BALIOE_02180 | |
| 883 c1 Prodigal CDS 461527 462942 . + 0 ID=BALIOE_02180;Name=hypothetical protein;locus_tag=BALIOE_02180;product=hypothetical protein;Parent=BALIOE_02180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 884 c1 Prodigal gene 463061 463381 . + . ID=BALIOE_02185_gene;locus_tag=BALIOE_02185 | |
| 885 c1 Prodigal CDS 463061 463381 . + 0 ID=BALIOE_02185;Name=hypothetical protein;locus_tag=BALIOE_02185;product=hypothetical protein;Parent=BALIOE_02185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 886 c1 Prodigal gene 463483 464598 . + . ID=BALIOE_02190_gene;locus_tag=BALIOE_02190 | |
| 887 c1 Prodigal CDS 463483 464598 . + 0 ID=BALIOE_02190;Name=hypothetical protein;locus_tag=BALIOE_02190;product=hypothetical protein;Parent=BALIOE_02190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 888 c1 Prodigal gene 464615 465424 . - . ID=BALIOE_02195_gene;locus_tag=BALIOE_02195 | |
| 889 c1 Prodigal CDS 464615 465424 . - 0 ID=BALIOE_02195;Name=hypothetical protein;locus_tag=BALIOE_02195;product=hypothetical protein;Parent=BALIOE_02195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 890 c1 Prodigal gene 465544 466002 . + . ID=BALIOE_02200_gene;locus_tag=BALIOE_02200 | |
| 891 c1 Prodigal CDS 465544 466002 . + 0 ID=BALIOE_02200;Name=hypothetical protein;locus_tag=BALIOE_02200;product=hypothetical protein;Parent=BALIOE_02200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 892 c1 Prodigal gene 466185 466709 . + . ID=BALIOE_02205_gene;locus_tag=BALIOE_02205 | |
| 893 c1 Prodigal CDS 466185 466709 . + 0 ID=BALIOE_02205;Name=hypothetical protein;locus_tag=BALIOE_02205;product=hypothetical protein;Parent=BALIOE_02205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 894 c1 Prodigal gene 466759 466950 . + . ID=BALIOE_02210_gene;locus_tag=BALIOE_02210 | |
| 895 c1 Prodigal CDS 466759 466950 . + 0 ID=BALIOE_02210;Name=hypothetical protein;locus_tag=BALIOE_02210;product=hypothetical protein;Parent=BALIOE_02210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 896 c1 Prodigal gene 467208 467885 . + . ID=BALIOE_02215_gene;locus_tag=BALIOE_02215 | |
| 897 c1 Prodigal CDS 467208 467885 . + 0 ID=BALIOE_02215;Name=hypothetical protein;locus_tag=BALIOE_02215;product=hypothetical protein;Parent=BALIOE_02215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 898 c1 Prodigal gene 467957 468241 . + . ID=BALIOE_02220_gene;locus_tag=BALIOE_02220 | |
| 899 c1 Prodigal CDS 467957 468241 . + 0 ID=BALIOE_02220;Name=hypothetical protein;locus_tag=BALIOE_02220;product=hypothetical protein;Parent=BALIOE_02220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 900 c1 Prodigal gene 468385 470664 . + . ID=BALIOE_02225_gene;locus_tag=BALIOE_02225 | |
| 901 c1 Prodigal CDS 468385 470664 . + 0 ID=BALIOE_02225;Name=hypothetical protein;locus_tag=BALIOE_02225;product=hypothetical protein;Parent=BALIOE_02225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 902 c1 Prodigal gene 470661 471110 . + . ID=BALIOE_02230_gene;locus_tag=BALIOE_02230 | |
| 903 c1 Prodigal CDS 470661 471110 . + 0 ID=BALIOE_02230;Name=hypothetical protein;locus_tag=BALIOE_02230;product=hypothetical protein;Parent=BALIOE_02230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 904 c1 Prodigal gene 471195 472172 . - . ID=BALIOE_02235_gene;locus_tag=BALIOE_02235 | |
| 905 c1 Prodigal CDS 471195 472172 . - 0 ID=BALIOE_02235;Name=hypothetical protein;locus_tag=BALIOE_02235;product=hypothetical protein;Parent=BALIOE_02235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 906 c1 Prodigal gene 472231 473139 . + . ID=BALIOE_02240_gene;locus_tag=BALIOE_02240 | |
| 907 c1 Prodigal CDS 472231 473139 . + 0 ID=BALIOE_02240;Name=hypothetical protein;locus_tag=BALIOE_02240;product=hypothetical protein;Parent=BALIOE_02240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 908 c1 Prodigal gene 473282 474550 . - . ID=BALIOE_02245_gene;locus_tag=BALIOE_02245 | |
| 909 c1 Prodigal CDS 473282 474550 . - 0 ID=BALIOE_02245;Name=hypothetical protein;locus_tag=BALIOE_02245;product=hypothetical protein;Parent=BALIOE_02245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 910 c1 Prodigal gene 474592 477735 . - . ID=BALIOE_02250_gene;locus_tag=BALIOE_02250 | |
| 911 c1 Prodigal CDS 474592 477735 . - 0 ID=BALIOE_02250;Name=hypothetical protein;locus_tag=BALIOE_02250;product=hypothetical protein;Parent=BALIOE_02250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 912 c1 Prodigal gene 477732 478934 . - . ID=BALIOE_02255_gene;locus_tag=BALIOE_02255 | |
| 913 c1 Prodigal CDS 477732 478934 . - 0 ID=BALIOE_02255;Name=hypothetical protein;locus_tag=BALIOE_02255;product=hypothetical protein;Parent=BALIOE_02255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 914 c1 Prodigal gene 479124 479813 . + . ID=BALIOE_02260_gene;locus_tag=BALIOE_02260 | |
| 915 c1 Prodigal CDS 479124 479813 . + 0 ID=BALIOE_02260;Name=hypothetical protein;locus_tag=BALIOE_02260;product=hypothetical protein;Parent=BALIOE_02260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 916 c1 Prodigal gene 479871 481166 . + . ID=BALIOE_02265_gene;locus_tag=BALIOE_02265 | |
| 917 c1 Prodigal CDS 479871 481166 . + 0 ID=BALIOE_02265;Name=hypothetical protein;locus_tag=BALIOE_02265;product=hypothetical protein;Parent=BALIOE_02265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 918 c1 Prodigal gene 481573 482892 . + . ID=BALIOE_02270_gene;locus_tag=BALIOE_02270 | |
| 919 c1 Prodigal CDS 481573 482892 . + 0 ID=BALIOE_02270;Name=hypothetical protein;locus_tag=BALIOE_02270;product=hypothetical protein;Parent=BALIOE_02270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 920 c1 Prodigal gene 482968 484341 . + . ID=BALIOE_02275_gene;locus_tag=BALIOE_02275 | |
| 921 c1 Prodigal CDS 482968 484341 . + 0 ID=BALIOE_02275;Name=hypothetical protein;locus_tag=BALIOE_02275;product=hypothetical protein;Parent=BALIOE_02275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 922 c1 Prodigal gene 484497 486314 . + . ID=BALIOE_02280_gene;locus_tag=BALIOE_02280 | |
| 923 c1 Prodigal CDS 484497 486314 . + 0 ID=BALIOE_02280;Name=hypothetical protein;locus_tag=BALIOE_02280;product=hypothetical protein;Parent=BALIOE_02280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 924 c1 Prodigal gene 486502 487947 . + . ID=BALIOE_02285_gene;locus_tag=BALIOE_02285 | |
| 925 c1 Prodigal CDS 486502 487947 . + 0 ID=BALIOE_02285;Name=hypothetical protein;locus_tag=BALIOE_02285;product=hypothetical protein;Parent=BALIOE_02285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 926 c1 Prodigal gene 487968 488549 . - . ID=BALIOE_02290_gene;locus_tag=BALIOE_02290 | |
| 927 c1 Prodigal CDS 487968 488549 . - 0 ID=BALIOE_02290;Name=hypothetical protein;locus_tag=BALIOE_02290;product=hypothetical protein;Parent=BALIOE_02290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 928 c1 Prodigal gene 488642 489712 . + . ID=BALIOE_02295_gene;locus_tag=BALIOE_02295 | |
| 929 c1 Prodigal CDS 488642 489712 . + 0 ID=BALIOE_02295;Name=hypothetical protein;locus_tag=BALIOE_02295;product=hypothetical protein;Parent=BALIOE_02295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 930 c1 Prodigal gene 489767 490894 . + . ID=BALIOE_02300_gene;locus_tag=BALIOE_02300 | |
| 931 c1 Prodigal CDS 489767 490894 . + 0 ID=BALIOE_02300;Name=hypothetical protein;locus_tag=BALIOE_02300;product=hypothetical protein;Parent=BALIOE_02300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 932 c1 Prodigal gene 490917 491249 . + . ID=BALIOE_02305_gene;locus_tag=BALIOE_02305 | |
| 933 c1 Prodigal CDS 490917 491249 . + 0 ID=BALIOE_02305;Name=hypothetical protein;locus_tag=BALIOE_02305;product=hypothetical protein;Parent=BALIOE_02305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 934 c1 Prodigal gene 491310 493124 . + . ID=BALIOE_02310_gene;locus_tag=BALIOE_02310 | |
| 935 c1 Prodigal CDS 491310 493124 . + 0 ID=BALIOE_02310;Name=hypothetical protein;locus_tag=BALIOE_02310;product=hypothetical protein;Parent=BALIOE_02310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 936 c1 Prodigal gene 493135 494106 . + . ID=BALIOE_02315_gene;locus_tag=BALIOE_02315 | |
| 937 c1 Prodigal CDS 493135 494106 . + 0 ID=BALIOE_02315;Name=hypothetical protein;locus_tag=BALIOE_02315;product=hypothetical protein;Parent=BALIOE_02315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 938 c1 Prodigal gene 494257 494499 . + . ID=BALIOE_02320_gene;locus_tag=BALIOE_02320 | |
| 939 c1 Prodigal CDS 494257 494499 . + 0 ID=BALIOE_02320;Name=hypothetical protein;locus_tag=BALIOE_02320;product=hypothetical protein;Parent=BALIOE_02320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 940 c1 Prodigal gene 494492 494773 . + . ID=BALIOE_02325_gene;locus_tag=BALIOE_02325 | |
| 941 c1 Prodigal CDS 494492 494773 . + 0 ID=BALIOE_02325;Name=hypothetical protein;locus_tag=BALIOE_02325;product=hypothetical protein;Parent=BALIOE_02325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 942 c1 Prodigal gene 494861 495208 . + . ID=BALIOE_02330_gene;locus_tag=BALIOE_02330 | |
| 943 c1 Prodigal CDS 494861 495208 . + 0 ID=BALIOE_02330;Name=hypothetical protein;locus_tag=BALIOE_02330;product=hypothetical protein;Parent=BALIOE_02330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 944 c1 Prodigal gene 495385 496269 . - . ID=BALIOE_02335_gene;locus_tag=BALIOE_02335 | |
| 945 c1 Prodigal CDS 495385 496269 . - 0 ID=BALIOE_02335;Name=hypothetical protein;locus_tag=BALIOE_02335;product=hypothetical protein;Parent=BALIOE_02335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 946 c1 Prodigal gene 496568 497107 . - . ID=BALIOE_02340_gene;locus_tag=BALIOE_02340 | |
| 947 c1 Prodigal CDS 496568 497107 . - 0 ID=BALIOE_02340;Name=hypothetical protein;locus_tag=BALIOE_02340;product=hypothetical protein;Parent=BALIOE_02340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 948 c1 Prodigal gene 497258 497707 . + . ID=BALIOE_02345_gene;locus_tag=BALIOE_02345 | |
| 949 c1 Prodigal CDS 497258 497707 . + 0 ID=BALIOE_02345;Name=hypothetical protein;locus_tag=BALIOE_02345;product=hypothetical protein;Parent=BALIOE_02345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 950 c1 Prodigal gene 497711 498814 . + . ID=BALIOE_02350_gene;locus_tag=BALIOE_02350 | |
| 951 c1 Prodigal CDS 497711 498814 . + 0 ID=BALIOE_02350;Name=hypothetical protein;locus_tag=BALIOE_02350;product=hypothetical protein;Parent=BALIOE_02350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 952 c1 Prodigal gene 498903 499373 . + . ID=BALIOE_02355_gene;locus_tag=BALIOE_02355 | |
| 953 c1 Prodigal CDS 498903 499373 . + 0 ID=BALIOE_02355;Name=hypothetical protein;locus_tag=BALIOE_02355;product=hypothetical protein;Parent=BALIOE_02355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 954 c1 Prodigal gene 499393 499812 . + . ID=BALIOE_02360_gene;locus_tag=BALIOE_02360 | |
| 955 c1 Prodigal CDS 499393 499812 . + 0 ID=BALIOE_02360;Name=hypothetical protein;locus_tag=BALIOE_02360;product=hypothetical protein;Parent=BALIOE_02360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 956 c1 Prodigal gene 499890 500867 . + . ID=BALIOE_02365_gene;locus_tag=BALIOE_02365 | |
| 957 c1 Prodigal CDS 499890 500867 . + 0 ID=BALIOE_02365;Name=hypothetical protein;locus_tag=BALIOE_02365;product=hypothetical protein;Parent=BALIOE_02365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 958 c1 Prodigal gene 500845 501360 . + . ID=BALIOE_02370_gene;locus_tag=BALIOE_02370 | |
| 959 c1 Prodigal CDS 500845 501360 . + 0 ID=BALIOE_02370;Name=hypothetical protein;locus_tag=BALIOE_02370;product=hypothetical protein;Parent=BALIOE_02370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 960 c1 Prodigal gene 501538 503109 . - . ID=BALIOE_02375_gene;locus_tag=BALIOE_02375 | |
| 961 c1 Prodigal CDS 501538 503109 . - 0 ID=BALIOE_02375;Name=hypothetical protein;locus_tag=BALIOE_02375;product=hypothetical protein;Parent=BALIOE_02375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 962 c1 Prodigal gene 503340 504314 . - . ID=BALIOE_02380_gene;locus_tag=BALIOE_02380 | |
| 963 c1 Prodigal CDS 503340 504314 . - 0 ID=BALIOE_02380;Name=hypothetical protein;locus_tag=BALIOE_02380;product=hypothetical protein;Parent=BALIOE_02380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 964 c1 Prodigal gene 504369 506231 . - . ID=BALIOE_02385_gene;locus_tag=BALIOE_02385 | |
| 965 c1 Prodigal CDS 504369 506231 . - 0 ID=BALIOE_02385;Name=hypothetical protein;locus_tag=BALIOE_02385;product=hypothetical protein;Parent=BALIOE_02385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 966 c1 Prodigal gene 506256 507155 . - . ID=BALIOE_02390_gene;locus_tag=BALIOE_02390 | |
| 967 c1 Prodigal CDS 506256 507155 . - 0 ID=BALIOE_02390;Name=hypothetical protein;locus_tag=BALIOE_02390;product=hypothetical protein;Parent=BALIOE_02390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 968 c1 Prodigal gene 507155 507397 . - . ID=BALIOE_02395_gene;locus_tag=BALIOE_02395 | |
| 969 c1 Prodigal CDS 507155 507397 . - 0 ID=BALIOE_02395;Name=hypothetical protein;locus_tag=BALIOE_02395;product=hypothetical protein;Parent=BALIOE_02395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 970 c1 Prodigal gene 507603 509051 . + . ID=BALIOE_02400_gene;locus_tag=BALIOE_02400 | |
| 971 c1 Prodigal CDS 507603 509051 . + 0 ID=BALIOE_02400;Name=hypothetical protein;locus_tag=BALIOE_02400;product=hypothetical protein;Parent=BALIOE_02400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 972 c1 Prodigal gene 509105 509695 . - . ID=BALIOE_02405_gene;locus_tag=BALIOE_02405 | |
| 973 c1 Prodigal CDS 509105 509695 . - 0 ID=BALIOE_02405;Name=hypothetical protein;locus_tag=BALIOE_02405;product=hypothetical protein;Parent=BALIOE_02405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 974 c1 Prodigal gene 509658 510569 . - . ID=BALIOE_02410_gene;locus_tag=BALIOE_02410 | |
| 975 c1 Prodigal CDS 509658 510569 . - 0 ID=BALIOE_02410;Name=hypothetical protein;locus_tag=BALIOE_02410;product=hypothetical protein;Parent=BALIOE_02410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 976 c1 Prodigal gene 510737 511228 . + . ID=BALIOE_02415_gene;locus_tag=BALIOE_02415 | |
| 977 c1 Prodigal CDS 510737 511228 . + 0 ID=BALIOE_02415;Name=hypothetical protein;locus_tag=BALIOE_02415;product=hypothetical protein;Parent=BALIOE_02415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 978 c1 Prodigal gene 511356 512720 . - . ID=BALIOE_02420_gene;locus_tag=BALIOE_02420 | |
| 979 c1 Prodigal CDS 511356 512720 . - 0 ID=BALIOE_02420;Name=hypothetical protein;locus_tag=BALIOE_02420;product=hypothetical protein;Parent=BALIOE_02420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 980 c1 Prodigal gene 512869 513759 . - . ID=BALIOE_02425_gene;locus_tag=BALIOE_02425 | |
| 981 c1 Prodigal CDS 512869 513759 . - 0 ID=BALIOE_02425;Name=hypothetical protein;locus_tag=BALIOE_02425;product=hypothetical protein;Parent=BALIOE_02425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 982 c1 Prodigal gene 513771 514100 . - . ID=BALIOE_02430_gene;locus_tag=BALIOE_02430 | |
| 983 c1 Prodigal CDS 513771 514100 . - 0 ID=BALIOE_02430;Name=hypothetical protein;locus_tag=BALIOE_02430;product=hypothetical protein;Parent=BALIOE_02430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 984 c1 Prodigal gene 514100 514714 . - . ID=BALIOE_02435_gene;locus_tag=BALIOE_02435 | |
| 985 c1 Prodigal CDS 514100 514714 . - 0 ID=BALIOE_02435;Name=hypothetical protein;locus_tag=BALIOE_02435;product=hypothetical protein;Parent=BALIOE_02435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 986 c1 Prodigal gene 514704 516695 . - . ID=BALIOE_02440_gene;locus_tag=BALIOE_02440 | |
| 987 c1 Prodigal CDS 514704 516695 . - 0 ID=BALIOE_02440;Name=hypothetical protein;locus_tag=BALIOE_02440;product=hypothetical protein;Parent=BALIOE_02440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 988 c1 Prodigal gene 516717 517664 . - . ID=BALIOE_02445_gene;locus_tag=BALIOE_02445 | |
| 989 c1 Prodigal CDS 516717 517664 . - 0 ID=BALIOE_02445;Name=hypothetical protein;locus_tag=BALIOE_02445;product=hypothetical protein;Parent=BALIOE_02445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 990 c1 Prodigal gene 518124 519599 . - . ID=BALIOE_02450_gene;locus_tag=BALIOE_02450 | |
| 991 c1 Prodigal CDS 518124 519599 . - 0 ID=BALIOE_02450;Name=hypothetical protein;locus_tag=BALIOE_02450;product=hypothetical protein;Parent=BALIOE_02450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 992 c1 Prodigal gene 519643 520221 . - . ID=BALIOE_02455_gene;locus_tag=BALIOE_02455 | |
| 993 c1 Prodigal CDS 519643 520221 . - 0 ID=BALIOE_02455;Name=hypothetical protein;locus_tag=BALIOE_02455;product=hypothetical protein;Parent=BALIOE_02455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 994 c1 Prodigal gene 520529 520843 . + . ID=BALIOE_02460_gene;locus_tag=BALIOE_02460 | |
| 995 c1 Prodigal CDS 520529 520843 . + 0 ID=BALIOE_02460;Name=hypothetical protein;locus_tag=BALIOE_02460;product=hypothetical protein;Parent=BALIOE_02460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 996 c1 Prodigal gene 521187 522485 . + . ID=BALIOE_02465_gene;locus_tag=BALIOE_02465 | |
| 997 c1 Prodigal CDS 521187 522485 . + 0 ID=BALIOE_02465;Name=hypothetical protein;locus_tag=BALIOE_02465;product=hypothetical protein;Parent=BALIOE_02465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 998 c1 Prodigal gene 522730 523353 . + . ID=BALIOE_02470_gene;locus_tag=BALIOE_02470 | |
| 999 c1 Prodigal CDS 522730 523353 . + 0 ID=BALIOE_02470;Name=hypothetical protein;locus_tag=BALIOE_02470;product=hypothetical protein;Parent=BALIOE_02470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1000 c1 Prodigal gene 523479 524753 . + . ID=BALIOE_02475_gene;locus_tag=BALIOE_02475 | |
| 1001 c1 Prodigal CDS 523479 524753 . + 0 ID=BALIOE_02475;Name=hypothetical protein;locus_tag=BALIOE_02475;product=hypothetical protein;Parent=BALIOE_02475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1002 c1 Prodigal gene 524941 527295 . + . ID=BALIOE_02480_gene;locus_tag=BALIOE_02480 | |
| 1003 c1 Prodigal CDS 524941 527295 . + 0 ID=BALIOE_02480;Name=hypothetical protein;locus_tag=BALIOE_02480;product=hypothetical protein;Parent=BALIOE_02480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1004 c1 Prodigal gene 527504 527776 . + . ID=BALIOE_02485_gene;locus_tag=BALIOE_02485 | |
| 1005 c1 Prodigal CDS 527504 527776 . + 0 ID=BALIOE_02485;Name=hypothetical protein;locus_tag=BALIOE_02485;product=hypothetical protein;Parent=BALIOE_02485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1006 c1 Prodigal gene 527968 529839 . + . ID=BALIOE_02490_gene;locus_tag=BALIOE_02490 | |
| 1007 c1 Prodigal CDS 527968 529839 . + 0 ID=BALIOE_02490;Name=hypothetical protein;locus_tag=BALIOE_02490;product=hypothetical protein;Parent=BALIOE_02490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1008 c1 Prodigal gene 529990 530361 . + . ID=BALIOE_02495_gene;locus_tag=BALIOE_02495 | |
| 1009 c1 Prodigal CDS 529990 530361 . + 0 ID=BALIOE_02495;Name=hypothetical protein;locus_tag=BALIOE_02495;product=hypothetical protein;Parent=BALIOE_02495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1010 c1 Prodigal gene 530467 530865 . + . ID=BALIOE_02500_gene;locus_tag=BALIOE_02500 | |
| 1011 c1 Prodigal CDS 530467 530865 . + 0 ID=BALIOE_02500;Name=hypothetical protein;locus_tag=BALIOE_02500;product=hypothetical protein;Parent=BALIOE_02500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1012 c1 Prodigal gene 530917 531612 . - . ID=BALIOE_02505_gene;locus_tag=BALIOE_02505 | |
| 1013 c1 Prodigal CDS 530917 531612 . - 0 ID=BALIOE_02505;Name=hypothetical protein;locus_tag=BALIOE_02505;product=hypothetical protein;Parent=BALIOE_02505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1014 c1 Prodigal gene 531677 533377 . - . ID=BALIOE_02510_gene;locus_tag=BALIOE_02510 | |
| 1015 c1 Prodigal CDS 531677 533377 . - 0 ID=BALIOE_02510;Name=hypothetical protein;locus_tag=BALIOE_02510;product=hypothetical protein;Parent=BALIOE_02510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1016 c1 Prodigal gene 533477 534295 . + . ID=BALIOE_02515_gene;locus_tag=BALIOE_02515 | |
| 1017 c1 Prodigal CDS 533477 534295 . + 0 ID=BALIOE_02515;Name=hypothetical protein;locus_tag=BALIOE_02515;product=hypothetical protein;Parent=BALIOE_02515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1018 c1 Prodigal gene 534447 534905 . + . ID=BALIOE_02520_gene;locus_tag=BALIOE_02520 | |
| 1019 c1 Prodigal CDS 534447 534905 . + 0 ID=BALIOE_02520;Name=hypothetical protein;locus_tag=BALIOE_02520;product=hypothetical protein;Parent=BALIOE_02520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1020 c1 Prodigal gene 534935 536707 . + . ID=BALIOE_02525_gene;locus_tag=BALIOE_02525 | |
| 1021 c1 Prodigal CDS 534935 536707 . + 0 ID=BALIOE_02525;Name=hypothetical protein;locus_tag=BALIOE_02525;product=hypothetical protein;Parent=BALIOE_02525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1022 c1 Prodigal gene 536700 538481 . + . ID=BALIOE_02530_gene;locus_tag=BALIOE_02530 | |
| 1023 c1 Prodigal CDS 536700 538481 . + 0 ID=BALIOE_02530;Name=hypothetical protein;locus_tag=BALIOE_02530;product=hypothetical protein;Parent=BALIOE_02530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1024 c1 Prodigal gene 538662 539000 . + . ID=BALIOE_02535_gene;locus_tag=BALIOE_02535 | |
| 1025 c1 Prodigal CDS 538662 539000 . + 0 ID=BALIOE_02535;Name=hypothetical protein;locus_tag=BALIOE_02535;product=hypothetical protein;Parent=BALIOE_02535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1026 c1 Prodigal gene 539030 540316 . + . ID=BALIOE_02540_gene;locus_tag=BALIOE_02540 | |
| 1027 c1 Prodigal CDS 539030 540316 . + 0 ID=BALIOE_02540;Name=hypothetical protein;locus_tag=BALIOE_02540;product=hypothetical protein;Parent=BALIOE_02540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1028 c1 Prodigal gene 540365 541225 . - . ID=BALIOE_02545_gene;locus_tag=BALIOE_02545 | |
| 1029 c1 Prodigal CDS 540365 541225 . - 0 ID=BALIOE_02545;Name=hypothetical protein;locus_tag=BALIOE_02545;product=hypothetical protein;Parent=BALIOE_02545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1030 c1 Prodigal gene 541443 542015 . + . ID=BALIOE_02550_gene;locus_tag=BALIOE_02550 | |
| 1031 c1 Prodigal CDS 541443 542015 . + 0 ID=BALIOE_02550;Name=hypothetical protein;locus_tag=BALIOE_02550;product=hypothetical protein;Parent=BALIOE_02550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1032 c1 Prodigal gene 542048 542359 . - . ID=BALIOE_02555_gene;locus_tag=BALIOE_02555 | |
| 1033 c1 Prodigal CDS 542048 542359 . - 0 ID=BALIOE_02555;Name=hypothetical protein;locus_tag=BALIOE_02555;product=hypothetical protein;Parent=BALIOE_02555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1034 c1 Prodigal gene 542738 543091 . + . ID=BALIOE_02560_gene;locus_tag=BALIOE_02560 | |
| 1035 c1 Prodigal CDS 542738 543091 . + 0 ID=BALIOE_02560;Name=hypothetical protein;locus_tag=BALIOE_02560;product=hypothetical protein;Parent=BALIOE_02560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1036 c1 Prodigal gene 543133 544683 . - . ID=BALIOE_02565_gene;locus_tag=BALIOE_02565 | |
| 1037 c1 Prodigal CDS 543133 544683 . - 0 ID=BALIOE_02565;Name=hypothetical protein;locus_tag=BALIOE_02565;product=hypothetical protein;Parent=BALIOE_02565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1038 c1 Prodigal gene 544847 545317 . - . ID=BALIOE_02570_gene;locus_tag=BALIOE_02570 | |
| 1039 c1 Prodigal CDS 544847 545317 . - 0 ID=BALIOE_02570;Name=hypothetical protein;locus_tag=BALIOE_02570;product=hypothetical protein;Parent=BALIOE_02570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1040 c1 Prodigal gene 545433 545984 . - . ID=BALIOE_02575_gene;locus_tag=BALIOE_02575 | |
| 1041 c1 Prodigal CDS 545433 545984 . - 0 ID=BALIOE_02575;Name=hypothetical protein;locus_tag=BALIOE_02575;product=hypothetical protein;Parent=BALIOE_02575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1042 c1 Prodigal gene 546156 546374 . - . ID=BALIOE_02580_gene;locus_tag=BALIOE_02580 | |
| 1043 c1 Prodigal CDS 546156 546374 . - 0 ID=BALIOE_02580;Name=hypothetical protein;locus_tag=BALIOE_02580;product=hypothetical protein;Parent=BALIOE_02580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1044 c1 Prodigal gene 546400 546774 . - . ID=BALIOE_02585_gene;locus_tag=BALIOE_02585 | |
| 1045 c1 Prodigal CDS 546400 546774 . - 0 ID=BALIOE_02585;Name=hypothetical protein;locus_tag=BALIOE_02585;product=hypothetical protein;Parent=BALIOE_02585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1046 c1 Prodigal gene 547320 550469 . - . ID=BALIOE_02590_gene;locus_tag=BALIOE_02590 | |
| 1047 c1 Prodigal CDS 547320 550469 . - 0 ID=BALIOE_02590;Name=hypothetical protein;locus_tag=BALIOE_02590;product=hypothetical protein;Parent=BALIOE_02590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1048 c1 Prodigal gene 550492 551685 . - . ID=BALIOE_02595_gene;locus_tag=BALIOE_02595 | |
| 1049 c1 Prodigal CDS 550492 551685 . - 0 ID=BALIOE_02595;Name=hypothetical protein;locus_tag=BALIOE_02595;product=hypothetical protein;Parent=BALIOE_02595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1050 c1 Prodigal gene 551827 552474 . + . ID=BALIOE_02600_gene;locus_tag=BALIOE_02600 | |
| 1051 c1 Prodigal CDS 551827 552474 . + 0 ID=BALIOE_02600;Name=hypothetical protein;locus_tag=BALIOE_02600;product=hypothetical protein;Parent=BALIOE_02600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1052 c1 Prodigal gene 552602 555964 . + . ID=BALIOE_02605_gene;locus_tag=BALIOE_02605 | |
| 1053 c1 Prodigal CDS 552602 555964 . + 0 ID=BALIOE_02605;Name=hypothetical protein;locus_tag=BALIOE_02605;product=hypothetical protein;Parent=BALIOE_02605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1054 c1 Prodigal gene 556003 556167 . - . ID=BALIOE_02610_gene;locus_tag=BALIOE_02610 | |
| 1055 c1 Prodigal CDS 556003 556167 . - 0 ID=BALIOE_02610;Name=hypothetical protein;locus_tag=BALIOE_02610;product=hypothetical protein;Parent=BALIOE_02610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1056 c1 Prodigal gene 556181 556708 . - . ID=BALIOE_02615_gene;locus_tag=BALIOE_02615 | |
| 1057 c1 Prodigal CDS 556181 556708 . - 0 ID=BALIOE_02615;Name=hypothetical protein;locus_tag=BALIOE_02615;product=hypothetical protein;Parent=BALIOE_02615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1058 c1 Prodigal gene 556778 557155 . + . ID=BALIOE_02620_gene;locus_tag=BALIOE_02620 | |
| 1059 c1 Prodigal CDS 556778 557155 . + 0 ID=BALIOE_02620;Name=hypothetical protein;locus_tag=BALIOE_02620;product=hypothetical protein;Parent=BALIOE_02620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1060 c1 Prodigal gene 557308 557859 . + . ID=BALIOE_02625_gene;locus_tag=BALIOE_02625 | |
| 1061 c1 Prodigal CDS 557308 557859 . + 0 ID=BALIOE_02625;Name=hypothetical protein;locus_tag=BALIOE_02625;product=hypothetical protein;Parent=BALIOE_02625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1062 c1 Prodigal gene 557988 559919 . + . ID=BALIOE_02630_gene;locus_tag=BALIOE_02630 | |
| 1063 c1 Prodigal CDS 557988 559919 . + 0 ID=BALIOE_02630;Name=hypothetical protein;locus_tag=BALIOE_02630;product=hypothetical protein;Parent=BALIOE_02630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1064 c1 Prodigal gene 559972 560301 . + . ID=BALIOE_02635_gene;locus_tag=BALIOE_02635 | |
| 1065 c1 Prodigal CDS 559972 560301 . + 0 ID=BALIOE_02635;Name=hypothetical protein;locus_tag=BALIOE_02635;product=hypothetical protein;Parent=BALIOE_02635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1066 c1 Prodigal gene 560301 560906 . + . ID=BALIOE_02640_gene;locus_tag=BALIOE_02640 | |
| 1067 c1 Prodigal CDS 560301 560906 . + 0 ID=BALIOE_02640;Name=hypothetical protein;locus_tag=BALIOE_02640;product=hypothetical protein;Parent=BALIOE_02640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1068 c1 Prodigal gene 561016 562890 . + . ID=BALIOE_02645_gene;locus_tag=BALIOE_02645 | |
| 1069 c1 Prodigal CDS 561016 562890 . + 0 ID=BALIOE_02645;Name=hypothetical protein;locus_tag=BALIOE_02645;product=hypothetical protein;Parent=BALIOE_02645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1070 c1 Prodigal gene 563011 563715 . + . ID=BALIOE_02650_gene;locus_tag=BALIOE_02650 | |
| 1071 c1 Prodigal CDS 563011 563715 . + 0 ID=BALIOE_02650;Name=hypothetical protein;locus_tag=BALIOE_02650;product=hypothetical protein;Parent=BALIOE_02650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1072 c1 Prodigal gene 563847 564809 . + . ID=BALIOE_02655_gene;locus_tag=BALIOE_02655 | |
| 1073 c1 Prodigal CDS 563847 564809 . + 0 ID=BALIOE_02655;Name=hypothetical protein;locus_tag=BALIOE_02655;product=hypothetical protein;Parent=BALIOE_02655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1074 c1 Prodigal gene 564806 565765 . - . ID=BALIOE_02660_gene;locus_tag=BALIOE_02660 | |
| 1075 c1 Prodigal CDS 564806 565765 . - 0 ID=BALIOE_02660;Name=hypothetical protein;locus_tag=BALIOE_02660;product=hypothetical protein;Parent=BALIOE_02660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1076 c1 Prodigal gene 565917 567221 . + . ID=BALIOE_02665_gene;locus_tag=BALIOE_02665 | |
| 1077 c1 Prodigal CDS 565917 567221 . + 0 ID=BALIOE_02665;Name=hypothetical protein;locus_tag=BALIOE_02665;product=hypothetical protein;Parent=BALIOE_02665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1078 c1 Infernal gene 567239 567316 . + . ID=BALIOE_02670_gene;locus_tag=BALIOE_02670;gene=naRNA4 | |
| 1079 c1 Infernal ncRNA 567239 567316 6.8e-11 + . ID=BALIOE_02670;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_02670;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_02670_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 1080 c1 Prodigal gene 567354 569030 . - . ID=BALIOE_02675_gene;locus_tag=BALIOE_02675 | |
| 1081 c1 Prodigal CDS 567354 569030 . - 0 ID=BALIOE_02675;Name=hypothetical protein;locus_tag=BALIOE_02675;product=hypothetical protein;Parent=BALIOE_02675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1082 c1 Prodigal gene 569267 570487 . - . ID=BALIOE_02680_gene;locus_tag=BALIOE_02680 | |
| 1083 c1 Prodigal CDS 569267 570487 . - 0 ID=BALIOE_02680;Name=hypothetical protein;locus_tag=BALIOE_02680;product=hypothetical protein;Parent=BALIOE_02680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1084 c1 Prodigal gene 570514 570708 . + . ID=BALIOE_02685_gene;locus_tag=BALIOE_02685 | |
| 1085 c1 Prodigal CDS 570514 570708 . + 0 ID=BALIOE_02685;Name=hypothetical protein;locus_tag=BALIOE_02685;product=hypothetical protein;Parent=BALIOE_02685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1086 c1 Prodigal gene 570705 572357 . + . ID=BALIOE_02690_gene;locus_tag=BALIOE_02690 | |
| 1087 c1 Prodigal CDS 570705 572357 . + 0 ID=BALIOE_02690;Name=hypothetical protein;locus_tag=BALIOE_02690;product=hypothetical protein;Parent=BALIOE_02690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1088 c1 Prodigal gene 572394 572873 . - . ID=BALIOE_02695_gene;locus_tag=BALIOE_02695 | |
| 1089 c1 Prodigal CDS 572394 572873 . - 0 ID=BALIOE_02695;Name=hypothetical protein;locus_tag=BALIOE_02695;product=hypothetical protein;Parent=BALIOE_02695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1090 c1 Prodigal gene 573077 573871 . - . ID=BALIOE_02700_gene;locus_tag=BALIOE_02700 | |
| 1091 c1 Prodigal CDS 573077 573871 . - 0 ID=BALIOE_02700;Name=hypothetical protein;locus_tag=BALIOE_02700;product=hypothetical protein;Parent=BALIOE_02700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1092 c1 Prodigal gene 573955 574350 . + . ID=BALIOE_02705_gene;locus_tag=BALIOE_02705 | |
| 1093 c1 Prodigal CDS 573955 574350 . + 0 ID=BALIOE_02705;Name=hypothetical protein;locus_tag=BALIOE_02705;product=hypothetical protein;Parent=BALIOE_02705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1094 c1 Infernal gene 574376 574453 . + . ID=BALIOE_02710_gene;locus_tag=BALIOE_02710;gene=naRNA4 | |
| 1095 c1 Infernal ncRNA 574376 574453 3.7e-13 + . ID=BALIOE_02710;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_02710;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_02710_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 1096 c1 Infernal gene 574376 574453 . - . ID=BALIOE_02715_gene;locus_tag=BALIOE_02715;gene=naRNA4 | |
| 1097 c1 Infernal ncRNA 574376 574453 6.5e-09 - . ID=BALIOE_02715;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_02715;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_02715_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 1098 c1 Prodigal gene 574565 577069 . - . ID=BALIOE_02720_gene;locus_tag=BALIOE_02720 | |
| 1099 c1 Prodigal CDS 574565 577069 . - 0 ID=BALIOE_02720;Name=hypothetical protein;locus_tag=BALIOE_02720;product=hypothetical protein;Parent=BALIOE_02720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1100 c1 Prodigal gene 577331 578263 . + . ID=BALIOE_02725_gene;locus_tag=BALIOE_02725 | |
| 1101 c1 Prodigal CDS 577331 578263 . + 0 ID=BALIOE_02725;Name=hypothetical protein;locus_tag=BALIOE_02725;product=hypothetical protein;Parent=BALIOE_02725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1102 c1 Prodigal gene 578266 579558 . + . ID=BALIOE_02730_gene;locus_tag=BALIOE_02730 | |
| 1103 c1 Prodigal CDS 578266 579558 . + 0 ID=BALIOE_02730;Name=hypothetical protein;locus_tag=BALIOE_02730;product=hypothetical protein;Parent=BALIOE_02730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1104 c1 Prodigal gene 579896 581251 . + . ID=BALIOE_02735_gene;locus_tag=BALIOE_02735 | |
| 1105 c1 Prodigal CDS 579896 581251 . + 0 ID=BALIOE_02735;Name=hypothetical protein;locus_tag=BALIOE_02735;product=hypothetical protein;Parent=BALIOE_02735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1106 c1 Prodigal gene 581354 585739 . + . ID=BALIOE_02740_gene;locus_tag=BALIOE_02740 | |
| 1107 c1 Prodigal CDS 581354 585739 . + 0 ID=BALIOE_02740;Name=hypothetical protein;locus_tag=BALIOE_02740;product=hypothetical protein;Parent=BALIOE_02740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1108 c1 Prodigal gene 585947 601822 . + . ID=BALIOE_02745_gene;locus_tag=BALIOE_02745 | |
| 1109 c1 Prodigal CDS 585947 601822 . + 0 ID=BALIOE_02745;Name=hypothetical protein;locus_tag=BALIOE_02745;product=hypothetical protein;Parent=BALIOE_02745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1110 c1 Prodigal gene 601826 603988 . + . ID=BALIOE_02750_gene;locus_tag=BALIOE_02750 | |
| 1111 c1 Prodigal CDS 601826 603988 . + 0 ID=BALIOE_02750;Name=hypothetical protein;locus_tag=BALIOE_02750;product=hypothetical protein;Parent=BALIOE_02750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1112 c1 Prodigal gene 603985 605160 . + . ID=BALIOE_02755_gene;locus_tag=BALIOE_02755 | |
| 1113 c1 Prodigal CDS 603985 605160 . + 0 ID=BALIOE_02755;Name=hypothetical protein;locus_tag=BALIOE_02755;product=hypothetical protein;Parent=BALIOE_02755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1114 c1 Prodigal gene 605157 605564 . + . ID=BALIOE_02760_gene;locus_tag=BALIOE_02760 | |
| 1115 c1 Prodigal CDS 605157 605564 . + 0 ID=BALIOE_02760;Name=hypothetical protein;locus_tag=BALIOE_02760;product=hypothetical protein;Parent=BALIOE_02760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1116 c1 Prodigal gene 605568 605771 . - . ID=BALIOE_02765_gene;locus_tag=BALIOE_02765 | |
| 1117 c1 Prodigal CDS 605568 605771 . - 0 ID=BALIOE_02765;Name=hypothetical protein;locus_tag=BALIOE_02765;product=hypothetical protein;Parent=BALIOE_02765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1118 c1 Prodigal gene 605768 606190 . - . ID=BALIOE_02770_gene;locus_tag=BALIOE_02770 | |
| 1119 c1 Prodigal CDS 605768 606190 . - 0 ID=BALIOE_02770;Name=hypothetical protein;locus_tag=BALIOE_02770;product=hypothetical protein;Parent=BALIOE_02770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1120 c1 Prodigal gene 606275 607291 . - . ID=BALIOE_02775_gene;locus_tag=BALIOE_02775 | |
| 1121 c1 Prodigal CDS 606275 607291 . - 0 ID=BALIOE_02775;Name=hypothetical protein;locus_tag=BALIOE_02775;product=hypothetical protein;Parent=BALIOE_02775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1122 c1 Prodigal gene 607658 608020 . + . ID=BALIOE_02780_gene;locus_tag=BALIOE_02780 | |
| 1123 c1 Prodigal CDS 607658 608020 . + 0 ID=BALIOE_02780;Name=hypothetical protein;locus_tag=BALIOE_02780;product=hypothetical protein;Parent=BALIOE_02780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1124 c1 Infernal gene 608071 608148 . - . ID=BALIOE_02785_gene;locus_tag=BALIOE_02785;gene=naRNA4 | |
| 1125 c1 Infernal ncRNA 608071 608148 6.7e-11 - . ID=BALIOE_02785;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_02785;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_02785_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 1126 c1 Prodigal gene 608199 608657 . - . ID=BALIOE_02790_gene;locus_tag=BALIOE_02790 | |
| 1127 c1 Prodigal CDS 608199 608657 . - 0 ID=BALIOE_02790;Name=hypothetical protein;locus_tag=BALIOE_02790;product=hypothetical protein;Parent=BALIOE_02790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1128 c1 Prodigal gene 608654 609571 . - . ID=BALIOE_02795_gene;locus_tag=BALIOE_02795 | |
| 1129 c1 Prodigal CDS 608654 609571 . - 0 ID=BALIOE_02795;Name=hypothetical protein;locus_tag=BALIOE_02795;product=hypothetical protein;Parent=BALIOE_02795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1130 c1 Prodigal gene 609717 610394 . + . ID=BALIOE_02800_gene;locus_tag=BALIOE_02800 | |
| 1131 c1 Prodigal CDS 609717 610394 . + 0 ID=BALIOE_02800;Name=hypothetical protein;locus_tag=BALIOE_02800;product=hypothetical protein;Parent=BALIOE_02800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1132 c1 Prodigal gene 610381 611160 . + . ID=BALIOE_02805_gene;locus_tag=BALIOE_02805 | |
| 1133 c1 Prodigal CDS 610381 611160 . + 0 ID=BALIOE_02805;Name=hypothetical protein;locus_tag=BALIOE_02805;product=hypothetical protein;Parent=BALIOE_02805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1134 c1 Prodigal gene 611223 612077 . - . ID=BALIOE_02810_gene;locus_tag=BALIOE_02810 | |
| 1135 c1 Prodigal CDS 611223 612077 . - 0 ID=BALIOE_02810;Name=hypothetical protein;locus_tag=BALIOE_02810;product=hypothetical protein;Parent=BALIOE_02810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1136 c1 Prodigal gene 612138 612947 . - . ID=BALIOE_02815_gene;locus_tag=BALIOE_02815 | |
| 1137 c1 Prodigal CDS 612138 612947 . - 0 ID=BALIOE_02815;Name=hypothetical protein;locus_tag=BALIOE_02815;product=hypothetical protein;Parent=BALIOE_02815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1138 c1 Prodigal gene 612937 613530 . - . ID=BALIOE_02820_gene;locus_tag=BALIOE_02820 | |
| 1139 c1 Prodigal CDS 612937 613530 . - 0 ID=BALIOE_02820;Name=hypothetical protein;locus_tag=BALIOE_02820;product=hypothetical protein;Parent=BALIOE_02820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1140 c1 Prodigal gene 613531 614217 . + . ID=BALIOE_02825_gene;locus_tag=BALIOE_02825 | |
| 1141 c1 Prodigal CDS 613531 614217 . + 0 ID=BALIOE_02825;Name=hypothetical protein;locus_tag=BALIOE_02825;product=hypothetical protein;Parent=BALIOE_02825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1142 c1 Prodigal gene 614214 616628 . + . ID=BALIOE_02830_gene;locus_tag=BALIOE_02830 | |
| 1143 c1 Prodigal CDS 614214 616628 . + 0 ID=BALIOE_02830;Name=hypothetical protein;locus_tag=BALIOE_02830;product=hypothetical protein;Parent=BALIOE_02830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1144 c1 Prodigal gene 617058 621254 . + . ID=BALIOE_02835_gene;locus_tag=BALIOE_02835 | |
| 1145 c1 Prodigal CDS 617058 621254 . + 0 ID=BALIOE_02835;Name=hypothetical protein;locus_tag=BALIOE_02835;product=hypothetical protein;Parent=BALIOE_02835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1146 c1 Prodigal gene 621235 621495 . + . ID=BALIOE_02840_gene;locus_tag=BALIOE_02840 | |
| 1147 c1 Prodigal CDS 621235 621495 . + 0 ID=BALIOE_02840;Name=hypothetical protein;locus_tag=BALIOE_02840;product=hypothetical protein;Parent=BALIOE_02840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1148 c1 Prodigal gene 622239 622610 . - . ID=BALIOE_02845_gene;locus_tag=BALIOE_02845 | |
| 1149 c1 Prodigal CDS 622239 622610 . - 0 ID=BALIOE_02845;Name=hypothetical protein;locus_tag=BALIOE_02845;product=hypothetical protein;Parent=BALIOE_02845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1150 c1 Prodigal gene 622726 623820 . - . ID=BALIOE_02850_gene;locus_tag=BALIOE_02850 | |
| 1151 c1 Prodigal CDS 622726 623820 . - 0 ID=BALIOE_02850;Name=hypothetical protein;locus_tag=BALIOE_02850;product=hypothetical protein;Parent=BALIOE_02850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1152 c1 Prodigal gene 623889 624815 . - . ID=BALIOE_02855_gene;locus_tag=BALIOE_02855 | |
| 1153 c1 Prodigal CDS 623889 624815 . - 0 ID=BALIOE_02855;Name=hypothetical protein;locus_tag=BALIOE_02855;product=hypothetical protein;Parent=BALIOE_02855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1154 c1 Prodigal gene 625045 625527 . + . ID=BALIOE_02860_gene;locus_tag=BALIOE_02860 | |
| 1155 c1 Prodigal CDS 625045 625527 . + 0 ID=BALIOE_02860;Name=hypothetical protein;locus_tag=BALIOE_02860;product=hypothetical protein;Parent=BALIOE_02860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1156 c1 Prodigal gene 625605 626420 . + . ID=BALIOE_02865_gene;locus_tag=BALIOE_02865 | |
| 1157 c1 Prodigal CDS 625605 626420 . + 0 ID=BALIOE_02865;Name=hypothetical protein;locus_tag=BALIOE_02865;product=hypothetical protein;Parent=BALIOE_02865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1158 c1 Prodigal gene 626510 628291 . + . ID=BALIOE_02870_gene;locus_tag=BALIOE_02870 | |
| 1159 c1 Prodigal CDS 626510 628291 . + 0 ID=BALIOE_02870;Name=hypothetical protein;locus_tag=BALIOE_02870;product=hypothetical protein;Parent=BALIOE_02870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1160 c1 Prodigal gene 628304 629080 . + . ID=BALIOE_02875_gene;locus_tag=BALIOE_02875 | |
| 1161 c1 Prodigal CDS 628304 629080 . + 0 ID=BALIOE_02875;Name=hypothetical protein;locus_tag=BALIOE_02875;product=hypothetical protein;Parent=BALIOE_02875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1162 c1 Prodigal gene 629181 630059 . + . ID=BALIOE_02880_gene;locus_tag=BALIOE_02880 | |
| 1163 c1 Prodigal CDS 629181 630059 . + 0 ID=BALIOE_02880;Name=hypothetical protein;locus_tag=BALIOE_02880;product=hypothetical protein;Parent=BALIOE_02880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1164 c1 Prodigal gene 630228 631619 . + . ID=BALIOE_02885_gene;locus_tag=BALIOE_02885 | |
| 1165 c1 Prodigal CDS 630228 631619 . + 0 ID=BALIOE_02885;Name=hypothetical protein;locus_tag=BALIOE_02885;product=hypothetical protein;Parent=BALIOE_02885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1166 c1 Prodigal gene 631656 632546 . + . ID=BALIOE_02890_gene;locus_tag=BALIOE_02890 | |
| 1167 c1 Prodigal CDS 631656 632546 . + 0 ID=BALIOE_02890;Name=hypothetical protein;locus_tag=BALIOE_02890;product=hypothetical protein;Parent=BALIOE_02890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1168 c1 Prodigal gene 632553 633017 . + . ID=BALIOE_02895_gene;locus_tag=BALIOE_02895 | |
| 1169 c1 Prodigal CDS 632553 633017 . + 0 ID=BALIOE_02895;Name=Allantoinase;locus_tag=BALIOE_02895;product=Allantoinase;Parent=BALIOE_02895_gene;inference=ab initio prediction:Prodigal:2.6;Note=SO:0001217,UniRef:UniRef50_A0A091C0K5,UniRef:UniRef90_A0A376X1Z1 | |
| 1170 c1 Prodigal gene 633074 634375 . + . ID=BALIOE_02900_gene;locus_tag=BALIOE_02900 | |
| 1171 c1 Prodigal CDS 633074 634375 . + 0 ID=BALIOE_02900;Name=hypothetical protein;locus_tag=BALIOE_02900;product=hypothetical protein;Parent=BALIOE_02900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1172 c1 Prodigal gene 634397 635542 . + . ID=BALIOE_02905_gene;locus_tag=BALIOE_02905 | |
| 1173 c1 Prodigal CDS 634397 635542 . + 0 ID=BALIOE_02905;Name=hypothetical protein;locus_tag=BALIOE_02905;product=hypothetical protein;Parent=BALIOE_02905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1174 c1 Prodigal gene 635770 636555 . - . ID=BALIOE_02910_gene;locus_tag=BALIOE_02910 | |
| 1175 c1 Prodigal CDS 635770 636555 . - 0 ID=BALIOE_02910;Name=hypothetical protein;locus_tag=BALIOE_02910;product=hypothetical protein;Parent=BALIOE_02910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1176 c1 Prodigal gene 636566 637801 . - . ID=BALIOE_02915_gene;locus_tag=BALIOE_02915 | |
| 1177 c1 Prodigal CDS 636566 637801 . - 0 ID=BALIOE_02915;Name=hypothetical protein;locus_tag=BALIOE_02915;product=hypothetical protein;Parent=BALIOE_02915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1178 c1 Prodigal gene 637823 638872 . - . ID=BALIOE_02920_gene;locus_tag=BALIOE_02920 | |
| 1179 c1 Prodigal CDS 637823 638872 . - 0 ID=BALIOE_02920;Name=hypothetical protein;locus_tag=BALIOE_02920;product=hypothetical protein;Parent=BALIOE_02920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1180 c1 Prodigal gene 639189 640856 . + . ID=BALIOE_02925_gene;locus_tag=BALIOE_02925 | |
| 1181 c1 Prodigal CDS 639189 640856 . + 0 ID=BALIOE_02925;Name=hypothetical protein;locus_tag=BALIOE_02925;product=hypothetical protein;Parent=BALIOE_02925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1182 c1 Prodigal gene 640866 642125 . + . ID=BALIOE_02930_gene;locus_tag=BALIOE_02930 | |
| 1183 c1 Prodigal CDS 640866 642125 . + 0 ID=BALIOE_02930;Name=hypothetical protein;locus_tag=BALIOE_02930;product=hypothetical protein;Parent=BALIOE_02930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1184 c1 Prodigal gene 642136 642951 . + . ID=BALIOE_02935_gene;locus_tag=BALIOE_02935 | |
| 1185 c1 Prodigal CDS 642136 642951 . + 0 ID=BALIOE_02935;Name=hypothetical protein;locus_tag=BALIOE_02935;product=hypothetical protein;Parent=BALIOE_02935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1186 c1 Prodigal gene 642948 643841 . + . ID=BALIOE_02940_gene;locus_tag=BALIOE_02940 | |
| 1187 c1 Prodigal CDS 642948 643841 . + 0 ID=BALIOE_02940;Name=hypothetical protein;locus_tag=BALIOE_02940;product=hypothetical protein;Parent=BALIOE_02940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1188 c1 Prodigal gene 643980 645047 . - . ID=BALIOE_02945_gene;locus_tag=BALIOE_02945 | |
| 1189 c1 Prodigal CDS 643980 645047 . - 0 ID=BALIOE_02945;Name=hypothetical protein;locus_tag=BALIOE_02945;product=hypothetical protein;Parent=BALIOE_02945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1190 c1 Prodigal gene 645044 645553 . - . ID=BALIOE_02950_gene;locus_tag=BALIOE_02950 | |
| 1191 c1 Prodigal CDS 645044 645553 . - 0 ID=BALIOE_02950;Name=hypothetical protein;locus_tag=BALIOE_02950;product=hypothetical protein;Parent=BALIOE_02950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1192 c1 Prodigal gene 645671 646393 . - . ID=BALIOE_02955_gene;locus_tag=BALIOE_02955 | |
| 1193 c1 Prodigal CDS 645671 646393 . - 0 ID=BALIOE_02955;Name=hypothetical protein;locus_tag=BALIOE_02955;product=hypothetical protein;Parent=BALIOE_02955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1194 c1 Prodigal gene 646396 646890 . - . ID=BALIOE_02960_gene;locus_tag=BALIOE_02960 | |
| 1195 c1 Prodigal CDS 646396 646890 . - 0 ID=BALIOE_02960;Name=hypothetical protein;locus_tag=BALIOE_02960;product=hypothetical protein;Parent=BALIOE_02960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1196 c1 Prodigal gene 647064 648449 . + . ID=BALIOE_02965_gene;locus_tag=BALIOE_02965 | |
| 1197 c1 Prodigal CDS 647064 648449 . + 0 ID=BALIOE_02965;Name=hypothetical protein;locus_tag=BALIOE_02965;product=hypothetical protein;Parent=BALIOE_02965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1198 c1 Prodigal gene 648485 649006 . - . ID=BALIOE_02970_gene;locus_tag=BALIOE_02970 | |
| 1199 c1 Prodigal CDS 648485 649006 . - 0 ID=BALIOE_02970;Name=hypothetical protein;locus_tag=BALIOE_02970;product=hypothetical protein;Parent=BALIOE_02970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1200 c1 Prodigal gene 649114 649326 . - . ID=BALIOE_02975_gene;locus_tag=BALIOE_02975 | |
| 1201 c1 Prodigal CDS 649114 649326 . - 0 ID=BALIOE_02975;Name=hypothetical protein;locus_tag=BALIOE_02975;product=hypothetical protein;Parent=BALIOE_02975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1202 c1 Prodigal gene 649328 650194 . - . ID=BALIOE_02980_gene;locus_tag=BALIOE_02980 | |
| 1203 c1 Prodigal CDS 649328 650194 . - 0 ID=BALIOE_02980;Name=hypothetical protein;locus_tag=BALIOE_02980;product=hypothetical protein;Parent=BALIOE_02980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1204 c1 Prodigal gene 650665 651207 . + . ID=BALIOE_02985_gene;locus_tag=BALIOE_02985 | |
| 1205 c1 Prodigal CDS 650665 651207 . + 0 ID=BALIOE_02985;Name=hypothetical protein;locus_tag=BALIOE_02985;product=hypothetical protein;Parent=BALIOE_02985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1206 c1 Prodigal gene 651427 652119 . + . ID=BALIOE_02990_gene;locus_tag=BALIOE_02990 | |
| 1207 c1 Prodigal CDS 651427 652119 . + 0 ID=BALIOE_02990;Name=hypothetical protein;locus_tag=BALIOE_02990;product=hypothetical protein;Parent=BALIOE_02990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1208 c1 Prodigal gene 652150 654759 . + . ID=BALIOE_02995_gene;locus_tag=BALIOE_02995 | |
| 1209 c1 Prodigal CDS 652150 654759 . + 0 ID=BALIOE_02995;Name=hypothetical protein;locus_tag=BALIOE_02995;product=hypothetical protein;Parent=BALIOE_02995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1210 c1 Prodigal gene 654772 655779 . + . ID=BALIOE_03000_gene;locus_tag=BALIOE_03000 | |
| 1211 c1 Prodigal CDS 654772 655779 . + 0 ID=BALIOE_03000;Name=hypothetical protein;locus_tag=BALIOE_03000;product=hypothetical protein;Parent=BALIOE_03000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1212 c1 Prodigal gene 655790 656305 . + . ID=BALIOE_03005_gene;locus_tag=BALIOE_03005 | |
| 1213 c1 Prodigal CDS 655790 656305 . + 0 ID=BALIOE_03005;Name=hypothetical protein;locus_tag=BALIOE_03005;product=hypothetical protein;Parent=BALIOE_03005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1214 c1 Prodigal gene 656308 656940 . - . ID=BALIOE_03010_gene;locus_tag=BALIOE_03010 | |
| 1215 c1 Prodigal CDS 656308 656940 . - 0 ID=BALIOE_03010;Name=hypothetical protein;locus_tag=BALIOE_03010;product=hypothetical protein;Parent=BALIOE_03010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1216 c1 tRNAscan-SE gene 657183 657259 . + . ID=BALIOE_03015_gene;locus_tag=BALIOE_03015;gene=Arg_trna | |
| 1217 c1 tRNAscan-SE tRNA 657183 657259 . + . ID=BALIOE_03015;Name=tRNA-Arg;locus_tag=BALIOE_03015;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_03015_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 1218 c1 Prodigal gene 657305 658066 . - . ID=BALIOE_03020_gene;locus_tag=BALIOE_03020 | |
| 1219 c1 Prodigal CDS 657305 658066 . - 0 ID=BALIOE_03020;Name=hypothetical protein;locus_tag=BALIOE_03020;product=hypothetical protein;Parent=BALIOE_03020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1220 c1 Prodigal gene 658249 659139 . - . ID=BALIOE_03025_gene;locus_tag=BALIOE_03025 | |
| 1221 c1 Prodigal CDS 658249 659139 . - 0 ID=BALIOE_03025;Name=hypothetical protein;locus_tag=BALIOE_03025;product=hypothetical protein;Parent=BALIOE_03025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1222 c1 Prodigal gene 659140 662112 . - . ID=BALIOE_03030_gene;locus_tag=BALIOE_03030 | |
| 1223 c1 Prodigal CDS 659140 662112 . - 0 ID=BALIOE_03030;Name=hypothetical protein;locus_tag=BALIOE_03030;product=hypothetical protein;Parent=BALIOE_03030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1224 c1 Prodigal gene 662099 664336 . - . ID=BALIOE_03035_gene;locus_tag=BALIOE_03035 | |
| 1225 c1 Prodigal CDS 662099 664336 . - 0 ID=BALIOE_03035;Name=hypothetical protein;locus_tag=BALIOE_03035;product=hypothetical protein;Parent=BALIOE_03035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1226 c1 Prodigal gene 664602 665738 . - . ID=BALIOE_03040_gene;locus_tag=BALIOE_03040 | |
| 1227 c1 Prodigal CDS 664602 665738 . - 0 ID=BALIOE_03040;Name=hypothetical protein;locus_tag=BALIOE_03040;product=hypothetical protein;Parent=BALIOE_03040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1228 c1 Prodigal gene 665953 666174 . - . ID=BALIOE_03045_gene;locus_tag=BALIOE_03045 | |
| 1229 c1 Prodigal CDS 665953 666174 . - 0 ID=BALIOE_03045;Name=hypothetical protein;locus_tag=BALIOE_03045;product=hypothetical protein;Parent=BALIOE_03045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1230 c1 Prodigal gene 666201 667535 . - . ID=BALIOE_03050_gene;locus_tag=BALIOE_03050 | |
| 1231 c1 Prodigal CDS 666201 667535 . - 0 ID=BALIOE_03050;Name=hypothetical protein;locus_tag=BALIOE_03050;product=hypothetical protein;Parent=BALIOE_03050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1232 c1 Prodigal gene 667704 668111 . - . ID=BALIOE_03055_gene;locus_tag=BALIOE_03055 | |
| 1233 c1 Prodigal CDS 667704 668111 . - 0 ID=BALIOE_03055;Name=hypothetical protein;locus_tag=BALIOE_03055;product=hypothetical protein;Parent=BALIOE_03055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1234 c1 Prodigal gene 668129 672979 . - . ID=BALIOE_03060_gene;locus_tag=BALIOE_03060 | |
| 1235 c1 Prodigal CDS 668129 672979 . - 0 ID=BALIOE_03060;Name=hypothetical protein;locus_tag=BALIOE_03060;product=hypothetical protein;Parent=BALIOE_03060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1236 c1 Prodigal gene 672999 673460 . - . ID=BALIOE_03065_gene;locus_tag=BALIOE_03065 | |
| 1237 c1 Prodigal CDS 672999 673460 . - 0 ID=BALIOE_03065;Name=hypothetical protein;locus_tag=BALIOE_03065;product=hypothetical protein;Parent=BALIOE_03065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1238 c1 Prodigal gene 673488 675389 . - . ID=BALIOE_03070_gene;locus_tag=BALIOE_03070 | |
| 1239 c1 Prodigal CDS 673488 675389 . - 0 ID=BALIOE_03070;Name=hypothetical protein;locus_tag=BALIOE_03070;product=hypothetical protein;Parent=BALIOE_03070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1240 c1 Prodigal gene 675983 677431 . - . ID=BALIOE_03075_gene;locus_tag=BALIOE_03075 | |
| 1241 c1 Prodigal CDS 675983 677431 . - 0 ID=BALIOE_03075;Name=hypothetical protein;locus_tag=BALIOE_03075;product=hypothetical protein;Parent=BALIOE_03075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1242 c1 Prodigal gene 677421 678104 . - . ID=BALIOE_03080_gene;locus_tag=BALIOE_03080 | |
| 1243 c1 Prodigal CDS 677421 678104 . - 0 ID=BALIOE_03080;Name=hypothetical protein;locus_tag=BALIOE_03080;product=hypothetical protein;Parent=BALIOE_03080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1244 c1 Prodigal gene 678261 679643 . + . ID=BALIOE_03085_gene;locus_tag=BALIOE_03085 | |
| 1245 c1 Prodigal CDS 678261 679643 . + 0 ID=BALIOE_03085;Name=hypothetical protein;locus_tag=BALIOE_03085;product=hypothetical protein;Parent=BALIOE_03085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1246 c1 Prodigal gene 679667 679999 . + . ID=BALIOE_03090_gene;locus_tag=BALIOE_03090 | |
| 1247 c1 Prodigal CDS 679667 679999 . + 0 ID=BALIOE_03090;Name=hypothetical protein;locus_tag=BALIOE_03090;product=hypothetical protein;Parent=BALIOE_03090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1248 c1 Prodigal gene 680015 681238 . + . ID=BALIOE_03095_gene;locus_tag=BALIOE_03095 | |
| 1249 c1 Prodigal CDS 680015 681238 . + 0 ID=BALIOE_03095;Name=hypothetical protein;locus_tag=BALIOE_03095;product=hypothetical protein;Parent=BALIOE_03095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1250 c1 Prodigal gene 681250 684387 . + . ID=BALIOE_03100_gene;locus_tag=BALIOE_03100 | |
| 1251 c1 Prodigal CDS 681250 684387 . + 0 ID=BALIOE_03100;Name=hypothetical protein;locus_tag=BALIOE_03100;product=hypothetical protein;Parent=BALIOE_03100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1252 c1 Prodigal gene 684489 685865 . + . ID=BALIOE_03105_gene;locus_tag=BALIOE_03105 | |
| 1253 c1 Prodigal CDS 684489 685865 . + 0 ID=BALIOE_03105;Name=hypothetical protein;locus_tag=BALIOE_03105;product=hypothetical protein;Parent=BALIOE_03105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1254 c1 Prodigal gene 685933 687180 . - . ID=BALIOE_03110_gene;locus_tag=BALIOE_03110 | |
| 1255 c1 Prodigal CDS 685933 687180 . - 0 ID=BALIOE_03110;Name=hypothetical protein;locus_tag=BALIOE_03110;product=hypothetical protein;Parent=BALIOE_03110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1256 c1 Prodigal gene 687288 687941 . - . ID=BALIOE_03115_gene;locus_tag=BALIOE_03115 | |
| 1257 c1 Prodigal CDS 687288 687941 . - 0 ID=BALIOE_03115;Name=hypothetical protein;locus_tag=BALIOE_03115;product=hypothetical protein;Parent=BALIOE_03115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1258 c1 Prodigal gene 688035 688403 . - . ID=BALIOE_03120_gene;locus_tag=BALIOE_03120 | |
| 1259 c1 Prodigal CDS 688035 688403 . - 0 ID=BALIOE_03120;Name=hypothetical protein;locus_tag=BALIOE_03120;product=hypothetical protein;Parent=BALIOE_03120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1260 c1 Prodigal gene 688468 688668 . - . ID=BALIOE_03125_gene;locus_tag=BALIOE_03125 | |
| 1261 c1 Prodigal CDS 688468 688668 . - 0 ID=BALIOE_03125;Name=hypothetical protein;locus_tag=BALIOE_03125;product=hypothetical protein;Parent=BALIOE_03125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1262 c1 Prodigal gene 688782 689900 . - . ID=BALIOE_03130_gene;locus_tag=BALIOE_03130 | |
| 1263 c1 Prodigal CDS 688782 689900 . - 0 ID=BALIOE_03130;Name=hypothetical protein;locus_tag=BALIOE_03130;product=hypothetical protein;Parent=BALIOE_03130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1264 c1 Prodigal gene 690339 690491 . + . ID=BALIOE_03135_gene;locus_tag=BALIOE_03135 | |
| 1265 c1 Prodigal CDS 690339 690491 . + 0 ID=BALIOE_03135;Name=hypothetical protein;locus_tag=BALIOE_03135;product=hypothetical protein;Parent=BALIOE_03135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1266 c1 Prodigal gene 690842 690994 . + . ID=BALIOE_03140_gene;locus_tag=BALIOE_03140 | |
| 1267 c1 Prodigal CDS 690842 690994 . + 0 ID=BALIOE_03140;Name=hypothetical protein;locus_tag=BALIOE_03140;product=hypothetical protein;Parent=BALIOE_03140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1268 c1 Prodigal gene 691116 691859 . - . ID=BALIOE_03145_gene;locus_tag=BALIOE_03145 | |
| 1269 c1 Prodigal CDS 691116 691859 . - 0 ID=BALIOE_03145;Name=hypothetical protein;locus_tag=BALIOE_03145;product=hypothetical protein;Parent=BALIOE_03145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1270 c1 Prodigal gene 691911 694151 . - . ID=BALIOE_03150_gene;locus_tag=BALIOE_03150 | |
| 1271 c1 Prodigal CDS 691911 694151 . - 0 ID=BALIOE_03150;Name=hypothetical protein;locus_tag=BALIOE_03150;product=hypothetical protein;Parent=BALIOE_03150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1272 c1 Prodigal gene 694394 695596 . + . ID=BALIOE_03155_gene;locus_tag=BALIOE_03155 | |
| 1273 c1 Prodigal CDS 694394 695596 . + 0 ID=BALIOE_03155;Name=hypothetical protein;locus_tag=BALIOE_03155;product=hypothetical protein;Parent=BALIOE_03155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1274 c1 Prodigal gene 695599 695817 . + . ID=BALIOE_03160_gene;locus_tag=BALIOE_03160 | |
| 1275 c1 Prodigal CDS 695599 695817 . + 0 ID=BALIOE_03160;Name=hypothetical protein;locus_tag=BALIOE_03160;product=hypothetical protein;Parent=BALIOE_03160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1276 c1 Prodigal gene 695814 699695 . + . ID=BALIOE_03165_gene;locus_tag=BALIOE_03165 | |
| 1277 c1 Prodigal CDS 695814 699695 . + 0 ID=BALIOE_03165;Name=hypothetical protein;locus_tag=BALIOE_03165;product=hypothetical protein;Parent=BALIOE_03165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1278 c1 Prodigal gene 699911 701044 . + . ID=BALIOE_03170_gene;locus_tag=BALIOE_03170 | |
| 1279 c1 Prodigal CDS 699911 701044 . + 0 ID=BALIOE_03170;Name=hypothetical protein;locus_tag=BALIOE_03170;product=hypothetical protein;Parent=BALIOE_03170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1280 c1 Prodigal gene 701041 701856 . - . ID=BALIOE_03175_gene;locus_tag=BALIOE_03175 | |
| 1281 c1 Prodigal CDS 701041 701856 . - 0 ID=BALIOE_03175;Name=hypothetical protein;locus_tag=BALIOE_03175;product=hypothetical protein;Parent=BALIOE_03175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1282 c1 Prodigal gene 701853 702845 . - . ID=BALIOE_03180_gene;locus_tag=BALIOE_03180 | |
| 1283 c1 Prodigal CDS 701853 702845 . - 0 ID=BALIOE_03180;Name=hypothetical protein;locus_tag=BALIOE_03180;product=hypothetical protein;Parent=BALIOE_03180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1284 c1 Prodigal gene 702842 703846 . - . ID=BALIOE_03185_gene;locus_tag=BALIOE_03185 | |
| 1285 c1 Prodigal CDS 702842 703846 . - 0 ID=BALIOE_03185;Name=hypothetical protein;locus_tag=BALIOE_03185;product=hypothetical protein;Parent=BALIOE_03185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1286 c1 Prodigal gene 703957 705207 . + . ID=BALIOE_03190_gene;locus_tag=BALIOE_03190 | |
| 1287 c1 Prodigal CDS 703957 705207 . + 0 ID=BALIOE_03190;Name=hypothetical protein;locus_tag=BALIOE_03190;product=hypothetical protein;Parent=BALIOE_03190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1288 c1 Prodigal gene 705211 706167 . - . ID=BALIOE_03195_gene;locus_tag=BALIOE_03195 | |
| 1289 c1 Prodigal CDS 705211 706167 . - 0 ID=BALIOE_03195;Name=hypothetical protein;locus_tag=BALIOE_03195;product=hypothetical protein;Parent=BALIOE_03195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1290 c1 Prodigal gene 706356 707531 . + . ID=BALIOE_03200_gene;locus_tag=BALIOE_03200 | |
| 1291 c1 Prodigal CDS 706356 707531 . + 0 ID=BALIOE_03200;Name=hypothetical protein;locus_tag=BALIOE_03200;product=hypothetical protein;Parent=BALIOE_03200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1292 c1 Prodigal gene 707541 709151 . + . ID=BALIOE_03205_gene;locus_tag=BALIOE_03205 | |
| 1293 c1 Prodigal CDS 707541 709151 . + 0 ID=BALIOE_03205;Name=hypothetical protein;locus_tag=BALIOE_03205;product=hypothetical protein;Parent=BALIOE_03205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1294 c1 Prodigal gene 709165 710022 . + . ID=BALIOE_03210_gene;locus_tag=BALIOE_03210 | |
| 1295 c1 Prodigal CDS 709165 710022 . + 0 ID=BALIOE_03210;Name=hypothetical protein;locus_tag=BALIOE_03210;product=hypothetical protein;Parent=BALIOE_03210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1296 c1 Prodigal gene 710022 710768 . + . ID=BALIOE_03215_gene;locus_tag=BALIOE_03215 | |
| 1297 c1 Prodigal CDS 710022 710768 . + 0 ID=BALIOE_03215;Name=hypothetical protein;locus_tag=BALIOE_03215;product=hypothetical protein;Parent=BALIOE_03215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1298 c1 Prodigal gene 710771 711184 . + . ID=BALIOE_03220_gene;locus_tag=BALIOE_03220 | |
| 1299 c1 Prodigal CDS 710771 711184 . + 0 ID=BALIOE_03220;Name=hypothetical protein;locus_tag=BALIOE_03220;product=hypothetical protein;Parent=BALIOE_03220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1300 c1 Prodigal gene 711365 713470 . + . ID=BALIOE_03225_gene;locus_tag=BALIOE_03225 | |
| 1301 c1 Prodigal CDS 711365 713470 . + 0 ID=BALIOE_03225;Name=hypothetical protein;locus_tag=BALIOE_03225;product=hypothetical protein;Parent=BALIOE_03225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1302 c1 Prodigal gene 713652 713849 . + . ID=BALIOE_03230_gene;locus_tag=BALIOE_03230 | |
| 1303 c1 Prodigal CDS 713652 713849 . + 0 ID=BALIOE_03230;Name=hypothetical protein;locus_tag=BALIOE_03230;product=hypothetical protein;Parent=BALIOE_03230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1304 c1 Prodigal gene 713859 714947 . - . ID=BALIOE_03235_gene;locus_tag=BALIOE_03235 | |
| 1305 c1 Prodigal CDS 713859 714947 . - 0 ID=BALIOE_03235;Name=hypothetical protein;locus_tag=BALIOE_03235;product=hypothetical protein;Parent=BALIOE_03235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1306 c1 Prodigal gene 715056 716216 . + . ID=BALIOE_03240_gene;locus_tag=BALIOE_03240 | |
| 1307 c1 Prodigal CDS 715056 716216 . + 0 ID=BALIOE_03240;Name=hypothetical protein;locus_tag=BALIOE_03240;product=hypothetical protein;Parent=BALIOE_03240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1308 c1 Prodigal gene 716217 716846 . - . ID=BALIOE_03245_gene;locus_tag=BALIOE_03245 | |
| 1309 c1 Prodigal CDS 716217 716846 . - 0 ID=BALIOE_03245;Name=hypothetical protein;locus_tag=BALIOE_03245;product=hypothetical protein;Parent=BALIOE_03245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1310 c1 Prodigal gene 716819 718039 . - . ID=BALIOE_03250_gene;locus_tag=BALIOE_03250 | |
| 1311 c1 Prodigal CDS 716819 718039 . - 0 ID=BALIOE_03250;Name=hypothetical protein;locus_tag=BALIOE_03250;product=hypothetical protein;Parent=BALIOE_03250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1312 c1 Prodigal gene 718186 719088 . - . ID=BALIOE_03255_gene;locus_tag=BALIOE_03255 | |
| 1313 c1 Prodigal CDS 718186 719088 . - 0 ID=BALIOE_03255;Name=hypothetical protein;locus_tag=BALIOE_03255;product=hypothetical protein;Parent=BALIOE_03255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1314 c1 Prodigal gene 719298 720044 . - . ID=BALIOE_03260_gene;locus_tag=BALIOE_03260 | |
| 1315 c1 Prodigal CDS 719298 720044 . - 0 ID=BALIOE_03260;Name=hypothetical protein;locus_tag=BALIOE_03260;product=hypothetical protein;Parent=BALIOE_03260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1316 c1 Prodigal gene 720416 720979 . + . ID=BALIOE_03265_gene;locus_tag=BALIOE_03265 | |
| 1317 c1 Prodigal CDS 720416 720979 . + 0 ID=BALIOE_03265;Name=hypothetical protein;locus_tag=BALIOE_03265;product=hypothetical protein;Parent=BALIOE_03265_gene;inference=ab initio prediction:Prodigal:2.6;Note=PFAM:PF10417.10 | |
| 1318 c1 Prodigal gene 721078 722673 . + . ID=BALIOE_03270_gene;locus_tag=BALIOE_03270 | |
| 1319 c1 Prodigal CDS 721078 722673 . + 0 ID=BALIOE_03270;Name=hypothetical protein;locus_tag=BALIOE_03270;product=hypothetical protein;Parent=BALIOE_03270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1320 c1 Prodigal gene 722794 723222 . - . ID=BALIOE_03275_gene;locus_tag=BALIOE_03275 | |
| 1321 c1 Prodigal CDS 722794 723222 . - 0 ID=BALIOE_03275;Name=hypothetical protein;locus_tag=BALIOE_03275;product=hypothetical protein;Parent=BALIOE_03275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1322 c1 Prodigal gene 723443 724681 . + . ID=BALIOE_03280_gene;locus_tag=BALIOE_03280 | |
| 1323 c1 Prodigal CDS 723443 724681 . + 0 ID=BALIOE_03280;Name=hypothetical protein;locus_tag=BALIOE_03280;product=hypothetical protein;Parent=BALIOE_03280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1324 c1 Prodigal gene 724685 724774 . - . ID=BALIOE_03285_gene;locus_tag=BALIOE_03285 | |
| 1325 c1 Prodigal CDS 724685 724774 . - 0 ID=BALIOE_03285;Name=hypothetical protein;locus_tag=BALIOE_03285;product=hypothetical protein;Parent=BALIOE_03285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1326 c1 Prodigal gene 724912 725322 . - . ID=BALIOE_03290_gene;locus_tag=BALIOE_03290 | |
| 1327 c1 Prodigal CDS 724912 725322 . - 0 ID=BALIOE_03290;Name=hypothetical protein;locus_tag=BALIOE_03290;product=hypothetical protein;Parent=BALIOE_03290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1328 c1 Prodigal gene 725552 726358 . - . ID=BALIOE_03295_gene;locus_tag=BALIOE_03295 | |
| 1329 c1 Prodigal CDS 725552 726358 . - 0 ID=BALIOE_03295;Name=hypothetical protein;locus_tag=BALIOE_03295;product=hypothetical protein;Parent=BALIOE_03295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1330 c1 Prodigal gene 726472 727935 . - . ID=BALIOE_03300_gene;locus_tag=BALIOE_03300 | |
| 1331 c1 Prodigal CDS 726472 727935 . - 0 ID=BALIOE_03300;Name=hypothetical protein;locus_tag=BALIOE_03300;product=hypothetical protein;Parent=BALIOE_03300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1332 c1 Prodigal gene 727986 728864 . - . ID=BALIOE_03305_gene;locus_tag=BALIOE_03305 | |
| 1333 c1 Prodigal CDS 727986 728864 . - 0 ID=BALIOE_03305;Name=hypothetical protein;locus_tag=BALIOE_03305;product=hypothetical protein;Parent=BALIOE_03305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1334 c1 Prodigal gene 728839 729390 . - . ID=BALIOE_03310_gene;locus_tag=BALIOE_03310 | |
| 1335 c1 Prodigal CDS 728839 729390 . - 0 ID=BALIOE_03310;Name=hypothetical protein;locus_tag=BALIOE_03310;product=hypothetical protein;Parent=BALIOE_03310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1336 c1 Prodigal gene 729394 730926 . - . ID=BALIOE_03315_gene;locus_tag=BALIOE_03315 | |
| 1337 c1 Prodigal CDS 729394 730926 . - 0 ID=BALIOE_03315;Name=hypothetical protein;locus_tag=BALIOE_03315;product=hypothetical protein;Parent=BALIOE_03315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1338 c1 Prodigal gene 730937 731845 . - . ID=BALIOE_03320_gene;locus_tag=BALIOE_03320 | |
| 1339 c1 Prodigal CDS 730937 731845 . - 0 ID=BALIOE_03320;Name=hypothetical protein;locus_tag=BALIOE_03320;product=hypothetical protein;Parent=BALIOE_03320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1340 c1 Prodigal gene 731842 732138 . - . ID=BALIOE_03325_gene;locus_tag=BALIOE_03325 | |
| 1341 c1 Prodigal CDS 731842 732138 . - 0 ID=BALIOE_03325;Name=hypothetical protein;locus_tag=BALIOE_03325;product=hypothetical protein;Parent=BALIOE_03325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1342 c1 Prodigal gene 732153 733211 . - . ID=BALIOE_03330_gene;locus_tag=BALIOE_03330 | |
| 1343 c1 Prodigal CDS 732153 733211 . - 0 ID=BALIOE_03330;Name=hypothetical protein;locus_tag=BALIOE_03330;product=hypothetical protein;Parent=BALIOE_03330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1344 c1 Prodigal gene 733591 735249 . + . ID=BALIOE_03335_gene;locus_tag=BALIOE_03335 | |
| 1345 c1 Prodigal CDS 733591 735249 . + 0 ID=BALIOE_03335;Name=hypothetical protein;locus_tag=BALIOE_03335;product=hypothetical protein;Parent=BALIOE_03335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1346 c1 Prodigal gene 735218 735898 . + . ID=BALIOE_03340_gene;locus_tag=BALIOE_03340 | |
| 1347 c1 Prodigal CDS 735218 735898 . + 0 ID=BALIOE_03340;Name=hypothetical protein;locus_tag=BALIOE_03340;product=hypothetical protein;Parent=BALIOE_03340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1348 c1 Prodigal gene 735939 737324 . - . ID=BALIOE_03345_gene;locus_tag=BALIOE_03345 | |
| 1349 c1 Prodigal CDS 735939 737324 . - 0 ID=BALIOE_03345;Name=hypothetical protein;locus_tag=BALIOE_03345;product=hypothetical protein;Parent=BALIOE_03345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1350 c1 Prodigal gene 737913 738473 . + . ID=BALIOE_03350_gene;locus_tag=BALIOE_03350 | |
| 1351 c1 Prodigal CDS 737913 738473 . + 0 ID=BALIOE_03350;Name=hypothetical protein;locus_tag=BALIOE_03350;product=hypothetical protein;Parent=BALIOE_03350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1352 c1 Prodigal gene 738648 738857 . + . ID=BALIOE_03355_gene;locus_tag=BALIOE_03355 | |
| 1353 c1 Prodigal CDS 738648 738857 . + 0 ID=BALIOE_03355;Name=hypothetical protein;locus_tag=BALIOE_03355;product=hypothetical protein;Parent=BALIOE_03355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1354 c1 Prodigal gene 738911 739294 . - . ID=BALIOE_03360_gene;locus_tag=BALIOE_03360 | |
| 1355 c1 Prodigal CDS 738911 739294 . - 0 ID=BALIOE_03360;Name=hypothetical protein;locus_tag=BALIOE_03360;product=hypothetical protein;Parent=BALIOE_03360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1356 c1 Prodigal gene 739387 740175 . + . ID=BALIOE_03365_gene;locus_tag=BALIOE_03365 | |
| 1357 c1 Prodigal CDS 739387 740175 . + 0 ID=BALIOE_03365;Name=hypothetical protein;locus_tag=BALIOE_03365;product=hypothetical protein;Parent=BALIOE_03365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1358 c1 Prodigal gene 740304 740507 . + . ID=BALIOE_03370_gene;locus_tag=BALIOE_03370 | |
| 1359 c1 Prodigal CDS 740304 740507 . + 0 ID=BALIOE_03370;Name=hypothetical protein;locus_tag=BALIOE_03370;product=hypothetical protein;Parent=BALIOE_03370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1360 c1 Prodigal gene 740608 741573 . - . ID=BALIOE_03375_gene;locus_tag=BALIOE_03375 | |
| 1361 c1 Prodigal CDS 740608 741573 . - 0 ID=BALIOE_03375;Name=hypothetical protein;locus_tag=BALIOE_03375;product=hypothetical protein;Parent=BALIOE_03375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1362 c1 Prodigal gene 741782 742735 . - . ID=BALIOE_03380_gene;locus_tag=BALIOE_03380 | |
| 1363 c1 Prodigal CDS 741782 742735 . - 0 ID=BALIOE_03380;Name=hypothetical protein;locus_tag=BALIOE_03380;product=hypothetical protein;Parent=BALIOE_03380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1364 c1 Prodigal gene 742995 743636 . - . ID=BALIOE_03385_gene;locus_tag=BALIOE_03385 | |
| 1365 c1 Prodigal CDS 742995 743636 . - 0 ID=BALIOE_03385;Name=hypothetical protein;locus_tag=BALIOE_03385;product=hypothetical protein;Parent=BALIOE_03385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1366 c1 Prodigal gene 743737 744000 . - . ID=BALIOE_03390_gene;locus_tag=BALIOE_03390 | |
| 1367 c1 Prodigal CDS 743737 744000 . - 0 ID=BALIOE_03390;Name=hypothetical protein;locus_tag=BALIOE_03390;product=hypothetical protein;Parent=BALIOE_03390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1368 c1 Prodigal gene 744110 745321 . - . ID=BALIOE_03395_gene;locus_tag=BALIOE_03395 | |
| 1369 c1 Prodigal CDS 744110 745321 . - 0 ID=BALIOE_03395;Name=hypothetical protein;locus_tag=BALIOE_03395;product=hypothetical protein;Parent=BALIOE_03395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1370 c1 Prodigal gene 745461 746549 . - . ID=BALIOE_03400_gene;locus_tag=BALIOE_03400 | |
| 1371 c1 Prodigal CDS 745461 746549 . - 0 ID=BALIOE_03400;Name=hypothetical protein;locus_tag=BALIOE_03400;product=hypothetical protein;Parent=BALIOE_03400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1372 c1 Prodigal gene 746560 747672 . - . ID=BALIOE_03405_gene;locus_tag=BALIOE_03405 | |
| 1373 c1 Prodigal CDS 746560 747672 . - 0 ID=BALIOE_03405;Name=hypothetical protein;locus_tag=BALIOE_03405;product=hypothetical protein;Parent=BALIOE_03405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1374 c1 Prodigal gene 747675 749576 . - . ID=BALIOE_03410_gene;locus_tag=BALIOE_03410 | |
| 1375 c1 Prodigal CDS 747675 749576 . - 0 ID=BALIOE_03410;Name=hypothetical protein;locus_tag=BALIOE_03410;product=hypothetical protein;Parent=BALIOE_03410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1376 c1 Prodigal gene 749607 750074 . - . ID=BALIOE_03415_gene;locus_tag=BALIOE_03415 | |
| 1377 c1 Prodigal CDS 749607 750074 . - 0 ID=BALIOE_03415;Name=hypothetical protein;locus_tag=BALIOE_03415;product=hypothetical protein;Parent=BALIOE_03415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1378 c1 Prodigal gene 750078 750395 . - . ID=BALIOE_03420_gene;locus_tag=BALIOE_03420 | |
| 1379 c1 Prodigal CDS 750078 750395 . - 0 ID=BALIOE_03420;Name=hypothetical protein;locus_tag=BALIOE_03420;product=hypothetical protein;Parent=BALIOE_03420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1380 c1 Prodigal gene 750655 751266 . - . ID=BALIOE_03425_gene;locus_tag=BALIOE_03425 | |
| 1381 c1 Prodigal CDS 750655 751266 . - 0 ID=BALIOE_03425;Name=hypothetical protein;locus_tag=BALIOE_03425;product=hypothetical protein;Parent=BALIOE_03425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1382 c1 Prodigal gene 751290 751931 . - . ID=BALIOE_03430_gene;locus_tag=BALIOE_03430 | |
| 1383 c1 Prodigal CDS 751290 751931 . - 0 ID=BALIOE_03430;Name=hypothetical protein;locus_tag=BALIOE_03430;product=hypothetical protein;Parent=BALIOE_03430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1384 c1 Prodigal gene 751933 752964 . - . ID=BALIOE_03435_gene;locus_tag=BALIOE_03435 | |
| 1385 c1 Prodigal CDS 751933 752964 . - 0 ID=BALIOE_03435;Name=hypothetical protein;locus_tag=BALIOE_03435;product=hypothetical protein;Parent=BALIOE_03435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1386 c1 Prodigal gene 752964 753545 . - . ID=BALIOE_03440_gene;locus_tag=BALIOE_03440 | |
| 1387 c1 Prodigal CDS 752964 753545 . - 0 ID=BALIOE_03440;Name=hypothetical protein;locus_tag=BALIOE_03440;product=hypothetical protein;Parent=BALIOE_03440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1388 c1 Prodigal gene 753560 756142 . - . ID=BALIOE_03445_gene;locus_tag=BALIOE_03445 | |
| 1389 c1 Prodigal CDS 753560 756142 . - 0 ID=BALIOE_03445;Name=hypothetical protein;locus_tag=BALIOE_03445;product=hypothetical protein;Parent=BALIOE_03445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1390 c1 Prodigal gene 756378 756860 . + . ID=BALIOE_03450_gene;locus_tag=BALIOE_03450 | |
| 1391 c1 Prodigal CDS 756378 756860 . + 0 ID=BALIOE_03450;Name=hypothetical protein;locus_tag=BALIOE_03450;product=hypothetical protein;Parent=BALIOE_03450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1392 c1 Prodigal gene 756930 757517 . - . ID=BALIOE_03455_gene;locus_tag=BALIOE_03455 | |
| 1393 c1 Prodigal CDS 756930 757517 . - 0 ID=BALIOE_03455;Name=hypothetical protein;locus_tag=BALIOE_03455;product=hypothetical protein;Parent=BALIOE_03455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1394 c1 Prodigal gene 757752 757907 . - . ID=BALIOE_03460_gene;locus_tag=BALIOE_03460 | |
| 1395 c1 Prodigal CDS 757752 757907 . - 0 ID=BALIOE_03460;Name=hypothetical protein;locus_tag=BALIOE_03460;product=hypothetical protein;Parent=BALIOE_03460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1396 c1 Prodigal gene 758072 758779 . + . ID=BALIOE_03465_gene;locus_tag=BALIOE_03465 | |
| 1397 c1 Prodigal CDS 758072 758779 . + 0 ID=BALIOE_03465;Name=hypothetical protein;locus_tag=BALIOE_03465;product=hypothetical protein;Parent=BALIOE_03465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1398 c1 Prodigal gene 758776 760203 . + . ID=BALIOE_03470_gene;locus_tag=BALIOE_03470 | |
| 1399 c1 Prodigal CDS 758776 760203 . + 0 ID=BALIOE_03470;Name=hypothetical protein;locus_tag=BALIOE_03470;product=hypothetical protein;Parent=BALIOE_03470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1400 c1 Prodigal gene 760213 760767 . - . ID=BALIOE_03475_gene;locus_tag=BALIOE_03475 | |
| 1401 c1 Prodigal CDS 760213 760767 . - 0 ID=BALIOE_03475;Name=hypothetical protein;locus_tag=BALIOE_03475;product=hypothetical protein;Parent=BALIOE_03475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1402 c1 Prodigal gene 760869 761576 . + . ID=BALIOE_03480_gene;locus_tag=BALIOE_03480 | |
| 1403 c1 Prodigal CDS 760869 761576 . + 0 ID=BALIOE_03480;Name=hypothetical protein;locus_tag=BALIOE_03480;product=hypothetical protein;Parent=BALIOE_03480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1404 c1 Prodigal gene 761573 762025 . + . ID=BALIOE_03485_gene;locus_tag=BALIOE_03485 | |
| 1405 c1 Prodigal CDS 761573 762025 . + 0 ID=BALIOE_03485;Name=hypothetical protein;locus_tag=BALIOE_03485;product=hypothetical protein;Parent=BALIOE_03485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1406 c1 Prodigal gene 762188 763024 . + . ID=BALIOE_03490_gene;locus_tag=BALIOE_03490 | |
| 1407 c1 Prodigal CDS 762188 763024 . + 0 ID=BALIOE_03490;Name=hypothetical protein;locus_tag=BALIOE_03490;product=hypothetical protein;Parent=BALIOE_03490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1408 c1 Prodigal gene 763084 764754 . - . ID=BALIOE_03495_gene;locus_tag=BALIOE_03495 | |
| 1409 c1 Prodigal CDS 763084 764754 . - 0 ID=BALIOE_03495;Name=hypothetical protein;locus_tag=BALIOE_03495;product=hypothetical protein;Parent=BALIOE_03495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1410 c1 Prodigal gene 764838 765773 . - . ID=BALIOE_03500_gene;locus_tag=BALIOE_03500 | |
| 1411 c1 Prodigal CDS 764838 765773 . - 0 ID=BALIOE_03500;Name=hypothetical protein;locus_tag=BALIOE_03500;product=hypothetical protein;Parent=BALIOE_03500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1412 c1 Prodigal gene 765891 766616 . - . ID=BALIOE_03505_gene;locus_tag=BALIOE_03505 | |
| 1413 c1 Prodigal CDS 765891 766616 . - 0 ID=BALIOE_03505;Name=hypothetical protein;locus_tag=BALIOE_03505;product=hypothetical protein;Parent=BALIOE_03505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1414 c1 Prodigal gene 766616 767290 . - . ID=BALIOE_03510_gene;locus_tag=BALIOE_03510 | |
| 1415 c1 Prodigal CDS 766616 767290 . - 0 ID=BALIOE_03510;Name=hypothetical protein;locus_tag=BALIOE_03510;product=hypothetical protein;Parent=BALIOE_03510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1416 c1 Prodigal gene 767290 768030 . - . ID=BALIOE_03515_gene;locus_tag=BALIOE_03515 | |
| 1417 c1 Prodigal CDS 767290 768030 . - 0 ID=BALIOE_03515;Name=hypothetical protein;locus_tag=BALIOE_03515;product=hypothetical protein;Parent=BALIOE_03515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1418 c1 Prodigal gene 768200 769108 . - . ID=BALIOE_03520_gene;locus_tag=BALIOE_03520 | |
| 1419 c1 Prodigal CDS 768200 769108 . - 0 ID=BALIOE_03520;Name=hypothetical protein;locus_tag=BALIOE_03520;product=hypothetical protein;Parent=BALIOE_03520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1420 c1 Prodigal gene 769505 771043 . - . ID=BALIOE_03525_gene;locus_tag=BALIOE_03525 | |
| 1421 c1 Prodigal CDS 769505 771043 . - 0 ID=BALIOE_03525;Name=hypothetical protein;locus_tag=BALIOE_03525;product=hypothetical protein;Parent=BALIOE_03525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1422 c1 Prodigal gene 771068 771946 . - . ID=BALIOE_03530_gene;locus_tag=BALIOE_03530 | |
| 1423 c1 Prodigal CDS 771068 771946 . - 0 ID=BALIOE_03530;Name=hypothetical protein;locus_tag=BALIOE_03530;product=hypothetical protein;Parent=BALIOE_03530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1424 c1 Prodigal gene 772036 772503 . - . ID=BALIOE_03535_gene;locus_tag=BALIOE_03535 | |
| 1425 c1 Prodigal CDS 772036 772503 . - 0 ID=BALIOE_03535;Name=hypothetical protein;locus_tag=BALIOE_03535;product=hypothetical protein;Parent=BALIOE_03535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1426 c1 Prodigal gene 772500 773579 . - . ID=BALIOE_03540_gene;locus_tag=BALIOE_03540 | |
| 1427 c1 Prodigal CDS 772500 773579 . - 0 ID=BALIOE_03540;Name=hypothetical protein;locus_tag=BALIOE_03540;product=hypothetical protein;Parent=BALIOE_03540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1428 c1 Prodigal gene 773693 775117 . - . ID=BALIOE_03545_gene;locus_tag=BALIOE_03545 | |
| 1429 c1 Prodigal CDS 773693 775117 . - 0 ID=BALIOE_03545;Name=hypothetical protein;locus_tag=BALIOE_03545;product=hypothetical protein;Parent=BALIOE_03545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1430 c1 Prodigal gene 775263 776438 . + . ID=BALIOE_03550_gene;locus_tag=BALIOE_03550 | |
| 1431 c1 Prodigal CDS 775263 776438 . + 0 ID=BALIOE_03550;Name=hypothetical protein;locus_tag=BALIOE_03550;product=hypothetical protein;Parent=BALIOE_03550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1432 c1 tRNAscan-SE gene 776592 776666 . - . ID=BALIOE_03555_gene;locus_tag=BALIOE_03555;gene=Gln_trna | |
| 1433 c1 tRNAscan-SE tRNA 776592 776666 . - . ID=BALIOE_03555;Name=tRNA-Gln;locus_tag=BALIOE_03555;product=tRNA-Gln;gene=Gln_trna;Parent=BALIOE_03555_gene;inference=profile:tRNAscan:2.0;Note=SO:0000261 | |
| 1434 c1 tRNAscan-SE gene 776704 776778 . - . ID=BALIOE_03560_gene;locus_tag=BALIOE_03560;gene=Gln_trna | |
| 1435 c1 tRNAscan-SE tRNA 776704 776778 . - . ID=BALIOE_03560;Name=tRNA-Gln;locus_tag=BALIOE_03560;product=tRNA-Gln;gene=Gln_trna;Parent=BALIOE_03560_gene;inference=profile:tRNAscan:2.0;Note=SO:0000261 | |
| 1436 c1 tRNAscan-SE gene 776827 776903 . - . ID=BALIOE_03565_gene;locus_tag=BALIOE_03565;gene=Met_trna | |
| 1437 c1 tRNAscan-SE tRNA 776827 776903 . - . ID=BALIOE_03565;Name=tRNA-Met;locus_tag=BALIOE_03565;product=tRNA-Met;gene=Met_trna;Parent=BALIOE_03565_gene;inference=profile:tRNAscan:2.0;Note=SO:0000266 | |
| 1438 c1 tRNAscan-SE gene 776919 776993 . - . ID=BALIOE_03570_gene;locus_tag=BALIOE_03570;gene=Gln_trna | |
| 1439 c1 tRNAscan-SE tRNA 776919 776993 . - . ID=BALIOE_03570;Name=tRNA-Gln;locus_tag=BALIOE_03570;product=tRNA-Gln;gene=Gln_trna;Parent=BALIOE_03570_gene;inference=profile:tRNAscan:2.0;Note=SO:0000261 | |
| 1440 c1 tRNAscan-SE gene 777028 777102 . - . ID=BALIOE_03575_gene;locus_tag=BALIOE_03575;gene=Gln_trna | |
| 1441 c1 tRNAscan-SE tRNA 777028 777102 . - . ID=BALIOE_03575;Name=tRNA-Gln;locus_tag=BALIOE_03575;product=tRNA-Gln;gene=Gln_trna;Parent=BALIOE_03575_gene;inference=profile:tRNAscan:2.0;Note=SO:0000261 | |
| 1442 c1 tRNAscan-SE gene 777126 777210 . - . ID=BALIOE_03580_gene;locus_tag=BALIOE_03580;gene=Leu_trna | |
| 1443 c1 tRNAscan-SE tRNA 777126 777210 . - . ID=BALIOE_03580;Name=tRNA-Leu;locus_tag=BALIOE_03580;product=tRNA-Leu;gene=Leu_trna;Parent=BALIOE_03580_gene;inference=profile:tRNAscan:2.0;Note=SO:0000264 | |
| 1444 c1 tRNAscan-SE gene 777221 777297 . - . ID=BALIOE_03585_gene;locus_tag=BALIOE_03585;gene=Met_trna | |
| 1445 c1 tRNAscan-SE tRNA 777221 777297 . - . ID=BALIOE_03585;Name=tRNA-Met;locus_tag=BALIOE_03585;product=tRNA-Met;gene=Met_trna;Parent=BALIOE_03585_gene;inference=profile:tRNAscan:2.0;Note=SO:0000266 | |
| 1446 c1 Prodigal gene 777677 779341 . - . ID=BALIOE_03590_gene;locus_tag=BALIOE_03590 | |
| 1447 c1 Prodigal CDS 777677 779341 . - 0 ID=BALIOE_03590;Name=hypothetical protein;locus_tag=BALIOE_03590;product=hypothetical protein;Parent=BALIOE_03590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1448 c1 Prodigal gene 779598 780350 . - . ID=BALIOE_03595_gene;locus_tag=BALIOE_03595 | |
| 1449 c1 Prodigal CDS 779598 780350 . - 0 ID=BALIOE_03595;Name=hypothetical protein;locus_tag=BALIOE_03595;product=hypothetical protein;Parent=BALIOE_03595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1450 c1 Prodigal gene 780398 781618 . - . ID=BALIOE_03600_gene;locus_tag=BALIOE_03600 | |
| 1451 c1 Prodigal CDS 780398 781618 . - 0 ID=BALIOE_03600;Name=hypothetical protein;locus_tag=BALIOE_03600;product=hypothetical protein;Parent=BALIOE_03600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1452 c1 Prodigal gene 781627 782775 . - . ID=BALIOE_03605_gene;locus_tag=BALIOE_03605 | |
| 1453 c1 Prodigal CDS 781627 782775 . - 0 ID=BALIOE_03605;Name=hypothetical protein;locus_tag=BALIOE_03605;product=hypothetical protein;Parent=BALIOE_03605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1454 c1 Prodigal gene 782835 783635 . - . ID=BALIOE_03610_gene;locus_tag=BALIOE_03610 | |
| 1455 c1 Prodigal CDS 782835 783635 . - 0 ID=BALIOE_03610;Name=hypothetical protein;locus_tag=BALIOE_03610;product=hypothetical protein;Parent=BALIOE_03610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1456 c1 Prodigal gene 783968 785914 . + . ID=BALIOE_03615_gene;locus_tag=BALIOE_03615 | |
| 1457 c1 Prodigal CDS 783968 785914 . + 0 ID=BALIOE_03615;Name=hypothetical protein;locus_tag=BALIOE_03615;product=hypothetical protein;Parent=BALIOE_03615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1458 c1 Prodigal gene 786117 787781 . + . ID=BALIOE_03620_gene;locus_tag=BALIOE_03620 | |
| 1459 c1 Prodigal CDS 786117 787781 . + 0 ID=BALIOE_03620;Name=hypothetical protein;locus_tag=BALIOE_03620;product=hypothetical protein;Parent=BALIOE_03620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1460 c1 Prodigal gene 788360 788839 . + . ID=BALIOE_03625_gene;locus_tag=BALIOE_03625 | |
| 1461 c1 Prodigal CDS 788360 788839 . + 0 ID=BALIOE_03625;Name=hypothetical protein;locus_tag=BALIOE_03625;product=hypothetical protein;Parent=BALIOE_03625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1462 c1 Prodigal gene 788857 789765 . + . ID=BALIOE_03630_gene;locus_tag=BALIOE_03630 | |
| 1463 c1 Prodigal CDS 788857 789765 . + 0 ID=BALIOE_03630;Name=hypothetical protein;locus_tag=BALIOE_03630;product=hypothetical protein;Parent=BALIOE_03630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1464 c1 Prodigal gene 789815 790141 . + . ID=BALIOE_03635_gene;locus_tag=BALIOE_03635 | |
| 1465 c1 Prodigal CDS 789815 790141 . + 0 ID=BALIOE_03635;Name=hypothetical protein;locus_tag=BALIOE_03635;product=hypothetical protein;Parent=BALIOE_03635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1466 c1 Prodigal gene 790225 790671 . - . ID=BALIOE_03640_gene;locus_tag=BALIOE_03640 | |
| 1467 c1 Prodigal CDS 790225 790671 . - 0 ID=BALIOE_03640;Name=hypothetical protein;locus_tag=BALIOE_03640;product=hypothetical protein;Parent=BALIOE_03640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1468 c1 Prodigal gene 790960 791490 . - . ID=BALIOE_03645_gene;locus_tag=BALIOE_03645 | |
| 1469 c1 Prodigal CDS 790960 791490 . - 0 ID=BALIOE_03645;Name=hypothetical protein;locus_tag=BALIOE_03645;product=hypothetical protein;Parent=BALIOE_03645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1470 c1 Prodigal gene 791630 791992 . - . ID=BALIOE_03650_gene;locus_tag=BALIOE_03650 | |
| 1471 c1 Prodigal CDS 791630 791992 . - 0 ID=BALIOE_03650;Name=hypothetical protein;locus_tag=BALIOE_03650;product=hypothetical protein;Parent=BALIOE_03650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1472 c1 Prodigal gene 792063 792827 . - . ID=BALIOE_03655_gene;locus_tag=BALIOE_03655 | |
| 1473 c1 Prodigal CDS 792063 792827 . - 0 ID=BALIOE_03655;Name=hypothetical protein;locus_tag=BALIOE_03655;product=hypothetical protein;Parent=BALIOE_03655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1474 c1 Prodigal gene 793012 793557 . + . ID=BALIOE_03660_gene;locus_tag=BALIOE_03660 | |
| 1475 c1 Prodigal CDS 793012 793557 . + 0 ID=BALIOE_03660;Name=hypothetical protein;locus_tag=BALIOE_03660;product=hypothetical protein;Parent=BALIOE_03660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1476 c1 Prodigal gene 793583 795223 . + . ID=BALIOE_03665_gene;locus_tag=BALIOE_03665 | |
| 1477 c1 Prodigal CDS 793583 795223 . + 0 ID=BALIOE_03665;Name=hypothetical protein;locus_tag=BALIOE_03665;product=hypothetical protein;Parent=BALIOE_03665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1478 c1 Prodigal gene 795280 796599 . - . ID=BALIOE_03670_gene;locus_tag=BALIOE_03670 | |
| 1479 c1 Prodigal CDS 795280 796599 . - 0 ID=BALIOE_03670;Name=hypothetical protein;locus_tag=BALIOE_03670;product=hypothetical protein;Parent=BALIOE_03670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1480 c1 Prodigal gene 796596 798794 . - . ID=BALIOE_03675_gene;locus_tag=BALIOE_03675 | |
| 1481 c1 Prodigal CDS 796596 798794 . - 0 ID=BALIOE_03675;Name=hypothetical protein;locus_tag=BALIOE_03675;product=hypothetical protein;Parent=BALIOE_03675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1482 c1 Prodigal gene 799105 799209 . - . ID=BALIOE_03680_gene;locus_tag=BALIOE_03680 | |
| 1483 c1 Prodigal CDS 799105 799209 . - 0 ID=BALIOE_03680;Name=hypothetical protein;locus_tag=BALIOE_03680;product=hypothetical protein;Parent=BALIOE_03680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1484 c1 Prodigal gene 799484 800161 . - . ID=BALIOE_03685_gene;locus_tag=BALIOE_03685 | |
| 1485 c1 Prodigal CDS 799484 800161 . - 0 ID=BALIOE_03685;Name=hypothetical protein;locus_tag=BALIOE_03685;product=hypothetical protein;Parent=BALIOE_03685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1486 c1 Prodigal gene 800158 802842 . - . ID=BALIOE_03690_gene;locus_tag=BALIOE_03690 | |
| 1487 c1 Prodigal CDS 800158 802842 . - 0 ID=BALIOE_03690;Name=hypothetical protein;locus_tag=BALIOE_03690;product=hypothetical protein;Parent=BALIOE_03690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1488 c1 Prodigal gene 802835 803407 . - . ID=BALIOE_03695_gene;locus_tag=BALIOE_03695 | |
| 1489 c1 Prodigal CDS 802835 803407 . - 0 ID=BALIOE_03695;Name=hypothetical protein;locus_tag=BALIOE_03695;product=hypothetical protein;Parent=BALIOE_03695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1490 c1 Prodigal gene 803416 805464 . - . ID=BALIOE_03700_gene;locus_tag=BALIOE_03700 | |
| 1491 c1 Prodigal CDS 803416 805464 . - 0 ID=BALIOE_03700;Name=hypothetical protein;locus_tag=BALIOE_03700;product=hypothetical protein;Parent=BALIOE_03700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1492 c1 Prodigal gene 805487 807160 . - . ID=BALIOE_03705_gene;locus_tag=BALIOE_03705 | |
| 1493 c1 Prodigal CDS 805487 807160 . - 0 ID=BALIOE_03705;Name=hypothetical protein;locus_tag=BALIOE_03705;product=hypothetical protein;Parent=BALIOE_03705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1494 c1 Prodigal gene 807562 807768 . + . ID=BALIOE_03710_gene;locus_tag=BALIOE_03710 | |
| 1495 c1 Prodigal CDS 807562 807768 . + 0 ID=BALIOE_03710;Name=hypothetical protein;locus_tag=BALIOE_03710;product=hypothetical protein;Parent=BALIOE_03710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1496 c1 Prodigal gene 808010 812209 . + . ID=BALIOE_03715_gene;locus_tag=BALIOE_03715 | |
| 1497 c1 Prodigal CDS 808010 812209 . + 0 ID=BALIOE_03715;Name=hypothetical protein;locus_tag=BALIOE_03715;product=hypothetical protein;Parent=BALIOE_03715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1498 c1 Prodigal gene 812234 812776 . + . ID=BALIOE_03720_gene;locus_tag=BALIOE_03720 | |
| 1499 c1 Prodigal CDS 812234 812776 . + 0 ID=BALIOE_03720;Name=hypothetical protein;locus_tag=BALIOE_03720;product=hypothetical protein;Parent=BALIOE_03720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1500 c1 Prodigal gene 814426 815499 . + . ID=BALIOE_03725_gene;locus_tag=BALIOE_03725 | |
| 1501 c1 Prodigal CDS 814426 815499 . + 0 ID=BALIOE_03725;Name=hypothetical protein;locus_tag=BALIOE_03725;product=hypothetical protein;Parent=BALIOE_03725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1502 c1 Prodigal gene 815648 816157 . + . ID=BALIOE_03730_gene;locus_tag=BALIOE_03730 | |
| 1503 c1 Prodigal CDS 815648 816157 . + 0 ID=BALIOE_03730;Name=hypothetical protein;locus_tag=BALIOE_03730;product=hypothetical protein;Parent=BALIOE_03730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1504 c1 Prodigal gene 816154 817572 . + . ID=BALIOE_03735_gene;locus_tag=BALIOE_03735 | |
| 1505 c1 Prodigal CDS 816154 817572 . + 0 ID=BALIOE_03735;Name=hypothetical protein;locus_tag=BALIOE_03735;product=hypothetical protein;Parent=BALIOE_03735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1506 c1 Prodigal gene 817722 819203 . - . ID=BALIOE_03740_gene;locus_tag=BALIOE_03740 | |
| 1507 c1 Prodigal CDS 817722 819203 . - 0 ID=BALIOE_03740;Name=hypothetical protein;locus_tag=BALIOE_03740;product=hypothetical protein;Parent=BALIOE_03740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1508 c1 Prodigal gene 819474 820217 . + . ID=BALIOE_03745_gene;locus_tag=BALIOE_03745 | |
| 1509 c1 Prodigal CDS 819474 820217 . + 0 ID=BALIOE_03745;Name=hypothetical protein;locus_tag=BALIOE_03745;product=hypothetical protein;Parent=BALIOE_03745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1510 c1 Prodigal gene 820240 820896 . + . ID=BALIOE_03750_gene;locus_tag=BALIOE_03750 | |
| 1511 c1 Prodigal CDS 820240 820896 . + 0 ID=BALIOE_03750;Name=hypothetical protein;locus_tag=BALIOE_03750;product=hypothetical protein;Parent=BALIOE_03750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1512 c1 Prodigal gene 820890 821822 . + . ID=BALIOE_03755_gene;locus_tag=BALIOE_03755 | |
| 1513 c1 Prodigal CDS 820890 821822 . + 0 ID=BALIOE_03755;Name=hypothetical protein;locus_tag=BALIOE_03755;product=hypothetical protein;Parent=BALIOE_03755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1514 c1 Prodigal gene 821812 822546 . + . ID=BALIOE_03760_gene;locus_tag=BALIOE_03760 | |
| 1515 c1 Prodigal CDS 821812 822546 . + 0 ID=BALIOE_03760;Name=hypothetical protein;locus_tag=BALIOE_03760;product=hypothetical protein;Parent=BALIOE_03760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1516 c1 Prodigal gene 822582 823373 . + . ID=BALIOE_03765_gene;locus_tag=BALIOE_03765 | |
| 1517 c1 Prodigal CDS 822582 823373 . + 0 ID=BALIOE_03765;Name=hypothetical protein;locus_tag=BALIOE_03765;product=hypothetical protein;Parent=BALIOE_03765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1518 c1 Prodigal gene 823370 824416 . - . ID=BALIOE_03770_gene;locus_tag=BALIOE_03770 | |
| 1519 c1 Prodigal CDS 823370 824416 . - 0 ID=BALIOE_03770;Name=hypothetical protein;locus_tag=BALIOE_03770;product=hypothetical protein;Parent=BALIOE_03770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1520 c1 Prodigal gene 824565 825626 . - . ID=BALIOE_03775_gene;locus_tag=BALIOE_03775 | |
| 1521 c1 Prodigal CDS 824565 825626 . - 0 ID=BALIOE_03775;Name=hypothetical protein;locus_tag=BALIOE_03775;product=hypothetical protein;Parent=BALIOE_03775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1522 c1 Prodigal gene 825623 826354 . - . ID=BALIOE_03780_gene;locus_tag=BALIOE_03780 | |
| 1523 c1 Prodigal CDS 825623 826354 . - 0 ID=BALIOE_03780;Name=hypothetical protein;locus_tag=BALIOE_03780;product=hypothetical protein;Parent=BALIOE_03780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1524 c1 Prodigal gene 826369 826518 . - . ID=BALIOE_03785_gene;locus_tag=BALIOE_03785 | |
| 1525 c1 Prodigal CDS 826369 826518 . - 0 ID=BALIOE_03785;Name=hypothetical protein;locus_tag=BALIOE_03785;product=hypothetical protein;Parent=BALIOE_03785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1526 c1 Prodigal gene 826657 828819 . - . ID=BALIOE_03790_gene;locus_tag=BALIOE_03790 | |
| 1527 c1 Prodigal CDS 826657 828819 . - 0 ID=BALIOE_03790;Name=hypothetical protein;locus_tag=BALIOE_03790;product=hypothetical protein;Parent=BALIOE_03790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1528 c1 Prodigal gene 828878 829444 . - . ID=BALIOE_03795_gene;locus_tag=BALIOE_03795 | |
| 1529 c1 Prodigal CDS 828878 829444 . - 0 ID=BALIOE_03795;Name=hypothetical protein;locus_tag=BALIOE_03795;product=hypothetical protein;Parent=BALIOE_03795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1530 c1 Prodigal gene 829831 831114 . - . ID=BALIOE_03800_gene;locus_tag=BALIOE_03800 | |
| 1531 c1 Prodigal CDS 829831 831114 . - 0 ID=BALIOE_03800;Name=hypothetical protein;locus_tag=BALIOE_03800;product=hypothetical protein;Parent=BALIOE_03800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1532 c1 Prodigal gene 831320 831427 . - . ID=BALIOE_03805_gene;locus_tag=BALIOE_03805 | |
| 1533 c1 Prodigal CDS 831320 831427 . - 0 ID=BALIOE_03805;Name=hypothetical protein;locus_tag=BALIOE_03805;product=hypothetical protein;Parent=BALIOE_03805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1534 c1 Prodigal gene 831808 832212 . + . ID=BALIOE_03810_gene;locus_tag=BALIOE_03810 | |
| 1535 c1 Prodigal CDS 831808 832212 . + 0 ID=BALIOE_03810;Name=hypothetical protein;locus_tag=BALIOE_03810;product=hypothetical protein;Parent=BALIOE_03810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1536 c1 Prodigal gene 832206 832553 . + . ID=BALIOE_03815_gene;locus_tag=BALIOE_03815 | |
| 1537 c1 Prodigal CDS 832206 832553 . + 0 ID=BALIOE_03815;Name=hypothetical protein;locus_tag=BALIOE_03815;product=hypothetical protein;Parent=BALIOE_03815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1538 c1 Prodigal gene 832553 834319 . + . ID=BALIOE_03820_gene;locus_tag=BALIOE_03820 | |
| 1539 c1 Prodigal CDS 832553 834319 . + 0 ID=BALIOE_03820;Name=hypothetical protein;locus_tag=BALIOE_03820;product=hypothetical protein;Parent=BALIOE_03820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1540 c1 Prodigal gene 834335 835051 . + . ID=BALIOE_03825_gene;locus_tag=BALIOE_03825 | |
| 1541 c1 Prodigal CDS 834335 835051 . + 0 ID=BALIOE_03825;Name=hypothetical protein;locus_tag=BALIOE_03825;product=hypothetical protein;Parent=BALIOE_03825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1542 c1 Infernal gene 835058 835128 . - . ID=BALIOE_03830_gene;locus_tag=BALIOE_03830;gene=naRNA4 | |
| 1543 c1 Infernal ncRNA 835058 835128 2.2e-13 - . ID=BALIOE_03830;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_03830;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_03830_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 1544 c1 Prodigal gene 835352 838153 . + . ID=BALIOE_03835_gene;locus_tag=BALIOE_03835 | |
| 1545 c1 Prodigal CDS 835352 838153 . + 0 ID=BALIOE_03835;Name=hypothetical protein;locus_tag=BALIOE_03835;product=hypothetical protein;Parent=BALIOE_03835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1546 c1 Prodigal gene 838168 839385 . + . ID=BALIOE_03840_gene;locus_tag=BALIOE_03840 | |
| 1547 c1 Prodigal CDS 838168 839385 . + 0 ID=BALIOE_03840;Name=hypothetical protein;locus_tag=BALIOE_03840;product=hypothetical protein;Parent=BALIOE_03840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1548 c1 Prodigal gene 839479 840645 . + . ID=BALIOE_03845_gene;locus_tag=BALIOE_03845 | |
| 1549 c1 Prodigal CDS 839479 840645 . + 0 ID=BALIOE_03845;Name=hypothetical protein;locus_tag=BALIOE_03845;product=hypothetical protein;Parent=BALIOE_03845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1550 c1 Prodigal gene 840645 841514 . + . ID=BALIOE_03850_gene;locus_tag=BALIOE_03850 | |
| 1551 c1 Prodigal CDS 840645 841514 . + 0 ID=BALIOE_03850;Name=hypothetical protein;locus_tag=BALIOE_03850;product=hypothetical protein;Parent=BALIOE_03850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1552 c1 Prodigal gene 842181 843086 . + . ID=BALIOE_03855_gene;locus_tag=BALIOE_03855 | |
| 1553 c1 Prodigal CDS 842181 843086 . + 0 ID=BALIOE_03855;Name=hypothetical protein;locus_tag=BALIOE_03855;product=hypothetical protein;Parent=BALIOE_03855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1554 c1 Prodigal gene 843120 843722 . - . ID=BALIOE_03860_gene;locus_tag=BALIOE_03860 | |
| 1555 c1 Prodigal CDS 843120 843722 . - 0 ID=BALIOE_03860;Name=hypothetical protein;locus_tag=BALIOE_03860;product=hypothetical protein;Parent=BALIOE_03860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1556 c1 Prodigal gene 843732 845384 . - . ID=BALIOE_03865_gene;locus_tag=BALIOE_03865 | |
| 1557 c1 Prodigal CDS 843732 845384 . - 0 ID=BALIOE_03865;Name=hypothetical protein;locus_tag=BALIOE_03865;product=hypothetical protein;Parent=BALIOE_03865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1558 c1 Prodigal gene 845492 846772 . - . ID=BALIOE_03870_gene;locus_tag=BALIOE_03870 | |
| 1559 c1 Prodigal CDS 845492 846772 . - 0 ID=BALIOE_03870;Name=hypothetical protein;locus_tag=BALIOE_03870;product=hypothetical protein;Parent=BALIOE_03870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1560 c1 Prodigal gene 846933 847250 . - . ID=BALIOE_03875_gene;locus_tag=BALIOE_03875 | |
| 1561 c1 Prodigal CDS 846933 847250 . - 0 ID=BALIOE_03875;Name=hypothetical protein;locus_tag=BALIOE_03875;product=hypothetical protein;Parent=BALIOE_03875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1562 c1 Prodigal gene 847247 848617 . - . ID=BALIOE_03880_gene;locus_tag=BALIOE_03880 | |
| 1563 c1 Prodigal CDS 847247 848617 . - 0 ID=BALIOE_03880;Name=hypothetical protein;locus_tag=BALIOE_03880;product=hypothetical protein;Parent=BALIOE_03880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1564 c1 Prodigal gene 848621 849862 . - . ID=BALIOE_03885_gene;locus_tag=BALIOE_03885 | |
| 1565 c1 Prodigal CDS 848621 849862 . - 0 ID=BALIOE_03885;Name=hypothetical protein;locus_tag=BALIOE_03885;product=hypothetical protein;Parent=BALIOE_03885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1566 c1 Prodigal gene 849862 851307 . - . ID=BALIOE_03890_gene;locus_tag=BALIOE_03890 | |
| 1567 c1 Prodigal CDS 849862 851307 . - 0 ID=BALIOE_03890;Name=hypothetical protein;locus_tag=BALIOE_03890;product=hypothetical protein;Parent=BALIOE_03890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1568 c1 Prodigal gene 851326 852714 . - . ID=BALIOE_03895_gene;locus_tag=BALIOE_03895 | |
| 1569 c1 Prodigal CDS 851326 852714 . - 0 ID=BALIOE_03895;Name=hypothetical protein;locus_tag=BALIOE_03895;product=hypothetical protein;Parent=BALIOE_03895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1570 c1 Prodigal gene 852714 853163 . - . ID=BALIOE_03900_gene;locus_tag=BALIOE_03900 | |
| 1571 c1 Prodigal CDS 852714 853163 . - 0 ID=BALIOE_03900;Name=hypothetical protein;locus_tag=BALIOE_03900;product=hypothetical protein;Parent=BALIOE_03900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1572 c1 Prodigal gene 853711 854133 . - . ID=BALIOE_03905_gene;locus_tag=BALIOE_03905 | |
| 1573 c1 Prodigal CDS 853711 854133 . - 0 ID=BALIOE_03905;Name=hypothetical protein;locus_tag=BALIOE_03905;product=hypothetical protein;Parent=BALIOE_03905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1574 c1 Prodigal gene 854215 855159 . - . ID=BALIOE_03910_gene;locus_tag=BALIOE_03910 | |
| 1575 c1 Prodigal CDS 854215 855159 . - 0 ID=BALIOE_03910;Name=hypothetical protein;locus_tag=BALIOE_03910;product=hypothetical protein;Parent=BALIOE_03910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1576 c1 Prodigal gene 855965 857533 . + . ID=BALIOE_03915_gene;locus_tag=BALIOE_03915 | |
| 1577 c1 Prodigal CDS 855965 857533 . + 0 ID=BALIOE_03915;Name=hypothetical protein;locus_tag=BALIOE_03915;product=hypothetical protein;Parent=BALIOE_03915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1578 c1 Prodigal gene 857549 858688 . + . ID=BALIOE_03920_gene;locus_tag=BALIOE_03920 | |
| 1579 c1 Prodigal CDS 857549 858688 . + 0 ID=BALIOE_03920;Name=hypothetical protein;locus_tag=BALIOE_03920;product=hypothetical protein;Parent=BALIOE_03920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1580 c1 Prodigal gene 858703 858816 . + . ID=BALIOE_03925_gene;locus_tag=BALIOE_03925 | |
| 1581 c1 Prodigal CDS 858703 858816 . + 0 ID=BALIOE_03925;Name=hypothetical protein;locus_tag=BALIOE_03925;product=hypothetical protein;Parent=BALIOE_03925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1582 c1 Prodigal gene 858816 859109 . + . ID=BALIOE_03930_gene;locus_tag=BALIOE_03930 | |
| 1583 c1 Prodigal CDS 858816 859109 . + 0 ID=BALIOE_03930;Name=hypothetical protein;locus_tag=BALIOE_03930;product=hypothetical protein;Parent=BALIOE_03930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1584 c1 Prodigal gene 859259 859663 . + . ID=BALIOE_03935_gene;locus_tag=BALIOE_03935 | |
| 1585 c1 Prodigal CDS 859259 859663 . + 0 ID=BALIOE_03935;Name=hypothetical protein;locus_tag=BALIOE_03935;product=hypothetical protein;Parent=BALIOE_03935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1586 c1 Prodigal gene 859660 860352 . + . ID=BALIOE_03940_gene;locus_tag=BALIOE_03940 | |
| 1587 c1 Prodigal CDS 859660 860352 . + 0 ID=BALIOE_03940;Name=hypothetical protein;locus_tag=BALIOE_03940;product=hypothetical protein;Parent=BALIOE_03940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1588 c1 Prodigal gene 860356 860784 . + . ID=BALIOE_03945_gene;locus_tag=BALIOE_03945 | |
| 1589 c1 Prodigal CDS 860356 860784 . + 0 ID=BALIOE_03945;Name=hypothetical protein;locus_tag=BALIOE_03945;product=hypothetical protein;Parent=BALIOE_03945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1590 c1 Prodigal gene 860849 862033 . + . ID=BALIOE_03950_gene;locus_tag=BALIOE_03950 | |
| 1591 c1 Prodigal CDS 860849 862033 . + 0 ID=BALIOE_03950;Name=hypothetical protein;locus_tag=BALIOE_03950;product=hypothetical protein;Parent=BALIOE_03950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1592 c1 Prodigal gene 862166 863458 . + . ID=BALIOE_03955_gene;locus_tag=BALIOE_03955 | |
| 1593 c1 Prodigal CDS 862166 863458 . + 0 ID=BALIOE_03955;Name=hypothetical protein;locus_tag=BALIOE_03955;product=hypothetical protein;Parent=BALIOE_03955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1594 c1 Prodigal gene 863493 864014 . + . ID=BALIOE_03960_gene;locus_tag=BALIOE_03960 | |
| 1595 c1 Prodigal CDS 863493 864014 . + 0 ID=BALIOE_03960;Name=hypothetical protein;locus_tag=BALIOE_03960;product=hypothetical protein;Parent=BALIOE_03960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1596 c1 Prodigal gene 864024 864815 . + . ID=BALIOE_03965_gene;locus_tag=BALIOE_03965 | |
| 1597 c1 Prodigal CDS 864024 864815 . + 0 ID=BALIOE_03965;Name=hypothetical protein;locus_tag=BALIOE_03965;product=hypothetical protein;Parent=BALIOE_03965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1598 c1 tRNAscan-SE gene 864980 865055 . + . ID=BALIOE_03970_gene;locus_tag=BALIOE_03970;gene=Lys_trna | |
| 1599 c1 tRNAscan-SE tRNA 864980 865055 . + . ID=BALIOE_03970;Name=tRNA-Lys;locus_tag=BALIOE_03970;product=tRNA-Lys;gene=Lys_trna;Parent=BALIOE_03970_gene;inference=profile:tRNAscan:2.0;Note=SO:0000265 | |
| 1600 c1 tRNAscan-SE gene 865091 865166 . + . ID=BALIOE_03975_gene;locus_tag=BALIOE_03975;gene=Val_trna | |
| 1601 c1 tRNAscan-SE tRNA 865091 865166 . + . ID=BALIOE_03975;Name=tRNA-Val;locus_tag=BALIOE_03975;product=tRNA-Val;gene=Val_trna;Parent=BALIOE_03975_gene;inference=profile:tRNAscan:2.0;Note=SO:0000273 | |
| 1602 c1 tRNAscan-SE gene 865169 865244 . + . ID=BALIOE_03980_gene;locus_tag=BALIOE_03980;gene=Lys_trna | |
| 1603 c1 tRNAscan-SE tRNA 865169 865244 . + . ID=BALIOE_03980;Name=tRNA-Lys;locus_tag=BALIOE_03980;product=tRNA-Lys;gene=Lys_trna;Parent=BALIOE_03980_gene;inference=profile:tRNAscan:2.0;Note=SO:0000265 | |
| 1604 c1 tRNAscan-SE gene 865296 865371 . + . ID=BALIOE_03985_gene;locus_tag=BALIOE_03985;gene=Val_trna | |
| 1605 c1 tRNAscan-SE tRNA 865296 865371 . + . ID=BALIOE_03985;Name=tRNA-Val;locus_tag=BALIOE_03985;product=tRNA-Val;gene=Val_trna;Parent=BALIOE_03985_gene;inference=profile:tRNAscan:2.0;Note=SO:0000273 | |
| 1606 c1 tRNAscan-SE gene 865375 865450 . + . ID=BALIOE_03990_gene;locus_tag=BALIOE_03990;gene=Lys_trna | |
| 1607 c1 tRNAscan-SE tRNA 865375 865450 . + . ID=BALIOE_03990;Name=tRNA-Lys;locus_tag=BALIOE_03990;product=tRNA-Lys;gene=Lys_trna;Parent=BALIOE_03990_gene;inference=profile:tRNAscan:2.0;Note=SO:0000265 | |
| 1608 c1 tRNAscan-SE gene 865597 865672 . + . ID=BALIOE_03995_gene;locus_tag=BALIOE_03995;gene=Lys_trna | |
| 1609 c1 tRNAscan-SE tRNA 865597 865672 . + . ID=BALIOE_03995;Name=tRNA-Lys;locus_tag=BALIOE_03995;product=tRNA-Lys;gene=Lys_trna;Parent=BALIOE_03995_gene;inference=profile:tRNAscan:2.0;Note=SO:0000265 | |
| 1610 c1 Prodigal gene 865950 866993 . + . ID=BALIOE_04000_gene;locus_tag=BALIOE_04000 | |
| 1611 c1 Prodigal CDS 865950 866993 . + 0 ID=BALIOE_04000;Name=hypothetical protein;locus_tag=BALIOE_04000;product=hypothetical protein;Parent=BALIOE_04000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1612 c1 Prodigal gene 867031 867750 . + . ID=BALIOE_04005_gene;locus_tag=BALIOE_04005 | |
| 1613 c1 Prodigal CDS 867031 867750 . + 0 ID=BALIOE_04005;Name=hypothetical protein;locus_tag=BALIOE_04005;product=hypothetical protein;Parent=BALIOE_04005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1614 c1 Prodigal gene 867747 868688 . - . ID=BALIOE_04010_gene;locus_tag=BALIOE_04010 | |
| 1615 c1 Prodigal CDS 867747 868688 . - 0 ID=BALIOE_04010;Name=hypothetical protein;locus_tag=BALIOE_04010;product=hypothetical protein;Parent=BALIOE_04010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1616 c1 Prodigal gene 868802 869182 . - . ID=BALIOE_04015_gene;locus_tag=BALIOE_04015 | |
| 1617 c1 Prodigal CDS 868802 869182 . - 0 ID=BALIOE_04015;Name=hypothetical protein;locus_tag=BALIOE_04015;product=hypothetical protein;Parent=BALIOE_04015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1618 c1 Prodigal gene 869498 870550 . + . ID=BALIOE_04020_gene;locus_tag=BALIOE_04020 | |
| 1619 c1 Prodigal CDS 869498 870550 . + 0 ID=BALIOE_04020;Name=hypothetical protein;locus_tag=BALIOE_04020;product=hypothetical protein;Parent=BALIOE_04020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1620 c1 Prodigal gene 870716 871468 . - . ID=BALIOE_04025_gene;locus_tag=BALIOE_04025 | |
| 1621 c1 Prodigal CDS 870716 871468 . - 0 ID=BALIOE_04025;Name=hypothetical protein;locus_tag=BALIOE_04025;product=hypothetical protein;Parent=BALIOE_04025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1622 c1 Prodigal gene 871670 872710 . - . ID=BALIOE_04030_gene;locus_tag=BALIOE_04030 | |
| 1623 c1 Prodigal CDS 871670 872710 . - 0 ID=BALIOE_04030;Name=hypothetical protein;locus_tag=BALIOE_04030;product=hypothetical protein;Parent=BALIOE_04030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1624 c1 Prodigal gene 872704 873852 . - . ID=BALIOE_04035_gene;locus_tag=BALIOE_04035 | |
| 1625 c1 Prodigal CDS 872704 873852 . - 0 ID=BALIOE_04035;Name=hypothetical protein;locus_tag=BALIOE_04035;product=hypothetical protein;Parent=BALIOE_04035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1626 c1 Prodigal gene 873856 874902 . - . ID=BALIOE_04040_gene;locus_tag=BALIOE_04040 | |
| 1627 c1 Prodigal CDS 873856 874902 . - 0 ID=BALIOE_04040;Name=hypothetical protein;locus_tag=BALIOE_04040;product=hypothetical protein;Parent=BALIOE_04040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1628 c1 Prodigal gene 874912 875928 . - . ID=BALIOE_04045_gene;locus_tag=BALIOE_04045 | |
| 1629 c1 Prodigal CDS 874912 875928 . - 0 ID=BALIOE_04045;Name=hypothetical protein;locus_tag=BALIOE_04045;product=hypothetical protein;Parent=BALIOE_04045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1630 c1 Prodigal gene 876190 877662 . - . ID=BALIOE_04050_gene;locus_tag=BALIOE_04050 | |
| 1631 c1 Prodigal CDS 876190 877662 . - 0 ID=BALIOE_04050;Name=hypothetical protein;locus_tag=BALIOE_04050;product=hypothetical protein;Parent=BALIOE_04050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1632 c1 Prodigal gene 877730 878518 . - . ID=BALIOE_04055_gene;locus_tag=BALIOE_04055 | |
| 1633 c1 Prodigal CDS 877730 878518 . - 0 ID=BALIOE_04055;Name=hypothetical protein;locus_tag=BALIOE_04055;product=hypothetical protein;Parent=BALIOE_04055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1634 c1 Prodigal gene 878647 878796 . + . ID=BALIOE_04060_gene;locus_tag=BALIOE_04060 | |
| 1635 c1 Prodigal CDS 878647 878796 . + 0 ID=BALIOE_04060;Name=hypothetical protein;locus_tag=BALIOE_04060;product=hypothetical protein;Parent=BALIOE_04060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1636 c1 Prodigal gene 878963 879736 . + . ID=BALIOE_04065_gene;locus_tag=BALIOE_04065 | |
| 1637 c1 Prodigal CDS 878963 879736 . + 0 ID=BALIOE_04065;Name=hypothetical protein;locus_tag=BALIOE_04065;product=hypothetical protein;Parent=BALIOE_04065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1638 c1 Prodigal gene 879736 880425 . + . ID=BALIOE_04070_gene;locus_tag=BALIOE_04070 | |
| 1639 c1 Prodigal CDS 879736 880425 . + 0 ID=BALIOE_04070;Name=hypothetical protein;locus_tag=BALIOE_04070;product=hypothetical protein;Parent=BALIOE_04070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1640 c1 Prodigal gene 880428 881486 . + . ID=BALIOE_04075_gene;locus_tag=BALIOE_04075 | |
| 1641 c1 Prodigal CDS 880428 881486 . + 0 ID=BALIOE_04075;Name=hypothetical protein;locus_tag=BALIOE_04075;product=hypothetical protein;Parent=BALIOE_04075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1642 c1 Prodigal gene 881487 882305 . - . ID=BALIOE_04080_gene;locus_tag=BALIOE_04080 | |
| 1643 c1 Prodigal CDS 881487 882305 . - 0 ID=BALIOE_04080;Name=hypothetical protein;locus_tag=BALIOE_04080;product=hypothetical protein;Parent=BALIOE_04080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1644 c1 Prodigal gene 882460 883455 . + . ID=BALIOE_04085_gene;locus_tag=BALIOE_04085 | |
| 1645 c1 Prodigal CDS 882460 883455 . + 0 ID=BALIOE_04085;Name=hypothetical protein;locus_tag=BALIOE_04085;product=hypothetical protein;Parent=BALIOE_04085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1646 c1 Prodigal gene 883496 884449 . - . ID=BALIOE_04090_gene;locus_tag=BALIOE_04090 | |
| 1647 c1 Prodigal CDS 883496 884449 . - 0 ID=BALIOE_04090;Name=hypothetical protein;locus_tag=BALIOE_04090;product=hypothetical protein;Parent=BALIOE_04090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1648 c1 Prodigal gene 884633 885685 . + . ID=BALIOE_04095_gene;locus_tag=BALIOE_04095 | |
| 1649 c1 Prodigal CDS 884633 885685 . + 0 ID=BALIOE_04095;Name=hypothetical protein;locus_tag=BALIOE_04095;product=hypothetical protein;Parent=BALIOE_04095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1650 c1 Prodigal gene 885761 887194 . + . ID=BALIOE_04100_gene;locus_tag=BALIOE_04100 | |
| 1651 c1 Prodigal CDS 885761 887194 . + 0 ID=BALIOE_04100;Name=hypothetical protein;locus_tag=BALIOE_04100;product=hypothetical protein;Parent=BALIOE_04100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1652 c1 Prodigal gene 887377 889638 . + . ID=BALIOE_04105_gene;locus_tag=BALIOE_04105 | |
| 1653 c1 Prodigal CDS 887377 889638 . + 0 ID=BALIOE_04105;Name=hypothetical protein;locus_tag=BALIOE_04105;product=hypothetical protein;Parent=BALIOE_04105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1654 c1 Prodigal gene 889779 891062 . - . ID=BALIOE_04110_gene;locus_tag=BALIOE_04110 | |
| 1655 c1 Prodigal CDS 889779 891062 . - 0 ID=BALIOE_04110;Name=hypothetical protein;locus_tag=BALIOE_04110;product=hypothetical protein;Parent=BALIOE_04110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1656 c1 Prodigal gene 891197 891967 . - . ID=BALIOE_04115_gene;locus_tag=BALIOE_04115 | |
| 1657 c1 Prodigal CDS 891197 891967 . - 0 ID=BALIOE_04115;Name=hypothetical protein;locus_tag=BALIOE_04115;product=hypothetical protein;Parent=BALIOE_04115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1658 c1 Prodigal gene 892499 892666 . - . ID=BALIOE_04120_gene;locus_tag=BALIOE_04120 | |
| 1659 c1 Prodigal CDS 892499 892666 . - 0 ID=BALIOE_04120;Name=hypothetical protein;locus_tag=BALIOE_04120;product=hypothetical protein;Parent=BALIOE_04120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1660 c1 Prodigal gene 892909 893511 . + . ID=BALIOE_04125_gene;locus_tag=BALIOE_04125 | |
| 1661 c1 Prodigal CDS 892909 893511 . + 0 ID=BALIOE_04125;Name=hypothetical protein;locus_tag=BALIOE_04125;product=hypothetical protein;Parent=BALIOE_04125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1662 c1 Prodigal gene 893722 893943 . - . ID=BALIOE_04130_gene;locus_tag=BALIOE_04130 | |
| 1663 c1 Prodigal CDS 893722 893943 . - 0 ID=BALIOE_04130;Name=hypothetical protein;locus_tag=BALIOE_04130;product=hypothetical protein;Parent=BALIOE_04130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1664 c1 Prodigal gene 894042 894257 . - . ID=BALIOE_04135_gene;locus_tag=BALIOE_04135 | |
| 1665 c1 Prodigal CDS 894042 894257 . - 0 ID=BALIOE_04135;Name=hypothetical protein;locus_tag=BALIOE_04135;product=hypothetical protein;Parent=BALIOE_04135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1666 c1 Prodigal gene 894334 894525 . - . ID=BALIOE_04140_gene;locus_tag=BALIOE_04140 | |
| 1667 c1 Prodigal CDS 894334 894525 . - 0 ID=BALIOE_04140;Name=hypothetical protein;locus_tag=BALIOE_04140;product=hypothetical protein;Parent=BALIOE_04140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1668 c1 Prodigal gene 894498 894680 . - . ID=BALIOE_04145_gene;locus_tag=BALIOE_04145 | |
| 1669 c1 Prodigal CDS 894498 894680 . - 0 ID=BALIOE_04145;Name=hypothetical protein;locus_tag=BALIOE_04145;product=hypothetical protein;Parent=BALIOE_04145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1670 c1 Prodigal gene 894677 895357 . - . ID=BALIOE_04150_gene;locus_tag=BALIOE_04150 | |
| 1671 c1 Prodigal CDS 894677 895357 . - 0 ID=BALIOE_04150;Name=hypothetical protein;locus_tag=BALIOE_04150;product=hypothetical protein;Parent=BALIOE_04150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1672 c1 Prodigal gene 895354 896001 . - . ID=BALIOE_04155_gene;locus_tag=BALIOE_04155 | |
| 1673 c1 Prodigal CDS 895354 896001 . - 0 ID=BALIOE_04155;Name=hypothetical protein;locus_tag=BALIOE_04155;product=hypothetical protein;Parent=BALIOE_04155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1674 c1 Prodigal gene 896394 897017 . + . ID=BALIOE_04160_gene;locus_tag=BALIOE_04160 | |
| 1675 c1 Prodigal CDS 896394 897017 . + 0 ID=BALIOE_04160;Name=hypothetical protein;locus_tag=BALIOE_04160;product=hypothetical protein;Parent=BALIOE_04160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1676 c1 Prodigal gene 897014 897679 . + . ID=BALIOE_04165_gene;locus_tag=BALIOE_04165 | |
| 1677 c1 Prodigal CDS 897014 897679 . + 0 ID=BALIOE_04165;Name=hypothetical protein;locus_tag=BALIOE_04165;product=hypothetical protein;Parent=BALIOE_04165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1678 c1 Prodigal gene 897891 898850 . - . ID=BALIOE_04170_gene;locus_tag=BALIOE_04170 | |
| 1679 c1 Prodigal CDS 897891 898850 . - 0 ID=BALIOE_04170;Name=hypothetical protein;locus_tag=BALIOE_04170;product=hypothetical protein;Parent=BALIOE_04170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1680 c1 Prodigal gene 899325 900014 . + . ID=BALIOE_04175_gene;locus_tag=BALIOE_04175 | |
| 1681 c1 Prodigal CDS 899325 900014 . + 0 ID=BALIOE_04175;Name=hypothetical protein;locus_tag=BALIOE_04175;product=hypothetical protein;Parent=BALIOE_04175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1682 c1 Prodigal gene 900198 900941 . + . ID=BALIOE_04180_gene;locus_tag=BALIOE_04180 | |
| 1683 c1 Prodigal CDS 900198 900941 . + 0 ID=BALIOE_04180;Name=hypothetical protein;locus_tag=BALIOE_04180;product=hypothetical protein;Parent=BALIOE_04180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1684 c1 Prodigal gene 900880 901005 . - . ID=BALIOE_04185_gene;locus_tag=BALIOE_04185 | |
| 1685 c1 Prodigal CDS 900880 901005 . - 0 ID=BALIOE_04185;Name=hypothetical protein;locus_tag=BALIOE_04185;product=hypothetical protein;Parent=BALIOE_04185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1686 c1 Prodigal gene 901807 902022 . + . ID=BALIOE_04190_gene;locus_tag=BALIOE_04190 | |
| 1687 c1 Prodigal CDS 901807 902022 . + 0 ID=BALIOE_04190;Name=hypothetical protein;locus_tag=BALIOE_04190;product=hypothetical protein;Parent=BALIOE_04190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1688 c1 Prodigal gene 902022 902519 . + . ID=BALIOE_04195_gene;locus_tag=BALIOE_04195 | |
| 1689 c1 Prodigal CDS 902022 902519 . + 0 ID=BALIOE_04195;Name=hypothetical protein;locus_tag=BALIOE_04195;product=hypothetical protein;Parent=BALIOE_04195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1690 c1 Prodigal gene 902516 902983 . + . ID=BALIOE_04200_gene;locus_tag=BALIOE_04200 | |
| 1691 c1 Prodigal CDS 902516 902983 . + 0 ID=BALIOE_04200;Name=hypothetical protein;locus_tag=BALIOE_04200;product=hypothetical protein;Parent=BALIOE_04200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1692 c1 Prodigal gene 902971 903123 . + . ID=BALIOE_04205_gene;locus_tag=BALIOE_04205 | |
| 1693 c1 Prodigal CDS 902971 903123 . + 0 ID=BALIOE_04205;Name=hypothetical protein;locus_tag=BALIOE_04205;product=hypothetical protein;Parent=BALIOE_04205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1694 c1 Prodigal gene 903798 904289 . + . ID=BALIOE_04210_gene;locus_tag=BALIOE_04210 | |
| 1695 c1 Prodigal CDS 903798 904289 . + 0 ID=BALIOE_04210;Name=hypothetical protein;locus_tag=BALIOE_04210;product=hypothetical protein;Parent=BALIOE_04210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1696 c1 Prodigal gene 904289 906391 . + . ID=BALIOE_04215_gene;locus_tag=BALIOE_04215 | |
| 1697 c1 Prodigal CDS 904289 906391 . + 0 ID=BALIOE_04215;Name=hypothetical protein;locus_tag=BALIOE_04215;product=hypothetical protein;Parent=BALIOE_04215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1698 c1 Prodigal gene 906388 906600 . + . ID=BALIOE_04220_gene;locus_tag=BALIOE_04220 | |
| 1699 c1 Prodigal CDS 906388 906600 . + 0 ID=BALIOE_04220;Name=hypothetical protein;locus_tag=BALIOE_04220;product=hypothetical protein;Parent=BALIOE_04220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1700 c1 Prodigal gene 906600 907652 . + . ID=BALIOE_04225_gene;locus_tag=BALIOE_04225 | |
| 1701 c1 Prodigal CDS 906600 907652 . + 0 ID=BALIOE_04225;Name=hypothetical protein;locus_tag=BALIOE_04225;product=hypothetical protein;Parent=BALIOE_04225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1702 c1 Prodigal gene 907747 908109 . + . ID=BALIOE_04230_gene;locus_tag=BALIOE_04230 | |
| 1703 c1 Prodigal CDS 907747 908109 . + 0 ID=BALIOE_04230;Name=hypothetical protein;locus_tag=BALIOE_04230;product=hypothetical protein;Parent=BALIOE_04230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1704 c1 Prodigal gene 908054 910081 . + . ID=BALIOE_04235_gene;locus_tag=BALIOE_04235 | |
| 1705 c1 Prodigal CDS 908054 910081 . + 0 ID=BALIOE_04235;Name=hypothetical protein;locus_tag=BALIOE_04235;product=hypothetical protein;Parent=BALIOE_04235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1706 c1 Prodigal gene 910168 910491 . + . ID=BALIOE_04240_gene;locus_tag=BALIOE_04240 | |
| 1707 c1 Prodigal CDS 910168 910491 . + 0 ID=BALIOE_04240;Name=hypothetical protein;locus_tag=BALIOE_04240;product=hypothetical protein;Parent=BALIOE_04240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1708 c1 Prodigal gene 910484 910759 . + . ID=BALIOE_04245_gene;locus_tag=BALIOE_04245 | |
| 1709 c1 Prodigal CDS 910484 910759 . + 0 ID=BALIOE_04245;Name=hypothetical protein;locus_tag=BALIOE_04245;product=hypothetical protein;Parent=BALIOE_04245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1710 c1 Prodigal gene 910771 911349 . + . ID=BALIOE_04250_gene;locus_tag=BALIOE_04250 | |
| 1711 c1 Prodigal CDS 910771 911349 . + 0 ID=BALIOE_04250;Name=hypothetical protein;locus_tag=BALIOE_04250;product=hypothetical protein;Parent=BALIOE_04250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1712 c1 Prodigal gene 911346 911747 . + . ID=BALIOE_04255_gene;locus_tag=BALIOE_04255 | |
| 1713 c1 Prodigal CDS 911346 911747 . + 0 ID=BALIOE_04255;Name=hypothetical protein;locus_tag=BALIOE_04255;product=hypothetical protein;Parent=BALIOE_04255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1714 c1 Prodigal gene 911758 912501 . + . ID=BALIOE_04260_gene;locus_tag=BALIOE_04260 | |
| 1715 c1 Prodigal CDS 911758 912501 . + 0 ID=BALIOE_04260;Name=hypothetical protein;locus_tag=BALIOE_04260;product=hypothetical protein;Parent=BALIOE_04260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1716 c1 Prodigal gene 912562 912948 . + . ID=BALIOE_04265_gene;locus_tag=BALIOE_04265 | |
| 1717 c1 Prodigal CDS 912562 912948 . + 0 ID=BALIOE_04265;Name=hypothetical protein;locus_tag=BALIOE_04265;product=hypothetical protein;Parent=BALIOE_04265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1718 c1 Prodigal gene 912957 913286 . + . ID=BALIOE_04270_gene;locus_tag=BALIOE_04270 | |
| 1719 c1 Prodigal CDS 912957 913286 . + 0 ID=BALIOE_04270;Name=hypothetical protein;locus_tag=BALIOE_04270;product=hypothetical protein;Parent=BALIOE_04270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1720 c1 Prodigal gene 913258 916323 . + . ID=BALIOE_04275_gene;locus_tag=BALIOE_04275 | |
| 1721 c1 Prodigal CDS 913258 916323 . + 0 ID=BALIOE_04275;Name=hypothetical protein;locus_tag=BALIOE_04275;product=hypothetical protein;Parent=BALIOE_04275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1722 c1 Prodigal gene 916323 916652 . + . ID=BALIOE_04280_gene;locus_tag=BALIOE_04280 | |
| 1723 c1 Prodigal CDS 916323 916652 . + 0 ID=BALIOE_04280;Name=hypothetical protein;locus_tag=BALIOE_04280;product=hypothetical protein;Parent=BALIOE_04280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1724 c1 Prodigal gene 916662 917360 . + . ID=BALIOE_04285_gene;locus_tag=BALIOE_04285 | |
| 1725 c1 Prodigal CDS 916662 917360 . + 0 ID=BALIOE_04285;Name=hypothetical protein;locus_tag=BALIOE_04285;product=hypothetical protein;Parent=BALIOE_04285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1726 c1 Prodigal gene 917366 918109 . + . ID=BALIOE_04290_gene;locus_tag=BALIOE_04290 | |
| 1727 c1 Prodigal CDS 917366 918109 . + 0 ID=BALIOE_04290;Name=hypothetical protein;locus_tag=BALIOE_04290;product=hypothetical protein;Parent=BALIOE_04290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1728 c1 Prodigal gene 918142 918654 . + . ID=BALIOE_04295_gene;locus_tag=BALIOE_04295 | |
| 1729 c1 Prodigal CDS 918142 918654 . + 0 ID=BALIOE_04295;Name=hypothetical protein;locus_tag=BALIOE_04295;product=hypothetical protein;Parent=BALIOE_04295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1730 c1 Prodigal gene 918715 922128 . + . ID=BALIOE_04300_gene;locus_tag=BALIOE_04300 | |
| 1731 c1 Prodigal CDS 918715 922128 . + 0 ID=BALIOE_04300;Name=hypothetical protein;locus_tag=BALIOE_04300;product=hypothetical protein;Parent=BALIOE_04300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1732 c1 Prodigal gene 922199 922798 . + . ID=BALIOE_04305_gene;locus_tag=BALIOE_04305 | |
| 1733 c1 Prodigal CDS 922199 922798 . + 0 ID=BALIOE_04305;Name=hypothetical protein;locus_tag=BALIOE_04305;product=hypothetical protein;Parent=BALIOE_04305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1734 c1 Prodigal gene 922858 924174 . + . ID=BALIOE_04310_gene;locus_tag=BALIOE_04310 | |
| 1735 c1 Prodigal CDS 922858 924174 . + 0 ID=BALIOE_04310;Name=hypothetical protein;locus_tag=BALIOE_04310;product=hypothetical protein;Parent=BALIOE_04310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1736 c1 Prodigal gene 924176 924445 . + . ID=BALIOE_04315_gene;locus_tag=BALIOE_04315 | |
| 1737 c1 Prodigal CDS 924176 924445 . + 0 ID=BALIOE_04315;Name=hypothetical protein;locus_tag=BALIOE_04315;product=hypothetical protein;Parent=BALIOE_04315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1738 c1 Prodigal gene 924622 925602 . + . ID=BALIOE_04320_gene;locus_tag=BALIOE_04320 | |
| 1739 c1 Prodigal CDS 924622 925602 . + 0 ID=BALIOE_04320;Name=hypothetical protein;locus_tag=BALIOE_04320;product=hypothetical protein;Parent=BALIOE_04320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1740 c1 Prodigal gene 925636 926655 . + . ID=BALIOE_04325_gene;locus_tag=BALIOE_04325 | |
| 1741 c1 Prodigal CDS 925636 926655 . + 0 ID=BALIOE_04325;Name=hypothetical protein;locus_tag=BALIOE_04325;product=hypothetical protein;Parent=BALIOE_04325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1742 c1 Prodigal gene 927756 928364 . + . ID=BALIOE_04330_gene;locus_tag=BALIOE_04330 | |
| 1743 c1 Prodigal CDS 927756 928364 . + 0 ID=BALIOE_04330;Name=hypothetical protein;locus_tag=BALIOE_04330;product=hypothetical protein;Parent=BALIOE_04330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1744 c1 Prodigal gene 928399 928533 . + . ID=BALIOE_04335_gene;locus_tag=BALIOE_04335 | |
| 1745 c1 Prodigal CDS 928399 928533 . + 0 ID=BALIOE_04335;Name=hypothetical protein;locus_tag=BALIOE_04335;product=hypothetical protein;Parent=BALIOE_04335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1746 c1 Prodigal gene 928595 929293 . + . ID=BALIOE_04340_gene;locus_tag=BALIOE_04340 | |
| 1747 c1 Prodigal CDS 928595 929293 . + 0 ID=BALIOE_04340;Name=hypothetical protein;locus_tag=BALIOE_04340;product=hypothetical protein;Parent=BALIOE_04340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1748 c1 Prodigal gene 929800 930276 . - . ID=BALIOE_04345_gene;locus_tag=BALIOE_04345 | |
| 1749 c1 Prodigal CDS 929800 930276 . - 0 ID=BALIOE_04345;Name=hypothetical protein;locus_tag=BALIOE_04345;product=hypothetical protein;Parent=BALIOE_04345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1750 c1 Prodigal gene 930335 931624 . - . ID=BALIOE_04350_gene;locus_tag=BALIOE_04350 | |
| 1751 c1 Prodigal CDS 930335 931624 . - 0 ID=BALIOE_04350;Name=hypothetical protein;locus_tag=BALIOE_04350;product=hypothetical protein;Parent=BALIOE_04350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1752 c1 Prodigal gene 931711 932751 . + . ID=BALIOE_04355_gene;locus_tag=BALIOE_04355 | |
| 1753 c1 Prodigal CDS 931711 932751 . + 0 ID=BALIOE_04355;Name=hypothetical protein;locus_tag=BALIOE_04355;product=hypothetical protein;Parent=BALIOE_04355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1754 c1 Prodigal gene 932748 933902 . + . ID=BALIOE_04360_gene;locus_tag=BALIOE_04360 | |
| 1755 c1 Prodigal CDS 932748 933902 . + 0 ID=BALIOE_04360;Name=hypothetical protein;locus_tag=BALIOE_04360;product=hypothetical protein;Parent=BALIOE_04360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1756 c1 Prodigal gene 933889 934644 . + . ID=BALIOE_04365_gene;locus_tag=BALIOE_04365 | |
| 1757 c1 Prodigal CDS 933889 934644 . + 0 ID=BALIOE_04365;Name=hypothetical protein;locus_tag=BALIOE_04365;product=hypothetical protein;Parent=BALIOE_04365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1758 c1 Prodigal gene 934637 935314 . + . ID=BALIOE_04370_gene;locus_tag=BALIOE_04370 | |
| 1759 c1 Prodigal CDS 934637 935314 . + 0 ID=BALIOE_04370;Name=hypothetical protein;locus_tag=BALIOE_04370;product=hypothetical protein;Parent=BALIOE_04370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1760 c1 Prodigal gene 935893 937914 . + . ID=BALIOE_04375_gene;locus_tag=BALIOE_04375 | |
| 1761 c1 Prodigal CDS 935893 937914 . + 0 ID=BALIOE_04375;Name=hypothetical protein;locus_tag=BALIOE_04375;product=hypothetical protein;Parent=BALIOE_04375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1762 c1 Prodigal gene 938105 939013 . - . ID=BALIOE_04380_gene;locus_tag=BALIOE_04380 | |
| 1763 c1 Prodigal CDS 938105 939013 . - 0 ID=BALIOE_04380;Name=hypothetical protein;locus_tag=BALIOE_04380;product=hypothetical protein;Parent=BALIOE_04380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1764 c1 Prodigal gene 939410 940399 . + . ID=BALIOE_04385_gene;locus_tag=BALIOE_04385 | |
| 1765 c1 Prodigal CDS 939410 940399 . + 0 ID=BALIOE_04385;Name=hypothetical protein;locus_tag=BALIOE_04385;product=hypothetical protein;Parent=BALIOE_04385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1766 c1 Prodigal gene 940421 940933 . + . ID=BALIOE_04390_gene;locus_tag=BALIOE_04390 | |
| 1767 c1 Prodigal CDS 940421 940933 . + 0 ID=BALIOE_04390;Name=hypothetical protein;locus_tag=BALIOE_04390;product=hypothetical protein;Parent=BALIOE_04390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1768 c1 Prodigal gene 940936 941421 . + . ID=BALIOE_04395_gene;locus_tag=BALIOE_04395 | |
| 1769 c1 Prodigal CDS 940936 941421 . + 0 ID=BALIOE_04395;Name=hypothetical protein;locus_tag=BALIOE_04395;product=hypothetical protein;Parent=BALIOE_04395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1770 c1 Prodigal gene 941414 941659 . + . ID=BALIOE_04400_gene;locus_tag=BALIOE_04400 | |
| 1771 c1 Prodigal CDS 941414 941659 . + 0 ID=BALIOE_04400;Name=hypothetical protein;locus_tag=BALIOE_04400;product=hypothetical protein;Parent=BALIOE_04400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1772 c1 Prodigal gene 941661 942113 . + . ID=BALIOE_04405_gene;locus_tag=BALIOE_04405 | |
| 1773 c1 Prodigal CDS 941661 942113 . + 0 ID=BALIOE_04405;Name=hypothetical protein;locus_tag=BALIOE_04405;product=hypothetical protein;Parent=BALIOE_04405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1774 c1 Prodigal gene 942249 942953 . + . ID=BALIOE_04410_gene;locus_tag=BALIOE_04410 | |
| 1775 c1 Prodigal CDS 942249 942953 . + 0 ID=BALIOE_04410;Name=hypothetical protein;locus_tag=BALIOE_04410;product=hypothetical protein;Parent=BALIOE_04410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1776 c1 Prodigal gene 943161 943874 . + . ID=BALIOE_04415_gene;locus_tag=BALIOE_04415 | |
| 1777 c1 Prodigal CDS 943161 943874 . + 0 ID=BALIOE_04415;Name=hypothetical protein;locus_tag=BALIOE_04415;product=hypothetical protein;Parent=BALIOE_04415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1778 c1 Prodigal gene 943910 944866 . - . ID=BALIOE_04420_gene;locus_tag=BALIOE_04420 | |
| 1779 c1 Prodigal CDS 943910 944866 . - 0 ID=BALIOE_04420;Name=hypothetical protein;locus_tag=BALIOE_04420;product=hypothetical protein;Parent=BALIOE_04420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1780 c1 Prodigal gene 944866 946107 . - . ID=BALIOE_04425_gene;locus_tag=BALIOE_04425 | |
| 1781 c1 Prodigal CDS 944866 946107 . - 0 ID=BALIOE_04425;Name=hypothetical protein;locus_tag=BALIOE_04425;product=hypothetical protein;Parent=BALIOE_04425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1782 c1 Prodigal gene 946104 946865 . - . ID=BALIOE_04430_gene;locus_tag=BALIOE_04430 | |
| 1783 c1 Prodigal CDS 946104 946865 . - 0 ID=BALIOE_04430;Name=hypothetical protein;locus_tag=BALIOE_04430;product=hypothetical protein;Parent=BALIOE_04430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1784 c1 Prodigal gene 946998 947408 . + . ID=BALIOE_04435_gene;locus_tag=BALIOE_04435 | |
| 1785 c1 Prodigal CDS 946998 947408 . + 0 ID=BALIOE_04435;Name=hypothetical protein;locus_tag=BALIOE_04435;product=hypothetical protein;Parent=BALIOE_04435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1786 c1 Prodigal gene 947370 948476 . - . ID=BALIOE_04440_gene;locus_tag=BALIOE_04440 | |
| 1787 c1 Prodigal CDS 947370 948476 . - 0 ID=BALIOE_04440;Name=hypothetical protein;locus_tag=BALIOE_04440;product=hypothetical protein;Parent=BALIOE_04440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1788 c1 Prodigal gene 948487 949620 . - . ID=BALIOE_04445_gene;locus_tag=BALIOE_04445 | |
| 1789 c1 Prodigal CDS 948487 949620 . - 0 ID=BALIOE_04445;Name=hypothetical protein;locus_tag=BALIOE_04445;product=hypothetical protein;Parent=BALIOE_04445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1790 c1 Prodigal gene 949613 951349 . - . ID=BALIOE_04450_gene;locus_tag=BALIOE_04450 | |
| 1791 c1 Prodigal CDS 949613 951349 . - 0 ID=BALIOE_04450;Name=hypothetical protein;locus_tag=BALIOE_04450;product=hypothetical protein;Parent=BALIOE_04450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1792 c1 Prodigal gene 951342 952337 . - . ID=BALIOE_04455_gene;locus_tag=BALIOE_04455 | |
| 1793 c1 Prodigal CDS 951342 952337 . - 0 ID=BALIOE_04455;Name=hypothetical protein;locus_tag=BALIOE_04455;product=hypothetical protein;Parent=BALIOE_04455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1794 c1 Prodigal gene 952340 953011 . - . ID=BALIOE_04460_gene;locus_tag=BALIOE_04460 | |
| 1795 c1 Prodigal CDS 952340 953011 . - 0 ID=BALIOE_04460;Name=hypothetical protein;locus_tag=BALIOE_04460;product=hypothetical protein;Parent=BALIOE_04460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1796 c1 Prodigal gene 953240 954607 . + . ID=BALIOE_04465_gene;locus_tag=BALIOE_04465 | |
| 1797 c1 Prodigal CDS 953240 954607 . + 0 ID=BALIOE_04465;Name=hypothetical protein;locus_tag=BALIOE_04465;product=hypothetical protein;Parent=BALIOE_04465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1798 c1 Prodigal gene 955215 957227 . + . ID=BALIOE_04470_gene;locus_tag=BALIOE_04470 | |
| 1799 c1 Prodigal CDS 955215 957227 . + 0 ID=BALIOE_04470;Name=hypothetical protein;locus_tag=BALIOE_04470;product=hypothetical protein;Parent=BALIOE_04470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1800 c1 Prodigal gene 957511 959661 . + . ID=BALIOE_04475_gene;locus_tag=BALIOE_04475 | |
| 1801 c1 Prodigal CDS 957511 959661 . + 0 ID=BALIOE_04475;Name=hypothetical protein;locus_tag=BALIOE_04475;product=hypothetical protein;Parent=BALIOE_04475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1802 c1 Prodigal gene 959689 960651 . + . ID=BALIOE_04480_gene;locus_tag=BALIOE_04480 | |
| 1803 c1 Prodigal CDS 959689 960651 . + 0 ID=BALIOE_04480;Name=hypothetical protein;locus_tag=BALIOE_04480;product=hypothetical protein;Parent=BALIOE_04480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1804 c1 Prodigal gene 960792 961877 . + . ID=BALIOE_04485_gene;locus_tag=BALIOE_04485 | |
| 1805 c1 Prodigal CDS 960792 961877 . + 0 ID=BALIOE_04485;Name=hypothetical protein;locus_tag=BALIOE_04485;product=hypothetical protein;Parent=BALIOE_04485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1806 c1 Infernal gene 962029 962099 . - . ID=BALIOE_04490_gene;locus_tag=BALIOE_04490;gene=naRNA4 | |
| 1807 c1 Infernal ncRNA 962029 962099 1.5e-11 - . ID=BALIOE_04490;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_04490;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_04490_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 1808 c1 Prodigal gene 962106 962366 . - . ID=BALIOE_04495_gene;locus_tag=BALIOE_04495 | |
| 1809 c1 Prodigal CDS 962106 962366 . - 0 ID=BALIOE_04495;Name=hypothetical protein;locus_tag=BALIOE_04495;product=hypothetical protein;Parent=BALIOE_04495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1810 c1 Prodigal gene 962631 962897 . - . ID=BALIOE_04500_gene;locus_tag=BALIOE_04500 | |
| 1811 c1 Prodigal CDS 962631 962897 . - 0 ID=BALIOE_04500;Name=hypothetical protein;locus_tag=BALIOE_04500;product=hypothetical protein;Parent=BALIOE_04500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1812 c1 Prodigal gene 962973 963656 . - . ID=BALIOE_04505_gene;locus_tag=BALIOE_04505 | |
| 1813 c1 Prodigal CDS 962973 963656 . - 0 ID=BALIOE_04505;Name=hypothetical protein;locus_tag=BALIOE_04505;product=hypothetical protein;Parent=BALIOE_04505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1814 c1 Prodigal gene 963701 965983 . - . ID=BALIOE_04510_gene;locus_tag=BALIOE_04510 | |
| 1815 c1 Prodigal CDS 963701 965983 . - 0 ID=BALIOE_04510;Name=hypothetical protein;locus_tag=BALIOE_04510;product=hypothetical protein;Parent=BALIOE_04510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1816 c1 Prodigal gene 966248 966508 . - . ID=BALIOE_04515_gene;locus_tag=BALIOE_04515 | |
| 1817 c1 Prodigal CDS 966248 966508 . - 0 ID=BALIOE_04515;Name=hypothetical protein;locus_tag=BALIOE_04515;product=hypothetical protein;Parent=BALIOE_04515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1818 c1 Prodigal gene 966784 967710 . + . ID=BALIOE_04520_gene;locus_tag=BALIOE_04520 | |
| 1819 c1 Prodigal CDS 966784 967710 . + 0 ID=BALIOE_04520;Name=hypothetical protein;locus_tag=BALIOE_04520;product=hypothetical protein;Parent=BALIOE_04520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1820 c1 Prodigal gene 967707 969932 . - . ID=BALIOE_04525_gene;locus_tag=BALIOE_04525 | |
| 1821 c1 Prodigal CDS 967707 969932 . - 0 ID=BALIOE_04525;Name=hypothetical protein;locus_tag=BALIOE_04525;product=hypothetical protein;Parent=BALIOE_04525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1822 c1 Prodigal gene 970049 970771 . - . ID=BALIOE_04530_gene;locus_tag=BALIOE_04530 | |
| 1823 c1 Prodigal CDS 970049 970771 . - 0 ID=BALIOE_04530;Name=hypothetical protein;locus_tag=BALIOE_04530;product=hypothetical protein;Parent=BALIOE_04530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1824 c1 Prodigal gene 970768 971427 . - . ID=BALIOE_04535_gene;locus_tag=BALIOE_04535 | |
| 1825 c1 Prodigal CDS 970768 971427 . - 0 ID=BALIOE_04535;Name=hypothetical protein;locus_tag=BALIOE_04535;product=hypothetical protein;Parent=BALIOE_04535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1826 c1 Prodigal gene 971565 972311 . - . ID=BALIOE_04540_gene;locus_tag=BALIOE_04540 | |
| 1827 c1 Prodigal CDS 971565 972311 . - 0 ID=BALIOE_04540;Name=hypothetical protein;locus_tag=BALIOE_04540;product=hypothetical protein;Parent=BALIOE_04540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1828 c1 Prodigal gene 972715 973218 . - . ID=BALIOE_04545_gene;locus_tag=BALIOE_04545 | |
| 1829 c1 Prodigal CDS 972715 973218 . - 0 ID=BALIOE_04545;Name=hypothetical protein;locus_tag=BALIOE_04545;product=hypothetical protein;Parent=BALIOE_04545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1830 c1 Prodigal gene 973517 974404 . - . ID=BALIOE_04550_gene;locus_tag=BALIOE_04550 | |
| 1831 c1 Prodigal CDS 973517 974404 . - 0 ID=BALIOE_04550;Name=hypothetical protein;locus_tag=BALIOE_04550;product=hypothetical protein;Parent=BALIOE_04550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1832 c1 Prodigal gene 974757 975272 . + . ID=BALIOE_04555_gene;locus_tag=BALIOE_04555 | |
| 1833 c1 Prodigal CDS 974757 975272 . + 0 ID=BALIOE_04555;Name=hypothetical protein;locus_tag=BALIOE_04555;product=hypothetical protein;Parent=BALIOE_04555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1834 c1 Prodigal gene 975321 976904 . - . ID=BALIOE_04560_gene;locus_tag=BALIOE_04560 | |
| 1835 c1 Prodigal CDS 975321 976904 . - 0 ID=BALIOE_04560;Name=hypothetical protein;locus_tag=BALIOE_04560;product=hypothetical protein;Parent=BALIOE_04560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1836 c1 Prodigal gene 977176 977304 . - . ID=BALIOE_04565_gene;locus_tag=BALIOE_04565 | |
| 1837 c1 Prodigal CDS 977176 977304 . - 0 ID=BALIOE_04565;Name=hypothetical protein;locus_tag=BALIOE_04565;product=hypothetical protein;Parent=BALIOE_04565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1838 c1 Prodigal gene 977490 977957 . + . ID=BALIOE_04570_gene;locus_tag=BALIOE_04570 | |
| 1839 c1 Prodigal CDS 977490 977957 . + 0 ID=BALIOE_04570;Name=hypothetical protein;locus_tag=BALIOE_04570;product=hypothetical protein;Parent=BALIOE_04570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1840 c1 Prodigal gene 977954 979072 . + . ID=BALIOE_04575_gene;locus_tag=BALIOE_04575 | |
| 1841 c1 Prodigal CDS 977954 979072 . + 0 ID=BALIOE_04575;Name=hypothetical protein;locus_tag=BALIOE_04575;product=hypothetical protein;Parent=BALIOE_04575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1842 c1 Prodigal gene 979130 980050 . - . ID=BALIOE_04580_gene;locus_tag=BALIOE_04580 | |
| 1843 c1 Prodigal CDS 979130 980050 . - 0 ID=BALIOE_04580;Name=hypothetical protein;locus_tag=BALIOE_04580;product=hypothetical protein;Parent=BALIOE_04580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1844 c1 Prodigal gene 980269 981861 . + . ID=BALIOE_04585_gene;locus_tag=BALIOE_04585 | |
| 1845 c1 Prodigal CDS 980269 981861 . + 0 ID=BALIOE_04585;Name=hypothetical protein;locus_tag=BALIOE_04585;product=hypothetical protein;Parent=BALIOE_04585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1846 c1 Prodigal gene 982029 983294 . - . ID=BALIOE_04590_gene;locus_tag=BALIOE_04590 | |
| 1847 c1 Prodigal CDS 982029 983294 . - 0 ID=BALIOE_04590;Name=hypothetical protein;locus_tag=BALIOE_04590;product=hypothetical protein;Parent=BALIOE_04590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1848 c1 Prodigal gene 983446 984261 . - . ID=BALIOE_04595_gene;locus_tag=BALIOE_04595 | |
| 1849 c1 Prodigal CDS 983446 984261 . - 0 ID=BALIOE_04595;Name=hypothetical protein;locus_tag=BALIOE_04595;product=hypothetical protein;Parent=BALIOE_04595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1850 c1 Prodigal gene 984407 986206 . - . ID=BALIOE_04600_gene;locus_tag=BALIOE_04600 | |
| 1851 c1 Prodigal CDS 984407 986206 . - 0 ID=BALIOE_04600;Name=hypothetical protein;locus_tag=BALIOE_04600;product=hypothetical protein;Parent=BALIOE_04600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1852 c1 Prodigal gene 986284 986838 . - . ID=BALIOE_04605_gene;locus_tag=BALIOE_04605 | |
| 1853 c1 Prodigal CDS 986284 986838 . - 0 ID=BALIOE_04605;Name=hypothetical protein;locus_tag=BALIOE_04605;product=hypothetical protein;Parent=BALIOE_04605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1854 c1 Prodigal gene 986844 987743 . - . ID=BALIOE_04610_gene;locus_tag=BALIOE_04610 | |
| 1855 c1 Prodigal CDS 986844 987743 . - 0 ID=BALIOE_04610;Name=hypothetical protein;locus_tag=BALIOE_04610;product=hypothetical protein;Parent=BALIOE_04610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1856 c1 Prodigal gene 987874 988536 . + . ID=BALIOE_04615_gene;locus_tag=BALIOE_04615 | |
| 1857 c1 Prodigal CDS 987874 988536 . + 0 ID=BALIOE_04615;Name=hypothetical protein;locus_tag=BALIOE_04615;product=hypothetical protein;Parent=BALIOE_04615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1858 c1 Infernal gene 988625 988702 . + . ID=BALIOE_04620_gene;locus_tag=BALIOE_04620;gene=naRNA4 | |
| 1859 c1 Infernal ncRNA 988625 988702 9e-12 + . ID=BALIOE_04620;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_04620;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_04620_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 1860 c1 Prodigal gene 988715 989464 . - . ID=BALIOE_04625_gene;locus_tag=BALIOE_04625 | |
| 1861 c1 Prodigal CDS 988715 989464 . - 0 ID=BALIOE_04625;Name=hypothetical protein;locus_tag=BALIOE_04625;product=hypothetical protein;Parent=BALIOE_04625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1862 c1 Prodigal gene 989464 990699 . - . ID=BALIOE_04630_gene;locus_tag=BALIOE_04630 | |
| 1863 c1 Prodigal CDS 989464 990699 . - 0 ID=BALIOE_04630;Name=hypothetical protein;locus_tag=BALIOE_04630;product=hypothetical protein;Parent=BALIOE_04630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1864 c1 Prodigal gene 990903 991250 . + . ID=BALIOE_04635_gene;locus_tag=BALIOE_04635 | |
| 1865 c1 Prodigal CDS 990903 991250 . + 0 ID=BALIOE_04635;Name=hypothetical protein;locus_tag=BALIOE_04635;product=hypothetical protein;Parent=BALIOE_04635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1866 c1 Prodigal gene 991263 991868 . + . ID=BALIOE_04640_gene;locus_tag=BALIOE_04640 | |
| 1867 c1 Prodigal CDS 991263 991868 . + 0 ID=BALIOE_04640;Name=hypothetical protein;locus_tag=BALIOE_04640;product=hypothetical protein;Parent=BALIOE_04640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1868 c1 Prodigal gene 991855 993726 . + . ID=BALIOE_04645_gene;locus_tag=BALIOE_04645 | |
| 1869 c1 Prodigal CDS 991855 993726 . + 0 ID=BALIOE_04645;Name=hypothetical protein;locus_tag=BALIOE_04645;product=hypothetical protein;Parent=BALIOE_04645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1870 c1 Prodigal gene 993746 995284 . + . ID=BALIOE_04650_gene;locus_tag=BALIOE_04650 | |
| 1871 c1 Prodigal CDS 993746 995284 . + 0 ID=BALIOE_04650;Name=hypothetical protein;locus_tag=BALIOE_04650;product=hypothetical protein;Parent=BALIOE_04650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1872 c1 Prodigal gene 995302 996222 . + . ID=BALIOE_04655_gene;locus_tag=BALIOE_04655 | |
| 1873 c1 Prodigal CDS 995302 996222 . + 0 ID=BALIOE_04655;Name=hypothetical protein;locus_tag=BALIOE_04655;product=hypothetical protein;Parent=BALIOE_04655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1874 c1 Prodigal gene 996225 997136 . + . ID=BALIOE_04660_gene;locus_tag=BALIOE_04660 | |
| 1875 c1 Prodigal CDS 996225 997136 . + 0 ID=BALIOE_04660;Name=hypothetical protein;locus_tag=BALIOE_04660;product=hypothetical protein;Parent=BALIOE_04660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1876 c1 Prodigal gene 997314 999662 . + . ID=BALIOE_04665_gene;locus_tag=BALIOE_04665 | |
| 1877 c1 Prodigal CDS 997314 999662 . + 0 ID=BALIOE_04665;Name=hypothetical protein;locus_tag=BALIOE_04665;product=hypothetical protein;Parent=BALIOE_04665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1878 c1 Prodigal gene 999670 1000998 . + . ID=BALIOE_04670_gene;locus_tag=BALIOE_04670 | |
| 1879 c1 Prodigal CDS 999670 1000998 . + 0 ID=BALIOE_04670;Name=hypothetical protein;locus_tag=BALIOE_04670;product=hypothetical protein;Parent=BALIOE_04670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1880 c1 Prodigal gene 1001068 1001397 . - . ID=BALIOE_04675_gene;locus_tag=BALIOE_04675 | |
| 1881 c1 Prodigal CDS 1001068 1001397 . - 0 ID=BALIOE_04675;Name=hypothetical protein;locus_tag=BALIOE_04675;product=hypothetical protein;Parent=BALIOE_04675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1882 c1 Prodigal gene 1001387 1001773 . - . ID=BALIOE_04680_gene;locus_tag=BALIOE_04680 | |
| 1883 c1 Prodigal CDS 1001387 1001773 . - 0 ID=BALIOE_04680;Name=hypothetical protein;locus_tag=BALIOE_04680;product=hypothetical protein;Parent=BALIOE_04680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1884 c1 Prodigal gene 1001999 1003324 . - . ID=BALIOE_04685_gene;locus_tag=BALIOE_04685 | |
| 1885 c1 Prodigal CDS 1001999 1003324 . - 0 ID=BALIOE_04685;Name=hypothetical protein;locus_tag=BALIOE_04685;product=hypothetical protein;Parent=BALIOE_04685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1886 c1 Prodigal gene 1003537 1003920 . + . ID=BALIOE_04690_gene;locus_tag=BALIOE_04690 | |
| 1887 c1 Prodigal CDS 1003537 1003920 . + 0 ID=BALIOE_04690;Name=hypothetical protein;locus_tag=BALIOE_04690;product=hypothetical protein;Parent=BALIOE_04690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1888 c1 Prodigal gene 1004031 1005146 . + . ID=BALIOE_04695_gene;locus_tag=BALIOE_04695 | |
| 1889 c1 Prodigal CDS 1004031 1005146 . + 0 ID=BALIOE_04695;Name=hypothetical protein;locus_tag=BALIOE_04695;product=hypothetical protein;Parent=BALIOE_04695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1890 c1 Prodigal gene 1005143 1005769 . - . ID=BALIOE_04700_gene;locus_tag=BALIOE_04700 | |
| 1891 c1 Prodigal CDS 1005143 1005769 . - 0 ID=BALIOE_04700;Name=hypothetical protein;locus_tag=BALIOE_04700;product=hypothetical protein;Parent=BALIOE_04700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1892 c1 Prodigal gene 1006015 1007217 . + . ID=BALIOE_04705_gene;locus_tag=BALIOE_04705 | |
| 1893 c1 Prodigal CDS 1006015 1007217 . + 0 ID=BALIOE_04705;Name=hypothetical protein;locus_tag=BALIOE_04705;product=hypothetical protein;Parent=BALIOE_04705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1894 c1 Prodigal gene 1007264 1008022 . - . ID=BALIOE_04710_gene;locus_tag=BALIOE_04710 | |
| 1895 c1 Prodigal CDS 1007264 1008022 . - 0 ID=BALIOE_04710;Name=hypothetical protein;locus_tag=BALIOE_04710;product=hypothetical protein;Parent=BALIOE_04710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1896 c1 Prodigal gene 1008080 1008676 . - . ID=BALIOE_04715_gene;locus_tag=BALIOE_04715 | |
| 1897 c1 Prodigal CDS 1008080 1008676 . - 0 ID=BALIOE_04715;Name=hypothetical protein;locus_tag=BALIOE_04715;product=hypothetical protein;Parent=BALIOE_04715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1898 c1 Prodigal gene 1008961 1010193 . + . ID=BALIOE_04720_gene;locus_tag=BALIOE_04720 | |
| 1899 c1 Prodigal CDS 1008961 1010193 . + 0 ID=BALIOE_04720;Name=hypothetical protein;locus_tag=BALIOE_04720;product=hypothetical protein;Parent=BALIOE_04720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1900 c1 Prodigal gene 1010234 1010512 . - . ID=BALIOE_04725_gene;locus_tag=BALIOE_04725 | |
| 1901 c1 Prodigal CDS 1010234 1010512 . - 0 ID=BALIOE_04725;Name=hypothetical protein;locus_tag=BALIOE_04725;product=hypothetical protein;Parent=BALIOE_04725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1902 c1 Prodigal gene 1010604 1011419 . - . ID=BALIOE_04730_gene;locus_tag=BALIOE_04730 | |
| 1903 c1 Prodigal CDS 1010604 1011419 . - 0 ID=BALIOE_04730;Name=hypothetical protein;locus_tag=BALIOE_04730;product=hypothetical protein;Parent=BALIOE_04730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1904 c1 Prodigal gene 1011419 1012627 . - . ID=BALIOE_04735_gene;locus_tag=BALIOE_04735 | |
| 1905 c1 Prodigal CDS 1011419 1012627 . - 0 ID=BALIOE_04735;Name=hypothetical protein;locus_tag=BALIOE_04735;product=hypothetical protein;Parent=BALIOE_04735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1906 c1 Prodigal gene 1012711 1013247 . + . ID=BALIOE_04740_gene;locus_tag=BALIOE_04740 | |
| 1907 c1 Prodigal CDS 1012711 1013247 . + 0 ID=BALIOE_04740;Name=hypothetical protein;locus_tag=BALIOE_04740;product=hypothetical protein;Parent=BALIOE_04740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1908 c1 Prodigal gene 1013422 1015107 . - . ID=BALIOE_04745_gene;locus_tag=BALIOE_04745 | |
| 1909 c1 Prodigal CDS 1013422 1015107 . - 0 ID=BALIOE_04745;Name=hypothetical protein;locus_tag=BALIOE_04745;product=hypothetical protein;Parent=BALIOE_04745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1910 c1 Prodigal gene 1015377 1015754 . + . ID=BALIOE_04750_gene;locus_tag=BALIOE_04750 | |
| 1911 c1 Prodigal CDS 1015377 1015754 . + 0 ID=BALIOE_04750;Name=hypothetical protein;locus_tag=BALIOE_04750;product=hypothetical protein;Parent=BALIOE_04750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1912 c1 Prodigal gene 1015784 1016041 . - . ID=BALIOE_04755_gene;locus_tag=BALIOE_04755 | |
| 1913 c1 Prodigal CDS 1015784 1016041 . - 0 ID=BALIOE_04755;Name=hypothetical protein;locus_tag=BALIOE_04755;product=hypothetical protein;Parent=BALIOE_04755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1914 c1 Prodigal gene 1016201 1016488 . + . ID=BALIOE_04760_gene;locus_tag=BALIOE_04760 | |
| 1915 c1 Prodigal CDS 1016201 1016488 . + 0 ID=BALIOE_04760;Name=hypothetical protein;locus_tag=BALIOE_04760;product=hypothetical protein;Parent=BALIOE_04760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1916 c1 Prodigal gene 1016472 1017194 . + . ID=BALIOE_04765_gene;locus_tag=BALIOE_04765 | |
| 1917 c1 Prodigal CDS 1016472 1017194 . + 0 ID=BALIOE_04765;Name=hypothetical protein;locus_tag=BALIOE_04765;product=hypothetical protein;Parent=BALIOE_04765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1918 c1 Prodigal gene 1017255 1018157 . + . ID=BALIOE_04770_gene;locus_tag=BALIOE_04770 | |
| 1919 c1 Prodigal CDS 1017255 1018157 . + 0 ID=BALIOE_04770;Name=hypothetical protein;locus_tag=BALIOE_04770;product=hypothetical protein;Parent=BALIOE_04770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1920 c1 Prodigal gene 1018245 1018721 . + . ID=BALIOE_04775_gene;locus_tag=BALIOE_04775 | |
| 1921 c1 Prodigal CDS 1018245 1018721 . + 0 ID=BALIOE_04775;Name=hypothetical protein;locus_tag=BALIOE_04775;product=hypothetical protein;Parent=BALIOE_04775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1922 c1 Prodigal gene 1019072 1020184 . + . ID=BALIOE_04780_gene;locus_tag=BALIOE_04780 | |
| 1923 c1 Prodigal CDS 1019072 1020184 . + 0 ID=BALIOE_04780;Name=hypothetical protein;locus_tag=BALIOE_04780;product=hypothetical protein;Parent=BALIOE_04780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1924 c1 Prodigal gene 1020279 1021412 . + . ID=BALIOE_04785_gene;locus_tag=BALIOE_04785 | |
| 1925 c1 Prodigal CDS 1020279 1021412 . + 0 ID=BALIOE_04785;Name=hypothetical protein;locus_tag=BALIOE_04785;product=hypothetical protein;Parent=BALIOE_04785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1926 c1 Prodigal gene 1021422 1022375 . + . ID=BALIOE_04790_gene;locus_tag=BALIOE_04790 | |
| 1927 c1 Prodigal CDS 1021422 1022375 . + 0 ID=BALIOE_04790;Name=hypothetical protein;locus_tag=BALIOE_04790;product=hypothetical protein;Parent=BALIOE_04790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1928 c1 Prodigal gene 1022372 1023217 . + . ID=BALIOE_04795_gene;locus_tag=BALIOE_04795 | |
| 1929 c1 Prodigal CDS 1022372 1023217 . + 0 ID=BALIOE_04795;Name=hypothetical protein;locus_tag=BALIOE_04795;product=hypothetical protein;Parent=BALIOE_04795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1930 c1 Prodigal gene 1023277 1023765 . + . ID=BALIOE_04800_gene;locus_tag=BALIOE_04800 | |
| 1931 c1 Prodigal CDS 1023277 1023765 . + 0 ID=BALIOE_04800;Name=hypothetical protein;locus_tag=BALIOE_04800;product=hypothetical protein;Parent=BALIOE_04800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1932 c1 Prodigal gene 1023806 1024933 . + . ID=BALIOE_04805_gene;locus_tag=BALIOE_04805 | |
| 1933 c1 Prodigal CDS 1023806 1024933 . + 0 ID=BALIOE_04805;Name=hypothetical protein;locus_tag=BALIOE_04805;product=hypothetical protein;Parent=BALIOE_04805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1934 c1 Prodigal gene 1025231 1026556 . + . ID=BALIOE_04810_gene;locus_tag=BALIOE_04810 | |
| 1935 c1 Prodigal CDS 1025231 1026556 . + 0 ID=BALIOE_04810;Name=hypothetical protein;locus_tag=BALIOE_04810;product=hypothetical protein;Parent=BALIOE_04810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1936 c1 Prodigal gene 1026578 1026898 . + . ID=BALIOE_04815_gene;locus_tag=BALIOE_04815 | |
| 1937 c1 Prodigal CDS 1026578 1026898 . + 0 ID=BALIOE_04815;Name=hypothetical protein;locus_tag=BALIOE_04815;product=hypothetical protein;Parent=BALIOE_04815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1938 c1 Prodigal gene 1026910 1028391 . + . ID=BALIOE_04820_gene;locus_tag=BALIOE_04820 | |
| 1939 c1 Prodigal CDS 1026910 1028391 . + 0 ID=BALIOE_04820;Name=hypothetical protein;locus_tag=BALIOE_04820;product=hypothetical protein;Parent=BALIOE_04820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1940 c1 Prodigal gene 1028442 1029173 . - . ID=BALIOE_04825_gene;locus_tag=BALIOE_04825 | |
| 1941 c1 Prodigal CDS 1028442 1029173 . - 0 ID=BALIOE_04825;Name=hypothetical protein;locus_tag=BALIOE_04825;product=hypothetical protein;Parent=BALIOE_04825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1942 c1 Prodigal gene 1029327 1029464 . - . ID=BALIOE_04830_gene;locus_tag=BALIOE_04830 | |
| 1943 c1 Prodigal CDS 1029327 1029464 . - 0 ID=BALIOE_04830;Name=hypothetical protein;locus_tag=BALIOE_04830;product=hypothetical protein;Parent=BALIOE_04830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1944 c1 Infernal gene 1029351 1029431 . + . ID=BALIOE_04835_gene;locus_tag=BALIOE_04835;gene=naRNA4 | |
| 1945 c1 Infernal ncRNA 1029351 1029431 1.4e-11 + . ID=BALIOE_04835;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_04835;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_04835_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 1946 c1 Prodigal gene 1029464 1030132 . - . ID=BALIOE_04840_gene;locus_tag=BALIOE_04840 | |
| 1947 c1 Prodigal CDS 1029464 1030132 . - 0 ID=BALIOE_04840;Name=hypothetical protein;locus_tag=BALIOE_04840;product=hypothetical protein;Parent=BALIOE_04840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1948 c1 Prodigal gene 1030132 1030848 . - . ID=BALIOE_04845_gene;locus_tag=BALIOE_04845 | |
| 1949 c1 Prodigal CDS 1030132 1030848 . - 0 ID=BALIOE_04845;Name=hypothetical protein;locus_tag=BALIOE_04845;product=hypothetical protein;Parent=BALIOE_04845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1950 c1 Prodigal gene 1030855 1031586 . - . ID=BALIOE_04850_gene;locus_tag=BALIOE_04850 | |
| 1951 c1 Prodigal CDS 1030855 1031586 . - 0 ID=BALIOE_04850;Name=hypothetical protein;locus_tag=BALIOE_04850;product=hypothetical protein;Parent=BALIOE_04850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1952 c1 Prodigal gene 1031604 1032332 . - . ID=BALIOE_04855_gene;locus_tag=BALIOE_04855 | |
| 1953 c1 Prodigal CDS 1031604 1032332 . - 0 ID=BALIOE_04855;Name=hypothetical protein;locus_tag=BALIOE_04855;product=hypothetical protein;Parent=BALIOE_04855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1954 c1 Prodigal gene 1032550 1033065 . - . ID=BALIOE_04860_gene;locus_tag=BALIOE_04860 | |
| 1955 c1 Prodigal CDS 1032550 1033065 . - 0 ID=BALIOE_04860;Name=hypothetical protein;locus_tag=BALIOE_04860;product=hypothetical protein;Parent=BALIOE_04860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1956 c1 Prodigal gene 1033689 1034930 . + . ID=BALIOE_04865_gene;locus_tag=BALIOE_04865 | |
| 1957 c1 Prodigal CDS 1033689 1034930 . + 0 ID=BALIOE_04865;Name=hypothetical protein;locus_tag=BALIOE_04865;product=hypothetical protein;Parent=BALIOE_04865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1958 c1 Prodigal gene 1035205 1035495 . + . ID=BALIOE_04870_gene;locus_tag=BALIOE_04870 | |
| 1959 c1 Prodigal CDS 1035205 1035495 . + 0 ID=BALIOE_04870;Name=hypothetical protein;locus_tag=BALIOE_04870;product=hypothetical protein;Parent=BALIOE_04870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1960 c1 Prodigal gene 1035706 1036029 . + . ID=BALIOE_04875_gene;locus_tag=BALIOE_04875 | |
| 1961 c1 Prodigal CDS 1035706 1036029 . + 0 ID=BALIOE_04875;Name=hypothetical protein;locus_tag=BALIOE_04875;product=hypothetical protein;Parent=BALIOE_04875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1962 c1 Prodigal gene 1036026 1036856 . + . ID=BALIOE_04880_gene;locus_tag=BALIOE_04880 | |
| 1963 c1 Prodigal CDS 1036026 1036856 . + 0 ID=BALIOE_04880;Name=hypothetical protein;locus_tag=BALIOE_04880;product=hypothetical protein;Parent=BALIOE_04880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1964 c1 Prodigal gene 1036853 1037866 . - . ID=BALIOE_04885_gene;locus_tag=BALIOE_04885 | |
| 1965 c1 Prodigal CDS 1036853 1037866 . - 0 ID=BALIOE_04885;Name=hypothetical protein;locus_tag=BALIOE_04885;product=hypothetical protein;Parent=BALIOE_04885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1966 c1 Prodigal gene 1037965 1039395 . - . ID=BALIOE_04890_gene;locus_tag=BALIOE_04890 | |
| 1967 c1 Prodigal CDS 1037965 1039395 . - 0 ID=BALIOE_04890;Name=hypothetical protein;locus_tag=BALIOE_04890;product=hypothetical protein;Parent=BALIOE_04890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1968 c1 Prodigal gene 1039406 1040407 . - . ID=BALIOE_04895_gene;locus_tag=BALIOE_04895 | |
| 1969 c1 Prodigal CDS 1039406 1040407 . - 0 ID=BALIOE_04895;Name=hypothetical protein;locus_tag=BALIOE_04895;product=hypothetical protein;Parent=BALIOE_04895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1970 c1 Prodigal gene 1040444 1042162 . - . ID=BALIOE_04900_gene;locus_tag=BALIOE_04900 | |
| 1971 c1 Prodigal CDS 1040444 1042162 . - 0 ID=BALIOE_04900;Name=hypothetical protein;locus_tag=BALIOE_04900;product=hypothetical protein;Parent=BALIOE_04900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1972 c1 Prodigal gene 1042295 1043263 . - . ID=BALIOE_04905_gene;locus_tag=BALIOE_04905 | |
| 1973 c1 Prodigal CDS 1042295 1043263 . - 0 ID=BALIOE_04905;Name=hypothetical protein;locus_tag=BALIOE_04905;product=hypothetical protein;Parent=BALIOE_04905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1974 c1 Prodigal gene 1043275 1044927 . - . ID=BALIOE_04910_gene;locus_tag=BALIOE_04910 | |
| 1975 c1 Prodigal CDS 1043275 1044927 . - 0 ID=BALIOE_04910;Name=hypothetical protein;locus_tag=BALIOE_04910;product=hypothetical protein;Parent=BALIOE_04910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1976 c1 Prodigal gene 1045071 1045970 . - . ID=BALIOE_04915_gene;locus_tag=BALIOE_04915 | |
| 1977 c1 Prodigal CDS 1045071 1045970 . - 0 ID=BALIOE_04915;Name=hypothetical protein;locus_tag=BALIOE_04915;product=hypothetical protein;Parent=BALIOE_04915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1978 c1 Prodigal gene 1046428 1047123 . - . ID=BALIOE_04920_gene;locus_tag=BALIOE_04920 | |
| 1979 c1 Prodigal CDS 1046428 1047123 . - 0 ID=BALIOE_04920;Name=hypothetical protein;locus_tag=BALIOE_04920;product=hypothetical protein;Parent=BALIOE_04920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1980 c1 Prodigal gene 1047549 1049207 . + . ID=BALIOE_04925_gene;locus_tag=BALIOE_04925 | |
| 1981 c1 Prodigal CDS 1047549 1049207 . + 0 ID=BALIOE_04925;Name=hypothetical protein;locus_tag=BALIOE_04925;product=hypothetical protein;Parent=BALIOE_04925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1982 c1 Prodigal gene 1049204 1050196 . - . ID=BALIOE_04930_gene;locus_tag=BALIOE_04930 | |
| 1983 c1 Prodigal CDS 1049204 1050196 . - 0 ID=BALIOE_04930;Name=hypothetical protein;locus_tag=BALIOE_04930;product=hypothetical protein;Parent=BALIOE_04930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1984 c1 Prodigal gene 1050311 1051426 . + . ID=BALIOE_04935_gene;locus_tag=BALIOE_04935 | |
| 1985 c1 Prodigal CDS 1050311 1051426 . + 0 ID=BALIOE_04935;Name=hypothetical protein;locus_tag=BALIOE_04935;product=hypothetical protein;Parent=BALIOE_04935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1986 c1 Prodigal gene 1051423 1053369 . + . ID=BALIOE_04940_gene;locus_tag=BALIOE_04940 | |
| 1987 c1 Prodigal CDS 1051423 1053369 . + 0 ID=BALIOE_04940;Name=hypothetical protein;locus_tag=BALIOE_04940;product=hypothetical protein;Parent=BALIOE_04940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1988 c1 Prodigal gene 1053442 1053666 . - . ID=BALIOE_04945_gene;locus_tag=BALIOE_04945 | |
| 1989 c1 Prodigal CDS 1053442 1053666 . - 0 ID=BALIOE_04945;Name=hypothetical protein;locus_tag=BALIOE_04945;product=hypothetical protein;Parent=BALIOE_04945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1990 c1 Prodigal gene 1053989 1054309 . + . ID=BALIOE_04950_gene;locus_tag=BALIOE_04950 | |
| 1991 c1 Prodigal CDS 1053989 1054309 . + 0 ID=BALIOE_04950;Name=hypothetical protein;locus_tag=BALIOE_04950;product=hypothetical protein;Parent=BALIOE_04950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1992 c1 Prodigal gene 1054340 1056616 . + . ID=BALIOE_04955_gene;locus_tag=BALIOE_04955 | |
| 1993 c1 Prodigal CDS 1054340 1056616 . + 0 ID=BALIOE_04955;Name=hypothetical protein;locus_tag=BALIOE_04955;product=hypothetical protein;Parent=BALIOE_04955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1994 c1 tRNAscan-SE gene 1056962 1057049 . - . ID=BALIOE_04960_gene;locus_tag=BALIOE_04960;gene=Ser_trna | |
| 1995 c1 tRNAscan-SE tRNA 1056962 1057049 . - . ID=BALIOE_04960;Name=tRNA-Ser;locus_tag=BALIOE_04960;product=tRNA-Ser;gene=Ser_trna;Parent=BALIOE_04960_gene;inference=profile:tRNAscan:2.0;Note=SO:0000269 | |
| 1996 c1 Prodigal gene 1057303 1057521 . - . ID=BALIOE_04965_gene;locus_tag=BALIOE_04965 | |
| 1997 c1 Prodigal CDS 1057303 1057521 . - 0 ID=BALIOE_04965;Name=hypothetical protein;locus_tag=BALIOE_04965;product=hypothetical protein;Parent=BALIOE_04965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 1998 c1 Prodigal gene 1057806 1058510 . - . ID=BALIOE_04970_gene;locus_tag=BALIOE_04970 | |
| 1999 c1 Prodigal CDS 1057806 1058510 . - 0 ID=BALIOE_04970;Name=hypothetical protein;locus_tag=BALIOE_04970;product=hypothetical protein;Parent=BALIOE_04970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2000 c1 Prodigal gene 1058552 1060273 . - . ID=BALIOE_04975_gene;locus_tag=BALIOE_04975 | |
| 2001 c1 Prodigal CDS 1058552 1060273 . - 0 ID=BALIOE_04975;Name=hypothetical protein;locus_tag=BALIOE_04975;product=hypothetical protein;Parent=BALIOE_04975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2002 c1 Prodigal gene 1060274 1062040 . - . ID=BALIOE_04980_gene;locus_tag=BALIOE_04980 | |
| 2003 c1 Prodigal CDS 1060274 1062040 . - 0 ID=BALIOE_04980;Name=hypothetical protein;locus_tag=BALIOE_04980;product=hypothetical protein;Parent=BALIOE_04980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2004 c1 Prodigal gene 1062163 1063128 . - . ID=BALIOE_04985_gene;locus_tag=BALIOE_04985 | |
| 2005 c1 Prodigal CDS 1062163 1063128 . - 0 ID=BALIOE_04985;Name=hypothetical protein;locus_tag=BALIOE_04985;product=hypothetical protein;Parent=BALIOE_04985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2006 c1 Prodigal gene 1063673 1064167 . + . ID=BALIOE_04990_gene;locus_tag=BALIOE_04990 | |
| 2007 c1 Prodigal CDS 1063673 1064167 . + 0 ID=BALIOE_04990;Name=hypothetical protein;locus_tag=BALIOE_04990;product=hypothetical protein;Parent=BALIOE_04990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2008 c1 Prodigal gene 1064302 1068330 . + . ID=BALIOE_04995_gene;locus_tag=BALIOE_04995 | |
| 2009 c1 Prodigal CDS 1064302 1068330 . + 0 ID=BALIOE_04995;Name=hypothetical protein;locus_tag=BALIOE_04995;product=hypothetical protein;Parent=BALIOE_04995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2010 c1 Prodigal gene 1068485 1069096 . + . ID=BALIOE_05000_gene;locus_tag=BALIOE_05000 | |
| 2011 c1 Prodigal CDS 1068485 1069096 . + 0 ID=BALIOE_05000;Name=hypothetical protein;locus_tag=BALIOE_05000;product=hypothetical protein;Parent=BALIOE_05000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2012 c1 Prodigal gene 1069107 1070450 . + . ID=BALIOE_05005_gene;locus_tag=BALIOE_05005 | |
| 2013 c1 Prodigal CDS 1069107 1070450 . + 0 ID=BALIOE_05005;Name=hypothetical protein;locus_tag=BALIOE_05005;product=hypothetical protein;Parent=BALIOE_05005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2014 c1 Prodigal gene 1070541 1071833 . + . ID=BALIOE_05010_gene;locus_tag=BALIOE_05010 | |
| 2015 c1 Prodigal CDS 1070541 1071833 . + 0 ID=BALIOE_05010;Name=hypothetical protein;locus_tag=BALIOE_05010;product=hypothetical protein;Parent=BALIOE_05010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2016 c1 Prodigal gene 1072072 1074516 . + . ID=BALIOE_05015_gene;locus_tag=BALIOE_05015 | |
| 2017 c1 Prodigal CDS 1072072 1074516 . + 0 ID=BALIOE_05015;Name=hypothetical protein;locus_tag=BALIOE_05015;product=hypothetical protein;Parent=BALIOE_05015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2018 c1 Prodigal gene 1074527 1075144 . + . ID=BALIOE_05020_gene;locus_tag=BALIOE_05020 | |
| 2019 c1 Prodigal CDS 1074527 1075144 . + 0 ID=BALIOE_05020;Name=hypothetical protein;locus_tag=BALIOE_05020;product=hypothetical protein;Parent=BALIOE_05020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2020 c1 Prodigal gene 1075146 1076009 . + . ID=BALIOE_05025_gene;locus_tag=BALIOE_05025 | |
| 2021 c1 Prodigal CDS 1075146 1076009 . + 0 ID=BALIOE_05025;Name=hypothetical protein;locus_tag=BALIOE_05025;product=hypothetical protein;Parent=BALIOE_05025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2022 c1 Prodigal gene 1076045 1076671 . - . ID=BALIOE_05030_gene;locus_tag=BALIOE_05030 | |
| 2023 c1 Prodigal CDS 1076045 1076671 . - 0 ID=BALIOE_05030;Name=hypothetical protein;locus_tag=BALIOE_05030;product=hypothetical protein;Parent=BALIOE_05030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2024 c1 Prodigal gene 1076986 1078134 . + . ID=BALIOE_05035_gene;locus_tag=BALIOE_05035 | |
| 2025 c1 Prodigal CDS 1076986 1078134 . + 0 ID=BALIOE_05035;Name=hypothetical protein;locus_tag=BALIOE_05035;product=hypothetical protein;Parent=BALIOE_05035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2026 c1 Prodigal gene 1078344 1079774 . + . ID=BALIOE_05040_gene;locus_tag=BALIOE_05040 | |
| 2027 c1 Prodigal CDS 1078344 1079774 . + 0 ID=BALIOE_05040;Name=hypothetical protein;locus_tag=BALIOE_05040;product=hypothetical protein;Parent=BALIOE_05040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2028 c1 Prodigal gene 1079984 1080724 . - . ID=BALIOE_05045_gene;locus_tag=BALIOE_05045 | |
| 2029 c1 Prodigal CDS 1079984 1080724 . - 0 ID=BALIOE_05045;Name=hypothetical protein;locus_tag=BALIOE_05045;product=hypothetical protein;Parent=BALIOE_05045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2030 c1 Prodigal gene 1080916 1083198 . - . ID=BALIOE_05050_gene;locus_tag=BALIOE_05050 | |
| 2031 c1 Prodigal CDS 1080916 1083198 . - 0 ID=BALIOE_05050;Name=hypothetical protein;locus_tag=BALIOE_05050;product=hypothetical protein;Parent=BALIOE_05050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2032 c1 Prodigal gene 1083253 1084110 . - . ID=BALIOE_05055_gene;locus_tag=BALIOE_05055 | |
| 2033 c1 Prodigal CDS 1083253 1084110 . - 0 ID=BALIOE_05055;Name=hypothetical protein;locus_tag=BALIOE_05055;product=hypothetical protein;Parent=BALIOE_05055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2034 c1 Prodigal gene 1084516 1086276 . - . ID=BALIOE_05060_gene;locus_tag=BALIOE_05060 | |
| 2035 c1 Prodigal CDS 1084516 1086276 . - 0 ID=BALIOE_05060;Name=hypothetical protein;locus_tag=BALIOE_05060;product=hypothetical protein;Parent=BALIOE_05060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2036 c1 Prodigal gene 1086406 1087098 . + . ID=BALIOE_05065_gene;locus_tag=BALIOE_05065 | |
| 2037 c1 Prodigal CDS 1086406 1087098 . + 0 ID=BALIOE_05065;Name=hypothetical protein;locus_tag=BALIOE_05065;product=hypothetical protein;Parent=BALIOE_05065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2038 c1 Prodigal gene 1087297 1088385 . + . ID=BALIOE_05070_gene;locus_tag=BALIOE_05070 | |
| 2039 c1 Prodigal CDS 1087297 1088385 . + 0 ID=BALIOE_05070;Name=hypothetical protein;locus_tag=BALIOE_05070;product=hypothetical protein;Parent=BALIOE_05070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2040 c1 Prodigal gene 1088456 1089739 . + . ID=BALIOE_05075_gene;locus_tag=BALIOE_05075 | |
| 2041 c1 Prodigal CDS 1088456 1089739 . + 0 ID=BALIOE_05075;Name=hypothetical protein;locus_tag=BALIOE_05075;product=hypothetical protein;Parent=BALIOE_05075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2042 c1 Prodigal gene 1089908 1090672 . + . ID=BALIOE_05080_gene;locus_tag=BALIOE_05080 | |
| 2043 c1 Prodigal CDS 1089908 1090672 . + 0 ID=BALIOE_05080;Name=hypothetical protein;locus_tag=BALIOE_05080;product=hypothetical protein;Parent=BALIOE_05080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2044 c1 Prodigal gene 1090845 1091528 . + . ID=BALIOE_05085_gene;locus_tag=BALIOE_05085 | |
| 2045 c1 Prodigal CDS 1090845 1091528 . + 0 ID=BALIOE_05085;Name=hypothetical protein;locus_tag=BALIOE_05085;product=hypothetical protein;Parent=BALIOE_05085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2046 c1 Prodigal gene 1091639 1093312 . + . ID=BALIOE_05090_gene;locus_tag=BALIOE_05090 | |
| 2047 c1 Prodigal CDS 1091639 1093312 . + 0 ID=BALIOE_05090;Name=hypothetical protein;locus_tag=BALIOE_05090;product=hypothetical protein;Parent=BALIOE_05090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2048 c1 Prodigal gene 1093472 1093756 . + . ID=BALIOE_05095_gene;locus_tag=BALIOE_05095 | |
| 2049 c1 Prodigal CDS 1093472 1093756 . + 0 ID=BALIOE_05095;Name=hypothetical protein;locus_tag=BALIOE_05095;product=hypothetical protein;Parent=BALIOE_05095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2050 c1 Prodigal gene 1093963 1096227 . + . ID=BALIOE_05100_gene;locus_tag=BALIOE_05100 | |
| 2051 c1 Prodigal CDS 1093963 1096227 . + 0 ID=BALIOE_05100;Name=hypothetical protein;locus_tag=BALIOE_05100;product=hypothetical protein;Parent=BALIOE_05100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2052 c1 Prodigal gene 1096264 1098012 . + . ID=BALIOE_05105_gene;locus_tag=BALIOE_05105 | |
| 2053 c1 Prodigal CDS 1096264 1098012 . + 0 ID=BALIOE_05105;Name=hypothetical protein;locus_tag=BALIOE_05105;product=hypothetical protein;Parent=BALIOE_05105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2054 c1 Prodigal gene 1098009 1098995 . + . ID=BALIOE_05110_gene;locus_tag=BALIOE_05110 | |
| 2055 c1 Prodigal CDS 1098009 1098995 . + 0 ID=BALIOE_05110;Name=hypothetical protein;locus_tag=BALIOE_05110;product=hypothetical protein;Parent=BALIOE_05110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2056 c1 Prodigal gene 1099032 1100264 . + . ID=BALIOE_05115_gene;locus_tag=BALIOE_05115 | |
| 2057 c1 Prodigal CDS 1099032 1100264 . + 0 ID=BALIOE_05115;Name=hypothetical protein;locus_tag=BALIOE_05115;product=hypothetical protein;Parent=BALIOE_05115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2058 c1 Prodigal gene 1100316 1100498 . + . ID=BALIOE_05120_gene;locus_tag=BALIOE_05120 | |
| 2059 c1 Prodigal CDS 1100316 1100498 . + 0 ID=BALIOE_05120;Name=hypothetical protein;locus_tag=BALIOE_05120;product=hypothetical protein;Parent=BALIOE_05120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2060 c1 Prodigal gene 1100495 1101241 . + . ID=BALIOE_05125_gene;locus_tag=BALIOE_05125 | |
| 2061 c1 Prodigal CDS 1100495 1101241 . + 0 ID=BALIOE_05125;Name=hypothetical protein;locus_tag=BALIOE_05125;product=hypothetical protein;Parent=BALIOE_05125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2062 c1 Prodigal gene 1101395 1102288 . + . ID=BALIOE_05130_gene;locus_tag=BALIOE_05130 | |
| 2063 c1 Prodigal CDS 1101395 1102288 . + 0 ID=BALIOE_05130;Name=hypothetical protein;locus_tag=BALIOE_05130;product=hypothetical protein;Parent=BALIOE_05130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2064 c1 Prodigal gene 1102265 1103044 . - . ID=BALIOE_05135_gene;locus_tag=BALIOE_05135 | |
| 2065 c1 Prodigal CDS 1102265 1103044 . - 0 ID=BALIOE_05135;Name=hypothetical protein;locus_tag=BALIOE_05135;product=hypothetical protein;Parent=BALIOE_05135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2066 c1 Prodigal gene 1103180 1103965 . + . ID=BALIOE_05140_gene;locus_tag=BALIOE_05140 | |
| 2067 c1 Prodigal CDS 1103180 1103965 . + 0 ID=BALIOE_05140;Name=hypothetical protein;locus_tag=BALIOE_05140;product=hypothetical protein;Parent=BALIOE_05140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2068 c1 Prodigal gene 1103962 1105284 . + . ID=BALIOE_05145_gene;locus_tag=BALIOE_05145 | |
| 2069 c1 Prodigal CDS 1103962 1105284 . + 0 ID=BALIOE_05145;Name=hypothetical protein;locus_tag=BALIOE_05145;product=hypothetical protein;Parent=BALIOE_05145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2070 c1 Prodigal gene 1105265 1105969 . + . ID=BALIOE_05150_gene;locus_tag=BALIOE_05150 | |
| 2071 c1 Prodigal CDS 1105265 1105969 . + 0 ID=BALIOE_05150;Name=hypothetical protein;locus_tag=BALIOE_05150;product=hypothetical protein;Parent=BALIOE_05150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2072 c1 Prodigal gene 1105969 1110429 . + . ID=BALIOE_05155_gene;locus_tag=BALIOE_05155 | |
| 2073 c1 Prodigal CDS 1105969 1110429 . + 0 ID=BALIOE_05155;Name=hypothetical protein;locus_tag=BALIOE_05155;product=hypothetical protein;Parent=BALIOE_05155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2074 c1 Prodigal gene 1110690 1112537 . + . ID=BALIOE_05160_gene;locus_tag=BALIOE_05160 | |
| 2075 c1 Prodigal CDS 1110690 1112537 . + 0 ID=BALIOE_05160;Name=hypothetical protein;locus_tag=BALIOE_05160;product=hypothetical protein;Parent=BALIOE_05160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2076 c1 Prodigal gene 1112718 1113266 . + . ID=BALIOE_05165_gene;locus_tag=BALIOE_05165 | |
| 2077 c1 Prodigal CDS 1112718 1113266 . + 0 ID=BALIOE_05165;Name=hypothetical protein;locus_tag=BALIOE_05165;product=hypothetical protein;Parent=BALIOE_05165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2078 c1 Prodigal gene 1113293 1113940 . + . ID=BALIOE_05170_gene;locus_tag=BALIOE_05170 | |
| 2079 c1 Prodigal CDS 1113293 1113940 . + 0 ID=BALIOE_05170;Name=hypothetical protein;locus_tag=BALIOE_05170;product=hypothetical protein;Parent=BALIOE_05170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2080 c1 Prodigal gene 1113991 1115181 . - . ID=BALIOE_05175_gene;locus_tag=BALIOE_05175 | |
| 2081 c1 Prodigal CDS 1113991 1115181 . - 0 ID=BALIOE_05175;Name=hypothetical protein;locus_tag=BALIOE_05175;product=hypothetical protein;Parent=BALIOE_05175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2082 c1 Prodigal gene 1115366 1116454 . - . ID=BALIOE_05180_gene;locus_tag=BALIOE_05180 | |
| 2083 c1 Prodigal CDS 1115366 1116454 . - 0 ID=BALIOE_05180;Name=hypothetical protein;locus_tag=BALIOE_05180;product=hypothetical protein;Parent=BALIOE_05180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2084 c1 Prodigal gene 1117057 1118457 . - . ID=BALIOE_05185_gene;locus_tag=BALIOE_05185 | |
| 2085 c1 Prodigal CDS 1117057 1118457 . - 0 ID=BALIOE_05185;Name=hypothetical protein;locus_tag=BALIOE_05185;product=hypothetical protein;Parent=BALIOE_05185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2086 c1 Prodigal gene 1118626 1119828 . - . ID=BALIOE_05190_gene;locus_tag=BALIOE_05190 | |
| 2087 c1 Prodigal CDS 1118626 1119828 . - 0 ID=BALIOE_05190;Name=hypothetical protein;locus_tag=BALIOE_05190;product=hypothetical protein;Parent=BALIOE_05190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2088 c1 Prodigal gene 1120094 1122706 . + . ID=BALIOE_05195_gene;locus_tag=BALIOE_05195 | |
| 2089 c1 Prodigal CDS 1120094 1122706 . + 0 ID=BALIOE_05195;Name=hypothetical protein;locus_tag=BALIOE_05195;product=hypothetical protein;Parent=BALIOE_05195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2090 c1 Prodigal gene 1122749 1123516 . - . ID=BALIOE_05200_gene;locus_tag=BALIOE_05200 | |
| 2091 c1 Prodigal CDS 1122749 1123516 . - 0 ID=BALIOE_05200;Name=hypothetical protein;locus_tag=BALIOE_05200;product=hypothetical protein;Parent=BALIOE_05200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2092 c1 Prodigal gene 1123513 1124304 . - . ID=BALIOE_05205_gene;locus_tag=BALIOE_05205 | |
| 2093 c1 Prodigal CDS 1123513 1124304 . - 0 ID=BALIOE_05205;Name=hypothetical protein;locus_tag=BALIOE_05205;product=hypothetical protein;Parent=BALIOE_05205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2094 c1 Prodigal gene 1124316 1125461 . - . ID=BALIOE_05210_gene;locus_tag=BALIOE_05210 | |
| 2095 c1 Prodigal CDS 1124316 1125461 . - 0 ID=BALIOE_05210;Name=hypothetical protein;locus_tag=BALIOE_05210;product=hypothetical protein;Parent=BALIOE_05210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2096 c1 Prodigal gene 1125458 1126417 . - . ID=BALIOE_05215_gene;locus_tag=BALIOE_05215 | |
| 2097 c1 Prodigal CDS 1125458 1126417 . - 0 ID=BALIOE_05215;Name=hypothetical protein;locus_tag=BALIOE_05215;product=hypothetical protein;Parent=BALIOE_05215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2098 c1 Prodigal gene 1126410 1126985 . - . ID=BALIOE_05220_gene;locus_tag=BALIOE_05220 | |
| 2099 c1 Prodigal CDS 1126410 1126985 . - 0 ID=BALIOE_05220;Name=hypothetical protein;locus_tag=BALIOE_05220;product=hypothetical protein;Parent=BALIOE_05220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2100 c1 Prodigal gene 1127341 1127880 . + . ID=BALIOE_05225_gene;locus_tag=BALIOE_05225 | |
| 2101 c1 Prodigal CDS 1127341 1127880 . + 0 ID=BALIOE_05225;Name=hypothetical protein;locus_tag=BALIOE_05225;product=hypothetical protein;Parent=BALIOE_05225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2102 c1 Prodigal gene 1127963 1128664 . + . ID=BALIOE_05230_gene;locus_tag=BALIOE_05230 | |
| 2103 c1 Prodigal CDS 1127963 1128664 . + 0 ID=BALIOE_05230;Name=hypothetical protein;locus_tag=BALIOE_05230;product=hypothetical protein;Parent=BALIOE_05230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2104 c1 Prodigal gene 1128689 1129291 . + . ID=BALIOE_05235_gene;locus_tag=BALIOE_05235 | |
| 2105 c1 Prodigal CDS 1128689 1129291 . + 0 ID=BALIOE_05235;Name=hypothetical protein;locus_tag=BALIOE_05235;product=hypothetical protein;Parent=BALIOE_05235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2106 c1 Prodigal gene 1129327 1131288 . + . ID=BALIOE_05240_gene;locus_tag=BALIOE_05240 | |
| 2107 c1 Prodigal CDS 1129327 1131288 . + 0 ID=BALIOE_05240;Name=hypothetical protein;locus_tag=BALIOE_05240;product=hypothetical protein;Parent=BALIOE_05240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2108 c1 Prodigal gene 1131279 1132259 . + . ID=BALIOE_05245_gene;locus_tag=BALIOE_05245 | |
| 2109 c1 Prodigal CDS 1131279 1132259 . + 0 ID=BALIOE_05245;Name=hypothetical protein;locus_tag=BALIOE_05245;product=hypothetical protein;Parent=BALIOE_05245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2110 c1 Prodigal gene 1132428 1132904 . + . ID=BALIOE_05250_gene;locus_tag=BALIOE_05250 | |
| 2111 c1 Prodigal CDS 1132428 1132904 . + 0 ID=BALIOE_05250;Name=hypothetical protein;locus_tag=BALIOE_05250;product=hypothetical protein;Parent=BALIOE_05250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2112 c1 Prodigal gene 1132864 1133427 . + . ID=BALIOE_05255_gene;locus_tag=BALIOE_05255 | |
| 2113 c1 Prodigal CDS 1132864 1133427 . + 0 ID=BALIOE_05255;Name=hypothetical protein;locus_tag=BALIOE_05255;product=hypothetical protein;Parent=BALIOE_05255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2114 c1 Prodigal gene 1133441 1133962 . + . ID=BALIOE_05260_gene;locus_tag=BALIOE_05260 | |
| 2115 c1 Prodigal CDS 1133441 1133962 . + 0 ID=BALIOE_05260;Name=hypothetical protein;locus_tag=BALIOE_05260;product=hypothetical protein;Parent=BALIOE_05260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2116 c1 Prodigal gene 1134240 1135250 . + . ID=BALIOE_05265_gene;locus_tag=BALIOE_05265 | |
| 2117 c1 Prodigal CDS 1134240 1135250 . + 0 ID=BALIOE_05265;Name=hypothetical protein;locus_tag=BALIOE_05265;product=hypothetical protein;Parent=BALIOE_05265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2118 c1 Prodigal gene 1135424 1135966 . + . ID=BALIOE_05270_gene;locus_tag=BALIOE_05270 | |
| 2119 c1 Prodigal CDS 1135424 1135966 . + 0 ID=BALIOE_05270;Name=hypothetical protein;locus_tag=BALIOE_05270;product=hypothetical protein;Parent=BALIOE_05270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2120 c1 Prodigal gene 1135963 1137072 . - . ID=BALIOE_05275_gene;locus_tag=BALIOE_05275 | |
| 2121 c1 Prodigal CDS 1135963 1137072 . - 0 ID=BALIOE_05275;Name=hypothetical protein;locus_tag=BALIOE_05275;product=hypothetical protein;Parent=BALIOE_05275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2122 c1 Prodigal gene 1137316 1139424 . + . ID=BALIOE_05280_gene;locus_tag=BALIOE_05280 | |
| 2123 c1 Prodigal CDS 1137316 1139424 . + 0 ID=BALIOE_05280;Name=hypothetical protein;locus_tag=BALIOE_05280;product=hypothetical protein;Parent=BALIOE_05280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2124 c1 Prodigal gene 1139436 1141343 . + . ID=BALIOE_05285_gene;locus_tag=BALIOE_05285 | |
| 2125 c1 Prodigal CDS 1139436 1141343 . + 0 ID=BALIOE_05285;Name=hypothetical protein;locus_tag=BALIOE_05285;product=hypothetical protein;Parent=BALIOE_05285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2126 c1 Prodigal gene 1141473 1142726 . + . ID=BALIOE_05290_gene;locus_tag=BALIOE_05290 | |
| 2127 c1 Prodigal CDS 1141473 1142726 . + 0 ID=BALIOE_05290;Name=hypothetical protein;locus_tag=BALIOE_05290;product=hypothetical protein;Parent=BALIOE_05290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2128 c1 Prodigal gene 1142731 1144371 . + . ID=BALIOE_05295_gene;locus_tag=BALIOE_05295 | |
| 2129 c1 Prodigal CDS 1142731 1144371 . + 0 ID=BALIOE_05295;Name=hypothetical protein;locus_tag=BALIOE_05295;product=hypothetical protein;Parent=BALIOE_05295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2130 c1 Prodigal gene 1144368 1144931 . + . ID=BALIOE_05300_gene;locus_tag=BALIOE_05300 | |
| 2131 c1 Prodigal CDS 1144368 1144931 . + 0 ID=BALIOE_05300;Name=hypothetical protein;locus_tag=BALIOE_05300;product=hypothetical protein;Parent=BALIOE_05300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2132 c1 Prodigal gene 1145187 1145354 . + . ID=BALIOE_05305_gene;locus_tag=BALIOE_05305 | |
| 2133 c1 Prodigal CDS 1145187 1145354 . + 0 ID=BALIOE_05305;Name=hypothetical protein;locus_tag=BALIOE_05305;product=hypothetical protein;Parent=BALIOE_05305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2134 c1 Prodigal gene 1145424 1146050 . - . ID=BALIOE_05310_gene;locus_tag=BALIOE_05310 | |
| 2135 c1 Prodigal CDS 1145424 1146050 . - 0 ID=BALIOE_05310;Name=hypothetical protein;locus_tag=BALIOE_05310;product=hypothetical protein;Parent=BALIOE_05310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2136 c1 Prodigal gene 1146011 1147771 . - . ID=BALIOE_05315_gene;locus_tag=BALIOE_05315 | |
| 2137 c1 Prodigal CDS 1146011 1147771 . - 0 ID=BALIOE_05315;Name=hypothetical protein;locus_tag=BALIOE_05315;product=hypothetical protein;Parent=BALIOE_05315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2138 c1 Prodigal gene 1147957 1148409 . + . ID=BALIOE_05320_gene;locus_tag=BALIOE_05320 | |
| 2139 c1 Prodigal CDS 1147957 1148409 . + 0 ID=BALIOE_05320;Name=hypothetical protein;locus_tag=BALIOE_05320;product=hypothetical protein;Parent=BALIOE_05320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2140 c1 Prodigal gene 1148485 1149525 . - . ID=BALIOE_05325_gene;locus_tag=BALIOE_05325 | |
| 2141 c1 Prodigal CDS 1148485 1149525 . - 0 ID=BALIOE_05325;Name=hypothetical protein;locus_tag=BALIOE_05325;product=hypothetical protein;Parent=BALIOE_05325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2142 c1 Prodigal gene 1149882 1150391 . - . ID=BALIOE_05330_gene;locus_tag=BALIOE_05330 | |
| 2143 c1 Prodigal CDS 1149882 1150391 . - 0 ID=BALIOE_05330;Name=hypothetical protein;locus_tag=BALIOE_05330;product=hypothetical protein;Parent=BALIOE_05330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2144 c1 Prodigal gene 1150610 1151239 . + . ID=BALIOE_05335_gene;locus_tag=BALIOE_05335 | |
| 2145 c1 Prodigal CDS 1150610 1151239 . + 0 ID=BALIOE_05335;Name=hypothetical protein;locus_tag=BALIOE_05335;product=hypothetical protein;Parent=BALIOE_05335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2146 c1 Prodigal gene 1151202 1153364 . - . ID=BALIOE_05340_gene;locus_tag=BALIOE_05340 | |
| 2147 c1 Prodigal CDS 1151202 1153364 . - 0 ID=BALIOE_05340;Name=hypothetical protein;locus_tag=BALIOE_05340;product=hypothetical protein;Parent=BALIOE_05340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2148 c1 Prodigal gene 1153374 1153820 . - . ID=BALIOE_05345_gene;locus_tag=BALIOE_05345 | |
| 2149 c1 Prodigal CDS 1153374 1153820 . - 0 ID=BALIOE_05345;Name=hypothetical protein;locus_tag=BALIOE_05345;product=hypothetical protein;Parent=BALIOE_05345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2150 c1 Prodigal gene 1153943 1155997 . + . ID=BALIOE_05350_gene;locus_tag=BALIOE_05350 | |
| 2151 c1 Prodigal CDS 1153943 1155997 . + 0 ID=BALIOE_05350;Name=hypothetical protein;locus_tag=BALIOE_05350;product=hypothetical protein;Parent=BALIOE_05350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2152 c1 Prodigal gene 1156029 1156487 . - . ID=BALIOE_05355_gene;locus_tag=BALIOE_05355 | |
| 2153 c1 Prodigal CDS 1156029 1156487 . - 0 ID=BALIOE_05355;Name=hypothetical protein;locus_tag=BALIOE_05355;product=hypothetical protein;Parent=BALIOE_05355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2154 c1 Prodigal gene 1156583 1157245 . - . ID=BALIOE_05360_gene;locus_tag=BALIOE_05360 | |
| 2155 c1 Prodigal CDS 1156583 1157245 . - 0 ID=BALIOE_05360;Name=hypothetical protein;locus_tag=BALIOE_05360;product=hypothetical protein;Parent=BALIOE_05360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2156 c1 Prodigal gene 1157418 1157831 . + . ID=BALIOE_05365_gene;locus_tag=BALIOE_05365 | |
| 2157 c1 Prodigal CDS 1157418 1157831 . + 0 ID=BALIOE_05365;Name=hypothetical protein;locus_tag=BALIOE_05365;product=hypothetical protein;Parent=BALIOE_05365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2158 c1 Prodigal gene 1157876 1158193 . - . ID=BALIOE_05370_gene;locus_tag=BALIOE_05370 | |
| 2159 c1 Prodigal CDS 1157876 1158193 . - 0 ID=BALIOE_05370;Name=hypothetical protein;locus_tag=BALIOE_05370;product=hypothetical protein;Parent=BALIOE_05370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2160 c1 Prodigal gene 1158251 1159426 . - . ID=BALIOE_05375_gene;locus_tag=BALIOE_05375 | |
| 2161 c1 Prodigal CDS 1158251 1159426 . - 0 ID=BALIOE_05375;Name=hypothetical protein;locus_tag=BALIOE_05375;product=hypothetical protein;Parent=BALIOE_05375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2162 c1 Prodigal gene 1159536 1159814 . + . ID=BALIOE_05380_gene;locus_tag=BALIOE_05380 | |
| 2163 c1 Prodigal CDS 1159536 1159814 . + 0 ID=BALIOE_05380;Name=hypothetical protein;locus_tag=BALIOE_05380;product=hypothetical protein;Parent=BALIOE_05380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2164 c1 Prodigal gene 1159811 1160140 . - . ID=BALIOE_05385_gene;locus_tag=BALIOE_05385 | |
| 2165 c1 Prodigal CDS 1159811 1160140 . - 0 ID=BALIOE_05385;Name=hypothetical protein;locus_tag=BALIOE_05385;product=hypothetical protein;Parent=BALIOE_05385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2166 c1 Prodigal gene 1160231 1160890 . - . ID=BALIOE_05390_gene;locus_tag=BALIOE_05390 | |
| 2167 c1 Prodigal CDS 1160231 1160890 . - 0 ID=BALIOE_05390;Name=hypothetical protein;locus_tag=BALIOE_05390;product=hypothetical protein;Parent=BALIOE_05390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2168 c1 tRNAscan-SE gene 1161097 1161186 . - . ID=BALIOE_05395_gene;locus_tag=BALIOE_05395;gene=Ser_trna;pseudo=true | |
| 2169 c1 tRNAscan-SE tRNA 1161097 1161186 . - . ID=BALIOE_05395;Name=(pseudo) tRNA-Ser;locus_tag=BALIOE_05395;product=(pseudo) tRNA-Ser;gene=Ser_trna;pseudo=true;Parent=BALIOE_05395_gene;inference=profile:tRNAscan:2.0;Note=SO:0000269 | |
| 2170 c1 Prodigal gene 1161298 1162317 . - . ID=BALIOE_05400_gene;locus_tag=BALIOE_05400 | |
| 2171 c1 Prodigal CDS 1161298 1162317 . - 0 ID=BALIOE_05400;Name=hypothetical protein;locus_tag=BALIOE_05400;product=hypothetical protein;Parent=BALIOE_05400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2172 c1 Prodigal gene 1162295 1162537 . - . ID=BALIOE_05405_gene;locus_tag=BALIOE_05405 | |
| 2173 c1 Prodigal CDS 1162295 1162537 . - 0 ID=BALIOE_05405;Name=hypothetical protein;locus_tag=BALIOE_05405;product=hypothetical protein;Parent=BALIOE_05405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2174 c1 Prodigal gene 1162605 1165076 . - . ID=BALIOE_05410_gene;locus_tag=BALIOE_05410 | |
| 2175 c1 Prodigal CDS 1162605 1165076 . - 0 ID=BALIOE_05410;Name=hypothetical protein;locus_tag=BALIOE_05410;product=hypothetical protein;Parent=BALIOE_05410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2176 c1 Prodigal gene 1165170 1165361 . - . ID=BALIOE_05415_gene;locus_tag=BALIOE_05415 | |
| 2177 c1 Prodigal CDS 1165170 1165361 . - 0 ID=BALIOE_05415;Name=hypothetical protein;locus_tag=BALIOE_05415;product=hypothetical protein;Parent=BALIOE_05415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2178 c1 Prodigal gene 1165358 1165546 . - . ID=BALIOE_05420_gene;locus_tag=BALIOE_05420 | |
| 2179 c1 Prodigal CDS 1165358 1165546 . - 0 ID=BALIOE_05420;Name=hypothetical protein;locus_tag=BALIOE_05420;product=hypothetical protein;Parent=BALIOE_05420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2180 c1 Prodigal gene 1166120 1166305 . + . ID=BALIOE_05425_gene;locus_tag=BALIOE_05425 | |
| 2181 c1 Prodigal CDS 1166120 1166305 . + 0 ID=BALIOE_05425;Name=hypothetical protein;locus_tag=BALIOE_05425;product=hypothetical protein;Parent=BALIOE_05425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2182 c1 Prodigal gene 1166492 1166881 . - . ID=BALIOE_05430_gene;locus_tag=BALIOE_05430 | |
| 2183 c1 Prodigal CDS 1166492 1166881 . - 0 ID=BALIOE_05430;Name=hypothetical protein;locus_tag=BALIOE_05430;product=hypothetical protein;Parent=BALIOE_05430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2184 c1 Prodigal gene 1166893 1167021 . - . ID=BALIOE_05435_gene;locus_tag=BALIOE_05435 | |
| 2185 c1 Prodigal CDS 1166893 1167021 . - 0 ID=BALIOE_05435;Name=hypothetical protein;locus_tag=BALIOE_05435;product=hypothetical protein;Parent=BALIOE_05435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2186 c1 Prodigal gene 1167023 1167178 . - . ID=BALIOE_05440_gene;locus_tag=BALIOE_05440 | |
| 2187 c1 Prodigal CDS 1167023 1167178 . - 0 ID=BALIOE_05440;Name=hypothetical protein;locus_tag=BALIOE_05440;product=hypothetical protein;Parent=BALIOE_05440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2188 c1 Prodigal gene 1167743 1167934 . - . ID=BALIOE_05445_gene;locus_tag=BALIOE_05445 | |
| 2189 c1 Prodigal CDS 1167743 1167934 . - 0 ID=BALIOE_05445;Name=hypothetical protein;locus_tag=BALIOE_05445;product=hypothetical protein;Parent=BALIOE_05445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2190 c1 Prodigal gene 1167962 1168363 . - . ID=BALIOE_05450_gene;locus_tag=BALIOE_05450 | |
| 2191 c1 Prodigal CDS 1167962 1168363 . - 0 ID=BALIOE_05450;Name=hypothetical protein;locus_tag=BALIOE_05450;product=hypothetical protein;Parent=BALIOE_05450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2192 c1 Prodigal gene 1168472 1168744 . + . ID=BALIOE_05455_gene;locus_tag=BALIOE_05455 | |
| 2193 c1 Prodigal CDS 1168472 1168744 . + 0 ID=BALIOE_05455;Name=hypothetical protein;locus_tag=BALIOE_05455;product=hypothetical protein;Parent=BALIOE_05455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2194 c1 Prodigal gene 1168728 1169153 . + . ID=BALIOE_05460_gene;locus_tag=BALIOE_05460 | |
| 2195 c1 Prodigal CDS 1168728 1169153 . + 0 ID=BALIOE_05460;Name=hypothetical protein;locus_tag=BALIOE_05460;product=hypothetical protein;Parent=BALIOE_05460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2196 c1 Prodigal gene 1169360 1169815 . - . ID=BALIOE_05465_gene;locus_tag=BALIOE_05465 | |
| 2197 c1 Prodigal CDS 1169360 1169815 . - 0 ID=BALIOE_05465;Name=hypothetical protein;locus_tag=BALIOE_05465;product=hypothetical protein;Parent=BALIOE_05465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2198 c1 Prodigal gene 1169894 1170985 . + . ID=BALIOE_05470_gene;locus_tag=BALIOE_05470 | |
| 2199 c1 Prodigal CDS 1169894 1170985 . + 0 ID=BALIOE_05470;Name=hypothetical protein;locus_tag=BALIOE_05470;product=hypothetical protein;Parent=BALIOE_05470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2200 c1 Prodigal gene 1170992 1171738 . + . ID=BALIOE_05475_gene;locus_tag=BALIOE_05475 | |
| 2201 c1 Prodigal CDS 1170992 1171738 . + 0 ID=BALIOE_05475;Name=hypothetical protein;locus_tag=BALIOE_05475;product=hypothetical protein;Parent=BALIOE_05475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2202 c1 Prodigal gene 1171760 1172530 . + . ID=BALIOE_05480_gene;locus_tag=BALIOE_05480 | |
| 2203 c1 Prodigal CDS 1171760 1172530 . + 0 ID=BALIOE_05480;Name=hypothetical protein;locus_tag=BALIOE_05480;product=hypothetical protein;Parent=BALIOE_05480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2204 c1 Prodigal gene 1172546 1172959 . + . ID=BALIOE_05485_gene;locus_tag=BALIOE_05485 | |
| 2205 c1 Prodigal CDS 1172546 1172959 . + 0 ID=BALIOE_05485;Name=hypothetical protein;locus_tag=BALIOE_05485;product=hypothetical protein;Parent=BALIOE_05485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2206 c1 Prodigal gene 1173311 1174084 . - . ID=BALIOE_05490_gene;locus_tag=BALIOE_05490 | |
| 2207 c1 Prodigal CDS 1173311 1174084 . - 0 ID=BALIOE_05490;Name=hypothetical protein;locus_tag=BALIOE_05490;product=hypothetical protein;Parent=BALIOE_05490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2208 c1 Prodigal gene 1174450 1174587 . - . ID=BALIOE_05495_gene;locus_tag=BALIOE_05495 | |
| 2209 c1 Prodigal CDS 1174450 1174587 . - 0 ID=BALIOE_05495;Name=hypothetical protein;locus_tag=BALIOE_05495;product=hypothetical protein;Parent=BALIOE_05495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2210 c1 Prodigal gene 1174632 1174844 . + . ID=BALIOE_05500_gene;locus_tag=BALIOE_05500 | |
| 2211 c1 Prodigal CDS 1174632 1174844 . + 0 ID=BALIOE_05500;Name=hypothetical protein;locus_tag=BALIOE_05500;product=hypothetical protein;Parent=BALIOE_05500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2212 c1 Prodigal gene 1175292 1176341 . + . ID=BALIOE_05505_gene;locus_tag=BALIOE_05505 | |
| 2213 c1 Prodigal CDS 1175292 1176341 . + 0 ID=BALIOE_05505;Name=hypothetical protein;locus_tag=BALIOE_05505;product=hypothetical protein;Parent=BALIOE_05505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2214 c1 Prodigal gene 1176354 1176725 . + . ID=BALIOE_05510_gene;locus_tag=BALIOE_05510 | |
| 2215 c1 Prodigal CDS 1176354 1176725 . + 0 ID=BALIOE_05510;Name=hypothetical protein;locus_tag=BALIOE_05510;product=hypothetical protein;Parent=BALIOE_05510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2216 c1 Prodigal gene 1176715 1177086 . + . ID=BALIOE_05515_gene;locus_tag=BALIOE_05515 | |
| 2217 c1 Prodigal CDS 1176715 1177086 . + 0 ID=BALIOE_05515;Name=hypothetical protein;locus_tag=BALIOE_05515;product=hypothetical protein;Parent=BALIOE_05515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2218 c1 Prodigal gene 1177238 1178056 . + . ID=BALIOE_05520_gene;locus_tag=BALIOE_05520 | |
| 2219 c1 Prodigal CDS 1177238 1178056 . + 0 ID=BALIOE_05520;Name=hypothetical protein;locus_tag=BALIOE_05520;product=hypothetical protein;Parent=BALIOE_05520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2220 c1 Prodigal gene 1178343 1178582 . + . ID=BALIOE_05525_gene;locus_tag=BALIOE_05525 | |
| 2221 c1 Prodigal CDS 1178343 1178582 . + 0 ID=BALIOE_05525;Name=hypothetical protein;locus_tag=BALIOE_05525;product=hypothetical protein;Parent=BALIOE_05525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2222 c1 Prodigal gene 1178646 1178786 . - . ID=BALIOE_05530_gene;locus_tag=BALIOE_05530 | |
| 2223 c1 Prodigal CDS 1178646 1178786 . - 0 ID=BALIOE_05530;Name=hypothetical protein;locus_tag=BALIOE_05530;product=hypothetical protein;Parent=BALIOE_05530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2224 c1 Prodigal gene 1178803 1179390 . + . ID=BALIOE_05535_gene;locus_tag=BALIOE_05535 | |
| 2225 c1 Prodigal CDS 1178803 1179390 . + 0 ID=BALIOE_05535;Name=hypothetical protein;locus_tag=BALIOE_05535;product=hypothetical protein;Parent=BALIOE_05535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2226 c1 tRNAscan-SE gene 1179419 1179494 . + . ID=BALIOE_05540_gene;locus_tag=BALIOE_05540;gene=Ile2_trna | |
| 2227 c1 tRNAscan-SE tRNA 1179419 1179494 . + . ID=BALIOE_05540;Name=tRNA-Ile2;locus_tag=BALIOE_05540;product=tRNA-Ile2;gene=Ile2_trna;Parent=BALIOE_05540_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 2228 c1 tRNAscan-SE gene 1179502 1179578 . + . ID=BALIOE_05545_gene;locus_tag=BALIOE_05545;gene=Arg_trna | |
| 2229 c1 tRNAscan-SE tRNA 1179502 1179578 . + . ID=BALIOE_05545;Name=tRNA-Arg;locus_tag=BALIOE_05545;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_05545_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 2230 c1 tRNAscan-SE gene 1179592 1179668 . + . ID=BALIOE_05550_gene;locus_tag=BALIOE_05550;gene=Arg_trna | |
| 2231 c1 tRNAscan-SE tRNA 1179592 1179668 . + . ID=BALIOE_05550;Name=tRNA-Arg;locus_tag=BALIOE_05550;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_05550_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 2232 c1 Prodigal gene 1180158 1182008 . + . ID=BALIOE_05555_gene;locus_tag=BALIOE_05555 | |
| 2233 c1 Prodigal CDS 1180158 1182008 . + 0 ID=BALIOE_05555;Name=hypothetical protein;locus_tag=BALIOE_05555;product=hypothetical protein;Parent=BALIOE_05555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2234 c1 Prodigal gene 1182184 1182510 . + . ID=BALIOE_05560_gene;locus_tag=BALIOE_05560 | |
| 2235 c1 Prodigal CDS 1182184 1182510 . + 0 ID=BALIOE_05560;Name=hypothetical protein;locus_tag=BALIOE_05560;product=hypothetical protein;Parent=BALIOE_05560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2236 c1 Prodigal gene 1182510 1183160 . + . ID=BALIOE_05565_gene;locus_tag=BALIOE_05565 | |
| 2237 c1 Prodigal CDS 1182510 1183160 . + 0 ID=BALIOE_05565;Name=hypothetical protein;locus_tag=BALIOE_05565;product=hypothetical protein;Parent=BALIOE_05565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2238 c1 Prodigal gene 1183365 1183679 . - . ID=BALIOE_05570_gene;locus_tag=BALIOE_05570 | |
| 2239 c1 Prodigal CDS 1183365 1183679 . - 0 ID=BALIOE_05570;Name=hypothetical protein;locus_tag=BALIOE_05570;product=hypothetical protein;Parent=BALIOE_05570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2240 c1 Prodigal gene 1184145 1184669 . - . ID=BALIOE_05575_gene;locus_tag=BALIOE_05575 | |
| 2241 c1 Prodigal CDS 1184145 1184669 . - 0 ID=BALIOE_05575;Name=hypothetical protein;locus_tag=BALIOE_05575;product=hypothetical protein;Parent=BALIOE_05575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2242 c1 Prodigal gene 1184614 1184727 . - . ID=BALIOE_05580_gene;locus_tag=BALIOE_05580 | |
| 2243 c1 Prodigal CDS 1184614 1184727 . - 0 ID=BALIOE_05580;Name=hypothetical protein;locus_tag=BALIOE_05580;product=hypothetical protein;Parent=BALIOE_05580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2244 c1 Prodigal gene 1184948 1185481 . - . ID=BALIOE_05585_gene;locus_tag=BALIOE_05585 | |
| 2245 c1 Prodigal CDS 1184948 1185481 . - 0 ID=BALIOE_05585;Name=hypothetical protein;locus_tag=BALIOE_05585;product=hypothetical protein;Parent=BALIOE_05585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2246 c1 Prodigal gene 1185641 1185913 . + . ID=BALIOE_05590_gene;locus_tag=BALIOE_05590 | |
| 2247 c1 Prodigal CDS 1185641 1185913 . + 0 ID=BALIOE_05590;Name=hypothetical protein;locus_tag=BALIOE_05590;product=hypothetical protein;Parent=BALIOE_05590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2248 c1 Prodigal gene 1186169 1186375 . - . ID=BALIOE_05595_gene;locus_tag=BALIOE_05595 | |
| 2249 c1 Prodigal CDS 1186169 1186375 . - 0 ID=BALIOE_05595;Name=hypothetical protein;locus_tag=BALIOE_05595;product=hypothetical protein;Parent=BALIOE_05595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2250 c1 Prodigal gene 1187126 1187401 . + . ID=BALIOE_05600_gene;locus_tag=BALIOE_05600 | |
| 2251 c1 Prodigal CDS 1187126 1187401 . + 0 ID=BALIOE_05600;Name=hypothetical protein;locus_tag=BALIOE_05600;product=hypothetical protein;Parent=BALIOE_05600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2252 c1 Prodigal gene 1187477 1187857 . + . ID=BALIOE_05605_gene;locus_tag=BALIOE_05605 | |
| 2253 c1 Prodigal CDS 1187477 1187857 . + 0 ID=BALIOE_05605;Name=hypothetical protein;locus_tag=BALIOE_05605;product=hypothetical protein;Parent=BALIOE_05605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2254 c1 Prodigal gene 1187854 1188201 . + . ID=BALIOE_05610_gene;locus_tag=BALIOE_05610 | |
| 2255 c1 Prodigal CDS 1187854 1188201 . + 0 ID=BALIOE_05610;Name=hypothetical protein;locus_tag=BALIOE_05610;product=hypothetical protein;Parent=BALIOE_05610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2256 c1 Prodigal gene 1188251 1189789 . + . ID=BALIOE_05615_gene;locus_tag=BALIOE_05615 | |
| 2257 c1 Prodigal CDS 1188251 1189789 . + 0 ID=BALIOE_05615;Name=hypothetical protein;locus_tag=BALIOE_05615;product=hypothetical protein;Parent=BALIOE_05615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2258 c1 Prodigal gene 1189823 1189939 . - . ID=BALIOE_05620_gene;locus_tag=BALIOE_05620 | |
| 2259 c1 Prodigal CDS 1189823 1189939 . - 0 ID=BALIOE_05620;Name=hypothetical protein;locus_tag=BALIOE_05620;product=hypothetical protein;Parent=BALIOE_05620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2260 c1 Prodigal gene 1190017 1191981 . + . ID=BALIOE_05625_gene;locus_tag=BALIOE_05625 | |
| 2261 c1 Prodigal CDS 1190017 1191981 . + 0 ID=BALIOE_05625;Name=hypothetical protein;locus_tag=BALIOE_05625;product=hypothetical protein;Parent=BALIOE_05625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2262 c1 Prodigal gene 1191965 1192171 . + . ID=BALIOE_05630_gene;locus_tag=BALIOE_05630 | |
| 2263 c1 Prodigal CDS 1191965 1192171 . + 0 ID=BALIOE_05630;Name=hypothetical protein;locus_tag=BALIOE_05630;product=hypothetical protein;Parent=BALIOE_05630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2264 c1 Prodigal gene 1192168 1193760 . + . ID=BALIOE_05635_gene;locus_tag=BALIOE_05635 | |
| 2265 c1 Prodigal CDS 1192168 1193760 . + 0 ID=BALIOE_05635;Name=hypothetical protein;locus_tag=BALIOE_05635;product=hypothetical protein;Parent=BALIOE_05635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2266 c1 Prodigal gene 1193750 1195255 . + . ID=BALIOE_05640_gene;locus_tag=BALIOE_05640 | |
| 2267 c1 Prodigal CDS 1193750 1195255 . + 0 ID=BALIOE_05640;Name=hypothetical protein;locus_tag=BALIOE_05640;product=hypothetical protein;Parent=BALIOE_05640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2268 c1 Prodigal gene 1195292 1195639 . + . ID=BALIOE_05645_gene;locus_tag=BALIOE_05645 | |
| 2269 c1 Prodigal CDS 1195292 1195639 . + 0 ID=BALIOE_05645;Name=hypothetical protein;locus_tag=BALIOE_05645;product=hypothetical protein;Parent=BALIOE_05645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2270 c1 Prodigal gene 1195697 1195963 . + . ID=BALIOE_05650_gene;locus_tag=BALIOE_05650 | |
| 2271 c1 Prodigal CDS 1195697 1195963 . + 0 ID=BALIOE_05650;Name=hypothetical protein;locus_tag=BALIOE_05650;product=hypothetical protein;Parent=BALIOE_05650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2272 c1 Prodigal gene 1196056 1196685 . + . ID=BALIOE_05655_gene;locus_tag=BALIOE_05655 | |
| 2273 c1 Prodigal CDS 1196056 1196685 . + 0 ID=BALIOE_05655;Name=hypothetical protein;locus_tag=BALIOE_05655;product=hypothetical protein;Parent=BALIOE_05655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2274 c1 Prodigal gene 1196699 1197130 . + . ID=BALIOE_05660_gene;locus_tag=BALIOE_05660 | |
| 2275 c1 Prodigal CDS 1196699 1197130 . + 0 ID=BALIOE_05660;Name=hypothetical protein;locus_tag=BALIOE_05660;product=hypothetical protein;Parent=BALIOE_05660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2276 c1 Prodigal gene 1197157 1197570 . + . ID=BALIOE_05665_gene;locus_tag=BALIOE_05665 | |
| 2277 c1 Prodigal CDS 1197157 1197570 . + 0 ID=BALIOE_05665;Name=hypothetical protein;locus_tag=BALIOE_05665;product=hypothetical protein;Parent=BALIOE_05665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2278 c1 Prodigal gene 1197551 1200130 . + . ID=BALIOE_05670_gene;locus_tag=BALIOE_05670 | |
| 2279 c1 Prodigal CDS 1197551 1200130 . + 0 ID=BALIOE_05670;Name=hypothetical protein;locus_tag=BALIOE_05670;product=hypothetical protein;Parent=BALIOE_05670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2280 c1 Prodigal gene 1200127 1200456 . + . ID=BALIOE_05675_gene;locus_tag=BALIOE_05675 | |
| 2281 c1 Prodigal CDS 1200127 1200456 . + 0 ID=BALIOE_05675;Name=hypothetical protein;locus_tag=BALIOE_05675;product=hypothetical protein;Parent=BALIOE_05675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2282 c1 Prodigal gene 1200456 1201154 . + . ID=BALIOE_05680_gene;locus_tag=BALIOE_05680 | |
| 2283 c1 Prodigal CDS 1200456 1201154 . + 0 ID=BALIOE_05680;Name=hypothetical protein;locus_tag=BALIOE_05680;product=hypothetical protein;Parent=BALIOE_05680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2284 c1 Prodigal gene 1201165 1201908 . + . ID=BALIOE_05685_gene;locus_tag=BALIOE_05685 | |
| 2285 c1 Prodigal CDS 1201165 1201908 . + 0 ID=BALIOE_05685;Name=hypothetical protein;locus_tag=BALIOE_05685;product=hypothetical protein;Parent=BALIOE_05685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2286 c1 Prodigal gene 1201905 1202486 . + . ID=BALIOE_05690_gene;locus_tag=BALIOE_05690 | |
| 2287 c1 Prodigal CDS 1201905 1202486 . + 0 ID=BALIOE_05690;Name=hypothetical protein;locus_tag=BALIOE_05690;product=hypothetical protein;Parent=BALIOE_05690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2288 c1 Prodigal gene 1202677 1203204 . - . ID=BALIOE_05695_gene;locus_tag=BALIOE_05695 | |
| 2289 c1 Prodigal CDS 1202677 1203204 . - 0 ID=BALIOE_05695;Name=hypothetical protein;locus_tag=BALIOE_05695;product=hypothetical protein;Parent=BALIOE_05695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2290 c1 Prodigal gene 1203338 1206811 . + . ID=BALIOE_05700_gene;locus_tag=BALIOE_05700 | |
| 2291 c1 Prodigal CDS 1203338 1206811 . + 0 ID=BALIOE_05700;Name=hypothetical protein;locus_tag=BALIOE_05700;product=hypothetical protein;Parent=BALIOE_05700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2292 c1 Prodigal gene 1206879 1207478 . + . ID=BALIOE_05705_gene;locus_tag=BALIOE_05705 | |
| 2293 c1 Prodigal CDS 1206879 1207478 . + 0 ID=BALIOE_05705;Name=hypothetical protein;locus_tag=BALIOE_05705;product=hypothetical protein;Parent=BALIOE_05705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2294 c1 Prodigal gene 1207543 1208856 . + . ID=BALIOE_05710_gene;locus_tag=BALIOE_05710 | |
| 2295 c1 Prodigal CDS 1207543 1208856 . + 0 ID=BALIOE_05710;Name=hypothetical protein;locus_tag=BALIOE_05710;product=hypothetical protein;Parent=BALIOE_05710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2296 c1 Prodigal gene 1208858 1209127 . + . ID=BALIOE_05715_gene;locus_tag=BALIOE_05715 | |
| 2297 c1 Prodigal CDS 1208858 1209127 . + 0 ID=BALIOE_05715;Name=hypothetical protein;locus_tag=BALIOE_05715;product=hypothetical protein;Parent=BALIOE_05715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2298 c1 Prodigal gene 1209252 1209962 . - . ID=BALIOE_05720_gene;locus_tag=BALIOE_05720 | |
| 2299 c1 Prodigal CDS 1209252 1209962 . - 0 ID=BALIOE_05720;Name=hypothetical protein;locus_tag=BALIOE_05720;product=hypothetical protein;Parent=BALIOE_05720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2300 c1 Prodigal gene 1210601 1210783 . - . ID=BALIOE_05725_gene;locus_tag=BALIOE_05725 | |
| 2301 c1 Prodigal CDS 1210601 1210783 . - 0 ID=BALIOE_05725;Name=hypothetical protein;locus_tag=BALIOE_05725;product=hypothetical protein;Parent=BALIOE_05725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2302 c1 tRNAscan-SE gene 1210888 1210975 . - . ID=BALIOE_05730_gene;locus_tag=BALIOE_05730;gene=Ser_trna | |
| 2303 c1 tRNAscan-SE tRNA 1210888 1210975 . - . ID=BALIOE_05730;Name=tRNA-Ser;locus_tag=BALIOE_05730;product=tRNA-Ser;gene=Ser_trna;Parent=BALIOE_05730_gene;inference=profile:tRNAscan:2.0;Note=SO:0000269 | |
| 2304 c1 Prodigal gene 1211401 1212519 . + . ID=BALIOE_05735_gene;locus_tag=BALIOE_05735 | |
| 2305 c1 Prodigal CDS 1211401 1212519 . + 0 ID=BALIOE_05735;Name=hypothetical protein;locus_tag=BALIOE_05735;product=hypothetical protein;Parent=BALIOE_05735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2306 c1 Prodigal gene 1212516 1214309 . + . ID=BALIOE_05740_gene;locus_tag=BALIOE_05740 | |
| 2307 c1 Prodigal CDS 1212516 1214309 . + 0 ID=BALIOE_05740;Name=hypothetical protein;locus_tag=BALIOE_05740;product=hypothetical protein;Parent=BALIOE_05740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2308 c1 Prodigal gene 1214328 1215035 . + . ID=BALIOE_05745_gene;locus_tag=BALIOE_05745 | |
| 2309 c1 Prodigal CDS 1214328 1215035 . + 0 ID=BALIOE_05745;Name=hypothetical protein;locus_tag=BALIOE_05745;product=hypothetical protein;Parent=BALIOE_05745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2310 c1 Prodigal gene 1215032 1215619 . + . ID=BALIOE_05750_gene;locus_tag=BALIOE_05750 | |
| 2311 c1 Prodigal CDS 1215032 1215619 . + 0 ID=BALIOE_05750;Name=hypothetical protein;locus_tag=BALIOE_05750;product=hypothetical protein;Parent=BALIOE_05750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2312 c1 Prodigal gene 1215616 1216014 . + . ID=BALIOE_05755_gene;locus_tag=BALIOE_05755 | |
| 2313 c1 Prodigal CDS 1215616 1216014 . + 0 ID=BALIOE_05755;Name=hypothetical protein;locus_tag=BALIOE_05755;product=hypothetical protein;Parent=BALIOE_05755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2314 c1 Prodigal gene 1216011 1216868 . + . ID=BALIOE_05760_gene;locus_tag=BALIOE_05760 | |
| 2315 c1 Prodigal CDS 1216011 1216868 . + 0 ID=BALIOE_05760;Name=hypothetical protein;locus_tag=BALIOE_05760;product=hypothetical protein;Parent=BALIOE_05760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2316 c1 Prodigal gene 1217002 1218546 . + . ID=BALIOE_05765_gene;locus_tag=BALIOE_05765 | |
| 2317 c1 Prodigal CDS 1217002 1218546 . + 0 ID=BALIOE_05765;Name=hypothetical protein;locus_tag=BALIOE_05765;product=hypothetical protein;Parent=BALIOE_05765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2318 c1 Prodigal gene 1218558 1219694 . + . ID=BALIOE_05770_gene;locus_tag=BALIOE_05770 | |
| 2319 c1 Prodigal CDS 1218558 1219694 . + 0 ID=BALIOE_05770;Name=hypothetical protein;locus_tag=BALIOE_05770;product=hypothetical protein;Parent=BALIOE_05770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2320 c1 Prodigal gene 1219879 1221183 . + . ID=BALIOE_05775_gene;locus_tag=BALIOE_05775 | |
| 2321 c1 Prodigal CDS 1219879 1221183 . + 0 ID=BALIOE_05775;Name=hypothetical protein;locus_tag=BALIOE_05775;product=hypothetical protein;Parent=BALIOE_05775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2322 c1 Prodigal gene 1221303 1223483 . - . ID=BALIOE_05780_gene;locus_tag=BALIOE_05780 | |
| 2323 c1 Prodigal CDS 1221303 1223483 . - 0 ID=BALIOE_05780;Name=hypothetical protein;locus_tag=BALIOE_05780;product=hypothetical protein;Parent=BALIOE_05780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2324 c1 Prodigal gene 1223503 1223949 . - . ID=BALIOE_05785_gene;locus_tag=BALIOE_05785 | |
| 2325 c1 Prodigal CDS 1223503 1223949 . - 0 ID=BALIOE_05785;Name=hypothetical protein;locus_tag=BALIOE_05785;product=hypothetical protein;Parent=BALIOE_05785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2326 c1 Prodigal gene 1223937 1225076 . - . ID=BALIOE_05790_gene;locus_tag=BALIOE_05790 | |
| 2327 c1 Prodigal CDS 1223937 1225076 . - 0 ID=BALIOE_05790;Name=hypothetical protein;locus_tag=BALIOE_05790;product=hypothetical protein;Parent=BALIOE_05790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2328 c1 Prodigal gene 1225122 1227218 . - . ID=BALIOE_05795_gene;locus_tag=BALIOE_05795 | |
| 2329 c1 Prodigal CDS 1225122 1227218 . - 0 ID=BALIOE_05795;Name=hypothetical protein;locus_tag=BALIOE_05795;product=hypothetical protein;Parent=BALIOE_05795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2330 c1 Prodigal gene 1227218 1227964 . - . ID=BALIOE_05800_gene;locus_tag=BALIOE_05800 | |
| 2331 c1 Prodigal CDS 1227218 1227964 . - 0 ID=BALIOE_05800;Name=hypothetical protein;locus_tag=BALIOE_05800;product=hypothetical protein;Parent=BALIOE_05800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2332 c1 Prodigal gene 1227961 1228605 . - . ID=BALIOE_05805_gene;locus_tag=BALIOE_05805 | |
| 2333 c1 Prodigal CDS 1227961 1228605 . - 0 ID=BALIOE_05805;Name=hypothetical protein;locus_tag=BALIOE_05805;product=hypothetical protein;Parent=BALIOE_05805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2334 c1 Prodigal gene 1228712 1229017 . - . ID=BALIOE_05810_gene;locus_tag=BALIOE_05810 | |
| 2335 c1 Prodigal CDS 1228712 1229017 . - 0 ID=BALIOE_05810;Name=hypothetical protein;locus_tag=BALIOE_05810;product=hypothetical protein;Parent=BALIOE_05810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2336 c1 Prodigal gene 1229957 1230169 . + . ID=BALIOE_05815_gene;locus_tag=BALIOE_05815 | |
| 2337 c1 Prodigal CDS 1229957 1230169 . + 0 ID=BALIOE_05815;Name=hypothetical protein;locus_tag=BALIOE_05815;product=hypothetical protein;Parent=BALIOE_05815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2338 c1 Prodigal gene 1230784 1231857 . - . ID=BALIOE_05820_gene;locus_tag=BALIOE_05820 | |
| 2339 c1 Prodigal CDS 1230784 1231857 . - 0 ID=BALIOE_05820;Name=hypothetical protein;locus_tag=BALIOE_05820;product=hypothetical protein;Parent=BALIOE_05820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2340 c1 Prodigal gene 1231929 1234628 . - . ID=BALIOE_05825_gene;locus_tag=BALIOE_05825 | |
| 2341 c1 Prodigal CDS 1231929 1234628 . - 0 ID=BALIOE_05825;Name=hypothetical protein;locus_tag=BALIOE_05825;product=hypothetical protein;Parent=BALIOE_05825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2342 c1 Prodigal gene 1234756 1235784 . + . ID=BALIOE_05830_gene;locus_tag=BALIOE_05830 | |
| 2343 c1 Prodigal CDS 1234756 1235784 . + 0 ID=BALIOE_05830;Name=hypothetical protein;locus_tag=BALIOE_05830;product=hypothetical protein;Parent=BALIOE_05830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2344 c1 Prodigal gene 1235757 1236449 . - . ID=BALIOE_05835_gene;locus_tag=BALIOE_05835 | |
| 2345 c1 Prodigal CDS 1235757 1236449 . - 0 ID=BALIOE_05835;Name=hypothetical protein;locus_tag=BALIOE_05835;product=hypothetical protein;Parent=BALIOE_05835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2346 c1 Prodigal gene 1236579 1237751 . + . ID=BALIOE_05840_gene;locus_tag=BALIOE_05840 | |
| 2347 c1 Prodigal CDS 1236579 1237751 . + 0 ID=BALIOE_05840;Name=hypothetical protein;locus_tag=BALIOE_05840;product=hypothetical protein;Parent=BALIOE_05840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2348 c1 Prodigal gene 1237751 1240297 . + . ID=BALIOE_05845_gene;locus_tag=BALIOE_05845 | |
| 2349 c1 Prodigal CDS 1237751 1240297 . + 0 ID=BALIOE_05845;Name=hypothetical protein;locus_tag=BALIOE_05845;product=hypothetical protein;Parent=BALIOE_05845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2350 c1 Prodigal gene 1240294 1240893 . + . ID=BALIOE_05850_gene;locus_tag=BALIOE_05850 | |
| 2351 c1 Prodigal CDS 1240294 1240893 . + 0 ID=BALIOE_05850;Name=hypothetical protein;locus_tag=BALIOE_05850;product=hypothetical protein;Parent=BALIOE_05850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2352 c1 Infernal gene 1240905 1240985 . - . ID=BALIOE_05855_gene;locus_tag=BALIOE_05855;gene=naRNA4 | |
| 2353 c1 Infernal ncRNA 1240905 1240985 1.4e-10 - . ID=BALIOE_05855;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_05855;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_05855_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 2354 c1 Prodigal gene 1241047 1241352 . - . ID=BALIOE_05860_gene;locus_tag=BALIOE_05860 | |
| 2355 c1 Prodigal CDS 1241047 1241352 . - 0 ID=BALIOE_05860;Name=hypothetical protein;locus_tag=BALIOE_05860;product=hypothetical protein;Parent=BALIOE_05860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2356 c1 Prodigal gene 1241352 1242272 . - . ID=BALIOE_05865_gene;locus_tag=BALIOE_05865 | |
| 2357 c1 Prodigal CDS 1241352 1242272 . - 0 ID=BALIOE_05865;Name=hypothetical protein;locus_tag=BALIOE_05865;product=hypothetical protein;Parent=BALIOE_05865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2358 c1 Prodigal gene 1242532 1243431 . + . ID=BALIOE_05870_gene;locus_tag=BALIOE_05870 | |
| 2359 c1 Prodigal CDS 1242532 1243431 . + 0 ID=BALIOE_05870;Name=hypothetical protein;locus_tag=BALIOE_05870;product=hypothetical protein;Parent=BALIOE_05870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2360 c1 Prodigal gene 1243541 1243789 . + . ID=BALIOE_05875_gene;locus_tag=BALIOE_05875 | |
| 2361 c1 Prodigal CDS 1243541 1243789 . + 0 ID=BALIOE_05875;Name=hypothetical protein;locus_tag=BALIOE_05875;product=hypothetical protein;Parent=BALIOE_05875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2362 c1 Prodigal gene 1244080 1245321 . + . ID=BALIOE_05880_gene;locus_tag=BALIOE_05880 | |
| 2363 c1 Prodigal CDS 1244080 1245321 . + 0 ID=BALIOE_05880;Name=hypothetical protein;locus_tag=BALIOE_05880;product=hypothetical protein;Parent=BALIOE_05880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2364 c1 Prodigal gene 1245359 1245586 . - . ID=BALIOE_05885_gene;locus_tag=BALIOE_05885 | |
| 2365 c1 Prodigal CDS 1245359 1245586 . - 0 ID=BALIOE_05885;Name=hypothetical protein;locus_tag=BALIOE_05885;product=hypothetical protein;Parent=BALIOE_05885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2366 c1 Prodigal gene 1245607 1246185 . - . ID=BALIOE_05890_gene;locus_tag=BALIOE_05890 | |
| 2367 c1 Prodigal CDS 1245607 1246185 . - 0 ID=BALIOE_05890;Name=hypothetical protein;locus_tag=BALIOE_05890;product=hypothetical protein;Parent=BALIOE_05890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2368 c1 Prodigal gene 1246182 1247492 . - . ID=BALIOE_05895_gene;locus_tag=BALIOE_05895 | |
| 2369 c1 Prodigal CDS 1246182 1247492 . - 0 ID=BALIOE_05895;Name=hypothetical protein;locus_tag=BALIOE_05895;product=hypothetical protein;Parent=BALIOE_05895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2370 c1 Prodigal gene 1247545 1247829 . - . ID=BALIOE_05900_gene;locus_tag=BALIOE_05900 | |
| 2371 c1 Prodigal CDS 1247545 1247829 . - 0 ID=BALIOE_05900;Name=hypothetical protein;locus_tag=BALIOE_05900;product=hypothetical protein;Parent=BALIOE_05900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2372 c1 Prodigal gene 1247915 1248214 . - . ID=BALIOE_05905_gene;locus_tag=BALIOE_05905 | |
| 2373 c1 Prodigal CDS 1247915 1248214 . - 0 ID=BALIOE_05905;Name=hypothetical protein;locus_tag=BALIOE_05905;product=hypothetical protein;Parent=BALIOE_05905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2374 c1 Prodigal gene 1248286 1248570 . - . ID=BALIOE_05910_gene;locus_tag=BALIOE_05910 | |
| 2375 c1 Prodigal CDS 1248286 1248570 . - 0 ID=BALIOE_05910;Name=hypothetical protein;locus_tag=BALIOE_05910;product=hypothetical protein;Parent=BALIOE_05910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2376 c1 Prodigal gene 1248563 1249186 . - . ID=BALIOE_05915_gene;locus_tag=BALIOE_05915 | |
| 2377 c1 Prodigal CDS 1248563 1249186 . - 0 ID=BALIOE_05915;Name=hypothetical protein;locus_tag=BALIOE_05915;product=hypothetical protein;Parent=BALIOE_05915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2378 c1 Prodigal gene 1249190 1249477 . - . ID=BALIOE_05920_gene;locus_tag=BALIOE_05920 | |
| 2379 c1 Prodigal CDS 1249190 1249477 . - 0 ID=BALIOE_05920;Name=hypothetical protein;locus_tag=BALIOE_05920;product=hypothetical protein;Parent=BALIOE_05920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2380 c1 Prodigal gene 1249479 1249697 . - . ID=BALIOE_05925_gene;locus_tag=BALIOE_05925 | |
| 2381 c1 Prodigal CDS 1249479 1249697 . - 0 ID=BALIOE_05925;Name=hypothetical protein;locus_tag=BALIOE_05925;product=hypothetical protein;Parent=BALIOE_05925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2382 c1 Prodigal gene 1249699 1249914 . - . ID=BALIOE_05930_gene;locus_tag=BALIOE_05930 | |
| 2383 c1 Prodigal CDS 1249699 1249914 . - 0 ID=BALIOE_05930;Name=hypothetical protein;locus_tag=BALIOE_05930;product=hypothetical protein;Parent=BALIOE_05930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2384 c1 Prodigal gene 1249916 1250104 . - . ID=BALIOE_05935_gene;locus_tag=BALIOE_05935 | |
| 2385 c1 Prodigal CDS 1249916 1250104 . - 0 ID=BALIOE_05935;Name=hypothetical protein;locus_tag=BALIOE_05935;product=hypothetical protein;Parent=BALIOE_05935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2386 c1 Prodigal gene 1250256 1251029 . - . ID=BALIOE_05940_gene;locus_tag=BALIOE_05940 | |
| 2387 c1 Prodigal CDS 1250256 1251029 . - 0 ID=BALIOE_05940;Name=hypothetical protein;locus_tag=BALIOE_05940;product=hypothetical protein;Parent=BALIOE_05940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2388 c1 Prodigal gene 1251026 1251247 . - . ID=BALIOE_05945_gene;locus_tag=BALIOE_05945 | |
| 2389 c1 Prodigal CDS 1251026 1251247 . - 0 ID=BALIOE_05945;Name=hypothetical protein;locus_tag=BALIOE_05945;product=hypothetical protein;Parent=BALIOE_05945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2390 c1 Prodigal gene 1251346 1251561 . - . ID=BALIOE_05950_gene;locus_tag=BALIOE_05950 | |
| 2391 c1 Prodigal CDS 1251346 1251561 . - 0 ID=BALIOE_05950;Name=hypothetical protein;locus_tag=BALIOE_05950;product=hypothetical protein;Parent=BALIOE_05950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2392 c1 Prodigal gene 1251638 1251829 . - . ID=BALIOE_05955_gene;locus_tag=BALIOE_05955 | |
| 2393 c1 Prodigal CDS 1251638 1251829 . - 0 ID=BALIOE_05955;Name=hypothetical protein;locus_tag=BALIOE_05955;product=hypothetical protein;Parent=BALIOE_05955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2394 c1 Prodigal gene 1251802 1251984 . - . ID=BALIOE_05960_gene;locus_tag=BALIOE_05960 | |
| 2395 c1 Prodigal CDS 1251802 1251984 . - 0 ID=BALIOE_05960;Name=hypothetical protein;locus_tag=BALIOE_05960;product=hypothetical protein;Parent=BALIOE_05960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2396 c1 Prodigal gene 1251981 1252661 . - . ID=BALIOE_05965_gene;locus_tag=BALIOE_05965 | |
| 2397 c1 Prodigal CDS 1251981 1252661 . - 0 ID=BALIOE_05965;Name=hypothetical protein;locus_tag=BALIOE_05965;product=hypothetical protein;Parent=BALIOE_05965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2398 c1 Prodigal gene 1252658 1253443 . - . ID=BALIOE_05970_gene;locus_tag=BALIOE_05970 | |
| 2399 c1 Prodigal CDS 1252658 1253443 . - 0 ID=BALIOE_05970;Name=hypothetical protein;locus_tag=BALIOE_05970;product=hypothetical protein;Parent=BALIOE_05970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2400 c1 Prodigal gene 1253449 1253745 . - . ID=BALIOE_05975_gene;locus_tag=BALIOE_05975 | |
| 2401 c1 Prodigal CDS 1253449 1253745 . - 0 ID=BALIOE_05975;Name=hypothetical protein;locus_tag=BALIOE_05975;product=hypothetical protein;Parent=BALIOE_05975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2402 c1 Prodigal gene 1253820 1253963 . - . ID=BALIOE_05980_gene;locus_tag=BALIOE_05980 | |
| 2403 c1 Prodigal CDS 1253820 1253963 . - 0 ID=BALIOE_05980;Name=hypothetical protein;locus_tag=BALIOE_05980;product=hypothetical protein;Parent=BALIOE_05980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2404 c1 Prodigal gene 1253932 1254096 . - . ID=BALIOE_05985_gene;locus_tag=BALIOE_05985 | |
| 2405 c1 Prodigal CDS 1253932 1254096 . - 0 ID=BALIOE_05985;Name=hypothetical protein;locus_tag=BALIOE_05985;product=hypothetical protein;Parent=BALIOE_05985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2406 c1 Prodigal gene 1254169 1254537 . - . ID=BALIOE_05990_gene;locus_tag=BALIOE_05990 | |
| 2407 c1 Prodigal CDS 1254169 1254537 . - 0 ID=BALIOE_05990;Name=hypothetical protein;locus_tag=BALIOE_05990;product=hypothetical protein;Parent=BALIOE_05990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2408 c1 Prodigal gene 1254720 1254971 . - . ID=BALIOE_05995_gene;locus_tag=BALIOE_05995 | |
| 2409 c1 Prodigal CDS 1254720 1254971 . - 0 ID=BALIOE_05995;Name=hypothetical protein;locus_tag=BALIOE_05995;product=hypothetical protein;Parent=BALIOE_05995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2410 c1 Prodigal gene 1255030 1255302 . - . ID=BALIOE_06000_gene;locus_tag=BALIOE_06000 | |
| 2411 c1 Prodigal CDS 1255030 1255302 . - 0 ID=BALIOE_06000;Name=hypothetical protein;locus_tag=BALIOE_06000;product=hypothetical protein;Parent=BALIOE_06000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2412 c1 Prodigal gene 1255280 1255462 . - . ID=BALIOE_06005_gene;locus_tag=BALIOE_06005 | |
| 2413 c1 Prodigal CDS 1255280 1255462 . - 0 ID=BALIOE_06005;Name=hypothetical protein;locus_tag=BALIOE_06005;product=hypothetical protein;Parent=BALIOE_06005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2414 c1 Prodigal gene 1256031 1256552 . - . ID=BALIOE_06010_gene;locus_tag=BALIOE_06010 | |
| 2415 c1 Prodigal CDS 1256031 1256552 . - 0 ID=BALIOE_06010;Name=hypothetical protein;locus_tag=BALIOE_06010;product=hypothetical protein;Parent=BALIOE_06010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2416 c1 Prodigal gene 1257054 1257707 . - . ID=BALIOE_06015_gene;locus_tag=BALIOE_06015 | |
| 2417 c1 Prodigal CDS 1257054 1257707 . - 0 ID=BALIOE_06015;Name=hypothetical protein;locus_tag=BALIOE_06015;product=hypothetical protein;Parent=BALIOE_06015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2418 c1 Prodigal gene 1257825 1258040 . + . ID=BALIOE_06020_gene;locus_tag=BALIOE_06020 | |
| 2419 c1 Prodigal CDS 1257825 1258040 . + 0 ID=BALIOE_06020;Name=hypothetical protein;locus_tag=BALIOE_06020;product=hypothetical protein;Parent=BALIOE_06020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2420 c1 Prodigal gene 1258182 1258478 . + . ID=BALIOE_06025_gene;locus_tag=BALIOE_06025 | |
| 2421 c1 Prodigal CDS 1258182 1258478 . + 0 ID=BALIOE_06025;Name=hypothetical protein;locus_tag=BALIOE_06025;product=hypothetical protein;Parent=BALIOE_06025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2422 c1 Prodigal gene 1258511 1258657 . + . ID=BALIOE_06030_gene;locus_tag=BALIOE_06030 | |
| 2423 c1 Prodigal CDS 1258511 1258657 . + 0 ID=BALIOE_06030;Name=hypothetical protein;locus_tag=BALIOE_06030;product=hypothetical protein;Parent=BALIOE_06030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2424 c1 Prodigal gene 1258650 1259549 . + . ID=BALIOE_06035_gene;locus_tag=BALIOE_06035 | |
| 2425 c1 Prodigal CDS 1258650 1259549 . + 0 ID=BALIOE_06035;Name=hypothetical protein;locus_tag=BALIOE_06035;product=hypothetical protein;Parent=BALIOE_06035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2426 c1 Prodigal gene 1259539 1260975 . + . ID=BALIOE_06040_gene;locus_tag=BALIOE_06040 | |
| 2427 c1 Prodigal CDS 1259539 1260975 . + 0 ID=BALIOE_06040;Name=hypothetical protein;locus_tag=BALIOE_06040;product=hypothetical protein;Parent=BALIOE_06040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2428 c1 Prodigal gene 1260975 1261244 . + . ID=BALIOE_06045_gene;locus_tag=BALIOE_06045 | |
| 2429 c1 Prodigal CDS 1260975 1261244 . + 0 ID=BALIOE_06045;Name=hypothetical protein;locus_tag=BALIOE_06045;product=hypothetical protein;Parent=BALIOE_06045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2430 c1 Prodigal gene 1261315 1261593 . + . ID=BALIOE_06050_gene;locus_tag=BALIOE_06050 | |
| 2431 c1 Prodigal CDS 1261315 1261593 . + 0 ID=BALIOE_06050;Name=hypothetical protein;locus_tag=BALIOE_06050;product=hypothetical protein;Parent=BALIOE_06050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2432 c1 Prodigal gene 1261726 1261941 . + . ID=BALIOE_06055_gene;locus_tag=BALIOE_06055 | |
| 2433 c1 Prodigal CDS 1261726 1261941 . + 0 ID=BALIOE_06055;Name=hypothetical protein;locus_tag=BALIOE_06055;product=hypothetical protein;Parent=BALIOE_06055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2434 c1 Prodigal gene 1261952 1262188 . + . ID=BALIOE_06060_gene;locus_tag=BALIOE_06060 | |
| 2435 c1 Prodigal CDS 1261952 1262188 . + 0 ID=BALIOE_06060;Name=hypothetical protein;locus_tag=BALIOE_06060;product=hypothetical protein;Parent=BALIOE_06060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2436 c1 Prodigal gene 1262145 1262591 . + . ID=BALIOE_06065_gene;locus_tag=BALIOE_06065 | |
| 2437 c1 Prodigal CDS 1262145 1262591 . + 0 ID=BALIOE_06065;Name=hypothetical protein;locus_tag=BALIOE_06065;product=hypothetical protein;Parent=BALIOE_06065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2438 c1 Prodigal gene 1262588 1263115 . + . ID=BALIOE_06070_gene;locus_tag=BALIOE_06070 | |
| 2439 c1 Prodigal CDS 1262588 1263115 . + 0 ID=BALIOE_06070;Name=hypothetical protein;locus_tag=BALIOE_06070;product=hypothetical protein;Parent=BALIOE_06070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2440 c1 Prodigal gene 1263569 1264303 . + . ID=BALIOE_06075_gene;locus_tag=BALIOE_06075 | |
| 2441 c1 Prodigal CDS 1263569 1264303 . + 0 ID=BALIOE_06075;Name=hypothetical protein;locus_tag=BALIOE_06075;product=hypothetical protein;Parent=BALIOE_06075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2442 c1 Prodigal gene 1264378 1265100 . + . ID=BALIOE_06080_gene;locus_tag=BALIOE_06080 | |
| 2443 c1 Prodigal CDS 1264378 1265100 . + 0 ID=BALIOE_06080;Name=hypothetical protein;locus_tag=BALIOE_06080;product=hypothetical protein;Parent=BALIOE_06080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2444 c1 Prodigal gene 1265100 1265705 . + . ID=BALIOE_06085_gene;locus_tag=BALIOE_06085 | |
| 2445 c1 Prodigal CDS 1265100 1265705 . + 0 ID=BALIOE_06085;Name=hypothetical protein;locus_tag=BALIOE_06085;product=hypothetical protein;Parent=BALIOE_06085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2446 c1 Prodigal gene 1265702 1265896 . + . ID=BALIOE_06090_gene;locus_tag=BALIOE_06090 | |
| 2447 c1 Prodigal CDS 1265702 1265896 . + 0 ID=BALIOE_06090;Name=hypothetical protein;locus_tag=BALIOE_06090;product=hypothetical protein;Parent=BALIOE_06090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2448 c1 Prodigal gene 1265889 1266323 . + . ID=BALIOE_06095_gene;locus_tag=BALIOE_06095 | |
| 2449 c1 Prodigal CDS 1265889 1266323 . + 0 ID=BALIOE_06095;Name=hypothetical protein;locus_tag=BALIOE_06095;product=hypothetical protein;Parent=BALIOE_06095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2450 c1 tRNAscan-SE gene 1266765 1266840 . + . ID=BALIOE_06100_gene;locus_tag=BALIOE_06100;gene=Ile2_trna | |
| 2451 c1 tRNAscan-SE tRNA 1266765 1266840 . + . ID=BALIOE_06100;Name=tRNA-Ile2;locus_tag=BALIOE_06100;product=tRNA-Ile2;gene=Ile2_trna;Parent=BALIOE_06100_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 2452 c1 tRNAscan-SE gene 1266850 1266926 . + . ID=BALIOE_06105_gene;locus_tag=BALIOE_06105;gene=Arg_trna | |
| 2453 c1 tRNAscan-SE tRNA 1266850 1266926 . + . ID=BALIOE_06105;Name=tRNA-Arg;locus_tag=BALIOE_06105;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_06105_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 2454 c1 tRNAscan-SE gene 1266940 1267016 . + . ID=BALIOE_06110_gene;locus_tag=BALIOE_06110;gene=Arg_trna | |
| 2455 c1 tRNAscan-SE tRNA 1266940 1267016 . + . ID=BALIOE_06110;Name=tRNA-Arg;locus_tag=BALIOE_06110;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_06110_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 2456 c1 Prodigal gene 1267107 1268066 . + . ID=BALIOE_06115_gene;locus_tag=BALIOE_06115 | |
| 2457 c1 Prodigal CDS 1267107 1268066 . + 0 ID=BALIOE_06115;Name=hypothetical protein;locus_tag=BALIOE_06115;product=hypothetical protein;Parent=BALIOE_06115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2458 c1 Prodigal gene 1268078 1268347 . + . ID=BALIOE_06120_gene;locus_tag=BALIOE_06120 | |
| 2459 c1 Prodigal CDS 1268078 1268347 . + 0 ID=BALIOE_06120;Name=hypothetical protein;locus_tag=BALIOE_06120;product=hypothetical protein;Parent=BALIOE_06120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2460 c1 Prodigal gene 1268834 1270738 . + . ID=BALIOE_06125_gene;locus_tag=BALIOE_06125 | |
| 2461 c1 Prodigal CDS 1268834 1270738 . + 0 ID=BALIOE_06125;Name=hypothetical protein;locus_tag=BALIOE_06125;product=hypothetical protein;Parent=BALIOE_06125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2462 c1 Prodigal gene 1270545 1271432 . - . ID=BALIOE_06130_gene;locus_tag=BALIOE_06130 | |
| 2463 c1 Prodigal CDS 1270545 1271432 . - 0 ID=BALIOE_06130;Name=hypothetical protein;locus_tag=BALIOE_06130;product=hypothetical protein;Parent=BALIOE_06130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2464 c1 Prodigal gene 1271432 1271758 . - . ID=BALIOE_06135_gene;locus_tag=BALIOE_06135 | |
| 2465 c1 Prodigal CDS 1271432 1271758 . - 0 ID=BALIOE_06135;Name=hypothetical protein;locus_tag=BALIOE_06135;product=hypothetical protein;Parent=BALIOE_06135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2466 c1 Prodigal gene 1271816 1272085 . + . ID=BALIOE_06140_gene;locus_tag=BALIOE_06140 | |
| 2467 c1 Prodigal CDS 1271816 1272085 . + 0 ID=BALIOE_06140;Name=hypothetical protein;locus_tag=BALIOE_06140;product=hypothetical protein;Parent=BALIOE_06140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2468 c1 Prodigal gene 1272220 1272399 . + . ID=BALIOE_06145_gene;locus_tag=BALIOE_06145 | |
| 2469 c1 Prodigal CDS 1272220 1272399 . + 0 ID=BALIOE_06145;Name=hypothetical protein;locus_tag=BALIOE_06145;product=hypothetical protein;Parent=BALIOE_06145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2470 c1 Prodigal gene 1272440 1272712 . + . ID=BALIOE_06150_gene;locus_tag=BALIOE_06150 | |
| 2471 c1 Prodigal CDS 1272440 1272712 . + 0 ID=BALIOE_06150;Name=hypothetical protein;locus_tag=BALIOE_06150;product=hypothetical protein;Parent=BALIOE_06150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2472 c1 Prodigal gene 1272789 1273004 . + . ID=BALIOE_06155_gene;locus_tag=BALIOE_06155 | |
| 2473 c1 Prodigal CDS 1272789 1273004 . + 0 ID=BALIOE_06155;Name=hypothetical protein;locus_tag=BALIOE_06155;product=hypothetical protein;Parent=BALIOE_06155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2474 c1 Prodigal gene 1273009 1273542 . + . ID=BALIOE_06160_gene;locus_tag=BALIOE_06160 | |
| 2475 c1 Prodigal CDS 1273009 1273542 . + 0 ID=BALIOE_06160;Name=hypothetical protein;locus_tag=BALIOE_06160;product=hypothetical protein;Parent=BALIOE_06160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2476 c1 Prodigal gene 1273813 1274382 . + . ID=BALIOE_06165_gene;locus_tag=BALIOE_06165 | |
| 2477 c1 Prodigal CDS 1273813 1274382 . + 0 ID=BALIOE_06165;Name=hypothetical protein;locus_tag=BALIOE_06165;product=hypothetical protein;Parent=BALIOE_06165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2478 c1 Prodigal gene 1274382 1274528 . + . ID=BALIOE_06170_gene;locus_tag=BALIOE_06170 | |
| 2479 c1 Prodigal CDS 1274382 1274528 . + 0 ID=BALIOE_06170;Name=hypothetical protein;locus_tag=BALIOE_06170;product=hypothetical protein;Parent=BALIOE_06170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2480 c1 Prodigal gene 1274536 1275000 . + . ID=BALIOE_06175_gene;locus_tag=BALIOE_06175 | |
| 2481 c1 Prodigal CDS 1274536 1275000 . + 0 ID=BALIOE_06175;Name=hypothetical protein;locus_tag=BALIOE_06175;product=hypothetical protein;Parent=BALIOE_06175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2482 c1 Prodigal gene 1275032 1275325 . - . ID=BALIOE_06180_gene;locus_tag=BALIOE_06180 | |
| 2483 c1 Prodigal CDS 1275032 1275325 . - 0 ID=BALIOE_06180;Name=hypothetical protein;locus_tag=BALIOE_06180;product=hypothetical protein;Parent=BALIOE_06180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2484 c1 Prodigal gene 1275475 1275678 . + . ID=BALIOE_06185_gene;locus_tag=BALIOE_06185 | |
| 2485 c1 Prodigal CDS 1275475 1275678 . + 0 ID=BALIOE_06185;Name=hypothetical protein;locus_tag=BALIOE_06185;product=hypothetical protein;Parent=BALIOE_06185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2486 c1 Prodigal gene 1275734 1276540 . + . ID=BALIOE_06190_gene;locus_tag=BALIOE_06190 | |
| 2487 c1 Prodigal CDS 1275734 1276540 . + 0 ID=BALIOE_06190;Name=hypothetical protein;locus_tag=BALIOE_06190;product=hypothetical protein;Parent=BALIOE_06190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2488 c1 Prodigal gene 1276521 1278227 . + . ID=BALIOE_06195_gene;locus_tag=BALIOE_06195 | |
| 2489 c1 Prodigal CDS 1276521 1278227 . + 0 ID=BALIOE_06195;Name=hypothetical protein;locus_tag=BALIOE_06195;product=hypothetical protein;Parent=BALIOE_06195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2490 c1 Prodigal gene 1278227 1280371 . + . ID=BALIOE_06200_gene;locus_tag=BALIOE_06200 | |
| 2491 c1 Prodigal CDS 1278227 1280371 . + 0 ID=BALIOE_06200;Name=hypothetical protein;locus_tag=BALIOE_06200;product=hypothetical protein;Parent=BALIOE_06200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2492 c1 Prodigal gene 1280529 1281536 . + . ID=BALIOE_06205_gene;locus_tag=BALIOE_06205 | |
| 2493 c1 Prodigal CDS 1280529 1281536 . + 0 ID=BALIOE_06205;Name=hypothetical protein;locus_tag=BALIOE_06205;product=hypothetical protein;Parent=BALIOE_06205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2494 c1 Prodigal gene 1281560 1282774 . + . ID=BALIOE_06210_gene;locus_tag=BALIOE_06210 | |
| 2495 c1 Prodigal CDS 1281560 1282774 . + 0 ID=BALIOE_06210;Name=hypothetical protein;locus_tag=BALIOE_06210;product=hypothetical protein;Parent=BALIOE_06210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2496 c1 Prodigal gene 1282830 1283219 . + . ID=BALIOE_06215_gene;locus_tag=BALIOE_06215 | |
| 2497 c1 Prodigal CDS 1282830 1283219 . + 0 ID=BALIOE_06215;Name=hypothetical protein;locus_tag=BALIOE_06215;product=hypothetical protein;Parent=BALIOE_06215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2498 c1 Prodigal gene 1283269 1283730 . + . ID=BALIOE_06220_gene;locus_tag=BALIOE_06220 | |
| 2499 c1 Prodigal CDS 1283269 1283730 . + 0 ID=BALIOE_06220;Name=hypothetical protein;locus_tag=BALIOE_06220;product=hypothetical protein;Parent=BALIOE_06220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2500 c1 Prodigal gene 1283714 1284277 . + . ID=BALIOE_06225_gene;locus_tag=BALIOE_06225 | |
| 2501 c1 Prodigal CDS 1283714 1284277 . + 0 ID=BALIOE_06225;Name=hypothetical protein;locus_tag=BALIOE_06225;product=hypothetical protein;Parent=BALIOE_06225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2502 c1 Prodigal gene 1284277 1284927 . + . ID=BALIOE_06230_gene;locus_tag=BALIOE_06230 | |
| 2503 c1 Prodigal CDS 1284277 1284927 . + 0 ID=BALIOE_06230;Name=hypothetical protein;locus_tag=BALIOE_06230;product=hypothetical protein;Parent=BALIOE_06230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2504 c1 Prodigal gene 1284924 1286861 . + . ID=BALIOE_06235_gene;locus_tag=BALIOE_06235 | |
| 2505 c1 Prodigal CDS 1284924 1286861 . + 0 ID=BALIOE_06235;Name=hypothetical protein;locus_tag=BALIOE_06235;product=hypothetical protein;Parent=BALIOE_06235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2506 c1 Prodigal gene 1286863 1287132 . + . ID=BALIOE_06240_gene;locus_tag=BALIOE_06240 | |
| 2507 c1 Prodigal CDS 1286863 1287132 . + 0 ID=BALIOE_06240;Name=hypothetical protein;locus_tag=BALIOE_06240;product=hypothetical protein;Parent=BALIOE_06240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2508 c1 Prodigal gene 1287272 1287460 . + . ID=BALIOE_06245_gene;locus_tag=BALIOE_06245 | |
| 2509 c1 Prodigal CDS 1287272 1287460 . + 0 ID=BALIOE_06245;Name=hypothetical protein;locus_tag=BALIOE_06245;product=hypothetical protein;Parent=BALIOE_06245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2510 c1 Prodigal gene 1287755 1289380 . + . ID=BALIOE_06250_gene;locus_tag=BALIOE_06250 | |
| 2511 c1 Prodigal CDS 1287755 1289380 . + 0 ID=BALIOE_06250;Name=hypothetical protein;locus_tag=BALIOE_06250;product=hypothetical protein;Parent=BALIOE_06250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2512 c1 Prodigal gene 1289377 1290645 . + . ID=BALIOE_06255_gene;locus_tag=BALIOE_06255 | |
| 2513 c1 Prodigal CDS 1289377 1290645 . + 0 ID=BALIOE_06255;Name=hypothetical protein;locus_tag=BALIOE_06255;product=hypothetical protein;Parent=BALIOE_06255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2514 c1 Prodigal gene 1290660 1290938 . + . ID=BALIOE_06260_gene;locus_tag=BALIOE_06260 | |
| 2515 c1 Prodigal CDS 1290660 1290938 . + 0 ID=BALIOE_06260;Name=hypothetical protein;locus_tag=BALIOE_06260;product=hypothetical protein;Parent=BALIOE_06260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2516 c1 Prodigal gene 1290944 1291561 . + . ID=BALIOE_06265_gene;locus_tag=BALIOE_06265 | |
| 2517 c1 Prodigal CDS 1290944 1291561 . + 0 ID=BALIOE_06265;Name=hypothetical protein;locus_tag=BALIOE_06265;product=hypothetical protein;Parent=BALIOE_06265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2518 c1 Prodigal gene 1291652 1292386 . + . ID=BALIOE_06270_gene;locus_tag=BALIOE_06270 | |
| 2519 c1 Prodigal CDS 1291652 1292386 . + 0 ID=BALIOE_06270;Name=hypothetical protein;locus_tag=BALIOE_06270;product=hypothetical protein;Parent=BALIOE_06270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2520 c1 Prodigal gene 1292619 1292759 . + . ID=BALIOE_06275_gene;locus_tag=BALIOE_06275 | |
| 2521 c1 Prodigal CDS 1292619 1292759 . + 0 ID=BALIOE_06275;Name=hypothetical protein;locus_tag=BALIOE_06275;product=hypothetical protein;Parent=BALIOE_06275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2522 c1 Prodigal gene 1292816 1293217 . + . ID=BALIOE_06280_gene;locus_tag=BALIOE_06280 | |
| 2523 c1 Prodigal CDS 1292816 1293217 . + 0 ID=BALIOE_06280;Name=hypothetical protein;locus_tag=BALIOE_06280;product=hypothetical protein;Parent=BALIOE_06280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2524 c1 Prodigal gene 1293311 1293967 . + . ID=BALIOE_06285_gene;locus_tag=BALIOE_06285 | |
| 2525 c1 Prodigal CDS 1293311 1293967 . + 0 ID=BALIOE_06285;Name=hypothetical protein;locus_tag=BALIOE_06285;product=hypothetical protein;Parent=BALIOE_06285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2526 c1 Prodigal gene 1293970 1294416 . + . ID=BALIOE_06290_gene;locus_tag=BALIOE_06290 | |
| 2527 c1 Prodigal CDS 1293970 1294416 . + 0 ID=BALIOE_06290;Name=hypothetical protein;locus_tag=BALIOE_06290;product=hypothetical protein;Parent=BALIOE_06290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2528 c1 Prodigal gene 1294426 1294677 . + . ID=BALIOE_06295_gene;locus_tag=BALIOE_06295 | |
| 2529 c1 Prodigal CDS 1294426 1294677 . + 0 ID=BALIOE_06295;Name=hypothetical protein;locus_tag=BALIOE_06295;product=hypothetical protein;Parent=BALIOE_06295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2530 c1 Prodigal gene 1294688 1295953 . + . ID=BALIOE_06300_gene;locus_tag=BALIOE_06300 | |
| 2531 c1 Prodigal CDS 1294688 1295953 . + 0 ID=BALIOE_06300;Name=hypothetical protein;locus_tag=BALIOE_06300;product=hypothetical protein;Parent=BALIOE_06300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2532 c1 Prodigal gene 1296023 1304404 . + . ID=BALIOE_06305_gene;locus_tag=BALIOE_06305 | |
| 2533 c1 Prodigal CDS 1296023 1304404 . + 0 ID=BALIOE_06305;Name=hypothetical protein;locus_tag=BALIOE_06305;product=hypothetical protein;Parent=BALIOE_06305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2534 c1 Prodigal gene 1304527 1304622 . + . ID=BALIOE_06310_gene;locus_tag=BALIOE_06310 | |
| 2535 c1 Prodigal CDS 1304527 1304622 . + 0 ID=BALIOE_06310;Name=hypothetical protein;locus_tag=BALIOE_06310;product=hypothetical protein;Parent=BALIOE_06310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2536 c1 Prodigal gene 1304955 1305299 . - . ID=BALIOE_06315_gene;locus_tag=BALIOE_06315 | |
| 2537 c1 Prodigal CDS 1304955 1305299 . - 0 ID=BALIOE_06315;Name=hypothetical protein;locus_tag=BALIOE_06315;product=hypothetical protein;Parent=BALIOE_06315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2538 c1 Prodigal gene 1305419 1305631 . - . ID=BALIOE_06320_gene;locus_tag=BALIOE_06320 | |
| 2539 c1 Prodigal CDS 1305419 1305631 . - 0 ID=BALIOE_06320;Name=hypothetical protein;locus_tag=BALIOE_06320;product=hypothetical protein;Parent=BALIOE_06320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2540 c1 Prodigal gene 1305865 1306260 . - . ID=BALIOE_06325_gene;locus_tag=BALIOE_06325 | |
| 2541 c1 Prodigal CDS 1305865 1306260 . - 0 ID=BALIOE_06325;Name=hypothetical protein;locus_tag=BALIOE_06325;product=hypothetical protein;Parent=BALIOE_06325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2542 c1 Prodigal gene 1306260 1306919 . - . ID=BALIOE_06330_gene;locus_tag=BALIOE_06330 | |
| 2543 c1 Prodigal CDS 1306260 1306919 . - 0 ID=BALIOE_06330;Name=hypothetical protein;locus_tag=BALIOE_06330;product=hypothetical protein;Parent=BALIOE_06330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2544 c1 Prodigal gene 1306940 1307158 . - . ID=BALIOE_06335_gene;locus_tag=BALIOE_06335 | |
| 2545 c1 Prodigal CDS 1306940 1307158 . - 0 ID=BALIOE_06335;Name=hypothetical protein;locus_tag=BALIOE_06335;product=hypothetical protein;Parent=BALIOE_06335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2546 c1 Prodigal gene 1307145 1307429 . - . ID=BALIOE_06340_gene;locus_tag=BALIOE_06340 | |
| 2547 c1 Prodigal CDS 1307145 1307429 . - 0 ID=BALIOE_06340;Name=hypothetical protein;locus_tag=BALIOE_06340;product=hypothetical protein;Parent=BALIOE_06340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2548 c1 Prodigal gene 1307426 1307647 . - . ID=BALIOE_06345_gene;locus_tag=BALIOE_06345 | |
| 2549 c1 Prodigal CDS 1307426 1307647 . - 0 ID=BALIOE_06345;Name=hypothetical protein;locus_tag=BALIOE_06345;product=hypothetical protein;Parent=BALIOE_06345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2550 c1 Prodigal gene 1307695 1308324 . - . ID=BALIOE_06350_gene;locus_tag=BALIOE_06350 | |
| 2551 c1 Prodigal CDS 1307695 1308324 . - 0 ID=BALIOE_06350;Name=hypothetical protein;locus_tag=BALIOE_06350;product=hypothetical protein;Parent=BALIOE_06350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2552 c1 Prodigal gene 1309283 1309390 . + . ID=BALIOE_06355_gene;locus_tag=BALIOE_06355 | |
| 2553 c1 Prodigal CDS 1309283 1309390 . + 0 ID=BALIOE_06355;Name=hypothetical protein;locus_tag=BALIOE_06355;product=hypothetical protein;Parent=BALIOE_06355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2554 c1 Prodigal gene 1309473 1310801 . - . ID=BALIOE_06360_gene;locus_tag=BALIOE_06360 | |
| 2555 c1 Prodigal CDS 1309473 1310801 . - 0 ID=BALIOE_06360;Name=hypothetical protein;locus_tag=BALIOE_06360;product=hypothetical protein;Parent=BALIOE_06360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2556 c1 Prodigal gene 1310822 1311316 . - . ID=BALIOE_06365_gene;locus_tag=BALIOE_06365 | |
| 2557 c1 Prodigal CDS 1310822 1311316 . - 0 ID=BALIOE_06365;Name=hypothetical protein;locus_tag=BALIOE_06365;product=hypothetical protein;Parent=BALIOE_06365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2558 c1 Prodigal gene 1311327 1311917 . - . ID=BALIOE_06370_gene;locus_tag=BALIOE_06370 | |
| 2559 c1 Prodigal CDS 1311327 1311917 . - 0 ID=BALIOE_06370;Name=hypothetical protein;locus_tag=BALIOE_06370;product=hypothetical protein;Parent=BALIOE_06370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2560 c1 Prodigal gene 1311927 1312727 . - . ID=BALIOE_06375_gene;locus_tag=BALIOE_06375 | |
| 2561 c1 Prodigal CDS 1311927 1312727 . - 0 ID=BALIOE_06375;Name=hypothetical protein;locus_tag=BALIOE_06375;product=hypothetical protein;Parent=BALIOE_06375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2562 c1 Prodigal gene 1312735 1313121 . - . ID=BALIOE_06380_gene;locus_tag=BALIOE_06380 | |
| 2563 c1 Prodigal CDS 1312735 1313121 . - 0 ID=BALIOE_06380;Name=hypothetical protein;locus_tag=BALIOE_06380;product=hypothetical protein;Parent=BALIOE_06380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2564 c1 Prodigal gene 1313133 1313828 . - . ID=BALIOE_06385_gene;locus_tag=BALIOE_06385 | |
| 2565 c1 Prodigal CDS 1313133 1313828 . - 0 ID=BALIOE_06385;Name=hypothetical protein;locus_tag=BALIOE_06385;product=hypothetical protein;Parent=BALIOE_06385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2566 c1 Prodigal gene 1313825 1314916 . - . ID=BALIOE_06390_gene;locus_tag=BALIOE_06390 | |
| 2567 c1 Prodigal CDS 1313825 1314916 . - 0 ID=BALIOE_06390;Name=hypothetical protein;locus_tag=BALIOE_06390;product=hypothetical protein;Parent=BALIOE_06390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2568 c1 Prodigal gene 1315204 1315842 . + . ID=BALIOE_06395_gene;locus_tag=BALIOE_06395 | |
| 2569 c1 Prodigal CDS 1315204 1315842 . + 0 ID=BALIOE_06395;Name=hypothetical protein;locus_tag=BALIOE_06395;product=hypothetical protein;Parent=BALIOE_06395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2570 c1 Prodigal gene 1315882 1319844 . - . ID=BALIOE_06400_gene;locus_tag=BALIOE_06400 | |
| 2571 c1 Prodigal CDS 1315882 1319844 . - 0 ID=BALIOE_06400;Name=hypothetical protein;locus_tag=BALIOE_06400;product=hypothetical protein;Parent=BALIOE_06400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2572 c1 Prodigal gene 1319899 1320108 . + . ID=BALIOE_06405_gene;locus_tag=BALIOE_06405 | |
| 2573 c1 Prodigal CDS 1319899 1320108 . + 0 ID=BALIOE_06405;Name=hypothetical protein;locus_tag=BALIOE_06405;product=hypothetical protein;Parent=BALIOE_06405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2574 c1 Prodigal gene 1320267 1321775 . + . ID=BALIOE_06410_gene;locus_tag=BALIOE_06410 | |
| 2575 c1 Prodigal CDS 1320267 1321775 . + 0 ID=BALIOE_06410;Name=hypothetical protein;locus_tag=BALIOE_06410;product=hypothetical protein;Parent=BALIOE_06410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2576 c1 Prodigal gene 1321924 1323267 . - . ID=BALIOE_06415_gene;locus_tag=BALIOE_06415 | |
| 2577 c1 Prodigal CDS 1321924 1323267 . - 0 ID=BALIOE_06415;Name=hypothetical protein;locus_tag=BALIOE_06415;product=hypothetical protein;Parent=BALIOE_06415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2578 c1 Prodigal gene 1324267 1324413 . - . ID=BALIOE_06420_gene;locus_tag=BALIOE_06420 | |
| 2579 c1 Prodigal CDS 1324267 1324413 . - 0 ID=BALIOE_06420;Name=hypothetical protein;locus_tag=BALIOE_06420;product=hypothetical protein;Parent=BALIOE_06420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2580 c1 Prodigal gene 1324449 1325279 . + . ID=BALIOE_06425_gene;locus_tag=BALIOE_06425 | |
| 2581 c1 Prodigal CDS 1324449 1325279 . + 0 ID=BALIOE_06425;Name=hypothetical protein;locus_tag=BALIOE_06425;product=hypothetical protein;Parent=BALIOE_06425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2582 c1 Prodigal gene 1325337 1326464 . + . ID=BALIOE_06430_gene;locus_tag=BALIOE_06430 | |
| 2583 c1 Prodigal CDS 1325337 1326464 . + 0 ID=BALIOE_06430;Name=hypothetical protein;locus_tag=BALIOE_06430;product=hypothetical protein;Parent=BALIOE_06430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2584 c1 Prodigal gene 1326470 1327741 . + . ID=BALIOE_06435_gene;locus_tag=BALIOE_06435 | |
| 2585 c1 Prodigal CDS 1326470 1327741 . + 0 ID=BALIOE_06435;Name=hypothetical protein;locus_tag=BALIOE_06435;product=hypothetical protein;Parent=BALIOE_06435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2586 c1 Prodigal gene 1328085 1329149 . + . ID=BALIOE_06440_gene;locus_tag=BALIOE_06440 | |
| 2587 c1 Prodigal CDS 1328085 1329149 . + 0 ID=BALIOE_06440;Name=hypothetical protein;locus_tag=BALIOE_06440;product=hypothetical protein;Parent=BALIOE_06440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2588 c1 Prodigal gene 1329199 1329612 . - . ID=BALIOE_06445_gene;locus_tag=BALIOE_06445 | |
| 2589 c1 Prodigal CDS 1329199 1329612 . - 0 ID=BALIOE_06445;Name=hypothetical protein;locus_tag=BALIOE_06445;product=hypothetical protein;Parent=BALIOE_06445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2590 c1 Prodigal gene 1329614 1330939 . - . ID=BALIOE_06450_gene;locus_tag=BALIOE_06450 | |
| 2591 c1 Prodigal CDS 1329614 1330939 . - 0 ID=BALIOE_06450;Name=hypothetical protein;locus_tag=BALIOE_06450;product=hypothetical protein;Parent=BALIOE_06450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2592 c1 Prodigal gene 1330932 1332950 . - . ID=BALIOE_06455_gene;locus_tag=BALIOE_06455 | |
| 2593 c1 Prodigal CDS 1330932 1332950 . - 0 ID=BALIOE_06455;Name=hypothetical protein;locus_tag=BALIOE_06455;product=hypothetical protein;Parent=BALIOE_06455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2594 c1 Prodigal gene 1332959 1335382 . - . ID=BALIOE_06460_gene;locus_tag=BALIOE_06460 | |
| 2595 c1 Prodigal CDS 1332959 1335382 . - 0 ID=BALIOE_06460;Name=hypothetical protein;locus_tag=BALIOE_06460;product=hypothetical protein;Parent=BALIOE_06460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2596 c1 Prodigal gene 1335969 1337327 . + . ID=BALIOE_06465_gene;locus_tag=BALIOE_06465 | |
| 2597 c1 Prodigal CDS 1335969 1337327 . + 0 ID=BALIOE_06465;Name=hypothetical protein;locus_tag=BALIOE_06465;product=hypothetical protein;Parent=BALIOE_06465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2598 c1 Prodigal gene 1337425 1339035 . + . ID=BALIOE_06470_gene;locus_tag=BALIOE_06470 | |
| 2599 c1 Prodigal CDS 1337425 1339035 . + 0 ID=BALIOE_06470;Name=hypothetical protein;locus_tag=BALIOE_06470;product=hypothetical protein;Parent=BALIOE_06470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2600 c1 Prodigal gene 1339137 1339628 . - . ID=BALIOE_06475_gene;locus_tag=BALIOE_06475 | |
| 2601 c1 Prodigal CDS 1339137 1339628 . - 0 ID=BALIOE_06475;Name=hypothetical protein;locus_tag=BALIOE_06475;product=hypothetical protein;Parent=BALIOE_06475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2602 c1 Prodigal gene 1339633 1340445 . - . ID=BALIOE_06480_gene;locus_tag=BALIOE_06480 | |
| 2603 c1 Prodigal CDS 1339633 1340445 . - 0 ID=BALIOE_06480;Name=hypothetical protein;locus_tag=BALIOE_06480;product=hypothetical protein;Parent=BALIOE_06480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2604 c1 Prodigal gene 1341133 1341915 . + . ID=BALIOE_06485_gene;locus_tag=BALIOE_06485 | |
| 2605 c1 Prodigal CDS 1341133 1341915 . + 0 ID=BALIOE_06485;Name=hypothetical protein;locus_tag=BALIOE_06485;product=hypothetical protein;Parent=BALIOE_06485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2606 c1 Prodigal gene 1342061 1342750 . - . ID=BALIOE_06490_gene;locus_tag=BALIOE_06490 | |
| 2607 c1 Prodigal CDS 1342061 1342750 . - 0 ID=BALIOE_06490;Name=hypothetical protein;locus_tag=BALIOE_06490;product=hypothetical protein;Parent=BALIOE_06490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2608 c1 Prodigal gene 1342747 1344081 . - . ID=BALIOE_06495_gene;locus_tag=BALIOE_06495 | |
| 2609 c1 Prodigal CDS 1342747 1344081 . - 0 ID=BALIOE_06495;Name=hypothetical protein;locus_tag=BALIOE_06495;product=hypothetical protein;Parent=BALIOE_06495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2610 c1 Prodigal gene 1344097 1346619 . - . ID=BALIOE_06500_gene;locus_tag=BALIOE_06500 | |
| 2611 c1 Prodigal CDS 1344097 1346619 . - 0 ID=BALIOE_06500;Name=hypothetical protein;locus_tag=BALIOE_06500;product=hypothetical protein;Parent=BALIOE_06500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2612 c1 Prodigal gene 1346672 1347373 . - . ID=BALIOE_06505_gene;locus_tag=BALIOE_06505 | |
| 2613 c1 Prodigal CDS 1346672 1347373 . - 0 ID=BALIOE_06505;Name=hypothetical protein;locus_tag=BALIOE_06505;product=hypothetical protein;Parent=BALIOE_06505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2614 c1 Prodigal gene 1347459 1348019 . - . ID=BALIOE_06510_gene;locus_tag=BALIOE_06510 | |
| 2615 c1 Prodigal CDS 1347459 1348019 . - 0 ID=BALIOE_06510;Name=hypothetical protein;locus_tag=BALIOE_06510;product=hypothetical protein;Parent=BALIOE_06510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2616 c1 Prodigal gene 1348062 1348685 . - . ID=BALIOE_06515_gene;locus_tag=BALIOE_06515 | |
| 2617 c1 Prodigal CDS 1348062 1348685 . - 0 ID=BALIOE_06515;Name=hypothetical protein;locus_tag=BALIOE_06515;product=hypothetical protein;Parent=BALIOE_06515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2618 c1 Prodigal gene 1348954 1349064 . - . ID=BALIOE_06520_gene;locus_tag=BALIOE_06520 | |
| 2619 c1 Prodigal CDS 1348954 1349064 . - 0 ID=BALIOE_06520;Name=hypothetical protein;locus_tag=BALIOE_06520;product=hypothetical protein;Parent=BALIOE_06520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2620 c1 Prodigal gene 1350076 1353888 . + . ID=BALIOE_06525_gene;locus_tag=BALIOE_06525 | |
| 2621 c1 Prodigal CDS 1350076 1353888 . + 0 ID=BALIOE_06525;Name=hypothetical protein;locus_tag=BALIOE_06525;product=hypothetical protein;Parent=BALIOE_06525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2622 c1 Prodigal gene 1353977 1355596 . + . ID=BALIOE_06530_gene;locus_tag=BALIOE_06530 | |
| 2623 c1 Prodigal CDS 1353977 1355596 . + 0 ID=BALIOE_06530;Name=hypothetical protein;locus_tag=BALIOE_06530;product=hypothetical protein;Parent=BALIOE_06530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2624 c1 Prodigal gene 1355612 1355980 . + . ID=BALIOE_06535_gene;locus_tag=BALIOE_06535 | |
| 2625 c1 Prodigal CDS 1355612 1355980 . + 0 ID=BALIOE_06535;Name=hypothetical protein;locus_tag=BALIOE_06535;product=hypothetical protein;Parent=BALIOE_06535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2626 c1 Prodigal gene 1355994 1356755 . + . ID=BALIOE_06540_gene;locus_tag=BALIOE_06540 | |
| 2627 c1 Prodigal CDS 1355994 1356755 . + 0 ID=BALIOE_06540;Name=hypothetical protein;locus_tag=BALIOE_06540;product=hypothetical protein;Parent=BALIOE_06540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2628 c1 Prodigal gene 1356759 1357307 . + . ID=BALIOE_06545_gene;locus_tag=BALIOE_06545 | |
| 2629 c1 Prodigal CDS 1356759 1357307 . + 0 ID=BALIOE_06545;Name=hypothetical protein;locus_tag=BALIOE_06545;product=hypothetical protein;Parent=BALIOE_06545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2630 c1 Prodigal gene 1357329 1357610 . + . ID=BALIOE_06550_gene;locus_tag=BALIOE_06550 | |
| 2631 c1 Prodigal CDS 1357329 1357610 . + 0 ID=BALIOE_06550;Name=hypothetical protein;locus_tag=BALIOE_06550;product=hypothetical protein;Parent=BALIOE_06550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2632 c1 Prodigal gene 1357646 1358806 . + . ID=BALIOE_06555_gene;locus_tag=BALIOE_06555 | |
| 2633 c1 Prodigal CDS 1357646 1358806 . + 0 ID=BALIOE_06555;Name=hypothetical protein;locus_tag=BALIOE_06555;product=hypothetical protein;Parent=BALIOE_06555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2634 c1 Prodigal gene 1358880 1361438 . + . ID=BALIOE_06560_gene;locus_tag=BALIOE_06560 | |
| 2635 c1 Prodigal CDS 1358880 1361438 . + 0 ID=BALIOE_06560;Name=hypothetical protein;locus_tag=BALIOE_06560;product=hypothetical protein;Parent=BALIOE_06560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2636 c1 Prodigal gene 1361443 1362666 . + . ID=BALIOE_06565_gene;locus_tag=BALIOE_06565 | |
| 2637 c1 Prodigal CDS 1361443 1362666 . + 0 ID=BALIOE_06565;Name=hypothetical protein;locus_tag=BALIOE_06565;product=hypothetical protein;Parent=BALIOE_06565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2638 c1 Prodigal gene 1362663 1363616 . + . ID=BALIOE_06570_gene;locus_tag=BALIOE_06570 | |
| 2639 c1 Prodigal CDS 1362663 1363616 . + 0 ID=BALIOE_06570;Name=hypothetical protein;locus_tag=BALIOE_06570;product=hypothetical protein;Parent=BALIOE_06570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2640 c1 Prodigal gene 1363627 1364334 . + . ID=BALIOE_06575_gene;locus_tag=BALIOE_06575 | |
| 2641 c1 Prodigal CDS 1363627 1364334 . + 0 ID=BALIOE_06575;Name=hypothetical protein;locus_tag=BALIOE_06575;product=hypothetical protein;Parent=BALIOE_06575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2642 c1 Prodigal gene 1364318 1364974 . + . ID=BALIOE_06580_gene;locus_tag=BALIOE_06580 | |
| 2643 c1 Prodigal CDS 1364318 1364974 . + 0 ID=BALIOE_06580;Name=hypothetical protein;locus_tag=BALIOE_06580;product=hypothetical protein;Parent=BALIOE_06580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2644 c1 Prodigal gene 1364975 1366285 . + . ID=BALIOE_06585_gene;locus_tag=BALIOE_06585 | |
| 2645 c1 Prodigal CDS 1364975 1366285 . + 0 ID=BALIOE_06585;Name=hypothetical protein;locus_tag=BALIOE_06585;product=hypothetical protein;Parent=BALIOE_06585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2646 c1 Prodigal gene 1366294 1367082 . + . ID=BALIOE_06590_gene;locus_tag=BALIOE_06590 | |
| 2647 c1 Prodigal CDS 1366294 1367082 . + 0 ID=BALIOE_06590;Name=hypothetical protein;locus_tag=BALIOE_06590;product=hypothetical protein;Parent=BALIOE_06590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2648 c1 Prodigal gene 1367079 1368467 . + . ID=BALIOE_06595_gene;locus_tag=BALIOE_06595 | |
| 2649 c1 Prodigal CDS 1367079 1368467 . + 0 ID=BALIOE_06595;Name=hypothetical protein;locus_tag=BALIOE_06595;product=hypothetical protein;Parent=BALIOE_06595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2650 c1 Prodigal gene 1368481 1369422 . + . ID=BALIOE_06600_gene;locus_tag=BALIOE_06600 | |
| 2651 c1 Prodigal CDS 1368481 1369422 . + 0 ID=BALIOE_06600;Name=hypothetical protein;locus_tag=BALIOE_06600;product=hypothetical protein;Parent=BALIOE_06600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2652 c1 Prodigal gene 1369419 1370405 . + . ID=BALIOE_06605_gene;locus_tag=BALIOE_06605 | |
| 2653 c1 Prodigal CDS 1369419 1370405 . + 0 ID=BALIOE_06605;Name=hypothetical protein;locus_tag=BALIOE_06605;product=hypothetical protein;Parent=BALIOE_06605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2654 c1 Prodigal gene 1370772 1371974 . + . ID=BALIOE_06610_gene;locus_tag=BALIOE_06610 | |
| 2655 c1 Prodigal CDS 1370772 1371974 . + 0 ID=BALIOE_06610;Name=hypothetical protein;locus_tag=BALIOE_06610;product=hypothetical protein;Parent=BALIOE_06610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2656 c1 Prodigal gene 1372161 1373978 . - . ID=BALIOE_06615_gene;locus_tag=BALIOE_06615 | |
| 2657 c1 Prodigal CDS 1372161 1373978 . - 0 ID=BALIOE_06615;Name=hypothetical protein;locus_tag=BALIOE_06615;product=hypothetical protein;Parent=BALIOE_06615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2658 c1 Prodigal gene 1376029 1377414 . + . ID=BALIOE_06620_gene;locus_tag=BALIOE_06620 | |
| 2659 c1 Prodigal CDS 1376029 1377414 . + 0 ID=BALIOE_06620;Name=hypothetical protein;locus_tag=BALIOE_06620;product=hypothetical protein;Parent=BALIOE_06620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2660 c1 Prodigal gene 1378235 1378798 . + . ID=BALIOE_06625_gene;locus_tag=BALIOE_06625 | |
| 2661 c1 Prodigal CDS 1378235 1378798 . + 0 ID=BALIOE_06625;Name=hypothetical protein;locus_tag=BALIOE_06625;product=hypothetical protein;Parent=BALIOE_06625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2662 c1 Prodigal gene 1378953 1381313 . + . ID=BALIOE_06630_gene;locus_tag=BALIOE_06630 | |
| 2663 c1 Prodigal CDS 1378953 1381313 . + 0 ID=BALIOE_06630;Name=hypothetical protein;locus_tag=BALIOE_06630;product=hypothetical protein;Parent=BALIOE_06630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2664 c1 Prodigal gene 1381475 1381744 . - . ID=BALIOE_06635_gene;locus_tag=BALIOE_06635 | |
| 2665 c1 Prodigal CDS 1381475 1381744 . - 0 ID=BALIOE_06635;Name=hypothetical protein;locus_tag=BALIOE_06635;product=hypothetical protein;Parent=BALIOE_06635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2666 c1 Prodigal gene 1382070 1383608 . - . ID=BALIOE_06640_gene;locus_tag=BALIOE_06640 | |
| 2667 c1 Prodigal CDS 1382070 1383608 . - 0 ID=BALIOE_06640;Name=hypothetical protein;locus_tag=BALIOE_06640;product=hypothetical protein;Parent=BALIOE_06640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2668 c1 Prodigal gene 1383658 1384005 . - . ID=BALIOE_06645_gene;locus_tag=BALIOE_06645 | |
| 2669 c1 Prodigal CDS 1383658 1384005 . - 0 ID=BALIOE_06645;Name=hypothetical protein;locus_tag=BALIOE_06645;product=hypothetical protein;Parent=BALIOE_06645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2670 c1 Prodigal gene 1384002 1384382 . - . ID=BALIOE_06650_gene;locus_tag=BALIOE_06650 | |
| 2671 c1 Prodigal CDS 1384002 1384382 . - 0 ID=BALIOE_06650;Name=hypothetical protein;locus_tag=BALIOE_06650;product=hypothetical protein;Parent=BALIOE_06650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2672 c1 Prodigal gene 1384458 1384769 . - . ID=BALIOE_06655_gene;locus_tag=BALIOE_06655 | |
| 2673 c1 Prodigal CDS 1384458 1384769 . - 0 ID=BALIOE_06655;Name=hypothetical protein;locus_tag=BALIOE_06655;product=hypothetical protein;Parent=BALIOE_06655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2674 c1 Prodigal gene 1384909 1385727 . + . ID=BALIOE_06660_gene;locus_tag=BALIOE_06660 | |
| 2675 c1 Prodigal CDS 1384909 1385727 . + 0 ID=BALIOE_06660;Name=hypothetical protein;locus_tag=BALIOE_06660;product=hypothetical protein;Parent=BALIOE_06660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2676 c1 Prodigal gene 1385840 1386379 . + . ID=BALIOE_06665_gene;locus_tag=BALIOE_06665 | |
| 2677 c1 Prodigal CDS 1385840 1386379 . + 0 ID=BALIOE_06665;Name=hypothetical protein;locus_tag=BALIOE_06665;product=hypothetical protein;Parent=BALIOE_06665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2678 c1 Prodigal gene 1386427 1386678 . - . ID=BALIOE_06670_gene;locus_tag=BALIOE_06670 | |
| 2679 c1 Prodigal CDS 1386427 1386678 . - 0 ID=BALIOE_06670;Name=hypothetical protein;locus_tag=BALIOE_06670;product=hypothetical protein;Parent=BALIOE_06670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2680 c1 Prodigal gene 1386702 1386992 . - . ID=BALIOE_06675_gene;locus_tag=BALIOE_06675 | |
| 2681 c1 Prodigal CDS 1386702 1386992 . - 0 ID=BALIOE_06675;Name=hypothetical protein;locus_tag=BALIOE_06675;product=hypothetical protein;Parent=BALIOE_06675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2682 c1 Prodigal gene 1387678 1388037 . + . ID=BALIOE_06680_gene;locus_tag=BALIOE_06680 | |
| 2683 c1 Prodigal CDS 1387678 1388037 . + 0 ID=BALIOE_06680;Name=hypothetical protein;locus_tag=BALIOE_06680;product=hypothetical protein;Parent=BALIOE_06680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2684 c1 Prodigal gene 1388130 1389749 . - . ID=BALIOE_06685_gene;locus_tag=BALIOE_06685 | |
| 2685 c1 Prodigal CDS 1388130 1389749 . - 0 ID=BALIOE_06685;Name=hypothetical protein;locus_tag=BALIOE_06685;product=hypothetical protein;Parent=BALIOE_06685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2686 c1 Prodigal gene 1389974 1390249 . - . ID=BALIOE_06690_gene;locus_tag=BALIOE_06690 | |
| 2687 c1 Prodigal CDS 1389974 1390249 . - 0 ID=BALIOE_06690;Name=hypothetical protein;locus_tag=BALIOE_06690;product=hypothetical protein;Parent=BALIOE_06690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2688 c1 Prodigal gene 1390630 1391328 . + . ID=BALIOE_06695_gene;locus_tag=BALIOE_06695 | |
| 2689 c1 Prodigal CDS 1390630 1391328 . + 0 ID=BALIOE_06695;Name=hypothetical protein;locus_tag=BALIOE_06695;product=hypothetical protein;Parent=BALIOE_06695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2690 c1 Prodigal gene 1391419 1391721 . + . ID=BALIOE_06700_gene;locus_tag=BALIOE_06700 | |
| 2691 c1 Prodigal CDS 1391419 1391721 . + 0 ID=BALIOE_06700;Name=hypothetical protein;locus_tag=BALIOE_06700;product=hypothetical protein;Parent=BALIOE_06700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2692 c1 Prodigal gene 1391730 1392050 . + . ID=BALIOE_06705_gene;locus_tag=BALIOE_06705 | |
| 2693 c1 Prodigal CDS 1391730 1392050 . + 0 ID=BALIOE_06705;Name=hypothetical protein;locus_tag=BALIOE_06705;product=hypothetical protein;Parent=BALIOE_06705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2694 c1 Prodigal gene 1392043 1393746 . + . ID=BALIOE_06710_gene;locus_tag=BALIOE_06710 | |
| 2695 c1 Prodigal CDS 1392043 1393746 . + 0 ID=BALIOE_06710;Name=hypothetical protein;locus_tag=BALIOE_06710;product=hypothetical protein;Parent=BALIOE_06710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2696 c1 Prodigal gene 1393756 1394220 . + . ID=BALIOE_06715_gene;locus_tag=BALIOE_06715 | |
| 2697 c1 Prodigal CDS 1393756 1394220 . + 0 ID=BALIOE_06715;Name=hypothetical protein;locus_tag=BALIOE_06715;product=hypothetical protein;Parent=BALIOE_06715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2698 c1 Prodigal gene 1394221 1394895 . + . ID=BALIOE_06720_gene;locus_tag=BALIOE_06720 | |
| 2699 c1 Prodigal CDS 1394221 1394895 . + 0 ID=BALIOE_06720;Name=hypothetical protein;locus_tag=BALIOE_06720;product=hypothetical protein;Parent=BALIOE_06720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2700 c1 Prodigal gene 1394907 1395524 . + . ID=BALIOE_06725_gene;locus_tag=BALIOE_06725 | |
| 2701 c1 Prodigal CDS 1394907 1395524 . + 0 ID=BALIOE_06725;Name=hypothetical protein;locus_tag=BALIOE_06725;product=hypothetical protein;Parent=BALIOE_06725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2702 c1 Prodigal gene 1395780 1396121 . - . ID=BALIOE_06730_gene;locus_tag=BALIOE_06730 | |
| 2703 c1 Prodigal CDS 1395780 1396121 . - 0 ID=BALIOE_06730;Name=hypothetical protein;locus_tag=BALIOE_06730;product=hypothetical protein;Parent=BALIOE_06730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2704 c1 Prodigal gene 1396183 1396311 . - . ID=BALIOE_06735_gene;locus_tag=BALIOE_06735 | |
| 2705 c1 Prodigal CDS 1396183 1396311 . - 0 ID=BALIOE_06735;Name=hypothetical protein;locus_tag=BALIOE_06735;product=hypothetical protein;Parent=BALIOE_06735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2706 c1 Prodigal gene 1396736 1396999 . + . ID=BALIOE_06740_gene;locus_tag=BALIOE_06740 | |
| 2707 c1 Prodigal CDS 1396736 1396999 . + 0 ID=BALIOE_06740;Name=hypothetical protein;locus_tag=BALIOE_06740;product=hypothetical protein;Parent=BALIOE_06740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2708 c1 Prodigal gene 1397301 1397441 . + . ID=BALIOE_06745_gene;locus_tag=BALIOE_06745 | |
| 2709 c1 Prodigal CDS 1397301 1397441 . + 0 ID=BALIOE_06745;Name=hypothetical protein;locus_tag=BALIOE_06745;product=hypothetical protein;Parent=BALIOE_06745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2710 c1 Prodigal gene 1398313 1398984 . - . ID=BALIOE_06750_gene;locus_tag=BALIOE_06750 | |
| 2711 c1 Prodigal CDS 1398313 1398984 . - 0 ID=BALIOE_06750;Name=hypothetical protein;locus_tag=BALIOE_06750;product=hypothetical protein;Parent=BALIOE_06750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2712 c1 Prodigal gene 1400517 1401002 . - . ID=BALIOE_06755_gene;locus_tag=BALIOE_06755 | |
| 2713 c1 Prodigal CDS 1400517 1401002 . - 0 ID=BALIOE_06755;Name=hypothetical protein;locus_tag=BALIOE_06755;product=hypothetical protein;Parent=BALIOE_06755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2714 c1 Prodigal gene 1401322 1401747 . + . ID=BALIOE_06760_gene;locus_tag=BALIOE_06760 | |
| 2715 c1 Prodigal CDS 1401322 1401747 . + 0 ID=BALIOE_06760;Name=hypothetical protein;locus_tag=BALIOE_06760;product=hypothetical protein;Parent=BALIOE_06760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2716 c1 Prodigal gene 1401744 1402094 . + . ID=BALIOE_06765_gene;locus_tag=BALIOE_06765 | |
| 2717 c1 Prodigal CDS 1401744 1402094 . + 0 ID=BALIOE_06765;Name=hypothetical protein;locus_tag=BALIOE_06765;product=hypothetical protein;Parent=BALIOE_06765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2718 c1 Prodigal gene 1402125 1403738 . + . ID=BALIOE_06770_gene;locus_tag=BALIOE_06770 | |
| 2719 c1 Prodigal CDS 1402125 1403738 . + 0 ID=BALIOE_06770;Name=hypothetical protein;locus_tag=BALIOE_06770;product=hypothetical protein;Parent=BALIOE_06770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2720 c1 Prodigal gene 1403742 1404599 . - . ID=BALIOE_06775_gene;locus_tag=BALIOE_06775 | |
| 2721 c1 Prodigal CDS 1403742 1404599 . - 0 ID=BALIOE_06775;Name=hypothetical protein;locus_tag=BALIOE_06775;product=hypothetical protein;Parent=BALIOE_06775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2722 c1 Prodigal gene 1404681 1405022 . - . ID=BALIOE_06780_gene;locus_tag=BALIOE_06780 | |
| 2723 c1 Prodigal CDS 1404681 1405022 . - 0 ID=BALIOE_06780;Name=hypothetical protein;locus_tag=BALIOE_06780;product=hypothetical protein;Parent=BALIOE_06780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2724 c1 Prodigal gene 1405009 1405338 . - . ID=BALIOE_06785_gene;locus_tag=BALIOE_06785 | |
| 2725 c1 Prodigal CDS 1405009 1405338 . - 0 ID=BALIOE_06785;Name=hypothetical protein;locus_tag=BALIOE_06785;product=hypothetical protein;Parent=BALIOE_06785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2726 c1 Prodigal gene 1405599 1406066 . - . ID=BALIOE_06790_gene;locus_tag=BALIOE_06790 | |
| 2727 c1 Prodigal CDS 1405599 1406066 . - 0 ID=BALIOE_06790;Name=hypothetical protein;locus_tag=BALIOE_06790;product=hypothetical protein;Parent=BALIOE_06790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2728 c1 Prodigal gene 1406084 1407292 . - . ID=BALIOE_06795_gene;locus_tag=BALIOE_06795 | |
| 2729 c1 Prodigal CDS 1406084 1407292 . - 0 ID=BALIOE_06795;Name=hypothetical protein;locus_tag=BALIOE_06795;product=hypothetical protein;Parent=BALIOE_06795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2730 c1 Prodigal gene 1407303 1408259 . - . ID=BALIOE_06800_gene;locus_tag=BALIOE_06800 | |
| 2731 c1 Prodigal CDS 1407303 1408259 . - 0 ID=BALIOE_06800;Name=hypothetical protein;locus_tag=BALIOE_06800;product=hypothetical protein;Parent=BALIOE_06800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2732 c1 Prodigal gene 1408259 1409338 . - . ID=BALIOE_06805_gene;locus_tag=BALIOE_06805 | |
| 2733 c1 Prodigal CDS 1408259 1409338 . - 0 ID=BALIOE_06805;Name=hypothetical protein;locus_tag=BALIOE_06805;product=hypothetical protein;Parent=BALIOE_06805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2734 c1 Prodigal gene 1409340 1410113 . - . ID=BALIOE_06810_gene;locus_tag=BALIOE_06810 | |
| 2735 c1 Prodigal CDS 1409340 1410113 . - 0 ID=BALIOE_06810;Name=hypothetical protein;locus_tag=BALIOE_06810;product=hypothetical protein;Parent=BALIOE_06810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2736 c1 Prodigal gene 1410106 1411248 . - . ID=BALIOE_06815_gene;locus_tag=BALIOE_06815 | |
| 2737 c1 Prodigal CDS 1410106 1411248 . - 0 ID=BALIOE_06815;Name=hypothetical protein;locus_tag=BALIOE_06815;product=hypothetical protein;Parent=BALIOE_06815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2738 c1 Prodigal gene 1411258 1412316 . - . ID=BALIOE_06820_gene;locus_tag=BALIOE_06820 | |
| 2739 c1 Prodigal CDS 1411258 1412316 . - 0 ID=BALIOE_06820;Name=hypothetical protein;locus_tag=BALIOE_06820;product=hypothetical protein;Parent=BALIOE_06820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2740 c1 Prodigal gene 1412639 1413220 . + . ID=BALIOE_06825_gene;locus_tag=BALIOE_06825 | |
| 2741 c1 Prodigal CDS 1412639 1413220 . + 0 ID=BALIOE_06825;Name=hypothetical protein;locus_tag=BALIOE_06825;product=hypothetical protein;Parent=BALIOE_06825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2742 c1 Prodigal gene 1413220 1414377 . + . ID=BALIOE_06830_gene;locus_tag=BALIOE_06830 | |
| 2743 c1 Prodigal CDS 1413220 1414377 . + 0 ID=BALIOE_06830;Name=hypothetical protein;locus_tag=BALIOE_06830;product=hypothetical protein;Parent=BALIOE_06830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2744 c1 Prodigal gene 1414400 1414855 . + . ID=BALIOE_06835_gene;locus_tag=BALIOE_06835 | |
| 2745 c1 Prodigal CDS 1414400 1414855 . + 0 ID=BALIOE_06835;Name=hypothetical protein;locus_tag=BALIOE_06835;product=hypothetical protein;Parent=BALIOE_06835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2746 c1 Prodigal gene 1414878 1415918 . + . ID=BALIOE_06840_gene;locus_tag=BALIOE_06840 | |
| 2747 c1 Prodigal CDS 1414878 1415918 . + 0 ID=BALIOE_06840;Name=hypothetical protein;locus_tag=BALIOE_06840;product=hypothetical protein;Parent=BALIOE_06840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2748 c1 Prodigal gene 1415967 1416545 . + . ID=BALIOE_06845_gene;locus_tag=BALIOE_06845 | |
| 2749 c1 Prodigal CDS 1415967 1416545 . + 0 ID=BALIOE_06845;Name=hypothetical protein;locus_tag=BALIOE_06845;product=hypothetical protein;Parent=BALIOE_06845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2750 c1 Prodigal gene 1416614 1417189 . + . ID=BALIOE_06850_gene;locus_tag=BALIOE_06850 | |
| 2751 c1 Prodigal CDS 1416614 1417189 . + 0 ID=BALIOE_06850;Name=hypothetical protein;locus_tag=BALIOE_06850;product=hypothetical protein;Parent=BALIOE_06850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2752 c1 Prodigal gene 1417611 1417919 . + . ID=BALIOE_06855_gene;locus_tag=BALIOE_06855 | |
| 2753 c1 Prodigal CDS 1417611 1417919 . + 0 ID=BALIOE_06855;Name=hypothetical protein;locus_tag=BALIOE_06855;product=hypothetical protein;Parent=BALIOE_06855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2754 c1 Prodigal gene 1418511 1420601 . - . ID=BALIOE_06860_gene;locus_tag=BALIOE_06860 | |
| 2755 c1 Prodigal CDS 1418511 1420601 . - 0 ID=BALIOE_06860;Name=hypothetical protein;locus_tag=BALIOE_06860;product=hypothetical protein;Parent=BALIOE_06860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2756 c1 Prodigal gene 1422054 1422272 . + . ID=BALIOE_06865_gene;locus_tag=BALIOE_06865 | |
| 2757 c1 Prodigal CDS 1422054 1422272 . + 0 ID=BALIOE_06865;Name=hypothetical protein;locus_tag=BALIOE_06865;product=hypothetical protein;Parent=BALIOE_06865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2758 c1 Prodigal gene 1423550 1423678 . - . ID=BALIOE_06870_gene;locus_tag=BALIOE_06870 | |
| 2759 c1 Prodigal CDS 1423550 1423678 . - 0 ID=BALIOE_06870;Name=hypothetical protein;locus_tag=BALIOE_06870;product=hypothetical protein;Parent=BALIOE_06870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2760 c1 Prodigal gene 1424021 1424215 . - . ID=BALIOE_06875_gene;locus_tag=BALIOE_06875 | |
| 2761 c1 Prodigal CDS 1424021 1424215 . - 0 ID=BALIOE_06875;Name=hypothetical protein;locus_tag=BALIOE_06875;product=hypothetical protein;Parent=BALIOE_06875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2762 c1 Prodigal gene 1424267 1424446 . - . ID=BALIOE_06880_gene;locus_tag=BALIOE_06880 | |
| 2763 c1 Prodigal CDS 1424267 1424446 . - 0 ID=BALIOE_06880;Name=hypothetical protein;locus_tag=BALIOE_06880;product=hypothetical protein;Parent=BALIOE_06880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2764 c1 Prodigal gene 1424535 1424807 . + . ID=BALIOE_06885_gene;locus_tag=BALIOE_06885 | |
| 2765 c1 Prodigal CDS 1424535 1424807 . + 0 ID=BALIOE_06885;Name=hypothetical protein;locus_tag=BALIOE_06885;product=hypothetical protein;Parent=BALIOE_06885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2766 c1 Prodigal gene 1425372 1425569 . + . ID=BALIOE_06890_gene;locus_tag=BALIOE_06890 | |
| 2767 c1 Prodigal CDS 1425372 1425569 . + 0 ID=BALIOE_06890;Name=hypothetical protein;locus_tag=BALIOE_06890;product=hypothetical protein;Parent=BALIOE_06890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2768 c1 Prodigal gene 1426299 1427423 . + . ID=BALIOE_06895_gene;locus_tag=BALIOE_06895 | |
| 2769 c1 Prodigal CDS 1426299 1427423 . + 0 ID=BALIOE_06895;Name=hypothetical protein;locus_tag=BALIOE_06895;product=hypothetical protein;Parent=BALIOE_06895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2770 c1 Prodigal gene 1427842 1428135 . - . ID=BALIOE_06900_gene;locus_tag=BALIOE_06900 | |
| 2771 c1 Prodigal CDS 1427842 1428135 . - 0 ID=BALIOE_06900;Name=hypothetical protein;locus_tag=BALIOE_06900;product=hypothetical protein;Parent=BALIOE_06900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2772 c1 Prodigal gene 1428777 1429235 . - . ID=BALIOE_06905_gene;locus_tag=BALIOE_06905 | |
| 2773 c1 Prodigal CDS 1428777 1429235 . - 0 ID=BALIOE_06905;Name=hypothetical protein;locus_tag=BALIOE_06905;product=hypothetical protein;Parent=BALIOE_06905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2774 c1 Prodigal gene 1429693 1430202 . + . ID=BALIOE_06910_gene;locus_tag=BALIOE_06910 | |
| 2775 c1 Prodigal CDS 1429693 1430202 . + 0 ID=BALIOE_06910;Name=hypothetical protein;locus_tag=BALIOE_06910;product=hypothetical protein;Parent=BALIOE_06910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2776 c1 Prodigal gene 1430291 1430914 . + . ID=BALIOE_06915_gene;locus_tag=BALIOE_06915 | |
| 2777 c1 Prodigal CDS 1430291 1430914 . + 0 ID=BALIOE_06915;Name=hypothetical protein;locus_tag=BALIOE_06915;product=hypothetical protein;Parent=BALIOE_06915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2778 c1 Prodigal gene 1431010 1431243 . + . ID=BALIOE_06920_gene;locus_tag=BALIOE_06920 | |
| 2779 c1 Prodigal CDS 1431010 1431243 . + 0 ID=BALIOE_06920;Name=hypothetical protein;locus_tag=BALIOE_06920;product=hypothetical protein;Parent=BALIOE_06920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2780 c1 Prodigal gene 1431296 1431487 . - . ID=BALIOE_06925_gene;locus_tag=BALIOE_06925 | |
| 2781 c1 Prodigal CDS 1431296 1431487 . - 0 ID=BALIOE_06925;Name=hypothetical protein;locus_tag=BALIOE_06925;product=hypothetical protein;Parent=BALIOE_06925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2782 c1 Prodigal gene 1432081 1432968 . - . ID=BALIOE_06930_gene;locus_tag=BALIOE_06930 | |
| 2783 c1 Prodigal CDS 1432081 1432968 . - 0 ID=BALIOE_06930;Name=hypothetical protein;locus_tag=BALIOE_06930;product=hypothetical protein;Parent=BALIOE_06930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2784 c1 Prodigal gene 1432968 1433294 . - . ID=BALIOE_06935_gene;locus_tag=BALIOE_06935 | |
| 2785 c1 Prodigal CDS 1432968 1433294 . - 0 ID=BALIOE_06935;Name=hypothetical protein;locus_tag=BALIOE_06935;product=hypothetical protein;Parent=BALIOE_06935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2786 c1 Prodigal gene 1433475 1434521 . + . ID=BALIOE_06940_gene;locus_tag=BALIOE_06940 | |
| 2787 c1 Prodigal CDS 1433475 1434521 . + 0 ID=BALIOE_06940;Name=hypothetical protein;locus_tag=BALIOE_06940;product=hypothetical protein;Parent=BALIOE_06940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2788 c1 Prodigal gene 1434762 1435277 . + . ID=BALIOE_06945_gene;locus_tag=BALIOE_06945 | |
| 2789 c1 Prodigal CDS 1434762 1435277 . + 0 ID=BALIOE_06945;Name=hypothetical protein;locus_tag=BALIOE_06945;product=hypothetical protein;Parent=BALIOE_06945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2790 c1 Prodigal gene 1435274 1437442 . + . ID=BALIOE_06950_gene;locus_tag=BALIOE_06950 | |
| 2791 c1 Prodigal CDS 1435274 1437442 . + 0 ID=BALIOE_06950;Name=hypothetical protein;locus_tag=BALIOE_06950;product=hypothetical protein;Parent=BALIOE_06950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2792 c1 Prodigal gene 1437943 1439175 . + . ID=BALIOE_06955_gene;locus_tag=BALIOE_06955 | |
| 2793 c1 Prodigal CDS 1437943 1439175 . + 0 ID=BALIOE_06955;Name=hypothetical protein;locus_tag=BALIOE_06955;product=hypothetical protein;Parent=BALIOE_06955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2794 c1 Prodigal gene 1439160 1439798 . + . ID=BALIOE_06960_gene;locus_tag=BALIOE_06960 | |
| 2795 c1 Prodigal CDS 1439160 1439798 . + 0 ID=BALIOE_06960;Name=hypothetical protein;locus_tag=BALIOE_06960;product=hypothetical protein;Parent=BALIOE_06960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2796 c1 Prodigal gene 1440167 1440811 . + . ID=BALIOE_06965_gene;locus_tag=BALIOE_06965 | |
| 2797 c1 Prodigal CDS 1440167 1440811 . + 0 ID=BALIOE_06965;Name=hypothetical protein;locus_tag=BALIOE_06965;product=hypothetical protein;Parent=BALIOE_06965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2798 c1 Prodigal gene 1441127 1441627 . + . ID=BALIOE_06970_gene;locus_tag=BALIOE_06970 | |
| 2799 c1 Prodigal CDS 1441127 1441627 . + 0 ID=BALIOE_06970;Name=hypothetical protein;locus_tag=BALIOE_06970;product=hypothetical protein;Parent=BALIOE_06970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2800 c1 Prodigal gene 1441509 1441757 . - . ID=BALIOE_06975_gene;locus_tag=BALIOE_06975 | |
| 2801 c1 Prodigal CDS 1441509 1441757 . - 0 ID=BALIOE_06975;Name=hypothetical protein;locus_tag=BALIOE_06975;product=hypothetical protein;Parent=BALIOE_06975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2802 c1 Prodigal gene 1441811 1442236 . + . ID=BALIOE_06980_gene;locus_tag=BALIOE_06980 | |
| 2803 c1 Prodigal CDS 1441811 1442236 . + 0 ID=BALIOE_06980;Name=hypothetical protein;locus_tag=BALIOE_06980;product=hypothetical protein;Parent=BALIOE_06980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2804 c1 Prodigal gene 1442233 1442322 . + . ID=BALIOE_06985_gene;locus_tag=BALIOE_06985 | |
| 2805 c1 Prodigal CDS 1442233 1442322 . + 0 ID=BALIOE_06985;Name=hypothetical protein;locus_tag=BALIOE_06985;product=hypothetical protein;Parent=BALIOE_06985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2806 c1 Prodigal gene 1442536 1442718 . - . ID=BALIOE_06990_gene;locus_tag=BALIOE_06990 | |
| 2807 c1 Prodigal CDS 1442536 1442718 . - 0 ID=BALIOE_06990;Name=hypothetical protein;locus_tag=BALIOE_06990;product=hypothetical protein;Parent=BALIOE_06990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2808 c1 Prodigal gene 1443047 1443919 . + . ID=BALIOE_06995_gene;locus_tag=BALIOE_06995 | |
| 2809 c1 Prodigal CDS 1443047 1443919 . + 0 ID=BALIOE_06995;Name=hypothetical protein;locus_tag=BALIOE_06995;product=hypothetical protein;Parent=BALIOE_06995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2810 c1 Prodigal gene 1444291 1447140 . + . ID=BALIOE_07000_gene;locus_tag=BALIOE_07000 | |
| 2811 c1 Prodigal CDS 1444291 1447140 . + 0 ID=BALIOE_07000;Name=hypothetical protein;locus_tag=BALIOE_07000;product=hypothetical protein;Parent=BALIOE_07000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2812 c1 Prodigal gene 1447251 1449635 . + . ID=BALIOE_07005_gene;locus_tag=BALIOE_07005 | |
| 2813 c1 Prodigal CDS 1447251 1449635 . + 0 ID=BALIOE_07005;Name=hypothetical protein;locus_tag=BALIOE_07005;product=hypothetical protein;Parent=BALIOE_07005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2814 c1 Prodigal gene 1449632 1450537 . + . ID=BALIOE_07010_gene;locus_tag=BALIOE_07010 | |
| 2815 c1 Prodigal CDS 1449632 1450537 . + 0 ID=BALIOE_07010;Name=hypothetical protein;locus_tag=BALIOE_07010;product=hypothetical protein;Parent=BALIOE_07010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2816 c1 Prodigal gene 1450534 1451604 . + . ID=BALIOE_07015_gene;locus_tag=BALIOE_07015 | |
| 2817 c1 Prodigal CDS 1450534 1451604 . + 0 ID=BALIOE_07015;Name=hypothetical protein;locus_tag=BALIOE_07015;product=hypothetical protein;Parent=BALIOE_07015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2818 c1 Prodigal gene 1451944 1452762 . + . ID=BALIOE_07020_gene;locus_tag=BALIOE_07020 | |
| 2819 c1 Prodigal CDS 1451944 1452762 . + 0 ID=BALIOE_07020;Name=hypothetical protein;locus_tag=BALIOE_07020;product=hypothetical protein;Parent=BALIOE_07020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2820 c1 Prodigal gene 1452853 1453338 . + . ID=BALIOE_07025_gene;locus_tag=BALIOE_07025 | |
| 2821 c1 Prodigal CDS 1452853 1453338 . + 0 ID=BALIOE_07025;Name=hypothetical protein;locus_tag=BALIOE_07025;product=hypothetical protein;Parent=BALIOE_07025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2822 c1 Prodigal gene 1453354 1453830 . + . ID=BALIOE_07030_gene;locus_tag=BALIOE_07030 | |
| 2823 c1 Prodigal CDS 1453354 1453830 . + 0 ID=BALIOE_07030;Name=hypothetical protein;locus_tag=BALIOE_07030;product=hypothetical protein;Parent=BALIOE_07030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2824 c1 Prodigal gene 1453893 1454114 . + . ID=BALIOE_07035_gene;locus_tag=BALIOE_07035 | |
| 2825 c1 Prodigal CDS 1453893 1454114 . + 0 ID=BALIOE_07035;Name=hypothetical protein;locus_tag=BALIOE_07035;product=hypothetical protein;Parent=BALIOE_07035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2826 c1 Prodigal gene 1454114 1454227 . + . ID=BALIOE_07040_gene;locus_tag=BALIOE_07040 | |
| 2827 c1 Prodigal CDS 1454114 1454227 . + 0 ID=BALIOE_07040;Name=hypothetical protein;locus_tag=BALIOE_07040;product=hypothetical protein;Parent=BALIOE_07040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2828 c1 Prodigal gene 1454277 1454651 . + . ID=BALIOE_07045_gene;locus_tag=BALIOE_07045 | |
| 2829 c1 Prodigal CDS 1454277 1454651 . + 0 ID=BALIOE_07045;Name=hypothetical protein;locus_tag=BALIOE_07045;product=hypothetical protein;Parent=BALIOE_07045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2830 c1 Prodigal gene 1454698 1455072 . + . ID=BALIOE_07050_gene;locus_tag=BALIOE_07050 | |
| 2831 c1 Prodigal CDS 1454698 1455072 . + 0 ID=BALIOE_07050;Name=hypothetical protein;locus_tag=BALIOE_07050;product=hypothetical protein;Parent=BALIOE_07050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2832 c1 Prodigal gene 1455069 1455560 . + . ID=BALIOE_07055_gene;locus_tag=BALIOE_07055 | |
| 2833 c1 Prodigal CDS 1455069 1455560 . + 0 ID=BALIOE_07055;Name=hypothetical protein;locus_tag=BALIOE_07055;product=hypothetical protein;Parent=BALIOE_07055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2834 c1 Prodigal gene 1455572 1455769 . + . ID=BALIOE_07060_gene;locus_tag=BALIOE_07060 | |
| 2835 c1 Prodigal CDS 1455572 1455769 . + 0 ID=BALIOE_07060;Name=hypothetical protein;locus_tag=BALIOE_07060;product=hypothetical protein;Parent=BALIOE_07060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2836 c1 Prodigal gene 1455854 1456696 . + . ID=BALIOE_07065_gene;locus_tag=BALIOE_07065 | |
| 2837 c1 Prodigal CDS 1455854 1456696 . + 0 ID=BALIOE_07065;Name=hypothetical protein;locus_tag=BALIOE_07065;product=hypothetical protein;Parent=BALIOE_07065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2838 c1 tRNAscan-SE gene 1456846 1456933 . - . ID=BALIOE_07070_gene;locus_tag=BALIOE_07070;gene=Ser_trna | |
| 2839 c1 tRNAscan-SE tRNA 1456846 1456933 . - . ID=BALIOE_07070;Name=tRNA-Ser;locus_tag=BALIOE_07070;product=tRNA-Ser;gene=Ser_trna;Parent=BALIOE_07070_gene;inference=profile:tRNAscan:2.0;Note=SO:0000269 | |
| 2840 c1 Prodigal gene 1457167 1458105 . + . ID=BALIOE_07075_gene;locus_tag=BALIOE_07075 | |
| 2841 c1 Prodigal CDS 1457167 1458105 . + 0 ID=BALIOE_07075;Name=hypothetical protein;locus_tag=BALIOE_07075;product=hypothetical protein;Parent=BALIOE_07075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2842 c1 Prodigal gene 1458160 1458897 . + . ID=BALIOE_07080_gene;locus_tag=BALIOE_07080 | |
| 2843 c1 Prodigal CDS 1458160 1458897 . + 0 ID=BALIOE_07080;Name=hypothetical protein;locus_tag=BALIOE_07080;product=hypothetical protein;Parent=BALIOE_07080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2844 c1 Prodigal gene 1458921 1459475 . + . ID=BALIOE_07085_gene;locus_tag=BALIOE_07085 | |
| 2845 c1 Prodigal CDS 1458921 1459475 . + 0 ID=BALIOE_07085;Name=hypothetical protein;locus_tag=BALIOE_07085;product=hypothetical protein;Parent=BALIOE_07085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2846 c1 Prodigal gene 1459547 1460068 . + . ID=BALIOE_07090_gene;locus_tag=BALIOE_07090 | |
| 2847 c1 Prodigal CDS 1459547 1460068 . + 0 ID=BALIOE_07090;Name=hypothetical protein;locus_tag=BALIOE_07090;product=hypothetical protein;Parent=BALIOE_07090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2848 c1 Prodigal gene 1460132 1460965 . - . ID=BALIOE_07095_gene;locus_tag=BALIOE_07095 | |
| 2849 c1 Prodigal CDS 1460132 1460965 . - 0 ID=BALIOE_07095;Name=hypothetical protein;locus_tag=BALIOE_07095;product=hypothetical protein;Parent=BALIOE_07095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2850 c1 Prodigal gene 1460992 1461408 . - . ID=BALIOE_07100_gene;locus_tag=BALIOE_07100 | |
| 2851 c1 Prodigal CDS 1460992 1461408 . - 0 ID=BALIOE_07100;Name=hypothetical protein;locus_tag=BALIOE_07100;product=hypothetical protein;Parent=BALIOE_07100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2852 c1 Prodigal gene 1461433 1461822 . - . ID=BALIOE_07105_gene;locus_tag=BALIOE_07105 | |
| 2853 c1 Prodigal CDS 1461433 1461822 . - 0 ID=BALIOE_07105;Name=hypothetical protein;locus_tag=BALIOE_07105;product=hypothetical protein;Parent=BALIOE_07105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2854 c1 Prodigal gene 1461827 1462477 . - . ID=BALIOE_07110_gene;locus_tag=BALIOE_07110 | |
| 2855 c1 Prodigal CDS 1461827 1462477 . - 0 ID=BALIOE_07110;Name=hypothetical protein;locus_tag=BALIOE_07110;product=hypothetical protein;Parent=BALIOE_07110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2856 c1 Prodigal gene 1463231 1463686 . + . ID=BALIOE_07115_gene;locus_tag=BALIOE_07115 | |
| 2857 c1 Prodigal CDS 1463231 1463686 . + 0 ID=BALIOE_07115;Name=hypothetical protein;locus_tag=BALIOE_07115;product=hypothetical protein;Parent=BALIOE_07115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2858 c1 Prodigal gene 1463727 1464185 . + . ID=BALIOE_07120_gene;locus_tag=BALIOE_07120 | |
| 2859 c1 Prodigal CDS 1463727 1464185 . + 0 ID=BALIOE_07120;Name=hypothetical protein;locus_tag=BALIOE_07120;product=hypothetical protein;Parent=BALIOE_07120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2860 c1 Prodigal gene 1464244 1464576 . + . ID=BALIOE_07125_gene;locus_tag=BALIOE_07125 | |
| 2861 c1 Prodigal CDS 1464244 1464576 . + 0 ID=BALIOE_07125;Name=hypothetical protein;locus_tag=BALIOE_07125;product=hypothetical protein;Parent=BALIOE_07125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2862 c1 Prodigal gene 1464697 1465008 . + . ID=BALIOE_07130_gene;locus_tag=BALIOE_07130 | |
| 2863 c1 Prodigal CDS 1464697 1465008 . + 0 ID=BALIOE_07130;Name=hypothetical protein;locus_tag=BALIOE_07130;product=hypothetical protein;Parent=BALIOE_07130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2864 c1 Prodigal gene 1465103 1465636 . + . ID=BALIOE_07135_gene;locus_tag=BALIOE_07135 | |
| 2865 c1 Prodigal CDS 1465103 1465636 . + 0 ID=BALIOE_07135;Name=hypothetical protein;locus_tag=BALIOE_07135;product=hypothetical protein;Parent=BALIOE_07135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2866 c1 Prodigal gene 1465578 1467059 . + . ID=BALIOE_07140_gene;locus_tag=BALIOE_07140 | |
| 2867 c1 Prodigal CDS 1465578 1467059 . + 0 ID=BALIOE_07140;Name=hypothetical protein;locus_tag=BALIOE_07140;product=hypothetical protein;Parent=BALIOE_07140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2868 c1 Prodigal gene 1467067 1468224 . - . ID=BALIOE_07145_gene;locus_tag=BALIOE_07145 | |
| 2869 c1 Prodigal CDS 1467067 1468224 . - 0 ID=BALIOE_07145;Name=hypothetical protein;locus_tag=BALIOE_07145;product=hypothetical protein;Parent=BALIOE_07145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2870 c1 Prodigal gene 1468650 1470152 . + . ID=BALIOE_07150_gene;locus_tag=BALIOE_07150 | |
| 2871 c1 Prodigal CDS 1468650 1470152 . + 0 ID=BALIOE_07150;Name=hypothetical protein;locus_tag=BALIOE_07150;product=hypothetical protein;Parent=BALIOE_07150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2872 c1 Prodigal gene 1470175 1472688 . + . ID=BALIOE_07155_gene;locus_tag=BALIOE_07155 | |
| 2873 c1 Prodigal CDS 1470175 1472688 . + 0 ID=BALIOE_07155;Name=hypothetical protein;locus_tag=BALIOE_07155;product=hypothetical protein;Parent=BALIOE_07155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2874 c1 Prodigal gene 1472861 1473088 . + . ID=BALIOE_07160_gene;locus_tag=BALIOE_07160 | |
| 2875 c1 Prodigal CDS 1472861 1473088 . + 0 ID=BALIOE_07160;Name=hypothetical protein;locus_tag=BALIOE_07160;product=hypothetical protein;Parent=BALIOE_07160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2876 c1 Prodigal gene 1473089 1473463 . - . ID=BALIOE_07165_gene;locus_tag=BALIOE_07165 | |
| 2877 c1 Prodigal CDS 1473089 1473463 . - 0 ID=BALIOE_07165;Name=hypothetical protein;locus_tag=BALIOE_07165;product=hypothetical protein;Parent=BALIOE_07165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2878 c1 Prodigal gene 1473546 1474517 . - . ID=BALIOE_07170_gene;locus_tag=BALIOE_07170 | |
| 2879 c1 Prodigal CDS 1473546 1474517 . - 0 ID=BALIOE_07170;Name=hypothetical protein;locus_tag=BALIOE_07170;product=hypothetical protein;Parent=BALIOE_07170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2880 c1 Prodigal gene 1474944 1475864 . - . ID=BALIOE_07175_gene;locus_tag=BALIOE_07175 | |
| 2881 c1 Prodigal CDS 1474944 1475864 . - 0 ID=BALIOE_07175;Name=hypothetical protein;locus_tag=BALIOE_07175;product=hypothetical protein;Parent=BALIOE_07175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2882 c1 Prodigal gene 1476089 1477141 . + . ID=BALIOE_07180_gene;locus_tag=BALIOE_07180 | |
| 2883 c1 Prodigal CDS 1476089 1477141 . + 0 ID=BALIOE_07180;Name=hypothetical protein;locus_tag=BALIOE_07180;product=hypothetical protein;Parent=BALIOE_07180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2884 c1 Prodigal gene 1477183 1477758 . - . ID=BALIOE_07185_gene;locus_tag=BALIOE_07185 | |
| 2885 c1 Prodigal CDS 1477183 1477758 . - 0 ID=BALIOE_07185;Name=hypothetical protein;locus_tag=BALIOE_07185;product=hypothetical protein;Parent=BALIOE_07185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2886 c1 Prodigal gene 1477762 1478328 . - . ID=BALIOE_07190_gene;locus_tag=BALIOE_07190 | |
| 2887 c1 Prodigal CDS 1477762 1478328 . - 0 ID=BALIOE_07190;Name=hypothetical protein;locus_tag=BALIOE_07190;product=hypothetical protein;Parent=BALIOE_07190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2888 c1 Prodigal gene 1478589 1478702 . - . ID=BALIOE_07195_gene;locus_tag=BALIOE_07195 | |
| 2889 c1 Prodigal CDS 1478589 1478702 . - 0 ID=BALIOE_07195;Name=hypothetical protein;locus_tag=BALIOE_07195;product=hypothetical protein;Parent=BALIOE_07195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2890 c1 Prodigal gene 1478750 1479868 . - . ID=BALIOE_07200_gene;locus_tag=BALIOE_07200 | |
| 2891 c1 Prodigal CDS 1478750 1479868 . - 0 ID=BALIOE_07200;Name=hypothetical protein;locus_tag=BALIOE_07200;product=hypothetical protein;Parent=BALIOE_07200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2892 c1 Prodigal gene 1479983 1480237 . - . ID=BALIOE_07205_gene;locus_tag=BALIOE_07205 | |
| 2893 c1 Prodigal CDS 1479983 1480237 . - 0 ID=BALIOE_07205;Name=hypothetical protein;locus_tag=BALIOE_07205;product=hypothetical protein;Parent=BALIOE_07205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2894 c1 Prodigal gene 1480527 1480772 . - . ID=BALIOE_07210_gene;locus_tag=BALIOE_07210 | |
| 2895 c1 Prodigal CDS 1480527 1480772 . - 0 ID=BALIOE_07210;Name=hypothetical protein;locus_tag=BALIOE_07210;product=hypothetical protein;Parent=BALIOE_07210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2896 c1 Prodigal gene 1480846 1481892 . - . ID=BALIOE_07215_gene;locus_tag=BALIOE_07215 | |
| 2897 c1 Prodigal CDS 1480846 1481892 . - 0 ID=BALIOE_07215;Name=hypothetical protein;locus_tag=BALIOE_07215;product=hypothetical protein;Parent=BALIOE_07215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2898 c1 Prodigal gene 1481998 1482558 . - . ID=BALIOE_07220_gene;locus_tag=BALIOE_07220 | |
| 2899 c1 Prodigal CDS 1481998 1482558 . - 0 ID=BALIOE_07220;Name=hypothetical protein;locus_tag=BALIOE_07220;product=hypothetical protein;Parent=BALIOE_07220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2900 c1 Prodigal gene 1482692 1483339 . - . ID=BALIOE_07225_gene;locus_tag=BALIOE_07225 | |
| 2901 c1 Prodigal CDS 1482692 1483339 . - 0 ID=BALIOE_07225;Name=hypothetical protein;locus_tag=BALIOE_07225;product=hypothetical protein;Parent=BALIOE_07225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2902 c1 Prodigal gene 1483403 1484611 . - . ID=BALIOE_07230_gene;locus_tag=BALIOE_07230 | |
| 2903 c1 Prodigal CDS 1483403 1484611 . - 0 ID=BALIOE_07230;Name=hypothetical protein;locus_tag=BALIOE_07230;product=hypothetical protein;Parent=BALIOE_07230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2904 c1 Prodigal gene 1484847 1485431 . + . ID=BALIOE_07235_gene;locus_tag=BALIOE_07235 | |
| 2905 c1 Prodigal CDS 1484847 1485431 . + 0 ID=BALIOE_07235;Name=hypothetical protein;locus_tag=BALIOE_07235;product=hypothetical protein;Parent=BALIOE_07235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2906 c1 Prodigal gene 1485442 1486089 . + . ID=BALIOE_07240_gene;locus_tag=BALIOE_07240 | |
| 2907 c1 Prodigal CDS 1485442 1486089 . + 0 ID=BALIOE_07240;Name=hypothetical protein;locus_tag=BALIOE_07240;product=hypothetical protein;Parent=BALIOE_07240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2908 c1 Prodigal gene 1486091 1487014 . + . ID=BALIOE_07245_gene;locus_tag=BALIOE_07245 | |
| 2909 c1 Prodigal CDS 1486091 1487014 . + 0 ID=BALIOE_07245;Name=hypothetical protein;locus_tag=BALIOE_07245;product=hypothetical protein;Parent=BALIOE_07245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2910 c1 Prodigal gene 1487124 1488659 . + . ID=BALIOE_07250_gene;locus_tag=BALIOE_07250 | |
| 2911 c1 Prodigal CDS 1487124 1488659 . + 0 ID=BALIOE_07250;Name=hypothetical protein;locus_tag=BALIOE_07250;product=hypothetical protein;Parent=BALIOE_07250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2912 c1 Prodigal gene 1488699 1489115 . - . ID=BALIOE_07255_gene;locus_tag=BALIOE_07255 | |
| 2913 c1 Prodigal CDS 1488699 1489115 . - 0 ID=BALIOE_07255;Name=hypothetical protein;locus_tag=BALIOE_07255;product=hypothetical protein;Parent=BALIOE_07255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2914 c1 Prodigal gene 1489120 1489413 . - . ID=BALIOE_07260_gene;locus_tag=BALIOE_07260 | |
| 2915 c1 Prodigal CDS 1489120 1489413 . - 0 ID=BALIOE_07260;Name=hypothetical protein;locus_tag=BALIOE_07260;product=hypothetical protein;Parent=BALIOE_07260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2916 c1 Prodigal gene 1489489 1490148 . - . ID=BALIOE_07265_gene;locus_tag=BALIOE_07265 | |
| 2917 c1 Prodigal CDS 1489489 1490148 . - 0 ID=BALIOE_07265;Name=hypothetical protein;locus_tag=BALIOE_07265;product=hypothetical protein;Parent=BALIOE_07265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2918 c1 Prodigal gene 1490303 1490719 . + . ID=BALIOE_07270_gene;locus_tag=BALIOE_07270 | |
| 2919 c1 Prodigal CDS 1490303 1490719 . + 0 ID=BALIOE_07270;Name=hypothetical protein;locus_tag=BALIOE_07270;product=hypothetical protein;Parent=BALIOE_07270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2920 c1 Prodigal gene 1490723 1491127 . + . ID=BALIOE_07275_gene;locus_tag=BALIOE_07275 | |
| 2921 c1 Prodigal CDS 1490723 1491127 . + 0 ID=BALIOE_07275;Name=hypothetical protein;locus_tag=BALIOE_07275;product=hypothetical protein;Parent=BALIOE_07275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2922 c1 Prodigal gene 1491139 1491834 . + . ID=BALIOE_07280_gene;locus_tag=BALIOE_07280 | |
| 2923 c1 Prodigal CDS 1491139 1491834 . + 0 ID=BALIOE_07280;Name=hypothetical protein;locus_tag=BALIOE_07280;product=hypothetical protein;Parent=BALIOE_07280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2924 c1 Prodigal gene 1491859 1493064 . + . ID=BALIOE_07285_gene;locus_tag=BALIOE_07285 | |
| 2925 c1 Prodigal CDS 1491859 1493064 . + 0 ID=BALIOE_07285;Name=hypothetical protein;locus_tag=BALIOE_07285;product=hypothetical protein;Parent=BALIOE_07285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2926 c1 Prodigal gene 1493084 1493839 . + . ID=BALIOE_07290_gene;locus_tag=BALIOE_07290 | |
| 2927 c1 Prodigal CDS 1493084 1493839 . + 0 ID=BALIOE_07290;Name=hypothetical protein;locus_tag=BALIOE_07290;product=hypothetical protein;Parent=BALIOE_07290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2928 c1 Prodigal gene 1493977 1494759 . + . ID=BALIOE_07295_gene;locus_tag=BALIOE_07295 | |
| 2929 c1 Prodigal CDS 1493977 1494759 . + 0 ID=BALIOE_07295;Name=hypothetical protein;locus_tag=BALIOE_07295;product=hypothetical protein;Parent=BALIOE_07295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2930 c1 Prodigal gene 1494812 1495510 . + . ID=BALIOE_07300_gene;locus_tag=BALIOE_07300 | |
| 2931 c1 Prodigal CDS 1494812 1495510 . + 0 ID=BALIOE_07300;Name=hypothetical protein;locus_tag=BALIOE_07300;product=hypothetical protein;Parent=BALIOE_07300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2932 c1 Prodigal gene 1495522 1496619 . + . ID=BALIOE_07305_gene;locus_tag=BALIOE_07305 | |
| 2933 c1 Prodigal CDS 1495522 1496619 . + 0 ID=BALIOE_07305;Name=hypothetical protein;locus_tag=BALIOE_07305;product=hypothetical protein;Parent=BALIOE_07305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2934 c1 Prodigal gene 1496619 1497560 . + . ID=BALIOE_07310_gene;locus_tag=BALIOE_07310 | |
| 2935 c1 Prodigal CDS 1496619 1497560 . + 0 ID=BALIOE_07310;Name=hypothetical protein;locus_tag=BALIOE_07310;product=hypothetical protein;Parent=BALIOE_07310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2936 c1 Prodigal gene 1497626 1499269 . + . ID=BALIOE_07315_gene;locus_tag=BALIOE_07315 | |
| 2937 c1 Prodigal CDS 1497626 1499269 . + 0 ID=BALIOE_07315;Name=hypothetical protein;locus_tag=BALIOE_07315;product=hypothetical protein;Parent=BALIOE_07315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2938 c1 Prodigal gene 1499281 1500234 . + . ID=BALIOE_07320_gene;locus_tag=BALIOE_07320 | |
| 2939 c1 Prodigal CDS 1499281 1500234 . + 0 ID=BALIOE_07320;Name=hypothetical protein;locus_tag=BALIOE_07320;product=hypothetical protein;Parent=BALIOE_07320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2940 c1 Prodigal gene 1500429 1503614 . - . ID=BALIOE_07325_gene;locus_tag=BALIOE_07325 | |
| 2941 c1 Prodigal CDS 1500429 1503614 . - 0 ID=BALIOE_07325;Name=hypothetical protein;locus_tag=BALIOE_07325;product=hypothetical protein;Parent=BALIOE_07325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2942 c1 Prodigal gene 1504187 1505146 . + . ID=BALIOE_07330_gene;locus_tag=BALIOE_07330 | |
| 2943 c1 Prodigal CDS 1504187 1505146 . + 0 ID=BALIOE_07330;Name=hypothetical protein;locus_tag=BALIOE_07330;product=hypothetical protein;Parent=BALIOE_07330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2944 c1 Prodigal gene 1505247 1505870 . - . ID=BALIOE_07335_gene;locus_tag=BALIOE_07335 | |
| 2945 c1 Prodigal CDS 1505247 1505870 . - 0 ID=BALIOE_07335;Name=hypothetical protein;locus_tag=BALIOE_07335;product=hypothetical protein;Parent=BALIOE_07335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2946 c1 Prodigal gene 1506030 1506551 . + . ID=BALIOE_07340_gene;locus_tag=BALIOE_07340 | |
| 2947 c1 Prodigal CDS 1506030 1506551 . + 0 ID=BALIOE_07340;Name=hypothetical protein;locus_tag=BALIOE_07340;product=hypothetical protein;Parent=BALIOE_07340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2948 c1 Prodigal gene 1506603 1506776 . + . ID=BALIOE_07345_gene;locus_tag=BALIOE_07345 | |
| 2949 c1 Prodigal CDS 1506603 1506776 . + 0 ID=BALIOE_07345;Name=hypothetical protein;locus_tag=BALIOE_07345;product=hypothetical protein;Parent=BALIOE_07345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2950 c1 Prodigal gene 1506887 1507927 . + . ID=BALIOE_07350_gene;locus_tag=BALIOE_07350 | |
| 2951 c1 Prodigal CDS 1506887 1507927 . + 0 ID=BALIOE_07350;Name=hypothetical protein;locus_tag=BALIOE_07350;product=hypothetical protein;Parent=BALIOE_07350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2952 c1 Prodigal gene 1507995 1508948 . + . ID=BALIOE_07355_gene;locus_tag=BALIOE_07355 | |
| 2953 c1 Prodigal CDS 1507995 1508948 . + 0 ID=BALIOE_07355;Name=hypothetical protein;locus_tag=BALIOE_07355;product=hypothetical protein;Parent=BALIOE_07355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2954 c1 Prodigal gene 1508964 1509893 . + . ID=BALIOE_07360_gene;locus_tag=BALIOE_07360 | |
| 2955 c1 Prodigal CDS 1508964 1509893 . + 0 ID=BALIOE_07360;Name=hypothetical protein;locus_tag=BALIOE_07360;product=hypothetical protein;Parent=BALIOE_07360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2956 c1 Prodigal gene 1509906 1510640 . + . ID=BALIOE_07365_gene;locus_tag=BALIOE_07365 | |
| 2957 c1 Prodigal CDS 1509906 1510640 . + 0 ID=BALIOE_07365;Name=hypothetical protein;locus_tag=BALIOE_07365;product=hypothetical protein;Parent=BALIOE_07365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2958 c1 Prodigal gene 1510851 1511087 . + . ID=BALIOE_07370_gene;locus_tag=BALIOE_07370 | |
| 2959 c1 Prodigal CDS 1510851 1511087 . + 0 ID=BALIOE_07370;Name=hypothetical protein;locus_tag=BALIOE_07370;product=hypothetical protein;Parent=BALIOE_07370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2960 c1 Prodigal gene 1511175 1512416 . + . ID=BALIOE_07375_gene;locus_tag=BALIOE_07375 | |
| 2961 c1 Prodigal CDS 1511175 1512416 . + 0 ID=BALIOE_07375;Name=hypothetical protein;locus_tag=BALIOE_07375;product=hypothetical protein;Parent=BALIOE_07375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2962 c1 Prodigal gene 1512536 1513345 . + . ID=BALIOE_07380_gene;locus_tag=BALIOE_07380 | |
| 2963 c1 Prodigal CDS 1512536 1513345 . + 0 ID=BALIOE_07380;Name=hypothetical protein;locus_tag=BALIOE_07380;product=hypothetical protein;Parent=BALIOE_07380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2964 c1 Prodigal gene 1513348 1514370 . + . ID=BALIOE_07385_gene;locus_tag=BALIOE_07385 | |
| 2965 c1 Prodigal CDS 1513348 1514370 . + 0 ID=BALIOE_07385;Name=hypothetical protein;locus_tag=BALIOE_07385;product=hypothetical protein;Parent=BALIOE_07385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2966 c1 Prodigal gene 1514360 1515001 . + . ID=BALIOE_07390_gene;locus_tag=BALIOE_07390 | |
| 2967 c1 Prodigal CDS 1514360 1515001 . + 0 ID=BALIOE_07390;Name=hypothetical protein;locus_tag=BALIOE_07390;product=hypothetical protein;Parent=BALIOE_07390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2968 c1 Prodigal gene 1514998 1516002 . + . ID=BALIOE_07395_gene;locus_tag=BALIOE_07395 | |
| 2969 c1 Prodigal CDS 1514998 1516002 . + 0 ID=BALIOE_07395;Name=hypothetical protein;locus_tag=BALIOE_07395;product=hypothetical protein;Parent=BALIOE_07395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2970 c1 Prodigal gene 1516013 1516810 . + . ID=BALIOE_07400_gene;locus_tag=BALIOE_07400 | |
| 2971 c1 Prodigal CDS 1516013 1516810 . + 0 ID=BALIOE_07400;Name=hypothetical protein;locus_tag=BALIOE_07400;product=hypothetical protein;Parent=BALIOE_07400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2972 c1 Prodigal gene 1517105 1518538 . + . ID=BALIOE_07405_gene;locus_tag=BALIOE_07405 | |
| 2973 c1 Prodigal CDS 1517105 1518538 . + 0 ID=BALIOE_07405;Name=hypothetical protein;locus_tag=BALIOE_07405;product=hypothetical protein;Parent=BALIOE_07405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2974 c1 Prodigal gene 1518598 1520787 . - . ID=BALIOE_07410_gene;locus_tag=BALIOE_07410 | |
| 2975 c1 Prodigal CDS 1518598 1520787 . - 0 ID=BALIOE_07410;Name=hypothetical protein;locus_tag=BALIOE_07410;product=hypothetical protein;Parent=BALIOE_07410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2976 c1 Prodigal gene 1521133 1521492 . + . ID=BALIOE_07415_gene;locus_tag=BALIOE_07415 | |
| 2977 c1 Prodigal CDS 1521133 1521492 . + 0 ID=BALIOE_07415;Name=hypothetical protein;locus_tag=BALIOE_07415;product=hypothetical protein;Parent=BALIOE_07415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2978 c1 Prodigal gene 1521495 1521872 . + . ID=BALIOE_07420_gene;locus_tag=BALIOE_07420 | |
| 2979 c1 Prodigal CDS 1521495 1521872 . + 0 ID=BALIOE_07420;Name=hypothetical protein;locus_tag=BALIOE_07420;product=hypothetical protein;Parent=BALIOE_07420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2980 c1 Prodigal gene 1521886 1522527 . + . ID=BALIOE_07425_gene;locus_tag=BALIOE_07425 | |
| 2981 c1 Prodigal CDS 1521886 1522527 . + 0 ID=BALIOE_07425;Name=hypothetical protein;locus_tag=BALIOE_07425;product=hypothetical protein;Parent=BALIOE_07425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2982 c1 Prodigal gene 1522508 1523332 . + . ID=BALIOE_07430_gene;locus_tag=BALIOE_07430 | |
| 2983 c1 Prodigal CDS 1522508 1523332 . + 0 ID=BALIOE_07430;Name=hypothetical protein;locus_tag=BALIOE_07430;product=hypothetical protein;Parent=BALIOE_07430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2984 c1 Prodigal gene 1523343 1524368 . + . ID=BALIOE_07435_gene;locus_tag=BALIOE_07435 | |
| 2985 c1 Prodigal CDS 1523343 1524368 . + 0 ID=BALIOE_07435;Name=hypothetical protein;locus_tag=BALIOE_07435;product=hypothetical protein;Parent=BALIOE_07435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2986 c1 Prodigal gene 1524391 1524933 . + . ID=BALIOE_07440_gene;locus_tag=BALIOE_07440 | |
| 2987 c1 Prodigal CDS 1524391 1524933 . + 0 ID=BALIOE_07440;Name=hypothetical protein;locus_tag=BALIOE_07440;product=hypothetical protein;Parent=BALIOE_07440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2988 c1 Prodigal gene 1525333 1526637 . + . ID=BALIOE_07445_gene;locus_tag=BALIOE_07445 | |
| 2989 c1 Prodigal CDS 1525333 1526637 . + 0 ID=BALIOE_07445;Name=hypothetical protein;locus_tag=BALIOE_07445;product=hypothetical protein;Parent=BALIOE_07445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2990 c1 Prodigal gene 1526864 1527403 . + . ID=BALIOE_07450_gene;locus_tag=BALIOE_07450 | |
| 2991 c1 Prodigal CDS 1526864 1527403 . + 0 ID=BALIOE_07450;Name=hypothetical protein;locus_tag=BALIOE_07450;product=hypothetical protein;Parent=BALIOE_07450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2992 c1 Prodigal gene 1527465 1528160 . - . ID=BALIOE_07455_gene;locus_tag=BALIOE_07455 | |
| 2993 c1 Prodigal CDS 1527465 1528160 . - 0 ID=BALIOE_07455;Name=hypothetical protein;locus_tag=BALIOE_07455;product=hypothetical protein;Parent=BALIOE_07455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2994 c1 Prodigal gene 1528338 1528595 . + . ID=BALIOE_07460_gene;locus_tag=BALIOE_07460 | |
| 2995 c1 Prodigal CDS 1528338 1528595 . + 0 ID=BALIOE_07460;Name=hypothetical protein;locus_tag=BALIOE_07460;product=hypothetical protein;Parent=BALIOE_07460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2996 c1 Prodigal gene 1528678 1529637 . - . ID=BALIOE_07465_gene;locus_tag=BALIOE_07465 | |
| 2997 c1 Prodigal CDS 1528678 1529637 . - 0 ID=BALIOE_07465;Name=hypothetical protein;locus_tag=BALIOE_07465;product=hypothetical protein;Parent=BALIOE_07465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 2998 c1 Prodigal gene 1529784 1533278 . - . ID=BALIOE_07470_gene;locus_tag=BALIOE_07470 | |
| 2999 c1 Prodigal CDS 1529784 1533278 . - 0 ID=BALIOE_07470;Name=hypothetical protein;locus_tag=BALIOE_07470;product=hypothetical protein;Parent=BALIOE_07470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3000 c1 Prodigal gene 1533358 1534431 . - . ID=BALIOE_07475_gene;locus_tag=BALIOE_07475 | |
| 3001 c1 Prodigal CDS 1533358 1534431 . - 0 ID=BALIOE_07475;Name=hypothetical protein;locus_tag=BALIOE_07475;product=hypothetical protein;Parent=BALIOE_07475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3002 c1 Prodigal gene 1534693 1535892 . + . ID=BALIOE_07480_gene;locus_tag=BALIOE_07480 | |
| 3003 c1 Prodigal CDS 1534693 1535892 . + 0 ID=BALIOE_07480;Name=hypothetical protein;locus_tag=BALIOE_07480;product=hypothetical protein;Parent=BALIOE_07480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3004 c1 Prodigal gene 1535885 1536586 . + . ID=BALIOE_07485_gene;locus_tag=BALIOE_07485 | |
| 3005 c1 Prodigal CDS 1535885 1536586 . + 0 ID=BALIOE_07485;Name=hypothetical protein;locus_tag=BALIOE_07485;product=hypothetical protein;Parent=BALIOE_07485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3006 c1 Prodigal gene 1536592 1537830 . + . ID=BALIOE_07490_gene;locus_tag=BALIOE_07490 | |
| 3007 c1 Prodigal CDS 1536592 1537830 . + 0 ID=BALIOE_07490;Name=hypothetical protein;locus_tag=BALIOE_07490;product=hypothetical protein;Parent=BALIOE_07490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3008 c1 Prodigal gene 1537859 1538770 . + . ID=BALIOE_07495_gene;locus_tag=BALIOE_07495 | |
| 3009 c1 Prodigal CDS 1537859 1538770 . + 0 ID=BALIOE_07495;Name=hypothetical protein;locus_tag=BALIOE_07495;product=hypothetical protein;Parent=BALIOE_07495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3010 c1 Prodigal gene 1538786 1539607 . + . ID=BALIOE_07500_gene;locus_tag=BALIOE_07500 | |
| 3011 c1 Prodigal CDS 1538786 1539607 . + 0 ID=BALIOE_07500;Name=hypothetical protein;locus_tag=BALIOE_07500;product=hypothetical protein;Parent=BALIOE_07500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3012 c1 Prodigal gene 1539763 1540809 . - . ID=BALIOE_07505_gene;locus_tag=BALIOE_07505 | |
| 3013 c1 Prodigal CDS 1539763 1540809 . - 0 ID=BALIOE_07505;Name=hypothetical protein;locus_tag=BALIOE_07505;product=hypothetical protein;Parent=BALIOE_07505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3014 c1 Prodigal gene 1540806 1541600 . - . ID=BALIOE_07510_gene;locus_tag=BALIOE_07510 | |
| 3015 c1 Prodigal CDS 1540806 1541600 . - 0 ID=BALIOE_07510;Name=hypothetical protein;locus_tag=BALIOE_07510;product=hypothetical protein;Parent=BALIOE_07510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3016 c1 Prodigal gene 1541767 1542885 . - . ID=BALIOE_07515_gene;locus_tag=BALIOE_07515 | |
| 3017 c1 Prodigal CDS 1541767 1542885 . - 0 ID=BALIOE_07515;Name=hypothetical protein;locus_tag=BALIOE_07515;product=hypothetical protein;Parent=BALIOE_07515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3018 c1 Prodigal gene 1542854 1543123 . - . ID=BALIOE_07520_gene;locus_tag=BALIOE_07520 | |
| 3019 c1 Prodigal CDS 1542854 1543123 . - 0 ID=BALIOE_07520;Name=hypothetical protein;locus_tag=BALIOE_07520;product=hypothetical protein;Parent=BALIOE_07520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3020 c1 Prodigal gene 1543185 1543529 . - . ID=BALIOE_07525_gene;locus_tag=BALIOE_07525 | |
| 3021 c1 Prodigal CDS 1543185 1543529 . - 0 ID=BALIOE_07525;Name=hypothetical protein;locus_tag=BALIOE_07525;product=hypothetical protein;Parent=BALIOE_07525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3022 c1 Prodigal gene 1543707 1544222 . + . ID=BALIOE_07530_gene;locus_tag=BALIOE_07530 | |
| 3023 c1 Prodigal CDS 1543707 1544222 . + 0 ID=BALIOE_07530;Name=hypothetical protein;locus_tag=BALIOE_07530;product=hypothetical protein;Parent=BALIOE_07530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3024 c1 Prodigal gene 1544337 1544567 . - . ID=BALIOE_07535_gene;locus_tag=BALIOE_07535 | |
| 3025 c1 Prodigal CDS 1544337 1544567 . - 0 ID=BALIOE_07535;Name=hypothetical protein;locus_tag=BALIOE_07535;product=hypothetical protein;Parent=BALIOE_07535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3026 c1 Prodigal gene 1544805 1545281 . - . ID=BALIOE_07540_gene;locus_tag=BALIOE_07540 | |
| 3027 c1 Prodigal CDS 1544805 1545281 . - 0 ID=BALIOE_07540;Name=hypothetical protein;locus_tag=BALIOE_07540;product=hypothetical protein;Parent=BALIOE_07540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3028 c1 Prodigal gene 1545406 1545729 . + . ID=BALIOE_07545_gene;locus_tag=BALIOE_07545 | |
| 3029 c1 Prodigal CDS 1545406 1545729 . + 0 ID=BALIOE_07545;Name=hypothetical protein;locus_tag=BALIOE_07545;product=hypothetical protein;Parent=BALIOE_07545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3030 c1 Prodigal gene 1545713 1546138 . + . ID=BALIOE_07550_gene;locus_tag=BALIOE_07550 | |
| 3031 c1 Prodigal CDS 1545713 1546138 . + 0 ID=BALIOE_07550;Name=hypothetical protein;locus_tag=BALIOE_07550;product=hypothetical protein;Parent=BALIOE_07550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3032 c1 Prodigal gene 1546207 1547244 . + . ID=BALIOE_07555_gene;locus_tag=BALIOE_07555 | |
| 3033 c1 Prodigal CDS 1546207 1547244 . + 0 ID=BALIOE_07555;Name=hypothetical protein;locus_tag=BALIOE_07555;product=hypothetical protein;Parent=BALIOE_07555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3034 c1 Prodigal gene 1547276 1547698 . + . ID=BALIOE_07560_gene;locus_tag=BALIOE_07560 | |
| 3035 c1 Prodigal CDS 1547276 1547698 . + 0 ID=BALIOE_07560;Name=hypothetical protein;locus_tag=BALIOE_07560;product=hypothetical protein;Parent=BALIOE_07560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3036 c1 Prodigal gene 1547732 1548448 . + . ID=BALIOE_07565_gene;locus_tag=BALIOE_07565 | |
| 3037 c1 Prodigal CDS 1547732 1548448 . + 0 ID=BALIOE_07565;Name=hypothetical protein;locus_tag=BALIOE_07565;product=hypothetical protein;Parent=BALIOE_07565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3038 c1 Prodigal gene 1548445 1548762 . + . ID=BALIOE_07570_gene;locus_tag=BALIOE_07570 | |
| 3039 c1 Prodigal CDS 1548445 1548762 . + 0 ID=BALIOE_07570;Name=hypothetical protein;locus_tag=BALIOE_07570;product=hypothetical protein;Parent=BALIOE_07570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3040 c1 Prodigal gene 1548759 1549061 . + . ID=BALIOE_07575_gene;locus_tag=BALIOE_07575 | |
| 3041 c1 Prodigal CDS 1548759 1549061 . + 0 ID=BALIOE_07575;Name=hypothetical protein;locus_tag=BALIOE_07575;product=hypothetical protein;Parent=BALIOE_07575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3042 c1 Prodigal gene 1549051 1549368 . + . ID=BALIOE_07580_gene;locus_tag=BALIOE_07580 | |
| 3043 c1 Prodigal CDS 1549051 1549368 . + 0 ID=BALIOE_07580;Name=hypothetical protein;locus_tag=BALIOE_07580;product=hypothetical protein;Parent=BALIOE_07580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3044 c1 Prodigal gene 1549322 1549639 . + . ID=BALIOE_07585_gene;locus_tag=BALIOE_07585 | |
| 3045 c1 Prodigal CDS 1549322 1549639 . + 0 ID=BALIOE_07585;Name=hypothetical protein;locus_tag=BALIOE_07585;product=hypothetical protein;Parent=BALIOE_07585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3046 c1 Prodigal gene 1549626 1550063 . + . ID=BALIOE_07590_gene;locus_tag=BALIOE_07590 | |
| 3047 c1 Prodigal CDS 1549626 1550063 . + 0 ID=BALIOE_07590;Name=hypothetical protein;locus_tag=BALIOE_07590;product=hypothetical protein;Parent=BALIOE_07590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3048 c1 Prodigal gene 1550065 1550256 . + . ID=BALIOE_07595_gene;locus_tag=BALIOE_07595 | |
| 3049 c1 Prodigal CDS 1550065 1550256 . + 0 ID=BALIOE_07595;Name=hypothetical protein;locus_tag=BALIOE_07595;product=hypothetical protein;Parent=BALIOE_07595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3050 c1 Prodigal gene 1550259 1550846 . + . ID=BALIOE_07600_gene;locus_tag=BALIOE_07600 | |
| 3051 c1 Prodigal CDS 1550259 1550846 . + 0 ID=BALIOE_07600;Name=hypothetical protein;locus_tag=BALIOE_07600;product=hypothetical protein;Parent=BALIOE_07600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3052 c1 Prodigal gene 1550962 1551066 . + . ID=BALIOE_07605_gene;locus_tag=BALIOE_07605 | |
| 3053 c1 Prodigal CDS 1550962 1551066 . + 0 ID=BALIOE_07605;Name=hypothetical protein;locus_tag=BALIOE_07605;product=hypothetical protein;Parent=BALIOE_07605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3054 c1 Prodigal gene 1551255 1551467 . + . ID=BALIOE_07610_gene;locus_tag=BALIOE_07610 | |
| 3055 c1 Prodigal CDS 1551255 1551467 . + 0 ID=BALIOE_07610;Name=hypothetical protein;locus_tag=BALIOE_07610;product=hypothetical protein;Parent=BALIOE_07610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3056 c1 Prodigal gene 1551915 1552964 . + . ID=BALIOE_07615_gene;locus_tag=BALIOE_07615 | |
| 3057 c1 Prodigal CDS 1551915 1552964 . + 0 ID=BALIOE_07615;Name=hypothetical protein;locus_tag=BALIOE_07615;product=hypothetical protein;Parent=BALIOE_07615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3058 c1 Prodigal gene 1552977 1553351 . + . ID=BALIOE_07620_gene;locus_tag=BALIOE_07620 | |
| 3059 c1 Prodigal CDS 1552977 1553351 . + 0 ID=BALIOE_07620;Name=hypothetical protein;locus_tag=BALIOE_07620;product=hypothetical protein;Parent=BALIOE_07620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3060 c1 Prodigal gene 1553348 1554169 . + . ID=BALIOE_07625_gene;locus_tag=BALIOE_07625 | |
| 3061 c1 Prodigal CDS 1553348 1554169 . + 0 ID=BALIOE_07625;Name=hypothetical protein;locus_tag=BALIOE_07625;product=hypothetical protein;Parent=BALIOE_07625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3062 c1 Prodigal gene 1554623 1554769 . + . ID=BALIOE_07630_gene;locus_tag=BALIOE_07630 | |
| 3063 c1 Prodigal CDS 1554623 1554769 . + 0 ID=BALIOE_07630;Name=hypothetical protein;locus_tag=BALIOE_07630;product=hypothetical protein;Parent=BALIOE_07630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3064 c1 Prodigal gene 1554766 1554933 . + . ID=BALIOE_07635_gene;locus_tag=BALIOE_07635 | |
| 3065 c1 Prodigal CDS 1554766 1554933 . + 0 ID=BALIOE_07635;Name=hypothetical protein;locus_tag=BALIOE_07635;product=hypothetical protein;Parent=BALIOE_07635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3066 c1 Prodigal gene 1555248 1557185 . + . ID=BALIOE_07640_gene;locus_tag=BALIOE_07640 | |
| 3067 c1 Prodigal CDS 1555248 1557185 . + 0 ID=BALIOE_07640;Name=hypothetical protein;locus_tag=BALIOE_07640;product=hypothetical protein;Parent=BALIOE_07640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3068 c1 Prodigal gene 1557333 1557515 . + . ID=BALIOE_07645_gene;locus_tag=BALIOE_07645 | |
| 3069 c1 Prodigal CDS 1557333 1557515 . + 0 ID=BALIOE_07645;Name=hypothetical protein;locus_tag=BALIOE_07645;product=hypothetical protein;Parent=BALIOE_07645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3070 c1 Prodigal gene 1557553 1557822 . + . ID=BALIOE_07650_gene;locus_tag=BALIOE_07650 | |
| 3071 c1 Prodigal CDS 1557553 1557822 . + 0 ID=BALIOE_07650;Name=hypothetical protein;locus_tag=BALIOE_07650;product=hypothetical protein;Parent=BALIOE_07650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3072 c1 Prodigal gene 1557898 1558113 . + . ID=BALIOE_07655_gene;locus_tag=BALIOE_07655 | |
| 3073 c1 Prodigal CDS 1557898 1558113 . + 0 ID=BALIOE_07655;Name=hypothetical protein;locus_tag=BALIOE_07655;product=hypothetical protein;Parent=BALIOE_07655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3074 c1 Prodigal gene 1558118 1558462 . + . ID=BALIOE_07660_gene;locus_tag=BALIOE_07660 | |
| 3075 c1 Prodigal CDS 1558118 1558462 . + 0 ID=BALIOE_07660;Name=hypothetical protein;locus_tag=BALIOE_07660;product=hypothetical protein;Parent=BALIOE_07660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3076 c1 Prodigal gene 1558513 1559046 . + . ID=BALIOE_07665_gene;locus_tag=BALIOE_07665 | |
| 3077 c1 Prodigal CDS 1558513 1559046 . + 0 ID=BALIOE_07665;Name=hypothetical protein;locus_tag=BALIOE_07665;product=hypothetical protein;Parent=BALIOE_07665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3078 c1 Prodigal gene 1559317 1559886 . + . ID=BALIOE_07670_gene;locus_tag=BALIOE_07670 | |
| 3079 c1 Prodigal CDS 1559317 1559886 . + 0 ID=BALIOE_07670;Name=hypothetical protein;locus_tag=BALIOE_07670;product=hypothetical protein;Parent=BALIOE_07670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3080 c1 Prodigal gene 1559886 1560032 . + . ID=BALIOE_07675_gene;locus_tag=BALIOE_07675 | |
| 3081 c1 Prodigal CDS 1559886 1560032 . + 0 ID=BALIOE_07675;Name=hypothetical protein;locus_tag=BALIOE_07675;product=hypothetical protein;Parent=BALIOE_07675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3082 c1 Prodigal gene 1560040 1560507 . + . ID=BALIOE_07680_gene;locus_tag=BALIOE_07680 | |
| 3083 c1 Prodigal CDS 1560040 1560507 . + 0 ID=BALIOE_07680;Name=hypothetical protein;locus_tag=BALIOE_07680;product=hypothetical protein;Parent=BALIOE_07680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3084 c1 Prodigal gene 1560531 1560755 . + . ID=BALIOE_07685_gene;locus_tag=BALIOE_07685 | |
| 3085 c1 Prodigal CDS 1560531 1560755 . + 0 ID=BALIOE_07685;Name=hypothetical protein;locus_tag=BALIOE_07685;product=hypothetical protein;Parent=BALIOE_07685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3086 c1 Prodigal gene 1561112 1561252 . + . ID=BALIOE_07690_gene;locus_tag=BALIOE_07690 | |
| 3087 c1 Prodigal CDS 1561112 1561252 . + 0 ID=BALIOE_07690;Name=hypothetical protein;locus_tag=BALIOE_07690;product=hypothetical protein;Parent=BALIOE_07690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3088 c1 Prodigal gene 1561475 1561564 . + . ID=BALIOE_07695_gene;locus_tag=BALIOE_07695 | |
| 3089 c1 Prodigal CDS 1561475 1561564 . + 0 ID=BALIOE_07695;Name=hypothetical protein;locus_tag=BALIOE_07695;product=hypothetical protein;Parent=BALIOE_07695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3090 c1 Prodigal gene 1561609 1561974 . + . ID=BALIOE_07700_gene;locus_tag=BALIOE_07700 | |
| 3091 c1 Prodigal CDS 1561609 1561974 . + 0 ID=BALIOE_07700;Name=hypothetical protein;locus_tag=BALIOE_07700;product=hypothetical protein;Parent=BALIOE_07700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3092 c1 Prodigal gene 1562264 1562827 . + . ID=BALIOE_07705_gene;locus_tag=BALIOE_07705 | |
| 3093 c1 Prodigal CDS 1562264 1562827 . + 0 ID=BALIOE_07705;Name=hypothetical protein;locus_tag=BALIOE_07705;product=hypothetical protein;Parent=BALIOE_07705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3094 c1 Prodigal gene 1562824 1564485 . + . ID=BALIOE_07710_gene;locus_tag=BALIOE_07710 | |
| 3095 c1 Prodigal CDS 1562824 1564485 . + 0 ID=BALIOE_07710;Name=hypothetical protein;locus_tag=BALIOE_07710;product=hypothetical protein;Parent=BALIOE_07710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3096 c1 Prodigal gene 1564549 1566486 . + . ID=BALIOE_07715_gene;locus_tag=BALIOE_07715 | |
| 3097 c1 Prodigal CDS 1564549 1566486 . + 0 ID=BALIOE_07715;Name=hypothetical protein;locus_tag=BALIOE_07715;product=hypothetical protein;Parent=BALIOE_07715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3098 c1 Prodigal gene 1566531 1566752 . + . ID=BALIOE_07720_gene;locus_tag=BALIOE_07720 | |
| 3099 c1 Prodigal CDS 1566531 1566752 . + 0 ID=BALIOE_07720;Name=hypothetical protein;locus_tag=BALIOE_07720;product=hypothetical protein;Parent=BALIOE_07720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3100 c1 Prodigal gene 1566698 1569199 . + . ID=BALIOE_07725_gene;locus_tag=BALIOE_07725 | |
| 3101 c1 Prodigal CDS 1566698 1569199 . + 0 ID=BALIOE_07725;Name=hypothetical protein;locus_tag=BALIOE_07725;product=hypothetical protein;Parent=BALIOE_07725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3102 c1 Prodigal gene 1569279 1569605 . + . ID=BALIOE_07730_gene;locus_tag=BALIOE_07730 | |
| 3103 c1 Prodigal CDS 1569279 1569605 . + 0 ID=BALIOE_07730;Name=hypothetical protein;locus_tag=BALIOE_07730;product=hypothetical protein;Parent=BALIOE_07730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3104 c1 Prodigal gene 1569615 1569965 . + . ID=BALIOE_07735_gene;locus_tag=BALIOE_07735 | |
| 3105 c1 Prodigal CDS 1569615 1569965 . + 0 ID=BALIOE_07735;Name=hypothetical protein;locus_tag=BALIOE_07735;product=hypothetical protein;Parent=BALIOE_07735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3106 c1 Prodigal gene 1569962 1570408 . + . ID=BALIOE_07740_gene;locus_tag=BALIOE_07740 | |
| 3107 c1 Prodigal CDS 1569962 1570408 . + 0 ID=BALIOE_07740;Name=hypothetical protein;locus_tag=BALIOE_07740;product=hypothetical protein;Parent=BALIOE_07740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3108 c1 Prodigal gene 1570405 1570749 . + . ID=BALIOE_07745_gene;locus_tag=BALIOE_07745 | |
| 3109 c1 Prodigal CDS 1570405 1570749 . + 0 ID=BALIOE_07745;Name=hypothetical protein;locus_tag=BALIOE_07745;product=hypothetical protein;Parent=BALIOE_07745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3110 c1 Prodigal gene 1570808 1571524 . + . ID=BALIOE_07750_gene;locus_tag=BALIOE_07750 | |
| 3111 c1 Prodigal CDS 1570808 1571524 . + 0 ID=BALIOE_07750;Name=hypothetical protein;locus_tag=BALIOE_07750;product=hypothetical protein;Parent=BALIOE_07750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3112 c1 Prodigal gene 1571530 1571904 . + . ID=BALIOE_07755_gene;locus_tag=BALIOE_07755 | |
| 3113 c1 Prodigal CDS 1571530 1571904 . + 0 ID=BALIOE_07755;Name=hypothetical protein;locus_tag=BALIOE_07755;product=hypothetical protein;Parent=BALIOE_07755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3114 c1 Prodigal gene 1572000 1572209 . + . ID=BALIOE_07760_gene;locus_tag=BALIOE_07760 | |
| 3115 c1 Prodigal CDS 1572000 1572209 . + 0 ID=BALIOE_07760;Name=hypothetical protein;locus_tag=BALIOE_07760;product=hypothetical protein;Parent=BALIOE_07760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3116 c1 Prodigal gene 1572262 1575504 . + . ID=BALIOE_07765_gene;locus_tag=BALIOE_07765 | |
| 3117 c1 Prodigal CDS 1572262 1575504 . + 0 ID=BALIOE_07765;Name=hypothetical protein;locus_tag=BALIOE_07765;product=hypothetical protein;Parent=BALIOE_07765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3118 c1 Prodigal gene 1575497 1575838 . + . ID=BALIOE_07770_gene;locus_tag=BALIOE_07770 | |
| 3119 c1 Prodigal CDS 1575497 1575838 . + 0 ID=BALIOE_07770;Name=hypothetical protein;locus_tag=BALIOE_07770;product=hypothetical protein;Parent=BALIOE_07770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3120 c1 Prodigal gene 1575838 1576536 . + . ID=BALIOE_07775_gene;locus_tag=BALIOE_07775 | |
| 3121 c1 Prodigal CDS 1575838 1576536 . + 0 ID=BALIOE_07775;Name=hypothetical protein;locus_tag=BALIOE_07775;product=hypothetical protein;Parent=BALIOE_07775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3122 c1 Prodigal gene 1577330 1578208 . + . ID=BALIOE_07780_gene;locus_tag=BALIOE_07780 | |
| 3123 c1 Prodigal CDS 1577330 1578208 . + 0 ID=BALIOE_07780;Name=hypothetical protein;locus_tag=BALIOE_07780;product=hypothetical protein;Parent=BALIOE_07780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3124 c1 Prodigal gene 1578262 1578999 . + . ID=BALIOE_07785_gene;locus_tag=BALIOE_07785 | |
| 3125 c1 Prodigal CDS 1578262 1578999 . + 0 ID=BALIOE_07785;Name=hypothetical protein;locus_tag=BALIOE_07785;product=hypothetical protein;Parent=BALIOE_07785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3126 c1 Prodigal gene 1578996 1579181 . + . ID=BALIOE_07790_gene;locus_tag=BALIOE_07790 | |
| 3127 c1 Prodigal CDS 1578996 1579181 . + 0 ID=BALIOE_07790;Name=hypothetical protein;locus_tag=BALIOE_07790;product=hypothetical protein;Parent=BALIOE_07790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3128 c1 Prodigal gene 1579194 1579283 . + . ID=BALIOE_07795_gene;locus_tag=BALIOE_07795 | |
| 3129 c1 Prodigal CDS 1579194 1579283 . + 0 ID=BALIOE_07795;Name=hypothetical protein;locus_tag=BALIOE_07795;product=hypothetical protein;Parent=BALIOE_07795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3130 c1 Prodigal gene 1579303 1581651 . + . ID=BALIOE_07800_gene;locus_tag=BALIOE_07800 | |
| 3131 c1 Prodigal CDS 1579303 1581651 . + 0 ID=BALIOE_07800;Name=hypothetical protein;locus_tag=BALIOE_07800;product=hypothetical protein;Parent=BALIOE_07800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3132 c1 Prodigal gene 1582242 1585643 . + . ID=BALIOE_07805_gene;locus_tag=BALIOE_07805 | |
| 3133 c1 Prodigal CDS 1582242 1585643 . + 0 ID=BALIOE_07805;Name=hypothetical protein;locus_tag=BALIOE_07805;product=hypothetical protein;Parent=BALIOE_07805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3134 c1 Prodigal gene 1585812 1586261 . + . ID=BALIOE_07810_gene;locus_tag=BALIOE_07810 | |
| 3135 c1 Prodigal CDS 1585812 1586261 . + 0 ID=BALIOE_07810;Name=hypothetical protein;locus_tag=BALIOE_07810;product=hypothetical protein;Parent=BALIOE_07810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3136 c1 Prodigal gene 1586186 1587091 . - . ID=BALIOE_07815_gene;locus_tag=BALIOE_07815 | |
| 3137 c1 Prodigal CDS 1586186 1587091 . - 0 ID=BALIOE_07815;Name=hypothetical protein;locus_tag=BALIOE_07815;product=hypothetical protein;Parent=BALIOE_07815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3138 c1 Prodigal gene 1587253 1587414 . - . ID=BALIOE_07820_gene;locus_tag=BALIOE_07820 | |
| 3139 c1 Prodigal CDS 1587253 1587414 . - 0 ID=BALIOE_07820;Name=hypothetical protein;locus_tag=BALIOE_07820;product=hypothetical protein;Parent=BALIOE_07820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3140 c1 Prodigal gene 1587425 1587724 . + . ID=BALIOE_07825_gene;locus_tag=BALIOE_07825 | |
| 3141 c1 Prodigal CDS 1587425 1587724 . + 0 ID=BALIOE_07825;Name=hypothetical protein;locus_tag=BALIOE_07825;product=hypothetical protein;Parent=BALIOE_07825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3142 c1 Prodigal gene 1587866 1588099 . + . ID=BALIOE_07830_gene;locus_tag=BALIOE_07830 | |
| 3143 c1 Prodigal CDS 1587866 1588099 . + 0 ID=BALIOE_07830;Name=hypothetical protein;locus_tag=BALIOE_07830;product=hypothetical protein;Parent=BALIOE_07830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3144 c1 Prodigal gene 1588288 1589649 . - . ID=BALIOE_07835_gene;locus_tag=BALIOE_07835 | |
| 3145 c1 Prodigal CDS 1588288 1589649 . - 0 ID=BALIOE_07835;Name=hypothetical protein;locus_tag=BALIOE_07835;product=hypothetical protein;Parent=BALIOE_07835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3146 c1 Prodigal gene 1590013 1590876 . - . ID=BALIOE_07840_gene;locus_tag=BALIOE_07840 | |
| 3147 c1 Prodigal CDS 1590013 1590876 . - 0 ID=BALIOE_07840;Name=hypothetical protein;locus_tag=BALIOE_07840;product=hypothetical protein;Parent=BALIOE_07840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3148 c1 Prodigal gene 1590860 1591996 . - . ID=BALIOE_07845_gene;locus_tag=BALIOE_07845 | |
| 3149 c1 Prodigal CDS 1590860 1591996 . - 0 ID=BALIOE_07845;Name=hypothetical protein;locus_tag=BALIOE_07845;product=hypothetical protein;Parent=BALIOE_07845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3150 c1 Prodigal gene 1592246 1593472 . + . ID=BALIOE_07850_gene;locus_tag=BALIOE_07850 | |
| 3151 c1 Prodigal CDS 1592246 1593472 . + 0 ID=BALIOE_07850;Name=hypothetical protein;locus_tag=BALIOE_07850;product=hypothetical protein;Parent=BALIOE_07850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3152 c1 Prodigal gene 1593521 1594642 . - . ID=BALIOE_07855_gene;locus_tag=BALIOE_07855 | |
| 3153 c1 Prodigal CDS 1593521 1594642 . - 0 ID=BALIOE_07855;Name=hypothetical protein;locus_tag=BALIOE_07855;product=hypothetical protein;Parent=BALIOE_07855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3154 c1 Prodigal gene 1594891 1596120 . + . ID=BALIOE_07860_gene;locus_tag=BALIOE_07860 | |
| 3155 c1 Prodigal CDS 1594891 1596120 . + 0 ID=BALIOE_07860;Name=hypothetical protein;locus_tag=BALIOE_07860;product=hypothetical protein;Parent=BALIOE_07860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3156 c1 Prodigal gene 1596731 1597474 . + . ID=BALIOE_07865_gene;locus_tag=BALIOE_07865 | |
| 3157 c1 Prodigal CDS 1596731 1597474 . + 0 ID=BALIOE_07865;Name=hypothetical protein;locus_tag=BALIOE_07865;product=hypothetical protein;Parent=BALIOE_07865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3158 c1 Prodigal gene 1597500 1597697 . + . ID=BALIOE_07870_gene;locus_tag=BALIOE_07870 | |
| 3159 c1 Prodigal CDS 1597500 1597697 . + 0 ID=BALIOE_07870;Name=hypothetical protein;locus_tag=BALIOE_07870;product=hypothetical protein;Parent=BALIOE_07870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3160 c1 Prodigal gene 1597690 1597875 . + . ID=BALIOE_07875_gene;locus_tag=BALIOE_07875 | |
| 3161 c1 Prodigal CDS 1597690 1597875 . + 0 ID=BALIOE_07875;Name=hypothetical protein;locus_tag=BALIOE_07875;product=hypothetical protein;Parent=BALIOE_07875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3162 c1 Prodigal gene 1597875 1598066 . + . ID=BALIOE_07880_gene;locus_tag=BALIOE_07880 | |
| 3163 c1 Prodigal CDS 1597875 1598066 . + 0 ID=BALIOE_07880;Name=hypothetical protein;locus_tag=BALIOE_07880;product=hypothetical protein;Parent=BALIOE_07880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3164 c1 Prodigal gene 1598056 1598298 . + . ID=BALIOE_07885_gene;locus_tag=BALIOE_07885 | |
| 3165 c1 Prodigal CDS 1598056 1598298 . + 0 ID=BALIOE_07885;Name=hypothetical protein;locus_tag=BALIOE_07885;product=hypothetical protein;Parent=BALIOE_07885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3166 c1 Prodigal gene 1598304 1598603 . + . ID=BALIOE_07890_gene;locus_tag=BALIOE_07890 | |
| 3167 c1 Prodigal CDS 1598304 1598603 . + 0 ID=BALIOE_07890;Name=hypothetical protein;locus_tag=BALIOE_07890;product=hypothetical protein;Parent=BALIOE_07890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3168 c1 Prodigal gene 1598600 1600732 . + . ID=BALIOE_07895_gene;locus_tag=BALIOE_07895 | |
| 3169 c1 Prodigal CDS 1598600 1600732 . + 0 ID=BALIOE_07895;Name=hypothetical protein;locus_tag=BALIOE_07895;product=hypothetical protein;Parent=BALIOE_07895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3170 c1 Prodigal gene 1601103 1601354 . + . ID=BALIOE_07900_gene;locus_tag=BALIOE_07900 | |
| 3171 c1 Prodigal CDS 1601103 1601354 . + 0 ID=BALIOE_07900;Name=hypothetical protein;locus_tag=BALIOE_07900;product=hypothetical protein;Parent=BALIOE_07900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3172 c1 Prodigal gene 1601351 1601761 . + . ID=BALIOE_07905_gene;locus_tag=BALIOE_07905 | |
| 3173 c1 Prodigal CDS 1601351 1601761 . + 0 ID=BALIOE_07905;Name=hypothetical protein;locus_tag=BALIOE_07905;product=hypothetical protein;Parent=BALIOE_07905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3174 c1 Prodigal gene 1601772 1602044 . + . ID=BALIOE_07910_gene;locus_tag=BALIOE_07910 | |
| 3175 c1 Prodigal CDS 1601772 1602044 . + 0 ID=BALIOE_07910;Name=hypothetical protein;locus_tag=BALIOE_07910;product=hypothetical protein;Parent=BALIOE_07910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3176 c1 Prodigal gene 1602169 1602393 . + . ID=BALIOE_07915_gene;locus_tag=BALIOE_07915 | |
| 3177 c1 Prodigal CDS 1602169 1602393 . + 0 ID=BALIOE_07915;Name=hypothetical protein;locus_tag=BALIOE_07915;product=hypothetical protein;Parent=BALIOE_07915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3178 c1 Prodigal gene 1602686 1603843 . + . ID=BALIOE_07920_gene;locus_tag=BALIOE_07920 | |
| 3179 c1 Prodigal CDS 1602686 1603843 . + 0 ID=BALIOE_07920;Name=hypothetical protein;locus_tag=BALIOE_07920;product=hypothetical protein;Parent=BALIOE_07920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3180 c1 Prodigal gene 1603883 1604455 . + . ID=BALIOE_07925_gene;locus_tag=BALIOE_07925 | |
| 3181 c1 Prodigal CDS 1603883 1604455 . + 0 ID=BALIOE_07925;Name=hypothetical protein;locus_tag=BALIOE_07925;product=hypothetical protein;Parent=BALIOE_07925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3182 c1 Prodigal gene 1604493 1605668 . + . ID=BALIOE_07930_gene;locus_tag=BALIOE_07930 | |
| 3183 c1 Prodigal CDS 1604493 1605668 . + 0 ID=BALIOE_07930;Name=hypothetical protein;locus_tag=BALIOE_07930;product=hypothetical protein;Parent=BALIOE_07930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3184 c1 Prodigal gene 1605665 1606003 . + . ID=BALIOE_07935_gene;locus_tag=BALIOE_07935 | |
| 3185 c1 Prodigal CDS 1605665 1606003 . + 0 ID=BALIOE_07935;Name=hypothetical protein;locus_tag=BALIOE_07935;product=hypothetical protein;Parent=BALIOE_07935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3186 c1 Prodigal gene 1606000 1606296 . + . ID=BALIOE_07940_gene;locus_tag=BALIOE_07940 | |
| 3187 c1 Prodigal CDS 1606000 1606296 . + 0 ID=BALIOE_07940;Name=hypothetical protein;locus_tag=BALIOE_07940;product=hypothetical protein;Parent=BALIOE_07940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3188 c1 Prodigal gene 1606296 1606736 . + . ID=BALIOE_07945_gene;locus_tag=BALIOE_07945 | |
| 3189 c1 Prodigal CDS 1606296 1606736 . + 0 ID=BALIOE_07945;Name=hypothetical protein;locus_tag=BALIOE_07945;product=hypothetical protein;Parent=BALIOE_07945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3190 c1 Prodigal gene 1607026 1607382 . + . ID=BALIOE_07950_gene;locus_tag=BALIOE_07950 | |
| 3191 c1 Prodigal CDS 1607026 1607382 . + 0 ID=BALIOE_07950;Name=hypothetical protein;locus_tag=BALIOE_07950;product=hypothetical protein;Parent=BALIOE_07950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3192 c1 Prodigal gene 1607366 1609027 . + . ID=BALIOE_07955_gene;locus_tag=BALIOE_07955 | |
| 3193 c1 Prodigal CDS 1607366 1609027 . + 0 ID=BALIOE_07955;Name=hypothetical protein;locus_tag=BALIOE_07955;product=hypothetical protein;Parent=BALIOE_07955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3194 c1 Prodigal gene 1609041 1609322 . + . ID=BALIOE_07960_gene;locus_tag=BALIOE_07960 | |
| 3195 c1 Prodigal CDS 1609041 1609322 . + 0 ID=BALIOE_07960;Name=hypothetical protein;locus_tag=BALIOE_07960;product=hypothetical protein;Parent=BALIOE_07960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3196 c1 Prodigal gene 1610179 1611639 . - . ID=BALIOE_07965_gene;locus_tag=BALIOE_07965 | |
| 3197 c1 Prodigal CDS 1610179 1611639 . - 0 ID=BALIOE_07965;Name=hypothetical protein;locus_tag=BALIOE_07965;product=hypothetical protein;Parent=BALIOE_07965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3198 c1 Prodigal gene 1611639 1612310 . - . ID=BALIOE_07970_gene;locus_tag=BALIOE_07970 | |
| 3199 c1 Prodigal CDS 1611639 1612310 . - 0 ID=BALIOE_07970;Name=hypothetical protein;locus_tag=BALIOE_07970;product=hypothetical protein;Parent=BALIOE_07970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3200 c1 Prodigal gene 1612479 1613849 . - . ID=BALIOE_07975_gene;locus_tag=BALIOE_07975 | |
| 3201 c1 Prodigal CDS 1612479 1613849 . - 0 ID=BALIOE_07975;Name=hypothetical protein;locus_tag=BALIOE_07975;product=hypothetical protein;Parent=BALIOE_07975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3202 c1 Prodigal gene 1613853 1614494 . - . ID=BALIOE_07980_gene;locus_tag=BALIOE_07980 | |
| 3203 c1 Prodigal CDS 1613853 1614494 . - 0 ID=BALIOE_07980;Name=hypothetical protein;locus_tag=BALIOE_07980;product=hypothetical protein;Parent=BALIOE_07980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3204 c1 Prodigal gene 1614530 1615636 . - . ID=BALIOE_07985_gene;locus_tag=BALIOE_07985 | |
| 3205 c1 Prodigal CDS 1614530 1615636 . - 0 ID=BALIOE_07985;Name=hypothetical protein;locus_tag=BALIOE_07985;product=hypothetical protein;Parent=BALIOE_07985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3206 c1 Prodigal gene 1615690 1616151 . - . ID=BALIOE_07990_gene;locus_tag=BALIOE_07990 | |
| 3207 c1 Prodigal CDS 1615690 1616151 . - 0 ID=BALIOE_07990;Name=hypothetical protein;locus_tag=BALIOE_07990;product=hypothetical protein;Parent=BALIOE_07990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3208 c1 Prodigal gene 1616161 1616814 . - . ID=BALIOE_07995_gene;locus_tag=BALIOE_07995 | |
| 3209 c1 Prodigal CDS 1616161 1616814 . - 0 ID=BALIOE_07995;Name=hypothetical protein;locus_tag=BALIOE_07995;product=hypothetical protein;Parent=BALIOE_07995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3210 c1 Prodigal gene 1616986 1618236 . + . ID=BALIOE_08000_gene;locus_tag=BALIOE_08000 | |
| 3211 c1 Prodigal CDS 1616986 1618236 . + 0 ID=BALIOE_08000;Name=hypothetical protein;locus_tag=BALIOE_08000;product=hypothetical protein;Parent=BALIOE_08000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3212 c1 Prodigal gene 1618350 1619492 . - . ID=BALIOE_08005_gene;locus_tag=BALIOE_08005 | |
| 3213 c1 Prodigal CDS 1618350 1619492 . - 0 ID=BALIOE_08005;Name=hypothetical protein;locus_tag=BALIOE_08005;product=hypothetical protein;Parent=BALIOE_08005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3214 c1 Prodigal gene 1619482 1619718 . - . ID=BALIOE_08010_gene;locus_tag=BALIOE_08010 | |
| 3215 c1 Prodigal CDS 1619482 1619718 . - 0 ID=BALIOE_08010;Name=hypothetical protein;locus_tag=BALIOE_08010;product=hypothetical protein;Parent=BALIOE_08010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3216 c1 Prodigal gene 1619822 1620646 . + . ID=BALIOE_08015_gene;locus_tag=BALIOE_08015 | |
| 3217 c1 Prodigal CDS 1619822 1620646 . + 0 ID=BALIOE_08015;Name=hypothetical protein;locus_tag=BALIOE_08015;product=hypothetical protein;Parent=BALIOE_08015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3218 c1 Prodigal gene 1620643 1621344 . + . ID=BALIOE_08020_gene;locus_tag=BALIOE_08020 | |
| 3219 c1 Prodigal CDS 1620643 1621344 . + 0 ID=BALIOE_08020;Name=hypothetical protein;locus_tag=BALIOE_08020;product=hypothetical protein;Parent=BALIOE_08020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3220 c1 Prodigal gene 1621341 1621643 . + . ID=BALIOE_08025_gene;locus_tag=BALIOE_08025 | |
| 3221 c1 Prodigal CDS 1621341 1621643 . + 0 ID=BALIOE_08025;Name=hypothetical protein;locus_tag=BALIOE_08025;product=hypothetical protein;Parent=BALIOE_08025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3222 c1 Prodigal gene 1621711 1622043 . + . ID=BALIOE_08030_gene;locus_tag=BALIOE_08030 | |
| 3223 c1 Prodigal CDS 1621711 1622043 . + 0 ID=BALIOE_08030;Name=hypothetical protein;locus_tag=BALIOE_08030;product=hypothetical protein;Parent=BALIOE_08030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3224 c1 Prodigal gene 1622288 1623814 . + . ID=BALIOE_08035_gene;locus_tag=BALIOE_08035 | |
| 3225 c1 Prodigal CDS 1622288 1623814 . + 0 ID=BALIOE_08035;Name=hypothetical protein;locus_tag=BALIOE_08035;product=hypothetical protein;Parent=BALIOE_08035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3226 c1 Prodigal gene 1624316 1624771 . + . ID=BALIOE_08040_gene;locus_tag=BALIOE_08040 | |
| 3227 c1 Prodigal CDS 1624316 1624771 . + 0 ID=BALIOE_08040;Name=hypothetical protein;locus_tag=BALIOE_08040;product=hypothetical protein;Parent=BALIOE_08040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3228 c1 Prodigal gene 1624771 1624941 . + . ID=BALIOE_08045_gene;locus_tag=BALIOE_08045 | |
| 3229 c1 Prodigal CDS 1624771 1624941 . + 0 ID=BALIOE_08045;Name=hypothetical protein;locus_tag=BALIOE_08045;product=hypothetical protein;Parent=BALIOE_08045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3230 c1 Prodigal gene 1624934 1625224 . + . ID=BALIOE_08050_gene;locus_tag=BALIOE_08050 | |
| 3231 c1 Prodigal CDS 1624934 1625224 . + 0 ID=BALIOE_08050;Name=hypothetical protein;locus_tag=BALIOE_08050;product=hypothetical protein;Parent=BALIOE_08050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3232 c1 Prodigal gene 1625221 1625583 . + . ID=BALIOE_08055_gene;locus_tag=BALIOE_08055 | |
| 3233 c1 Prodigal CDS 1625221 1625583 . + 0 ID=BALIOE_08055;Name=hypothetical protein;locus_tag=BALIOE_08055;product=hypothetical protein;Parent=BALIOE_08055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3234 c1 Prodigal gene 1625580 1625720 . + . ID=BALIOE_08060_gene;locus_tag=BALIOE_08060 | |
| 3235 c1 Prodigal CDS 1625580 1625720 . + 0 ID=BALIOE_08060;Name=hypothetical protein;locus_tag=BALIOE_08060;product=hypothetical protein;Parent=BALIOE_08060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3236 c1 Prodigal gene 1625717 1626406 . + . ID=BALIOE_08065_gene;locus_tag=BALIOE_08065 | |
| 3237 c1 Prodigal CDS 1625717 1626406 . + 0 ID=BALIOE_08065;Name=hypothetical protein;locus_tag=BALIOE_08065;product=hypothetical protein;Parent=BALIOE_08065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3238 c1 Prodigal gene 1626728 1627033 . + . ID=BALIOE_08070_gene;locus_tag=BALIOE_08070 | |
| 3239 c1 Prodigal CDS 1626728 1627033 . + 0 ID=BALIOE_08070;Name=hypothetical protein;locus_tag=BALIOE_08070;product=hypothetical protein;Parent=BALIOE_08070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3240 c1 Prodigal gene 1627020 1627496 . + . ID=BALIOE_08075_gene;locus_tag=BALIOE_08075 | |
| 3241 c1 Prodigal CDS 1627020 1627496 . + 0 ID=BALIOE_08075;Name=hypothetical protein;locus_tag=BALIOE_08075;product=hypothetical protein;Parent=BALIOE_08075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3242 c1 Prodigal gene 1627493 1627954 . + . ID=BALIOE_08080_gene;locus_tag=BALIOE_08080 | |
| 3243 c1 Prodigal CDS 1627493 1627954 . + 0 ID=BALIOE_08080;Name=hypothetical protein;locus_tag=BALIOE_08080;product=hypothetical protein;Parent=BALIOE_08080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3244 c1 Prodigal gene 1627986 1628279 . - . ID=BALIOE_08085_gene;locus_tag=BALIOE_08085 | |
| 3245 c1 Prodigal CDS 1627986 1628279 . - 0 ID=BALIOE_08085;Name=hypothetical protein;locus_tag=BALIOE_08085;product=hypothetical protein;Parent=BALIOE_08085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3246 c1 Prodigal gene 1628571 1628981 . - . ID=BALIOE_08090_gene;locus_tag=BALIOE_08090 | |
| 3247 c1 Prodigal CDS 1628571 1628981 . - 0 ID=BALIOE_08090;Name=hypothetical protein;locus_tag=BALIOE_08090;product=hypothetical protein;Parent=BALIOE_08090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3248 c1 Prodigal gene 1629267 1629473 . + . ID=BALIOE_08095_gene;locus_tag=BALIOE_08095 | |
| 3249 c1 Prodigal CDS 1629267 1629473 . + 0 ID=BALIOE_08095;Name=hypothetical protein;locus_tag=BALIOE_08095;product=hypothetical protein;Parent=BALIOE_08095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3250 c1 Prodigal gene 1630221 1630766 . + . ID=BALIOE_08100_gene;locus_tag=BALIOE_08100 | |
| 3251 c1 Prodigal CDS 1630221 1630766 . + 0 ID=BALIOE_08100;Name=hypothetical protein;locus_tag=BALIOE_08100;product=hypothetical protein;Parent=BALIOE_08100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3252 c1 Prodigal gene 1630741 1632666 . + . ID=BALIOE_08105_gene;locus_tag=BALIOE_08105 | |
| 3253 c1 Prodigal CDS 1630741 1632666 . + 0 ID=BALIOE_08105;Name=hypothetical protein;locus_tag=BALIOE_08105;product=hypothetical protein;Parent=BALIOE_08105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3254 c1 Prodigal gene 1632663 1632869 . + . ID=BALIOE_08110_gene;locus_tag=BALIOE_08110 | |
| 3255 c1 Prodigal CDS 1632663 1632869 . + 0 ID=BALIOE_08110;Name=hypothetical protein;locus_tag=BALIOE_08110;product=hypothetical protein;Parent=BALIOE_08110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3256 c1 Prodigal gene 1632866 1634467 . + . ID=BALIOE_08115_gene;locus_tag=BALIOE_08115 | |
| 3257 c1 Prodigal CDS 1632866 1634467 . + 0 ID=BALIOE_08115;Name=hypothetical protein;locus_tag=BALIOE_08115;product=hypothetical protein;Parent=BALIOE_08115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3258 c1 Prodigal gene 1634448 1635767 . + . ID=BALIOE_08120_gene;locus_tag=BALIOE_08120 | |
| 3259 c1 Prodigal CDS 1634448 1635767 . + 0 ID=BALIOE_08120;Name=hypothetical protein;locus_tag=BALIOE_08120;product=hypothetical protein;Parent=BALIOE_08120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3260 c1 Prodigal gene 1635777 1636109 . + . ID=BALIOE_08125_gene;locus_tag=BALIOE_08125 | |
| 3261 c1 Prodigal CDS 1635777 1636109 . + 0 ID=BALIOE_08125;Name=hypothetical protein;locus_tag=BALIOE_08125;product=hypothetical protein;Parent=BALIOE_08125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3262 c1 Prodigal gene 1636165 1637190 . + . ID=BALIOE_08130_gene;locus_tag=BALIOE_08130 | |
| 3263 c1 Prodigal CDS 1636165 1637190 . + 0 ID=BALIOE_08130;Name=hypothetical protein;locus_tag=BALIOE_08130;product=hypothetical protein;Parent=BALIOE_08130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3264 c1 Prodigal gene 1637232 1637630 . + . ID=BALIOE_08135_gene;locus_tag=BALIOE_08135 | |
| 3265 c1 Prodigal CDS 1637232 1637630 . + 0 ID=BALIOE_08135;Name=hypothetical protein;locus_tag=BALIOE_08135;product=hypothetical protein;Parent=BALIOE_08135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3266 c1 Prodigal gene 1637642 1637995 . + . ID=BALIOE_08140_gene;locus_tag=BALIOE_08140 | |
| 3267 c1 Prodigal CDS 1637642 1637995 . + 0 ID=BALIOE_08140;Name=hypothetical protein;locus_tag=BALIOE_08140;product=hypothetical protein;Parent=BALIOE_08140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3268 c1 Prodigal gene 1638007 1638585 . + . ID=BALIOE_08145_gene;locus_tag=BALIOE_08145 | |
| 3269 c1 Prodigal CDS 1638007 1638585 . + 0 ID=BALIOE_08145;Name=hypothetical protein;locus_tag=BALIOE_08145;product=hypothetical protein;Parent=BALIOE_08145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3270 c1 Prodigal gene 1638582 1638977 . + . ID=BALIOE_08150_gene;locus_tag=BALIOE_08150 | |
| 3271 c1 Prodigal CDS 1638582 1638977 . + 0 ID=BALIOE_08150;Name=hypothetical protein;locus_tag=BALIOE_08150;product=hypothetical protein;Parent=BALIOE_08150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3272 c1 Prodigal gene 1638985 1639725 . + . ID=BALIOE_08155_gene;locus_tag=BALIOE_08155 | |
| 3273 c1 Prodigal CDS 1638985 1639725 . + 0 ID=BALIOE_08155;Name=hypothetical protein;locus_tag=BALIOE_08155;product=hypothetical protein;Parent=BALIOE_08155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3274 c1 Prodigal gene 1639741 1640163 . + . ID=BALIOE_08160_gene;locus_tag=BALIOE_08160 | |
| 3275 c1 Prodigal CDS 1639741 1640163 . + 0 ID=BALIOE_08160;Name=hypothetical protein;locus_tag=BALIOE_08160;product=hypothetical protein;Parent=BALIOE_08160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3276 c1 Prodigal gene 1640145 1640579 . + . ID=BALIOE_08165_gene;locus_tag=BALIOE_08165 | |
| 3277 c1 Prodigal CDS 1640145 1640579 . + 0 ID=BALIOE_08165;Name=hypothetical protein;locus_tag=BALIOE_08165;product=hypothetical protein;Parent=BALIOE_08165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3278 c1 Prodigal gene 1640572 1643121 . + . ID=BALIOE_08170_gene;locus_tag=BALIOE_08170 | |
| 3279 c1 Prodigal CDS 1640572 1643121 . + 0 ID=BALIOE_08170;Name=hypothetical protein;locus_tag=BALIOE_08170;product=hypothetical protein;Parent=BALIOE_08170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3280 c1 Prodigal gene 1643118 1643447 . + . ID=BALIOE_08175_gene;locus_tag=BALIOE_08175 | |
| 3281 c1 Prodigal CDS 1643118 1643447 . + 0 ID=BALIOE_08175;Name=hypothetical protein;locus_tag=BALIOE_08175;product=hypothetical protein;Parent=BALIOE_08175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3282 c1 Prodigal gene 1643447 1644145 . + . ID=BALIOE_08180_gene;locus_tag=BALIOE_08180 | |
| 3283 c1 Prodigal CDS 1643447 1644145 . + 0 ID=BALIOE_08180;Name=hypothetical protein;locus_tag=BALIOE_08180;product=hypothetical protein;Parent=BALIOE_08180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3284 c1 Prodigal gene 1644151 1644894 . + . ID=BALIOE_08185_gene;locus_tag=BALIOE_08185 | |
| 3285 c1 Prodigal CDS 1644151 1644894 . + 0 ID=BALIOE_08185;Name=hypothetical protein;locus_tag=BALIOE_08185;product=hypothetical protein;Parent=BALIOE_08185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3286 c1 Prodigal gene 1644891 1645463 . + . ID=BALIOE_08190_gene;locus_tag=BALIOE_08190 | |
| 3287 c1 Prodigal CDS 1644891 1645463 . + 0 ID=BALIOE_08190;Name=hypothetical protein;locus_tag=BALIOE_08190;product=hypothetical protein;Parent=BALIOE_08190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3288 c1 Prodigal gene 1645524 1648922 . + . ID=BALIOE_08195_gene;locus_tag=BALIOE_08195 | |
| 3289 c1 Prodigal CDS 1645524 1648922 . + 0 ID=BALIOE_08195;Name=hypothetical protein;locus_tag=BALIOE_08195;product=hypothetical protein;Parent=BALIOE_08195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3290 c1 Prodigal gene 1648989 1649588 . + . ID=BALIOE_08200_gene;locus_tag=BALIOE_08200 | |
| 3291 c1 Prodigal CDS 1648989 1649588 . + 0 ID=BALIOE_08200;Name=hypothetical protein;locus_tag=BALIOE_08200;product=hypothetical protein;Parent=BALIOE_08200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3292 c1 Prodigal gene 1649653 1652568 . + . ID=BALIOE_08205_gene;locus_tag=BALIOE_08205 | |
| 3293 c1 Prodigal CDS 1649653 1652568 . + 0 ID=BALIOE_08205;Name=hypothetical protein;locus_tag=BALIOE_08205;product=hypothetical protein;Parent=BALIOE_08205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3294 c1 Prodigal gene 1652568 1653149 . + . ID=BALIOE_08210_gene;locus_tag=BALIOE_08210 | |
| 3295 c1 Prodigal CDS 1652568 1653149 . + 0 ID=BALIOE_08210;Name=hypothetical protein;locus_tag=BALIOE_08210;product=hypothetical protein;Parent=BALIOE_08210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3296 c1 Prodigal gene 1653269 1654159 . - . ID=BALIOE_08215_gene;locus_tag=BALIOE_08215 | |
| 3297 c1 Prodigal CDS 1653269 1654159 . - 0 ID=BALIOE_08215;Name=hypothetical protein;locus_tag=BALIOE_08215;product=hypothetical protein;Parent=BALIOE_08215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3298 c1 Prodigal gene 1654178 1654684 . - . ID=BALIOE_08220_gene;locus_tag=BALIOE_08220 | |
| 3299 c1 Prodigal CDS 1654178 1654684 . - 0 ID=BALIOE_08220;Name=hypothetical protein;locus_tag=BALIOE_08220;product=hypothetical protein;Parent=BALIOE_08220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3300 c1 Prodigal gene 1654721 1655221 . - . ID=BALIOE_08225_gene;locus_tag=BALIOE_08225 | |
| 3301 c1 Prodigal CDS 1654721 1655221 . - 0 ID=BALIOE_08225;Name=hypothetical protein;locus_tag=BALIOE_08225;product=hypothetical protein;Parent=BALIOE_08225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3302 c1 Prodigal gene 1655300 1655482 . - . ID=BALIOE_08230_gene;locus_tag=BALIOE_08230 | |
| 3303 c1 Prodigal CDS 1655300 1655482 . - 0 ID=BALIOE_08230;Name=hypothetical protein;locus_tag=BALIOE_08230;product=hypothetical protein;Parent=BALIOE_08230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3304 c1 Prodigal gene 1655980 1656648 . - . ID=BALIOE_08235_gene;locus_tag=BALIOE_08235 | |
| 3305 c1 Prodigal CDS 1655980 1656648 . - 0 ID=BALIOE_08235;Name=hypothetical protein;locus_tag=BALIOE_08235;product=hypothetical protein;Parent=BALIOE_08235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3306 c1 Prodigal gene 1656705 1656953 . + . ID=BALIOE_08240_gene;locus_tag=BALIOE_08240 | |
| 3307 c1 Prodigal CDS 1656705 1656953 . + 0 ID=BALIOE_08240;Name=hypothetical protein;locus_tag=BALIOE_08240;product=hypothetical protein;Parent=BALIOE_08240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3308 c1 Prodigal gene 1657029 1657409 . + . ID=BALIOE_08245_gene;locus_tag=BALIOE_08245 | |
| 3309 c1 Prodigal CDS 1657029 1657409 . + 0 ID=BALIOE_08245;Name=hypothetical protein;locus_tag=BALIOE_08245;product=hypothetical protein;Parent=BALIOE_08245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3310 c1 Prodigal gene 1657406 1657753 . + . ID=BALIOE_08250_gene;locus_tag=BALIOE_08250 | |
| 3311 c1 Prodigal CDS 1657406 1657753 . + 0 ID=BALIOE_08250;Name=hypothetical protein;locus_tag=BALIOE_08250;product=hypothetical protein;Parent=BALIOE_08250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3312 c1 Prodigal gene 1657803 1659341 . + . ID=BALIOE_08255_gene;locus_tag=BALIOE_08255 | |
| 3313 c1 Prodigal CDS 1657803 1659341 . + 0 ID=BALIOE_08255;Name=hypothetical protein;locus_tag=BALIOE_08255;product=hypothetical protein;Parent=BALIOE_08255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3314 c1 Prodigal gene 1659644 1661128 . - . ID=BALIOE_08260_gene;locus_tag=BALIOE_08260 | |
| 3315 c1 Prodigal CDS 1659644 1661128 . - 0 ID=BALIOE_08260;Name=hypothetical protein;locus_tag=BALIOE_08260;product=hypothetical protein;Parent=BALIOE_08260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3316 c1 Prodigal gene 1661315 1662268 . - . ID=BALIOE_08265_gene;locus_tag=BALIOE_08265 | |
| 3317 c1 Prodigal CDS 1661315 1662268 . - 0 ID=BALIOE_08265;Name=hypothetical protein;locus_tag=BALIOE_08265;product=hypothetical protein;Parent=BALIOE_08265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3318 c1 Prodigal gene 1662767 1663351 . + . ID=BALIOE_08270_gene;locus_tag=BALIOE_08270 | |
| 3319 c1 Prodigal CDS 1662767 1663351 . + 0 ID=BALIOE_08270;Name=hypothetical protein;locus_tag=BALIOE_08270;product=hypothetical protein;Parent=BALIOE_08270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3320 c1 Prodigal gene 1663525 1663851 . + . ID=BALIOE_08275_gene;locus_tag=BALIOE_08275 | |
| 3321 c1 Prodigal CDS 1663525 1663851 . + 0 ID=BALIOE_08275;Name=hypothetical protein;locus_tag=BALIOE_08275;product=hypothetical protein;Parent=BALIOE_08275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3322 c1 Prodigal gene 1663851 1664738 . + . ID=BALIOE_08280_gene;locus_tag=BALIOE_08280 | |
| 3323 c1 Prodigal CDS 1663851 1664738 . + 0 ID=BALIOE_08280;Name=hypothetical protein;locus_tag=BALIOE_08280;product=hypothetical protein;Parent=BALIOE_08280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3324 c1 Prodigal gene 1664822 1665532 . + . ID=BALIOE_08285_gene;locus_tag=BALIOE_08285 | |
| 3325 c1 Prodigal CDS 1664822 1665532 . + 0 ID=BALIOE_08285;Name=hypothetical protein;locus_tag=BALIOE_08285;product=hypothetical protein;Parent=BALIOE_08285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3326 c1 Prodigal gene 1665904 1666170 . - . ID=BALIOE_08290_gene;locus_tag=BALIOE_08290 | |
| 3327 c1 Prodigal CDS 1665904 1666170 . - 0 ID=BALIOE_08290;Name=hypothetical protein;locus_tag=BALIOE_08290;product=hypothetical protein;Parent=BALIOE_08290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3328 c1 Prodigal gene 1666174 1666986 . - . ID=BALIOE_08295_gene;locus_tag=BALIOE_08295 | |
| 3329 c1 Prodigal CDS 1666174 1666986 . - 0 ID=BALIOE_08295;Name=hypothetical protein;locus_tag=BALIOE_08295;product=hypothetical protein;Parent=BALIOE_08295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3330 c1 Prodigal gene 1667010 1667705 . - . ID=BALIOE_08300_gene;locus_tag=BALIOE_08300 | |
| 3331 c1 Prodigal CDS 1667010 1667705 . - 0 ID=BALIOE_08300;Name=hypothetical protein;locus_tag=BALIOE_08300;product=hypothetical protein;Parent=BALIOE_08300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3332 c1 Prodigal gene 1668225 1668593 . + . ID=BALIOE_08305_gene;locus_tag=BALIOE_08305 | |
| 3333 c1 Prodigal CDS 1668225 1668593 . + 0 ID=BALIOE_08305;Name=hypothetical protein;locus_tag=BALIOE_08305;product=hypothetical protein;Parent=BALIOE_08305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3334 c1 Prodigal gene 1668696 1669097 . - . ID=BALIOE_08310_gene;locus_tag=BALIOE_08310 | |
| 3335 c1 Prodigal CDS 1668696 1669097 . - 0 ID=BALIOE_08310;Name=hypothetical protein;locus_tag=BALIOE_08310;product=hypothetical protein;Parent=BALIOE_08310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3336 c1 Prodigal gene 1669168 1669326 . + . ID=BALIOE_08315_gene;locus_tag=BALIOE_08315 | |
| 3337 c1 Prodigal CDS 1669168 1669326 . + 0 ID=BALIOE_08315;Name=hypothetical protein;locus_tag=BALIOE_08315;product=hypothetical protein;Parent=BALIOE_08315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3338 c1 Prodigal gene 1669338 1669631 . + . ID=BALIOE_08320_gene;locus_tag=BALIOE_08320 | |
| 3339 c1 Prodigal CDS 1669338 1669631 . + 0 ID=BALIOE_08320;Name=hypothetical protein;locus_tag=BALIOE_08320;product=hypothetical protein;Parent=BALIOE_08320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3340 c1 Prodigal gene 1669703 1670362 . + . ID=BALIOE_08325_gene;locus_tag=BALIOE_08325 | |
| 3341 c1 Prodigal CDS 1669703 1670362 . + 0 ID=BALIOE_08325;Name=hypothetical protein;locus_tag=BALIOE_08325;product=hypothetical protein;Parent=BALIOE_08325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3342 c1 Prodigal gene 1670454 1670900 . + . ID=BALIOE_08330_gene;locus_tag=BALIOE_08330 | |
| 3343 c1 Prodigal CDS 1670454 1670900 . + 0 ID=BALIOE_08330;Name=hypothetical protein;locus_tag=BALIOE_08330;product=hypothetical protein;Parent=BALIOE_08330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3344 c1 Prodigal gene 1671107 1672018 . - . ID=BALIOE_08335_gene;locus_tag=BALIOE_08335 | |
| 3345 c1 Prodigal CDS 1671107 1672018 . - 0 ID=BALIOE_08335;Name=hypothetical protein;locus_tag=BALIOE_08335;product=hypothetical protein;Parent=BALIOE_08335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3346 c1 Prodigal gene 1672391 1672810 . + . ID=BALIOE_08340_gene;locus_tag=BALIOE_08340 | |
| 3347 c1 Prodigal CDS 1672391 1672810 . + 0 ID=BALIOE_08340;Name=hypothetical protein;locus_tag=BALIOE_08340;product=hypothetical protein;Parent=BALIOE_08340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3348 c1 Prodigal gene 1672810 1674078 . + . ID=BALIOE_08345_gene;locus_tag=BALIOE_08345 | |
| 3349 c1 Prodigal CDS 1672810 1674078 . + 0 ID=BALIOE_08345;Name=hypothetical protein;locus_tag=BALIOE_08345;product=hypothetical protein;Parent=BALIOE_08345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3350 c1 Prodigal gene 1674124 1674654 . - . ID=BALIOE_08350_gene;locus_tag=BALIOE_08350 | |
| 3351 c1 Prodigal CDS 1674124 1674654 . - 0 ID=BALIOE_08350;Name=hypothetical protein;locus_tag=BALIOE_08350;product=hypothetical protein;Parent=BALIOE_08350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3352 c1 Prodigal gene 1674800 1676341 . - . ID=BALIOE_08355_gene;locus_tag=BALIOE_08355 | |
| 3353 c1 Prodigal CDS 1674800 1676341 . - 0 ID=BALIOE_08355;Name=hypothetical protein;locus_tag=BALIOE_08355;product=hypothetical protein;Parent=BALIOE_08355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3354 c1 Prodigal gene 1676563 1677282 . + . ID=BALIOE_08360_gene;locus_tag=BALIOE_08360 | |
| 3355 c1 Prodigal CDS 1676563 1677282 . + 0 ID=BALIOE_08360;Name=hypothetical protein;locus_tag=BALIOE_08360;product=hypothetical protein;Parent=BALIOE_08360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3356 c1 Prodigal gene 1677334 1678866 . - . ID=BALIOE_08365_gene;locus_tag=BALIOE_08365 | |
| 3357 c1 Prodigal CDS 1677334 1678866 . - 0 ID=BALIOE_08365;Name=hypothetical protein;locus_tag=BALIOE_08365;product=hypothetical protein;Parent=BALIOE_08365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3358 c1 Prodigal gene 1679229 1680527 . + . ID=BALIOE_08370_gene;locus_tag=BALIOE_08370 | |
| 3359 c1 Prodigal CDS 1679229 1680527 . + 0 ID=BALIOE_08370;Name=hypothetical protein;locus_tag=BALIOE_08370;product=hypothetical protein;Parent=BALIOE_08370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3360 c1 Prodigal gene 1680537 1681607 . + . ID=BALIOE_08375_gene;locus_tag=BALIOE_08375 | |
| 3361 c1 Prodigal CDS 1680537 1681607 . + 0 ID=BALIOE_08375;Name=hypothetical protein;locus_tag=BALIOE_08375;product=hypothetical protein;Parent=BALIOE_08375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3362 c1 Prodigal gene 1681999 1683735 . - . ID=BALIOE_08380_gene;locus_tag=BALIOE_08380 | |
| 3363 c1 Prodigal CDS 1681999 1683735 . - 0 ID=BALIOE_08380;Name=hypothetical protein;locus_tag=BALIOE_08380;product=hypothetical protein;Parent=BALIOE_08380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3364 c1 Prodigal gene 1683831 1684745 . - . ID=BALIOE_08385_gene;locus_tag=BALIOE_08385 | |
| 3365 c1 Prodigal CDS 1683831 1684745 . - 0 ID=BALIOE_08385;Name=hypothetical protein;locus_tag=BALIOE_08385;product=hypothetical protein;Parent=BALIOE_08385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3366 c1 Prodigal gene 1684845 1685456 . + . ID=BALIOE_08390_gene;locus_tag=BALIOE_08390 | |
| 3367 c1 Prodigal CDS 1684845 1685456 . + 0 ID=BALIOE_08390;Name=hypothetical protein;locus_tag=BALIOE_08390;product=hypothetical protein;Parent=BALIOE_08390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3368 c1 Prodigal gene 1685644 1686531 . - . ID=BALIOE_08395_gene;locus_tag=BALIOE_08395 | |
| 3369 c1 Prodigal CDS 1685644 1686531 . - 0 ID=BALIOE_08395;Name=hypothetical protein;locus_tag=BALIOE_08395;product=hypothetical protein;Parent=BALIOE_08395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3370 c1 Prodigal gene 1686531 1686857 . - . ID=BALIOE_08400_gene;locus_tag=BALIOE_08400 | |
| 3371 c1 Prodigal CDS 1686531 1686857 . - 0 ID=BALIOE_08400;Name=hypothetical protein;locus_tag=BALIOE_08400;product=hypothetical protein;Parent=BALIOE_08400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3372 c1 Prodigal gene 1686909 1687505 . - . ID=BALIOE_08405_gene;locus_tag=BALIOE_08405 | |
| 3373 c1 Prodigal CDS 1686909 1687505 . - 0 ID=BALIOE_08405;Name=hypothetical protein;locus_tag=BALIOE_08405;product=hypothetical protein;Parent=BALIOE_08405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3374 c1 Prodigal gene 1687706 1687960 . + . ID=BALIOE_08410_gene;locus_tag=BALIOE_08410 | |
| 3375 c1 Prodigal CDS 1687706 1687960 . + 0 ID=BALIOE_08410;Name=hypothetical protein;locus_tag=BALIOE_08410;product=hypothetical protein;Parent=BALIOE_08410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3376 c1 Prodigal gene 1688010 1689980 . - . ID=BALIOE_08415_gene;locus_tag=BALIOE_08415 | |
| 3377 c1 Prodigal CDS 1688010 1689980 . - 0 ID=BALIOE_08415;Name=hypothetical protein;locus_tag=BALIOE_08415;product=hypothetical protein;Parent=BALIOE_08415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3378 c1 Prodigal gene 1690006 1690860 . - . ID=BALIOE_08420_gene;locus_tag=BALIOE_08420 | |
| 3379 c1 Prodigal CDS 1690006 1690860 . - 0 ID=BALIOE_08420;Name=hypothetical protein;locus_tag=BALIOE_08420;product=hypothetical protein;Parent=BALIOE_08420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3380 c1 Prodigal gene 1691025 1691669 . - . ID=BALIOE_08425_gene;locus_tag=BALIOE_08425 | |
| 3381 c1 Prodigal CDS 1691025 1691669 . - 0 ID=BALIOE_08425;Name=hypothetical protein;locus_tag=BALIOE_08425;product=hypothetical protein;Parent=BALIOE_08425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3382 c1 Prodigal gene 1691679 1692437 . - . ID=BALIOE_08430_gene;locus_tag=BALIOE_08430 | |
| 3383 c1 Prodigal CDS 1691679 1692437 . - 0 ID=BALIOE_08430;Name=hypothetical protein;locus_tag=BALIOE_08430;product=hypothetical protein;Parent=BALIOE_08430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3384 c1 Prodigal gene 1692434 1693414 . - . ID=BALIOE_08435_gene;locus_tag=BALIOE_08435 | |
| 3385 c1 Prodigal CDS 1692434 1693414 . - 0 ID=BALIOE_08435;Name=hypothetical protein;locus_tag=BALIOE_08435;product=hypothetical protein;Parent=BALIOE_08435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3386 c1 Prodigal gene 1693414 1694436 . - . ID=BALIOE_08440_gene;locus_tag=BALIOE_08440 | |
| 3387 c1 Prodigal CDS 1693414 1694436 . - 0 ID=BALIOE_08440;Name=hypothetical protein;locus_tag=BALIOE_08440;product=hypothetical protein;Parent=BALIOE_08440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3388 c1 Prodigal gene 1694544 1694744 . - . ID=BALIOE_08445_gene;locus_tag=BALIOE_08445 | |
| 3389 c1 Prodigal CDS 1694544 1694744 . - 0 ID=BALIOE_08445;Name=hypothetical protein;locus_tag=BALIOE_08445;product=hypothetical protein;Parent=BALIOE_08445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3390 c1 Prodigal gene 1694772 1696229 . - . ID=BALIOE_08450_gene;locus_tag=BALIOE_08450 | |
| 3391 c1 Prodigal CDS 1694772 1696229 . - 0 ID=BALIOE_08450;Name=hypothetical protein;locus_tag=BALIOE_08450;product=hypothetical protein;Parent=BALIOE_08450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3392 c1 Prodigal gene 1696776 1698194 . - . ID=BALIOE_08455_gene;locus_tag=BALIOE_08455 | |
| 3393 c1 Prodigal CDS 1696776 1698194 . - 0 ID=BALIOE_08455;Name=hypothetical protein;locus_tag=BALIOE_08455;product=hypothetical protein;Parent=BALIOE_08455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3394 c1 Prodigal gene 1698205 1698837 . - . ID=BALIOE_08460_gene;locus_tag=BALIOE_08460 | |
| 3395 c1 Prodigal CDS 1698205 1698837 . - 0 ID=BALIOE_08460;Name=hypothetical protein;locus_tag=BALIOE_08460;product=hypothetical protein;Parent=BALIOE_08460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3396 c1 Prodigal gene 1698848 1699918 . - . ID=BALIOE_08465_gene;locus_tag=BALIOE_08465 | |
| 3397 c1 Prodigal CDS 1698848 1699918 . - 0 ID=BALIOE_08465;Name=hypothetical protein;locus_tag=BALIOE_08465;product=hypothetical protein;Parent=BALIOE_08465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3398 c1 Prodigal gene 1700253 1701896 . - . ID=BALIOE_08470_gene;locus_tag=BALIOE_08470 | |
| 3399 c1 Prodigal CDS 1700253 1701896 . - 0 ID=BALIOE_08470;Name=hypothetical protein;locus_tag=BALIOE_08470;product=hypothetical protein;Parent=BALIOE_08470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3400 c1 Prodigal gene 1702740 1703831 . - . ID=BALIOE_08475_gene;locus_tag=BALIOE_08475 | |
| 3401 c1 Prodigal CDS 1702740 1703831 . - 0 ID=BALIOE_08475;Name=hypothetical protein;locus_tag=BALIOE_08475;product=hypothetical protein;Parent=BALIOE_08475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3402 c1 Prodigal gene 1703948 1704532 . - . ID=BALIOE_08480_gene;locus_tag=BALIOE_08480 | |
| 3403 c1 Prodigal CDS 1703948 1704532 . - 0 ID=BALIOE_08480;Name=hypothetical protein;locus_tag=BALIOE_08480;product=hypothetical protein;Parent=BALIOE_08480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3404 c1 Prodigal gene 1704810 1705088 . + . ID=BALIOE_08485_gene;locus_tag=BALIOE_08485 | |
| 3405 c1 Prodigal CDS 1704810 1705088 . + 0 ID=BALIOE_08485;Name=hypothetical protein;locus_tag=BALIOE_08485;product=hypothetical protein;Parent=BALIOE_08485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3406 c1 Prodigal gene 1705143 1706795 . - . ID=BALIOE_08490_gene;locus_tag=BALIOE_08490 | |
| 3407 c1 Prodigal CDS 1705143 1706795 . - 0 ID=BALIOE_08490;Name=hypothetical protein;locus_tag=BALIOE_08490;product=hypothetical protein;Parent=BALIOE_08490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3408 c1 Prodigal gene 1706947 1707960 . - . ID=BALIOE_08495_gene;locus_tag=BALIOE_08495 | |
| 3409 c1 Prodigal CDS 1706947 1707960 . - 0 ID=BALIOE_08495;Name=hypothetical protein;locus_tag=BALIOE_08495;product=hypothetical protein;Parent=BALIOE_08495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3410 c1 Prodigal gene 1708045 1708896 . - . ID=BALIOE_08500_gene;locus_tag=BALIOE_08500 | |
| 3411 c1 Prodigal CDS 1708045 1708896 . - 0 ID=BALIOE_08500;Name=hypothetical protein;locus_tag=BALIOE_08500;product=hypothetical protein;Parent=BALIOE_08500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3412 c1 Prodigal gene 1708896 1709519 . - . ID=BALIOE_08505_gene;locus_tag=BALIOE_08505 | |
| 3413 c1 Prodigal CDS 1708896 1709519 . - 0 ID=BALIOE_08505;Name=hypothetical protein;locus_tag=BALIOE_08505;product=hypothetical protein;Parent=BALIOE_08505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3414 c1 Prodigal gene 1709733 1710989 . + . ID=BALIOE_08510_gene;locus_tag=BALIOE_08510 | |
| 3415 c1 Prodigal CDS 1709733 1710989 . + 0 ID=BALIOE_08510;Name=hypothetical protein;locus_tag=BALIOE_08510;product=hypothetical protein;Parent=BALIOE_08510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3416 c1 Prodigal gene 1711031 1712113 . + . ID=BALIOE_08515_gene;locus_tag=BALIOE_08515 | |
| 3417 c1 Prodigal CDS 1711031 1712113 . + 0 ID=BALIOE_08515;Name=hypothetical protein;locus_tag=BALIOE_08515;product=hypothetical protein;Parent=BALIOE_08515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3418 c1 Prodigal gene 1712113 1712946 . + . ID=BALIOE_08520_gene;locus_tag=BALIOE_08520 | |
| 3419 c1 Prodigal CDS 1712113 1712946 . + 0 ID=BALIOE_08520;Name=hypothetical protein;locus_tag=BALIOE_08520;product=hypothetical protein;Parent=BALIOE_08520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3420 c1 Prodigal gene 1712943 1713335 . + . ID=BALIOE_08525_gene;locus_tag=BALIOE_08525 | |
| 3421 c1 Prodigal CDS 1712943 1713335 . + 0 ID=BALIOE_08525;Name=hypothetical protein;locus_tag=BALIOE_08525;product=hypothetical protein;Parent=BALIOE_08525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3422 c1 Prodigal gene 1713339 1714148 . + . ID=BALIOE_08530_gene;locus_tag=BALIOE_08530 | |
| 3423 c1 Prodigal CDS 1713339 1714148 . + 0 ID=BALIOE_08530;Name=hypothetical protein;locus_tag=BALIOE_08530;product=hypothetical protein;Parent=BALIOE_08530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3424 c1 Prodigal gene 1714184 1715038 . + . ID=BALIOE_08535_gene;locus_tag=BALIOE_08535 | |
| 3425 c1 Prodigal CDS 1714184 1715038 . + 0 ID=BALIOE_08535;Name=hypothetical protein;locus_tag=BALIOE_08535;product=hypothetical protein;Parent=BALIOE_08535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3426 c1 Prodigal gene 1715186 1715293 . - . ID=BALIOE_08540_gene;locus_tag=BALIOE_08540 | |
| 3427 c1 Prodigal CDS 1715186 1715293 . - 0 ID=BALIOE_08540;Name=hypothetical protein;locus_tag=BALIOE_08540;product=hypothetical protein;Parent=BALIOE_08540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3428 c1 Prodigal gene 1715722 1715829 . - . ID=BALIOE_08545_gene;locus_tag=BALIOE_08545 | |
| 3429 c1 Prodigal CDS 1715722 1715829 . - 0 ID=BALIOE_08545;Name=hypothetical protein;locus_tag=BALIOE_08545;product=hypothetical protein;Parent=BALIOE_08545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3430 c1 Prodigal gene 1716228 1717328 . - . ID=BALIOE_08550_gene;locus_tag=BALIOE_08550 | |
| 3431 c1 Prodigal CDS 1716228 1717328 . - 0 ID=BALIOE_08550;Name=hypothetical protein;locus_tag=BALIOE_08550;product=hypothetical protein;Parent=BALIOE_08550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3432 c1 Prodigal gene 1717598 1717828 . + . ID=BALIOE_08555_gene;locus_tag=BALIOE_08555 | |
| 3433 c1 Prodigal CDS 1717598 1717828 . + 0 ID=BALIOE_08555;Name=hypothetical protein;locus_tag=BALIOE_08555;product=hypothetical protein;Parent=BALIOE_08555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3434 c1 Prodigal gene 1717965 1718684 . + . ID=BALIOE_08560_gene;locus_tag=BALIOE_08560 | |
| 3435 c1 Prodigal CDS 1717965 1718684 . + 0 ID=BALIOE_08560;Name=hypothetical protein;locus_tag=BALIOE_08560;product=hypothetical protein;Parent=BALIOE_08560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3436 c1 Prodigal gene 1718728 1719081 . - . ID=BALIOE_08565_gene;locus_tag=BALIOE_08565 | |
| 3437 c1 Prodigal CDS 1718728 1719081 . - 0 ID=BALIOE_08565;Name=hypothetical protein;locus_tag=BALIOE_08565;product=hypothetical protein;Parent=BALIOE_08565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3438 c1 Prodigal gene 1719231 1720661 . + . ID=BALIOE_08570_gene;locus_tag=BALIOE_08570 | |
| 3439 c1 Prodigal CDS 1719231 1720661 . + 0 ID=BALIOE_08570;Name=hypothetical protein;locus_tag=BALIOE_08570;product=hypothetical protein;Parent=BALIOE_08570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3440 c1 Prodigal gene 1720662 1721312 . - . ID=BALIOE_08575_gene;locus_tag=BALIOE_08575 | |
| 3441 c1 Prodigal CDS 1720662 1721312 . - 0 ID=BALIOE_08575;Name=hypothetical protein;locus_tag=BALIOE_08575;product=hypothetical protein;Parent=BALIOE_08575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3442 c1 Prodigal gene 1721305 1723101 . - . ID=BALIOE_08580_gene;locus_tag=BALIOE_08580 | |
| 3443 c1 Prodigal CDS 1721305 1723101 . - 0 ID=BALIOE_08580;Name=hypothetical protein;locus_tag=BALIOE_08580;product=hypothetical protein;Parent=BALIOE_08580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3444 c1 Prodigal gene 1723127 1723345 . + . ID=BALIOE_08585_gene;locus_tag=BALIOE_08585 | |
| 3445 c1 Prodigal CDS 1723127 1723345 . + 0 ID=BALIOE_08585;Name=hypothetical protein;locus_tag=BALIOE_08585;product=hypothetical protein;Parent=BALIOE_08585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3446 c1 Prodigal gene 1723440 1724831 . + . ID=BALIOE_08590_gene;locus_tag=BALIOE_08590 | |
| 3447 c1 Prodigal CDS 1723440 1724831 . + 0 ID=BALIOE_08590;Name=hypothetical protein;locus_tag=BALIOE_08590;product=hypothetical protein;Parent=BALIOE_08590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3448 c1 Prodigal gene 1725224 1728967 . + . ID=BALIOE_08595_gene;locus_tag=BALIOE_08595 | |
| 3449 c1 Prodigal CDS 1725224 1728967 . + 0 ID=BALIOE_08595;Name=hypothetical protein;locus_tag=BALIOE_08595;product=hypothetical protein;Parent=BALIOE_08595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3450 c1 Prodigal gene 1728964 1730502 . + . ID=BALIOE_08600_gene;locus_tag=BALIOE_08600 | |
| 3451 c1 Prodigal CDS 1728964 1730502 . + 0 ID=BALIOE_08600;Name=hypothetical protein;locus_tag=BALIOE_08600;product=hypothetical protein;Parent=BALIOE_08600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3452 c1 Prodigal gene 1730499 1731209 . + . ID=BALIOE_08605_gene;locus_tag=BALIOE_08605 | |
| 3453 c1 Prodigal CDS 1730499 1731209 . + 0 ID=BALIOE_08605;Name=hypothetical protein;locus_tag=BALIOE_08605;product=hypothetical protein;Parent=BALIOE_08605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3454 c1 Prodigal gene 1731209 1731886 . + . ID=BALIOE_08610_gene;locus_tag=BALIOE_08610 | |
| 3455 c1 Prodigal CDS 1731209 1731886 . + 0 ID=BALIOE_08610;Name=hypothetical protein;locus_tag=BALIOE_08610;product=hypothetical protein;Parent=BALIOE_08610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3456 c1 tRNAscan-SE gene 1732426 1732510 . - . ID=BALIOE_08615_gene;locus_tag=BALIOE_08615;gene=Tyr_trna | |
| 3457 c1 tRNAscan-SE tRNA 1732426 1732510 . - . ID=BALIOE_08615;Name=tRNA-Tyr;locus_tag=BALIOE_08615;product=tRNA-Tyr;gene=Tyr_trna;Parent=BALIOE_08615_gene;inference=profile:tRNAscan:2.0;Note=SO:0000272 | |
| 3458 c1 tRNAscan-SE gene 1732720 1732804 . - . ID=BALIOE_08620_gene;locus_tag=BALIOE_08620;gene=Tyr_trna | |
| 3459 c1 tRNAscan-SE tRNA 1732720 1732804 . - . ID=BALIOE_08620;Name=tRNA-Tyr;locus_tag=BALIOE_08620;product=tRNA-Tyr;gene=Tyr_trna;Parent=BALIOE_08620_gene;inference=profile:tRNAscan:2.0;Note=SO:0000272 | |
| 3460 c1 Prodigal gene 1732964 1733806 . - . ID=BALIOE_08625_gene;locus_tag=BALIOE_08625 | |
| 3461 c1 Prodigal CDS 1732964 1733806 . - 0 ID=BALIOE_08625;Name=hypothetical protein;locus_tag=BALIOE_08625;product=hypothetical protein;Parent=BALIOE_08625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3462 c1 Prodigal gene 1733856 1734314 . - . ID=BALIOE_08630_gene;locus_tag=BALIOE_08630 | |
| 3463 c1 Prodigal CDS 1733856 1734314 . - 0 ID=BALIOE_08630;Name=hypothetical protein;locus_tag=BALIOE_08630;product=hypothetical protein;Parent=BALIOE_08630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3464 c1 Prodigal gene 1734388 1735332 . + . ID=BALIOE_08635_gene;locus_tag=BALIOE_08635 | |
| 3465 c1 Prodigal CDS 1734388 1735332 . + 0 ID=BALIOE_08635;Name=hypothetical protein;locus_tag=BALIOE_08635;product=hypothetical protein;Parent=BALIOE_08635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3466 c1 Prodigal gene 1735424 1736437 . + . ID=BALIOE_08640_gene;locus_tag=BALIOE_08640 | |
| 3467 c1 Prodigal CDS 1735424 1736437 . + 0 ID=BALIOE_08640;Name=hypothetical protein;locus_tag=BALIOE_08640;product=hypothetical protein;Parent=BALIOE_08640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3468 c1 Prodigal gene 1736639 1737547 . + . ID=BALIOE_08645_gene;locus_tag=BALIOE_08645 | |
| 3469 c1 Prodigal CDS 1736639 1737547 . + 0 ID=BALIOE_08645;Name=hypothetical protein;locus_tag=BALIOE_08645;product=hypothetical protein;Parent=BALIOE_08645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3470 c1 Prodigal gene 1737691 1738104 . - . ID=BALIOE_08650_gene;locus_tag=BALIOE_08650 | |
| 3471 c1 Prodigal CDS 1737691 1738104 . - 0 ID=BALIOE_08650;Name=hypothetical protein;locus_tag=BALIOE_08650;product=hypothetical protein;Parent=BALIOE_08650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3472 c1 Prodigal gene 1738708 1739325 . + . ID=BALIOE_08655_gene;locus_tag=BALIOE_08655 | |
| 3473 c1 Prodigal CDS 1738708 1739325 . + 0 ID=BALIOE_08655;Name=hypothetical protein;locus_tag=BALIOE_08655;product=hypothetical protein;Parent=BALIOE_08655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3474 c1 Prodigal gene 1739626 1742301 . - . ID=BALIOE_08660_gene;locus_tag=BALIOE_08660 | |
| 3475 c1 Prodigal CDS 1739626 1742301 . - 0 ID=BALIOE_08660;Name=hypothetical protein;locus_tag=BALIOE_08660;product=hypothetical protein;Parent=BALIOE_08660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3476 c1 Prodigal gene 1742778 1743425 . + . ID=BALIOE_08665_gene;locus_tag=BALIOE_08665 | |
| 3477 c1 Prodigal CDS 1742778 1743425 . + 0 ID=BALIOE_08665;Name=hypothetical protein;locus_tag=BALIOE_08665;product=hypothetical protein;Parent=BALIOE_08665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3478 c1 Prodigal gene 1743452 1743607 . + . ID=BALIOE_08670_gene;locus_tag=BALIOE_08670 | |
| 3479 c1 Prodigal CDS 1743452 1743607 . + 0 ID=BALIOE_08670;Name=hypothetical protein;locus_tag=BALIOE_08670;product=hypothetical protein;Parent=BALIOE_08670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3480 c1 Prodigal gene 1743583 1743744 . - . ID=BALIOE_08675_gene;locus_tag=BALIOE_08675 | |
| 3481 c1 Prodigal CDS 1743583 1743744 . - 0 ID=BALIOE_08675;Name=hypothetical protein;locus_tag=BALIOE_08675;product=hypothetical protein;Parent=BALIOE_08675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3482 c1 Prodigal gene 1744118 1745794 . + . ID=BALIOE_08680_gene;locus_tag=BALIOE_08680 | |
| 3483 c1 Prodigal CDS 1744118 1745794 . + 0 ID=BALIOE_08680;Name=hypothetical protein;locus_tag=BALIOE_08680;product=hypothetical protein;Parent=BALIOE_08680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3484 c1 Prodigal gene 1745880 1746800 . + . ID=BALIOE_08685_gene;locus_tag=BALIOE_08685 | |
| 3485 c1 Prodigal CDS 1745880 1746800 . + 0 ID=BALIOE_08685;Name=hypothetical protein;locus_tag=BALIOE_08685;product=hypothetical protein;Parent=BALIOE_08685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3486 c1 Prodigal gene 1746815 1747723 . + . ID=BALIOE_08690_gene;locus_tag=BALIOE_08690 | |
| 3487 c1 Prodigal CDS 1746815 1747723 . + 0 ID=BALIOE_08690;Name=hypothetical protein;locus_tag=BALIOE_08690;product=hypothetical protein;Parent=BALIOE_08690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3488 c1 Prodigal gene 1747735 1748748 . + . ID=BALIOE_08695_gene;locus_tag=BALIOE_08695 | |
| 3489 c1 Prodigal CDS 1747735 1748748 . + 0 ID=BALIOE_08695;Name=hypothetical protein;locus_tag=BALIOE_08695;product=hypothetical protein;Parent=BALIOE_08695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3490 c1 Prodigal gene 1748745 1749749 . + . ID=BALIOE_08700_gene;locus_tag=BALIOE_08700 | |
| 3491 c1 Prodigal CDS 1748745 1749749 . + 0 ID=BALIOE_08700;Name=hypothetical protein;locus_tag=BALIOE_08700;product=hypothetical protein;Parent=BALIOE_08700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3492 c1 Prodigal gene 1749802 1750131 . - . ID=BALIOE_08705_gene;locus_tag=BALIOE_08705 | |
| 3493 c1 Prodigal CDS 1749802 1750131 . - 0 ID=BALIOE_08705;Name=hypothetical protein;locus_tag=BALIOE_08705;product=hypothetical protein;Parent=BALIOE_08705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3494 c1 Prodigal gene 1750166 1751626 . - . ID=BALIOE_08710_gene;locus_tag=BALIOE_08710 | |
| 3495 c1 Prodigal CDS 1750166 1751626 . - 0 ID=BALIOE_08710;Name=hypothetical protein;locus_tag=BALIOE_08710;product=hypothetical protein;Parent=BALIOE_08710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3496 c1 Prodigal gene 1751997 1753250 . - . ID=BALIOE_08715_gene;locus_tag=BALIOE_08715 | |
| 3497 c1 Prodigal CDS 1751997 1753250 . - 0 ID=BALIOE_08715;Name=hypothetical protein;locus_tag=BALIOE_08715;product=hypothetical protein;Parent=BALIOE_08715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3498 c1 Prodigal gene 1753551 1753847 . - . ID=BALIOE_08720_gene;locus_tag=BALIOE_08720 | |
| 3499 c1 Prodigal CDS 1753551 1753847 . - 0 ID=BALIOE_08720;Name=hypothetical protein;locus_tag=BALIOE_08720;product=hypothetical protein;Parent=BALIOE_08720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3500 c1 Prodigal gene 1754071 1754790 . + . ID=BALIOE_08725_gene;locus_tag=BALIOE_08725 | |
| 3501 c1 Prodigal CDS 1754071 1754790 . + 0 ID=BALIOE_08725;Name=hypothetical protein;locus_tag=BALIOE_08725;product=hypothetical protein;Parent=BALIOE_08725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3502 c1 Prodigal gene 1754830 1755228 . - . ID=BALIOE_08730_gene;locus_tag=BALIOE_08730 | |
| 3503 c1 Prodigal CDS 1754830 1755228 . - 0 ID=BALIOE_08730;Name=hypothetical protein;locus_tag=BALIOE_08730;product=hypothetical protein;Parent=BALIOE_08730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3504 c1 Prodigal gene 1755333 1755872 . - . ID=BALIOE_08735_gene;locus_tag=BALIOE_08735 | |
| 3505 c1 Prodigal CDS 1755333 1755872 . - 0 ID=BALIOE_08735;Name=hypothetical protein;locus_tag=BALIOE_08735;product=hypothetical protein;Parent=BALIOE_08735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3506 c1 Prodigal gene 1755902 1756645 . - . ID=BALIOE_08740_gene;locus_tag=BALIOE_08740 | |
| 3507 c1 Prodigal CDS 1755902 1756645 . - 0 ID=BALIOE_08740;Name=hypothetical protein;locus_tag=BALIOE_08740;product=hypothetical protein;Parent=BALIOE_08740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3508 c1 Prodigal gene 1757002 1757640 . + . ID=BALIOE_08745_gene;locus_tag=BALIOE_08745 | |
| 3509 c1 Prodigal CDS 1757002 1757640 . + 0 ID=BALIOE_08745;Name=hypothetical protein;locus_tag=BALIOE_08745;product=hypothetical protein;Parent=BALIOE_08745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3510 c1 Prodigal gene 1757686 1758816 . - . ID=BALIOE_08750_gene;locus_tag=BALIOE_08750 | |
| 3511 c1 Prodigal CDS 1757686 1758816 . - 0 ID=BALIOE_08750;Name=hypothetical protein;locus_tag=BALIOE_08750;product=hypothetical protein;Parent=BALIOE_08750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3512 c1 Prodigal gene 1759107 1761578 . - . ID=BALIOE_08755_gene;locus_tag=BALIOE_08755 | |
| 3513 c1 Prodigal CDS 1759107 1761578 . - 0 ID=BALIOE_08755;Name=hypothetical protein;locus_tag=BALIOE_08755;product=hypothetical protein;Parent=BALIOE_08755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3514 c1 Prodigal gene 1761671 1761862 . - . ID=BALIOE_08760_gene;locus_tag=BALIOE_08760 | |
| 3515 c1 Prodigal CDS 1761671 1761862 . - 0 ID=BALIOE_08760;Name=hypothetical protein;locus_tag=BALIOE_08760;product=hypothetical protein;Parent=BALIOE_08760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3516 c1 Prodigal gene 1761859 1762047 . - . ID=BALIOE_08765_gene;locus_tag=BALIOE_08765 | |
| 3517 c1 Prodigal CDS 1761859 1762047 . - 0 ID=BALIOE_08765;Name=hypothetical protein;locus_tag=BALIOE_08765;product=hypothetical protein;Parent=BALIOE_08765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3518 c1 Prodigal gene 1762521 1762754 . + . ID=BALIOE_08770_gene;locus_tag=BALIOE_08770 | |
| 3519 c1 Prodigal CDS 1762521 1762754 . + 0 ID=BALIOE_08770;Name=hypothetical protein;locus_tag=BALIOE_08770;product=hypothetical protein;Parent=BALIOE_08770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3520 c1 Prodigal gene 1762732 1763139 . - . ID=BALIOE_08775_gene;locus_tag=BALIOE_08775 | |
| 3521 c1 Prodigal CDS 1762732 1763139 . - 0 ID=BALIOE_08775;Name=hypothetical protein;locus_tag=BALIOE_08775;product=hypothetical protein;Parent=BALIOE_08775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3522 c1 Prodigal gene 1763162 1763380 . - . ID=BALIOE_08780_gene;locus_tag=BALIOE_08780 | |
| 3523 c1 Prodigal CDS 1763162 1763380 . - 0 ID=BALIOE_08780;Name=hypothetical protein;locus_tag=BALIOE_08780;product=hypothetical protein;Parent=BALIOE_08780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3524 c1 Prodigal gene 1763453 1763752 . - . ID=BALIOE_08785_gene;locus_tag=BALIOE_08785 | |
| 3525 c1 Prodigal CDS 1763453 1763752 . - 0 ID=BALIOE_08785;Name=hypothetical protein;locus_tag=BALIOE_08785;product=hypothetical protein;Parent=BALIOE_08785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3526 c1 Prodigal gene 1764016 1764423 . - . ID=BALIOE_08790_gene;locus_tag=BALIOE_08790 | |
| 3527 c1 Prodigal CDS 1764016 1764423 . - 0 ID=BALIOE_08790;Name=hypothetical protein;locus_tag=BALIOE_08790;product=hypothetical protein;Parent=BALIOE_08790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3528 c1 Prodigal gene 1764500 1764727 . + . ID=BALIOE_08795_gene;locus_tag=BALIOE_08795 | |
| 3529 c1 Prodigal CDS 1764500 1764727 . + 0 ID=BALIOE_08795;Name=hypothetical protein;locus_tag=BALIOE_08795;product=hypothetical protein;Parent=BALIOE_08795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3530 c1 Prodigal gene 1764711 1765262 . + . ID=BALIOE_08800_gene;locus_tag=BALIOE_08800 | |
| 3531 c1 Prodigal CDS 1764711 1765262 . + 0 ID=BALIOE_08800;Name=hypothetical protein;locus_tag=BALIOE_08800;product=hypothetical protein;Parent=BALIOE_08800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3532 c1 Prodigal gene 1765234 1766274 . + . ID=BALIOE_08805_gene;locus_tag=BALIOE_08805 | |
| 3533 c1 Prodigal CDS 1765234 1766274 . + 0 ID=BALIOE_08805;Name=hypothetical protein;locus_tag=BALIOE_08805;product=hypothetical protein;Parent=BALIOE_08805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3534 c1 Prodigal gene 1766306 1766728 . + . ID=BALIOE_08810_gene;locus_tag=BALIOE_08810 | |
| 3535 c1 Prodigal CDS 1766306 1766728 . + 0 ID=BALIOE_08810;Name=hypothetical protein;locus_tag=BALIOE_08810;product=hypothetical protein;Parent=BALIOE_08810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3536 c1 Prodigal gene 1766915 1767496 . + . ID=BALIOE_08815_gene;locus_tag=BALIOE_08815 | |
| 3537 c1 Prodigal CDS 1766915 1767496 . + 0 ID=BALIOE_08815;Name=hypothetical protein;locus_tag=BALIOE_08815;product=hypothetical protein;Parent=BALIOE_08815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3538 c1 Prodigal gene 1767493 1767657 . + . ID=BALIOE_08820_gene;locus_tag=BALIOE_08820 | |
| 3539 c1 Prodigal CDS 1767493 1767657 . + 0 ID=BALIOE_08820;Name=hypothetical protein;locus_tag=BALIOE_08820;product=hypothetical protein;Parent=BALIOE_08820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3540 c1 Prodigal gene 1768356 1769114 . + . ID=BALIOE_08825_gene;locus_tag=BALIOE_08825 | |
| 3541 c1 Prodigal CDS 1768356 1769114 . + 0 ID=BALIOE_08825;Name=hypothetical protein;locus_tag=BALIOE_08825;product=hypothetical protein;Parent=BALIOE_08825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3542 c1 Prodigal gene 1769393 1769605 . + . ID=BALIOE_08830_gene;locus_tag=BALIOE_08830 | |
| 3543 c1 Prodigal CDS 1769393 1769605 . + 0 ID=BALIOE_08830;Name=hypothetical protein;locus_tag=BALIOE_08830;product=hypothetical protein;Parent=BALIOE_08830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3544 c1 Prodigal gene 1769826 1770083 . + . ID=BALIOE_08835_gene;locus_tag=BALIOE_08835 | |
| 3545 c1 Prodigal CDS 1769826 1770083 . + 0 ID=BALIOE_08835;Name=hypothetical protein;locus_tag=BALIOE_08835;product=hypothetical protein;Parent=BALIOE_08835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3546 c1 Prodigal gene 1770153 1770431 . + . ID=BALIOE_08840_gene;locus_tag=BALIOE_08840 | |
| 3547 c1 Prodigal CDS 1770153 1770431 . + 0 ID=BALIOE_08840;Name=hypothetical protein;locus_tag=BALIOE_08840;product=hypothetical protein;Parent=BALIOE_08840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3548 c1 Prodigal gene 1770433 1771479 . + . ID=BALIOE_08845_gene;locus_tag=BALIOE_08845 | |
| 3549 c1 Prodigal CDS 1770433 1771479 . + 0 ID=BALIOE_08845;Name=hypothetical protein;locus_tag=BALIOE_08845;product=hypothetical protein;Parent=BALIOE_08845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3550 c1 Prodigal gene 1771492 1771851 . + . ID=BALIOE_08850_gene;locus_tag=BALIOE_08850 | |
| 3551 c1 Prodigal CDS 1771492 1771851 . + 0 ID=BALIOE_08850;Name=hypothetical protein;locus_tag=BALIOE_08850;product=hypothetical protein;Parent=BALIOE_08850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3552 c1 Prodigal gene 1771860 1772390 . + . ID=BALIOE_08855_gene;locus_tag=BALIOE_08855 | |
| 3553 c1 Prodigal CDS 1771860 1772390 . + 0 ID=BALIOE_08855;Name=hypothetical protein;locus_tag=BALIOE_08855;product=hypothetical protein;Parent=BALIOE_08855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3554 c1 Prodigal gene 1772632 1772829 . + . ID=BALIOE_08860_gene;locus_tag=BALIOE_08860 | |
| 3555 c1 Prodigal CDS 1772632 1772829 . + 0 ID=BALIOE_08860;Name=hypothetical protein;locus_tag=BALIOE_08860;product=hypothetical protein;Parent=BALIOE_08860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3556 c1 Prodigal gene 1772980 1774038 . + . ID=BALIOE_08865_gene;locus_tag=BALIOE_08865 | |
| 3557 c1 Prodigal CDS 1772980 1774038 . + 0 ID=BALIOE_08865;Name=hypothetical protein;locus_tag=BALIOE_08865;product=hypothetical protein;Parent=BALIOE_08865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3558 c1 tRNAscan-SE gene 1774079 1774154 . + . ID=BALIOE_08870_gene;locus_tag=BALIOE_08870;gene=Ile2_trna | |
| 3559 c1 tRNAscan-SE tRNA 1774079 1774154 . + . ID=BALIOE_08870;Name=tRNA-Ile2;locus_tag=BALIOE_08870;product=tRNA-Ile2;gene=Ile2_trna;Parent=BALIOE_08870_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 3560 c1 tRNAscan-SE gene 1774235 1774311 . + . ID=BALIOE_08875_gene;locus_tag=BALIOE_08875;gene=Arg_trna | |
| 3561 c1 tRNAscan-SE tRNA 1774235 1774311 . + . ID=BALIOE_08875;Name=tRNA-Arg;locus_tag=BALIOE_08875;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_08875_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 3562 c1 Prodigal gene 1774835 1776688 . + . ID=BALIOE_08880_gene;locus_tag=BALIOE_08880 | |
| 3563 c1 Prodigal CDS 1774835 1776688 . + 0 ID=BALIOE_08880;Name=hypothetical protein;locus_tag=BALIOE_08880;product=hypothetical protein;Parent=BALIOE_08880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3564 c1 Prodigal gene 1776838 1777053 . + . ID=BALIOE_08885_gene;locus_tag=BALIOE_08885 | |
| 3565 c1 Prodigal CDS 1776838 1777053 . + 0 ID=BALIOE_08885;Name=hypothetical protein;locus_tag=BALIOE_08885;product=hypothetical protein;Parent=BALIOE_08885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3566 c1 Prodigal gene 1777058 1777402 . + . ID=BALIOE_08890_gene;locus_tag=BALIOE_08890 | |
| 3567 c1 Prodigal CDS 1777058 1777402 . + 0 ID=BALIOE_08890;Name=hypothetical protein;locus_tag=BALIOE_08890;product=hypothetical protein;Parent=BALIOE_08890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3568 c1 Prodigal gene 1777453 1777986 . + . ID=BALIOE_08895_gene;locus_tag=BALIOE_08895 | |
| 3569 c1 Prodigal CDS 1777453 1777986 . + 0 ID=BALIOE_08895;Name=hypothetical protein;locus_tag=BALIOE_08895;product=hypothetical protein;Parent=BALIOE_08895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3570 c1 Prodigal gene 1778257 1778826 . + . ID=BALIOE_08900_gene;locus_tag=BALIOE_08900 | |
| 3571 c1 Prodigal CDS 1778257 1778826 . + 0 ID=BALIOE_08900;Name=hypothetical protein;locus_tag=BALIOE_08900;product=hypothetical protein;Parent=BALIOE_08900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3572 c1 Prodigal gene 1778826 1778972 . + . ID=BALIOE_08905_gene;locus_tag=BALIOE_08905 | |
| 3573 c1 Prodigal CDS 1778826 1778972 . + 0 ID=BALIOE_08905;Name=hypothetical protein;locus_tag=BALIOE_08905;product=hypothetical protein;Parent=BALIOE_08905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3574 c1 Prodigal gene 1778980 1779447 . + . ID=BALIOE_08910_gene;locus_tag=BALIOE_08910 | |
| 3575 c1 Prodigal CDS 1778980 1779447 . + 0 ID=BALIOE_08910;Name=hypothetical protein;locus_tag=BALIOE_08910;product=hypothetical protein;Parent=BALIOE_08910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3576 c1 Prodigal gene 1779810 1780037 . - . ID=BALIOE_08915_gene;locus_tag=BALIOE_08915 | |
| 3577 c1 Prodigal CDS 1779810 1780037 . - 0 ID=BALIOE_08915;Name=hypothetical protein;locus_tag=BALIOE_08915;product=hypothetical protein;Parent=BALIOE_08915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3578 c1 Prodigal gene 1780079 1780444 . + . ID=BALIOE_08920_gene;locus_tag=BALIOE_08920 | |
| 3579 c1 Prodigal CDS 1780079 1780444 . + 0 ID=BALIOE_08920;Name=hypothetical protein;locus_tag=BALIOE_08920;product=hypothetical protein;Parent=BALIOE_08920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3580 c1 Prodigal gene 1780734 1781297 . + . ID=BALIOE_08925_gene;locus_tag=BALIOE_08925 | |
| 3581 c1 Prodigal CDS 1780734 1781297 . + 0 ID=BALIOE_08925;Name=hypothetical protein;locus_tag=BALIOE_08925;product=hypothetical protein;Parent=BALIOE_08925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3582 c1 Prodigal gene 1781294 1782955 . + . ID=BALIOE_08930_gene;locus_tag=BALIOE_08930 | |
| 3583 c1 Prodigal CDS 1781294 1782955 . + 0 ID=BALIOE_08930;Name=hypothetical protein;locus_tag=BALIOE_08930;product=hypothetical protein;Parent=BALIOE_08930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3584 c1 Prodigal gene 1783019 1784956 . + . ID=BALIOE_08935_gene;locus_tag=BALIOE_08935 | |
| 3585 c1 Prodigal CDS 1783019 1784956 . + 0 ID=BALIOE_08935;Name=hypothetical protein;locus_tag=BALIOE_08935;product=hypothetical protein;Parent=BALIOE_08935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3586 c1 Prodigal gene 1785001 1785222 . + . ID=BALIOE_08940_gene;locus_tag=BALIOE_08940 | |
| 3587 c1 Prodigal CDS 1785001 1785222 . + 0 ID=BALIOE_08940;Name=hypothetical protein;locus_tag=BALIOE_08940;product=hypothetical protein;Parent=BALIOE_08940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3588 c1 Prodigal gene 1785168 1787747 . + . ID=BALIOE_08945_gene;locus_tag=BALIOE_08945 | |
| 3589 c1 Prodigal CDS 1785168 1787747 . + 0 ID=BALIOE_08945;Name=hypothetical protein;locus_tag=BALIOE_08945;product=hypothetical protein;Parent=BALIOE_08945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3590 c1 Prodigal gene 1787750 1788076 . + . ID=BALIOE_08950_gene;locus_tag=BALIOE_08950 | |
| 3591 c1 Prodigal CDS 1787750 1788076 . + 0 ID=BALIOE_08950;Name=hypothetical protein;locus_tag=BALIOE_08950;product=hypothetical protein;Parent=BALIOE_08950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3592 c1 Prodigal gene 1788086 1788436 . + . ID=BALIOE_08955_gene;locus_tag=BALIOE_08955 | |
| 3593 c1 Prodigal CDS 1788086 1788436 . + 0 ID=BALIOE_08955;Name=hypothetical protein;locus_tag=BALIOE_08955;product=hypothetical protein;Parent=BALIOE_08955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3594 c1 Prodigal gene 1788433 1788879 . + . ID=BALIOE_08960_gene;locus_tag=BALIOE_08960 | |
| 3595 c1 Prodigal CDS 1788433 1788879 . + 0 ID=BALIOE_08960;Name=hypothetical protein;locus_tag=BALIOE_08960;product=hypothetical protein;Parent=BALIOE_08960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3596 c1 Prodigal gene 1788876 1789220 . + . ID=BALIOE_08965_gene;locus_tag=BALIOE_08965 | |
| 3597 c1 Prodigal CDS 1788876 1789220 . + 0 ID=BALIOE_08965;Name=hypothetical protein;locus_tag=BALIOE_08965;product=hypothetical protein;Parent=BALIOE_08965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3598 c1 Prodigal gene 1789279 1789995 . + . ID=BALIOE_08970_gene;locus_tag=BALIOE_08970 | |
| 3599 c1 Prodigal CDS 1789279 1789995 . + 0 ID=BALIOE_08970;Name=hypothetical protein;locus_tag=BALIOE_08970;product=hypothetical protein;Parent=BALIOE_08970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3600 c1 Prodigal gene 1790001 1790375 . + . ID=BALIOE_08975_gene;locus_tag=BALIOE_08975 | |
| 3601 c1 Prodigal CDS 1790001 1790375 . + 0 ID=BALIOE_08975;Name=hypothetical protein;locus_tag=BALIOE_08975;product=hypothetical protein;Parent=BALIOE_08975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3602 c1 Prodigal gene 1790471 1790680 . + . ID=BALIOE_08980_gene;locus_tag=BALIOE_08980 | |
| 3603 c1 Prodigal CDS 1790471 1790680 . + 0 ID=BALIOE_08980;Name=hypothetical protein;locus_tag=BALIOE_08980;product=hypothetical protein;Parent=BALIOE_08980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3604 c1 Prodigal gene 1790733 1793813 . + . ID=BALIOE_08985_gene;locus_tag=BALIOE_08985 | |
| 3605 c1 Prodigal CDS 1790733 1793813 . + 0 ID=BALIOE_08985;Name=hypothetical protein;locus_tag=BALIOE_08985;product=hypothetical protein;Parent=BALIOE_08985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3606 c1 Prodigal gene 1793806 1794147 . + . ID=BALIOE_08990_gene;locus_tag=BALIOE_08990 | |
| 3607 c1 Prodigal CDS 1793806 1794147 . + 0 ID=BALIOE_08990;Name=hypothetical protein;locus_tag=BALIOE_08990;product=hypothetical protein;Parent=BALIOE_08990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3608 c1 Prodigal gene 1794147 1794584 . + . ID=BALIOE_08995_gene;locus_tag=BALIOE_08995 | |
| 3609 c1 Prodigal CDS 1794147 1794584 . + 0 ID=BALIOE_08995;Name=hypothetical protein;locus_tag=BALIOE_08995;product=hypothetical protein;Parent=BALIOE_08995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3610 c1 Prodigal gene 1794772 1798248 . + . ID=BALIOE_09000_gene;locus_tag=BALIOE_09000 | |
| 3611 c1 Prodigal CDS 1794772 1798248 . + 0 ID=BALIOE_09000;Name=hypothetical protein;locus_tag=BALIOE_09000;product=hypothetical protein;Parent=BALIOE_09000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3612 c1 Prodigal gene 1798316 1798915 . + . ID=BALIOE_09005_gene;locus_tag=BALIOE_09005 | |
| 3613 c1 Prodigal CDS 1798316 1798915 . + 0 ID=BALIOE_09005;Name=hypothetical protein;locus_tag=BALIOE_09005;product=hypothetical protein;Parent=BALIOE_09005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3614 c1 Prodigal gene 1799067 1800380 . + . ID=BALIOE_09010_gene;locus_tag=BALIOE_09010 | |
| 3615 c1 Prodigal CDS 1799067 1800380 . + 0 ID=BALIOE_09010;Name=hypothetical protein;locus_tag=BALIOE_09010;product=hypothetical protein;Parent=BALIOE_09010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3616 c1 Prodigal gene 1800382 1800651 . + . ID=BALIOE_09015_gene;locus_tag=BALIOE_09015 | |
| 3617 c1 Prodigal CDS 1800382 1800651 . + 0 ID=BALIOE_09015;Name=hypothetical protein;locus_tag=BALIOE_09015;product=hypothetical protein;Parent=BALIOE_09015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3618 c1 Prodigal gene 1801003 1801338 . + . ID=BALIOE_09020_gene;locus_tag=BALIOE_09020 | |
| 3619 c1 Prodigal CDS 1801003 1801338 . + 0 ID=BALIOE_09020;Name=hypothetical protein;locus_tag=BALIOE_09020;product=hypothetical protein;Parent=BALIOE_09020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3620 c1 Prodigal gene 1801678 1803003 . - . ID=BALIOE_09025_gene;locus_tag=BALIOE_09025 | |
| 3621 c1 Prodigal CDS 1801678 1803003 . - 0 ID=BALIOE_09025;Name=hypothetical protein;locus_tag=BALIOE_09025;product=hypothetical protein;Parent=BALIOE_09025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3622 c1 Prodigal gene 1803664 1804356 . - . ID=BALIOE_09030_gene;locus_tag=BALIOE_09030 | |
| 3623 c1 Prodigal CDS 1803664 1804356 . - 0 ID=BALIOE_09030;Name=hypothetical protein;locus_tag=BALIOE_09030;product=hypothetical protein;Parent=BALIOE_09030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3624 c1 Prodigal gene 1804830 1805741 . + . ID=BALIOE_09035_gene;locus_tag=BALIOE_09035 | |
| 3625 c1 Prodigal CDS 1804830 1805741 . + 0 ID=BALIOE_09035;Name=hypothetical protein;locus_tag=BALIOE_09035;product=hypothetical protein;Parent=BALIOE_09035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3626 c1 Prodigal gene 1805807 1806376 . + . ID=BALIOE_09040_gene;locus_tag=BALIOE_09040 | |
| 3627 c1 Prodigal CDS 1805807 1806376 . + 0 ID=BALIOE_09040;Name=hypothetical protein;locus_tag=BALIOE_09040;product=hypothetical protein;Parent=BALIOE_09040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3628 c1 Prodigal gene 1806423 1806680 . - . ID=BALIOE_09045_gene;locus_tag=BALIOE_09045 | |
| 3629 c1 Prodigal CDS 1806423 1806680 . - 0 ID=BALIOE_09045;Name=hypothetical protein;locus_tag=BALIOE_09045;product=hypothetical protein;Parent=BALIOE_09045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3630 c1 Prodigal gene 1806710 1807057 . - . ID=BALIOE_09050_gene;locus_tag=BALIOE_09050 | |
| 3631 c1 Prodigal CDS 1806710 1807057 . - 0 ID=BALIOE_09050;Name=hypothetical protein;locus_tag=BALIOE_09050;product=hypothetical protein;Parent=BALIOE_09050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3632 c1 Prodigal gene 1807342 1808880 . - . ID=BALIOE_09055_gene;locus_tag=BALIOE_09055 | |
| 3633 c1 Prodigal CDS 1807342 1808880 . - 0 ID=BALIOE_09055;Name=hypothetical protein;locus_tag=BALIOE_09055;product=hypothetical protein;Parent=BALIOE_09055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3634 c1 Prodigal gene 1808930 1809277 . - . ID=BALIOE_09060_gene;locus_tag=BALIOE_09060 | |
| 3635 c1 Prodigal CDS 1808930 1809277 . - 0 ID=BALIOE_09060;Name=hypothetical protein;locus_tag=BALIOE_09060;product=hypothetical protein;Parent=BALIOE_09060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3636 c1 Prodigal gene 1809274 1809654 . - . ID=BALIOE_09065_gene;locus_tag=BALIOE_09065 | |
| 3637 c1 Prodigal CDS 1809274 1809654 . - 0 ID=BALIOE_09065;Name=hypothetical protein;locus_tag=BALIOE_09065;product=hypothetical protein;Parent=BALIOE_09065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3638 c1 Prodigal gene 1809959 1810228 . + . ID=BALIOE_09070_gene;locus_tag=BALIOE_09070 | |
| 3639 c1 Prodigal CDS 1809959 1810228 . + 0 ID=BALIOE_09070;Name=hypothetical protein;locus_tag=BALIOE_09070;product=hypothetical protein;Parent=BALIOE_09070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3640 c1 Prodigal gene 1810983 1811630 . - . ID=BALIOE_09075_gene;locus_tag=BALIOE_09075 | |
| 3641 c1 Prodigal CDS 1810983 1811630 . - 0 ID=BALIOE_09075;Name=hypothetical protein;locus_tag=BALIOE_09075;product=hypothetical protein;Parent=BALIOE_09075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3642 c1 Prodigal gene 1811814 1812404 . + . ID=BALIOE_09080_gene;locus_tag=BALIOE_09080 | |
| 3643 c1 Prodigal CDS 1811814 1812404 . + 0 ID=BALIOE_09080;Name=hypothetical protein;locus_tag=BALIOE_09080;product=hypothetical protein;Parent=BALIOE_09080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3644 c1 Prodigal gene 1814052 1814561 . + . ID=BALIOE_09085_gene;locus_tag=BALIOE_09085 | |
| 3645 c1 Prodigal CDS 1814052 1814561 . + 0 ID=BALIOE_09085;Name=hypothetical protein;locus_tag=BALIOE_09085;product=hypothetical protein;Parent=BALIOE_09085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3646 c1 Prodigal gene 1815875 1816381 . - . ID=BALIOE_09090_gene;locus_tag=BALIOE_09090 | |
| 3647 c1 Prodigal CDS 1815875 1816381 . - 0 ID=BALIOE_09090;Name=hypothetical protein;locus_tag=BALIOE_09090;product=hypothetical protein;Parent=BALIOE_09090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3648 c1 Prodigal gene 1816427 1816927 . - . ID=BALIOE_09095_gene;locus_tag=BALIOE_09095 | |
| 3649 c1 Prodigal CDS 1816427 1816927 . - 0 ID=BALIOE_09095;Name=hypothetical protein;locus_tag=BALIOE_09095;product=hypothetical protein;Parent=BALIOE_09095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3650 c1 Prodigal gene 1817013 1817192 . - . ID=BALIOE_09100_gene;locus_tag=BALIOE_09100 | |
| 3651 c1 Prodigal CDS 1817013 1817192 . - 0 ID=BALIOE_09100;Name=hypothetical protein;locus_tag=BALIOE_09100;product=hypothetical protein;Parent=BALIOE_09100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3652 c1 Prodigal gene 1817573 1818379 . - . ID=BALIOE_09105_gene;locus_tag=BALIOE_09105 | |
| 3653 c1 Prodigal CDS 1817573 1818379 . - 0 ID=BALIOE_09105;Name=hypothetical protein;locus_tag=BALIOE_09105;product=hypothetical protein;Parent=BALIOE_09105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3654 c1 Prodigal gene 1818379 1819572 . - . ID=BALIOE_09110_gene;locus_tag=BALIOE_09110 | |
| 3655 c1 Prodigal CDS 1818379 1819572 . - 0 ID=BALIOE_09110;Name=hypothetical protein;locus_tag=BALIOE_09110;product=hypothetical protein;Parent=BALIOE_09110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3656 c1 Prodigal gene 1819584 1820942 . - . ID=BALIOE_09115_gene;locus_tag=BALIOE_09115 | |
| 3657 c1 Prodigal CDS 1819584 1820942 . - 0 ID=BALIOE_09115;Name=hypothetical protein;locus_tag=BALIOE_09115;product=hypothetical protein;Parent=BALIOE_09115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3658 c1 Prodigal gene 1820946 1822541 . - . ID=BALIOE_09120_gene;locus_tag=BALIOE_09120 | |
| 3659 c1 Prodigal CDS 1820946 1822541 . - 0 ID=BALIOE_09120;Name=hypothetical protein;locus_tag=BALIOE_09120;product=hypothetical protein;Parent=BALIOE_09120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3660 c1 Prodigal gene 1822541 1824103 . - . ID=BALIOE_09125_gene;locus_tag=BALIOE_09125 | |
| 3661 c1 Prodigal CDS 1822541 1824103 . - 0 ID=BALIOE_09125;Name=hypothetical protein;locus_tag=BALIOE_09125;product=hypothetical protein;Parent=BALIOE_09125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3662 c1 Prodigal gene 1824377 1825258 . + . ID=BALIOE_09130_gene;locus_tag=BALIOE_09130 | |
| 3663 c1 Prodigal CDS 1824377 1825258 . + 0 ID=BALIOE_09130;Name=hypothetical protein;locus_tag=BALIOE_09130;product=hypothetical protein;Parent=BALIOE_09130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3664 c1 Prodigal gene 1825255 1825875 . + . ID=BALIOE_09135_gene;locus_tag=BALIOE_09135 | |
| 3665 c1 Prodigal CDS 1825255 1825875 . + 0 ID=BALIOE_09135;Name=hypothetical protein;locus_tag=BALIOE_09135;product=hypothetical protein;Parent=BALIOE_09135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3666 c1 Prodigal gene 1825903 1827486 . + . ID=BALIOE_09140_gene;locus_tag=BALIOE_09140 | |
| 3667 c1 Prodigal CDS 1825903 1827486 . + 0 ID=BALIOE_09140;Name=hypothetical protein;locus_tag=BALIOE_09140;product=hypothetical protein;Parent=BALIOE_09140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3668 c1 Prodigal gene 1827699 1828571 . + . ID=BALIOE_09145_gene;locus_tag=BALIOE_09145 | |
| 3669 c1 Prodigal CDS 1827699 1828571 . + 0 ID=BALIOE_09145;Name=hypothetical protein;locus_tag=BALIOE_09145;product=hypothetical protein;Parent=BALIOE_09145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3670 c1 Prodigal gene 1828611 1829201 . - . ID=BALIOE_09150_gene;locus_tag=BALIOE_09150 | |
| 3671 c1 Prodigal CDS 1828611 1829201 . - 0 ID=BALIOE_09150;Name=hypothetical protein;locus_tag=BALIOE_09150;product=hypothetical protein;Parent=BALIOE_09150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3672 c1 Prodigal gene 1829198 1829956 . - . ID=BALIOE_09155_gene;locus_tag=BALIOE_09155 | |
| 3673 c1 Prodigal CDS 1829198 1829956 . - 0 ID=BALIOE_09155;Name=hypothetical protein;locus_tag=BALIOE_09155;product=hypothetical protein;Parent=BALIOE_09155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3674 c1 Prodigal gene 1830176 1831225 . + . ID=BALIOE_09160_gene;locus_tag=BALIOE_09160 | |
| 3675 c1 Prodigal CDS 1830176 1831225 . + 0 ID=BALIOE_09160;Name=hypothetical protein;locus_tag=BALIOE_09160;product=hypothetical protein;Parent=BALIOE_09160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3676 c1 Prodigal gene 1831261 1831512 . - . ID=BALIOE_09165_gene;locus_tag=BALIOE_09165 | |
| 3677 c1 Prodigal CDS 1831261 1831512 . - 0 ID=BALIOE_09165;Name=hypothetical protein;locus_tag=BALIOE_09165;product=hypothetical protein;Parent=BALIOE_09165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3678 c1 Prodigal gene 1831892 1834489 . + . ID=BALIOE_09170_gene;locus_tag=BALIOE_09170 | |
| 3679 c1 Prodigal CDS 1831892 1834489 . + 0 ID=BALIOE_09170;Name=hypothetical protein;locus_tag=BALIOE_09170;product=hypothetical protein;Parent=BALIOE_09170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3680 c1 Prodigal gene 1834699 1835673 . + . ID=BALIOE_09175_gene;locus_tag=BALIOE_09175 | |
| 3681 c1 Prodigal CDS 1834699 1835673 . + 0 ID=BALIOE_09175;Name=hypothetical protein;locus_tag=BALIOE_09175;product=hypothetical protein;Parent=BALIOE_09175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3682 c1 Prodigal gene 1836004 1836132 . + . ID=BALIOE_09180_gene;locus_tag=BALIOE_09180 | |
| 3683 c1 Prodigal CDS 1836004 1836132 . + 0 ID=BALIOE_09180;Name=hypothetical protein;locus_tag=BALIOE_09180;product=hypothetical protein;Parent=BALIOE_09180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3684 c1 Prodigal gene 1836135 1836302 . + . ID=BALIOE_09185_gene;locus_tag=BALIOE_09185 | |
| 3685 c1 Prodigal CDS 1836135 1836302 . + 0 ID=BALIOE_09185;Name=hypothetical protein;locus_tag=BALIOE_09185;product=hypothetical protein;Parent=BALIOE_09185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3686 c1 Prodigal gene 1836675 1839350 . + . ID=BALIOE_09190_gene;locus_tag=BALIOE_09190 | |
| 3687 c1 Prodigal CDS 1836675 1839350 . + 0 ID=BALIOE_09190;Name=hypothetical protein;locus_tag=BALIOE_09190;product=hypothetical protein;Parent=BALIOE_09190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3688 c1 Prodigal gene 1839414 1840004 . - . ID=BALIOE_09195_gene;locus_tag=BALIOE_09195 | |
| 3689 c1 Prodigal CDS 1839414 1840004 . - 0 ID=BALIOE_09195;Name=hypothetical protein;locus_tag=BALIOE_09195;product=hypothetical protein;Parent=BALIOE_09195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3690 c1 Prodigal gene 1840174 1840938 . + . ID=BALIOE_09200_gene;locus_tag=BALIOE_09200 | |
| 3691 c1 Prodigal CDS 1840174 1840938 . + 0 ID=BALIOE_09200;Name=hypothetical protein;locus_tag=BALIOE_09200;product=hypothetical protein;Parent=BALIOE_09200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3692 c1 Prodigal gene 1841087 1841395 . + . ID=BALIOE_09205_gene;locus_tag=BALIOE_09205 | |
| 3693 c1 Prodigal CDS 1841087 1841395 . + 0 ID=BALIOE_09205;Name=hypothetical protein;locus_tag=BALIOE_09205;product=hypothetical protein;Parent=BALIOE_09205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3694 c1 Prodigal gene 1841402 1842571 . + . ID=BALIOE_09210_gene;locus_tag=BALIOE_09210 | |
| 3695 c1 Prodigal CDS 1841402 1842571 . + 0 ID=BALIOE_09210;Name=hypothetical protein;locus_tag=BALIOE_09210;product=hypothetical protein;Parent=BALIOE_09210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3696 c1 Prodigal gene 1842704 1843501 . + . ID=BALIOE_09215_gene;locus_tag=BALIOE_09215 | |
| 3697 c1 Prodigal CDS 1842704 1843501 . + 0 ID=BALIOE_09215;Name=hypothetical protein;locus_tag=BALIOE_09215;product=hypothetical protein;Parent=BALIOE_09215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3698 c1 Prodigal gene 1843501 1843827 . + . ID=BALIOE_09220_gene;locus_tag=BALIOE_09220 | |
| 3699 c1 Prodigal CDS 1843501 1843827 . + 0 ID=BALIOE_09220;Name=hypothetical protein;locus_tag=BALIOE_09220;product=hypothetical protein;Parent=BALIOE_09220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3700 c1 Prodigal gene 1843953 1844171 . - . ID=BALIOE_09225_gene;locus_tag=BALIOE_09225 | |
| 3701 c1 Prodigal CDS 1843953 1844171 . - 0 ID=BALIOE_09225;Name=hypothetical protein;locus_tag=BALIOE_09225;product=hypothetical protein;Parent=BALIOE_09225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3702 c1 Prodigal gene 1844440 1845189 . - . ID=BALIOE_09230_gene;locus_tag=BALIOE_09230 | |
| 3703 c1 Prodigal CDS 1844440 1845189 . - 0 ID=BALIOE_09230;Name=hypothetical protein;locus_tag=BALIOE_09230;product=hypothetical protein;Parent=BALIOE_09230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3704 c1 Prodigal gene 1845279 1845452 . - . ID=BALIOE_09235_gene;locus_tag=BALIOE_09235 | |
| 3705 c1 Prodigal CDS 1845279 1845452 . - 0 ID=BALIOE_09235;Name=hypothetical protein;locus_tag=BALIOE_09235;product=hypothetical protein;Parent=BALIOE_09235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3706 c1 Prodigal gene 1845600 1847585 . - . ID=BALIOE_09240_gene;locus_tag=BALIOE_09240 | |
| 3707 c1 Prodigal CDS 1845600 1847585 . - 0 ID=BALIOE_09240;Name=hypothetical protein;locus_tag=BALIOE_09240;product=hypothetical protein;Parent=BALIOE_09240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3708 c1 Prodigal gene 1847820 1849754 . - . ID=BALIOE_09245_gene;locus_tag=BALIOE_09245 | |
| 3709 c1 Prodigal CDS 1847820 1849754 . - 0 ID=BALIOE_09245;Name=hypothetical protein;locus_tag=BALIOE_09245;product=hypothetical protein;Parent=BALIOE_09245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3710 c1 Prodigal gene 1849822 1850949 . - . ID=BALIOE_09250_gene;locus_tag=BALIOE_09250 | |
| 3711 c1 Prodigal CDS 1849822 1850949 . - 0 ID=BALIOE_09250;Name=hypothetical protein;locus_tag=BALIOE_09250;product=hypothetical protein;Parent=BALIOE_09250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3712 c1 Prodigal gene 1851093 1851881 . - . ID=BALIOE_09255_gene;locus_tag=BALIOE_09255 | |
| 3713 c1 Prodigal CDS 1851093 1851881 . - 0 ID=BALIOE_09255;Name=hypothetical protein;locus_tag=BALIOE_09255;product=hypothetical protein;Parent=BALIOE_09255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3714 c1 Prodigal gene 1852359 1852925 . + . ID=BALIOE_09260_gene;locus_tag=BALIOE_09260 | |
| 3715 c1 Prodigal CDS 1852359 1852925 . + 0 ID=BALIOE_09260;Name=hypothetical protein;locus_tag=BALIOE_09260;product=hypothetical protein;Parent=BALIOE_09260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3716 c1 Prodigal gene 1853074 1854195 . + . ID=BALIOE_09265_gene;locus_tag=BALIOE_09265 | |
| 3717 c1 Prodigal CDS 1853074 1854195 . + 0 ID=BALIOE_09265;Name=hypothetical protein;locus_tag=BALIOE_09265;product=hypothetical protein;Parent=BALIOE_09265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3718 c1 Prodigal gene 1854195 1857278 . + . ID=BALIOE_09270_gene;locus_tag=BALIOE_09270 | |
| 3719 c1 Prodigal CDS 1854195 1857278 . + 0 ID=BALIOE_09270;Name=hypothetical protein;locus_tag=BALIOE_09270;product=hypothetical protein;Parent=BALIOE_09270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3720 c1 Prodigal gene 1857301 1858674 . + . ID=BALIOE_09275_gene;locus_tag=BALIOE_09275 | |
| 3721 c1 Prodigal CDS 1857301 1858674 . + 0 ID=BALIOE_09275;Name=hypothetical protein;locus_tag=BALIOE_09275;product=hypothetical protein;Parent=BALIOE_09275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3722 c1 Prodigal gene 1858683 1859846 . + . ID=BALIOE_09280_gene;locus_tag=BALIOE_09280 | |
| 3723 c1 Prodigal CDS 1858683 1859846 . + 0 ID=BALIOE_09280;Name=hypothetical protein;locus_tag=BALIOE_09280;product=hypothetical protein;Parent=BALIOE_09280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3724 c1 Prodigal gene 1859898 1860704 . - . ID=BALIOE_09285_gene;locus_tag=BALIOE_09285 | |
| 3725 c1 Prodigal CDS 1859898 1860704 . - 0 ID=BALIOE_09285;Name=hypothetical protein;locus_tag=BALIOE_09285;product=hypothetical protein;Parent=BALIOE_09285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3726 c1 Prodigal gene 1860706 1861698 . - . ID=BALIOE_09290_gene;locus_tag=BALIOE_09290 | |
| 3727 c1 Prodigal CDS 1860706 1861698 . - 0 ID=BALIOE_09290;Name=hypothetical protein;locus_tag=BALIOE_09290;product=hypothetical protein;Parent=BALIOE_09290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3728 c1 Prodigal gene 1861698 1862588 . - . ID=BALIOE_09295_gene;locus_tag=BALIOE_09295 | |
| 3729 c1 Prodigal CDS 1861698 1862588 . - 0 ID=BALIOE_09295;Name=hypothetical protein;locus_tag=BALIOE_09295;product=hypothetical protein;Parent=BALIOE_09295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3730 c1 Prodigal gene 1862575 1863540 . - . ID=BALIOE_09300_gene;locus_tag=BALIOE_09300 | |
| 3731 c1 Prodigal CDS 1862575 1863540 . - 0 ID=BALIOE_09300;Name=hypothetical protein;locus_tag=BALIOE_09300;product=hypothetical protein;Parent=BALIOE_09300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3732 c1 Prodigal gene 1863537 1865180 . - . ID=BALIOE_09305_gene;locus_tag=BALIOE_09305 | |
| 3733 c1 Prodigal CDS 1863537 1865180 . - 0 ID=BALIOE_09305;Name=hypothetical protein;locus_tag=BALIOE_09305;product=hypothetical protein;Parent=BALIOE_09305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3734 c1 Prodigal gene 1865493 1865738 . - . ID=BALIOE_09310_gene;locus_tag=BALIOE_09310 | |
| 3735 c1 Prodigal CDS 1865493 1865738 . - 0 ID=BALIOE_09310;Name=hypothetical protein;locus_tag=BALIOE_09310;product=hypothetical protein;Parent=BALIOE_09310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3736 c1 Prodigal gene 1865872 1867257 . - . ID=BALIOE_09315_gene;locus_tag=BALIOE_09315 | |
| 3737 c1 Prodigal CDS 1865872 1867257 . - 0 ID=BALIOE_09315;Name=hypothetical protein;locus_tag=BALIOE_09315;product=hypothetical protein;Parent=BALIOE_09315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3738 c1 Prodigal gene 1867560 1868978 . - . ID=BALIOE_09320_gene;locus_tag=BALIOE_09320 | |
| 3739 c1 Prodigal CDS 1867560 1868978 . - 0 ID=BALIOE_09320;Name=hypothetical protein;locus_tag=BALIOE_09320;product=hypothetical protein;Parent=BALIOE_09320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3740 c1 Prodigal gene 1869190 1869954 . + . ID=BALIOE_09325_gene;locus_tag=BALIOE_09325 | |
| 3741 c1 Prodigal CDS 1869190 1869954 . + 0 ID=BALIOE_09325;Name=hypothetical protein;locus_tag=BALIOE_09325;product=hypothetical protein;Parent=BALIOE_09325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3742 c1 Prodigal gene 1869981 1870538 . + . ID=BALIOE_09330_gene;locus_tag=BALIOE_09330 | |
| 3743 c1 Prodigal CDS 1869981 1870538 . + 0 ID=BALIOE_09330;Name=hypothetical protein;locus_tag=BALIOE_09330;product=hypothetical protein;Parent=BALIOE_09330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3744 c1 Prodigal gene 1870688 1872175 . + . ID=BALIOE_09335_gene;locus_tag=BALIOE_09335 | |
| 3745 c1 Prodigal CDS 1870688 1872175 . + 0 ID=BALIOE_09335;Name=hypothetical protein;locus_tag=BALIOE_09335;product=hypothetical protein;Parent=BALIOE_09335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3746 c1 Prodigal gene 1872177 1873457 . + . ID=BALIOE_09340_gene;locus_tag=BALIOE_09340 | |
| 3747 c1 Prodigal CDS 1872177 1873457 . + 0 ID=BALIOE_09340;Name=hypothetical protein;locus_tag=BALIOE_09340;product=hypothetical protein;Parent=BALIOE_09340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3748 c1 Prodigal gene 1873495 1874760 . + . ID=BALIOE_09345_gene;locus_tag=BALIOE_09345 | |
| 3749 c1 Prodigal CDS 1873495 1874760 . + 0 ID=BALIOE_09345;Name=hypothetical protein;locus_tag=BALIOE_09345;product=hypothetical protein;Parent=BALIOE_09345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3750 c1 Prodigal gene 1874891 1875868 . - . ID=BALIOE_09350_gene;locus_tag=BALIOE_09350 | |
| 3751 c1 Prodigal CDS 1874891 1875868 . - 0 ID=BALIOE_09350;Name=hypothetical protein;locus_tag=BALIOE_09350;product=hypothetical protein;Parent=BALIOE_09350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3752 c1 Prodigal gene 1876035 1876703 . + . ID=BALIOE_09355_gene;locus_tag=BALIOE_09355 | |
| 3753 c1 Prodigal CDS 1876035 1876703 . + 0 ID=BALIOE_09355;Name=hypothetical protein;locus_tag=BALIOE_09355;product=hypothetical protein;Parent=BALIOE_09355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3754 c1 Prodigal gene 1876757 1876981 . + . ID=BALIOE_09360_gene;locus_tag=BALIOE_09360 | |
| 3755 c1 Prodigal CDS 1876757 1876981 . + 0 ID=BALIOE_09360;Name=hypothetical protein;locus_tag=BALIOE_09360;product=hypothetical protein;Parent=BALIOE_09360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3756 c1 Prodigal gene 1876981 1877340 . + . ID=BALIOE_09365_gene;locus_tag=BALIOE_09365 | |
| 3757 c1 Prodigal CDS 1876981 1877340 . + 0 ID=BALIOE_09365;Name=hypothetical protein;locus_tag=BALIOE_09365;product=hypothetical protein;Parent=BALIOE_09365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3758 c1 Prodigal gene 1877349 1877570 . + . ID=BALIOE_09370_gene;locus_tag=BALIOE_09370 | |
| 3759 c1 Prodigal CDS 1877349 1877570 . + 0 ID=BALIOE_09370;Name=hypothetical protein;locus_tag=BALIOE_09370;product=hypothetical protein;Parent=BALIOE_09370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3760 c1 Prodigal gene 1877645 1877959 . + . ID=BALIOE_09375_gene;locus_tag=BALIOE_09375 | |
| 3761 c1 Prodigal CDS 1877645 1877959 . + 0 ID=BALIOE_09375;Name=hypothetical protein;locus_tag=BALIOE_09375;product=hypothetical protein;Parent=BALIOE_09375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3762 c1 Prodigal gene 1878169 1878543 . + . ID=BALIOE_09380_gene;locus_tag=BALIOE_09380 | |
| 3763 c1 Prodigal CDS 1878169 1878543 . + 0 ID=BALIOE_09380;Name=hypothetical protein;locus_tag=BALIOE_09380;product=hypothetical protein;Parent=BALIOE_09380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3764 c1 Prodigal gene 1878543 1879847 . + . ID=BALIOE_09385_gene;locus_tag=BALIOE_09385 | |
| 3765 c1 Prodigal CDS 1878543 1879847 . + 0 ID=BALIOE_09385;Name=hypothetical protein;locus_tag=BALIOE_09385;product=hypothetical protein;Parent=BALIOE_09385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3766 c1 Prodigal gene 1879861 1880490 . + . ID=BALIOE_09390_gene;locus_tag=BALIOE_09390 | |
| 3767 c1 Prodigal CDS 1879861 1880490 . + 0 ID=BALIOE_09390;Name=hypothetical protein;locus_tag=BALIOE_09390;product=hypothetical protein;Parent=BALIOE_09390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3768 c1 Prodigal gene 1880539 1881153 . + . ID=BALIOE_09395_gene;locus_tag=BALIOE_09395 | |
| 3769 c1 Prodigal CDS 1880539 1881153 . + 0 ID=BALIOE_09395;Name=hypothetical protein;locus_tag=BALIOE_09395;product=hypothetical protein;Parent=BALIOE_09395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3770 c1 Prodigal gene 1881174 1882055 . + . ID=BALIOE_09400_gene;locus_tag=BALIOE_09400 | |
| 3771 c1 Prodigal CDS 1881174 1882055 . + 0 ID=BALIOE_09400;Name=hypothetical protein;locus_tag=BALIOE_09400;product=hypothetical protein;Parent=BALIOE_09400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3772 c1 Prodigal gene 1882042 1882884 . + . ID=BALIOE_09405_gene;locus_tag=BALIOE_09405 | |
| 3773 c1 Prodigal CDS 1882042 1882884 . + 0 ID=BALIOE_09405;Name=hypothetical protein;locus_tag=BALIOE_09405;product=hypothetical protein;Parent=BALIOE_09405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3774 c1 Prodigal gene 1882915 1883967 . + . ID=BALIOE_09410_gene;locus_tag=BALIOE_09410 | |
| 3775 c1 Prodigal CDS 1882915 1883967 . + 0 ID=BALIOE_09410;Name=hypothetical protein;locus_tag=BALIOE_09410;product=hypothetical protein;Parent=BALIOE_09410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3776 c1 Prodigal gene 1883985 1884773 . + . ID=BALIOE_09415_gene;locus_tag=BALIOE_09415 | |
| 3777 c1 Prodigal CDS 1883985 1884773 . + 0 ID=BALIOE_09415;Name=hypothetical protein;locus_tag=BALIOE_09415;product=hypothetical protein;Parent=BALIOE_09415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3778 c1 Prodigal gene 1884783 1885838 . + . ID=BALIOE_09420_gene;locus_tag=BALIOE_09420 | |
| 3779 c1 Prodigal CDS 1884783 1885838 . + 0 ID=BALIOE_09420;Name=hypothetical protein;locus_tag=BALIOE_09420;product=hypothetical protein;Parent=BALIOE_09420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3780 c1 Prodigal gene 1885835 1888102 . + . ID=BALIOE_09425_gene;locus_tag=BALIOE_09425 | |
| 3781 c1 Prodigal CDS 1885835 1888102 . + 0 ID=BALIOE_09425;Name=hypothetical protein;locus_tag=BALIOE_09425;product=hypothetical protein;Parent=BALIOE_09425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3782 c1 Prodigal gene 1888099 1888758 . + . ID=BALIOE_09430_gene;locus_tag=BALIOE_09430 | |
| 3783 c1 Prodigal CDS 1888099 1888758 . + 0 ID=BALIOE_09430;Name=hypothetical protein;locus_tag=BALIOE_09430;product=hypothetical protein;Parent=BALIOE_09430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3784 c1 Prodigal gene 1888772 1889854 . + . ID=BALIOE_09435_gene;locus_tag=BALIOE_09435 | |
| 3785 c1 Prodigal CDS 1888772 1889854 . + 0 ID=BALIOE_09435;Name=hypothetical protein;locus_tag=BALIOE_09435;product=hypothetical protein;Parent=BALIOE_09435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3786 c1 Prodigal gene 1889899 1890804 . + . ID=BALIOE_09440_gene;locus_tag=BALIOE_09440 | |
| 3787 c1 Prodigal CDS 1889899 1890804 . + 0 ID=BALIOE_09440;Name=hypothetical protein;locus_tag=BALIOE_09440;product=hypothetical protein;Parent=BALIOE_09440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3788 c1 Prodigal gene 1890915 1891913 . - . ID=BALIOE_09445_gene;locus_tag=BALIOE_09445 | |
| 3789 c1 Prodigal CDS 1890915 1891913 . - 0 ID=BALIOE_09445;Name=hypothetical protein;locus_tag=BALIOE_09445;product=hypothetical protein;Parent=BALIOE_09445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3790 c1 Prodigal gene 1892068 1893465 . + . ID=BALIOE_09450_gene;locus_tag=BALIOE_09450 | |
| 3791 c1 Prodigal CDS 1892068 1893465 . + 0 ID=BALIOE_09450;Name=hypothetical protein;locus_tag=BALIOE_09450;product=hypothetical protein;Parent=BALIOE_09450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3792 c1 Prodigal gene 1893462 1894523 . + . ID=BALIOE_09455_gene;locus_tag=BALIOE_09455 | |
| 3793 c1 Prodigal CDS 1893462 1894523 . + 0 ID=BALIOE_09455;Name=hypothetical protein;locus_tag=BALIOE_09455;product=hypothetical protein;Parent=BALIOE_09455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3794 c1 Prodigal gene 1894671 1896212 . + . ID=BALIOE_09460_gene;locus_tag=BALIOE_09460 | |
| 3795 c1 Prodigal CDS 1894671 1896212 . + 0 ID=BALIOE_09460;Name=hypothetical protein;locus_tag=BALIOE_09460;product=hypothetical protein;Parent=BALIOE_09460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3796 c1 Prodigal gene 1896256 1896762 . - . ID=BALIOE_09465_gene;locus_tag=BALIOE_09465 | |
| 3797 c1 Prodigal CDS 1896256 1896762 . - 0 ID=BALIOE_09465;Name=hypothetical protein;locus_tag=BALIOE_09465;product=hypothetical protein;Parent=BALIOE_09465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3798 c1 Prodigal gene 1896881 1897846 . + . ID=BALIOE_09470_gene;locus_tag=BALIOE_09470 | |
| 3799 c1 Prodigal CDS 1896881 1897846 . + 0 ID=BALIOE_09470;Name=hypothetical protein;locus_tag=BALIOE_09470;product=hypothetical protein;Parent=BALIOE_09470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3800 c1 Prodigal gene 1897821 1898549 . - . ID=BALIOE_09475_gene;locus_tag=BALIOE_09475 | |
| 3801 c1 Prodigal CDS 1897821 1898549 . - 0 ID=BALIOE_09475;Name=hypothetical protein;locus_tag=BALIOE_09475;product=hypothetical protein;Parent=BALIOE_09475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3802 c1 Prodigal gene 1898840 1899478 . - . ID=BALIOE_09480_gene;locus_tag=BALIOE_09480 | |
| 3803 c1 Prodigal CDS 1898840 1899478 . - 0 ID=BALIOE_09480;Name=hypothetical protein;locus_tag=BALIOE_09480;product=hypothetical protein;Parent=BALIOE_09480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3804 c1 Prodigal gene 1899499 1900122 . - . ID=BALIOE_09485_gene;locus_tag=BALIOE_09485 | |
| 3805 c1 Prodigal CDS 1899499 1900122 . - 0 ID=BALIOE_09485;Name=hypothetical protein;locus_tag=BALIOE_09485;product=hypothetical protein;Parent=BALIOE_09485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3806 c1 Prodigal gene 1900061 1900429 . - . ID=BALIOE_09490_gene;locus_tag=BALIOE_09490 | |
| 3807 c1 Prodigal CDS 1900061 1900429 . - 0 ID=BALIOE_09490;Name=hypothetical protein;locus_tag=BALIOE_09490;product=hypothetical protein;Parent=BALIOE_09490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3808 c1 Prodigal gene 1900429 1901349 . - . ID=BALIOE_09495_gene;locus_tag=BALIOE_09495 | |
| 3809 c1 Prodigal CDS 1900429 1901349 . - 0 ID=BALIOE_09495;Name=hypothetical protein;locus_tag=BALIOE_09495;product=hypothetical protein;Parent=BALIOE_09495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3810 c1 Prodigal gene 1901487 1902386 . + . ID=BALIOE_09500_gene;locus_tag=BALIOE_09500 | |
| 3811 c1 Prodigal CDS 1901487 1902386 . + 0 ID=BALIOE_09500;Name=hypothetical protein;locus_tag=BALIOE_09500;product=hypothetical protein;Parent=BALIOE_09500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3812 c1 Prodigal gene 1902722 1904335 . + . ID=BALIOE_09505_gene;locus_tag=BALIOE_09505 | |
| 3813 c1 Prodigal CDS 1902722 1904335 . + 0 ID=BALIOE_09505;Name=hypothetical protein;locus_tag=BALIOE_09505;product=hypothetical protein;Parent=BALIOE_09505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3814 c1 Prodigal gene 1904386 1905417 . - . ID=BALIOE_09510_gene;locus_tag=BALIOE_09510 | |
| 3815 c1 Prodigal CDS 1904386 1905417 . - 0 ID=BALIOE_09510;Name=hypothetical protein;locus_tag=BALIOE_09510;product=hypothetical protein;Parent=BALIOE_09510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3816 c1 Prodigal gene 1905661 1905918 . + . ID=BALIOE_09515_gene;locus_tag=BALIOE_09515 | |
| 3817 c1 Prodigal CDS 1905661 1905918 . + 0 ID=BALIOE_09515;Name=hypothetical protein;locus_tag=BALIOE_09515;product=hypothetical protein;Parent=BALIOE_09515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3818 c1 Prodigal gene 1905968 1906918 . - . ID=BALIOE_09520_gene;locus_tag=BALIOE_09520 | |
| 3819 c1 Prodigal CDS 1905968 1906918 . - 0 ID=BALIOE_09520;Name=hypothetical protein;locus_tag=BALIOE_09520;product=hypothetical protein;Parent=BALIOE_09520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3820 c1 Prodigal gene 1907070 1907822 . - . ID=BALIOE_09525_gene;locus_tag=BALIOE_09525 | |
| 3821 c1 Prodigal CDS 1907070 1907822 . - 0 ID=BALIOE_09525;Name=hypothetical protein;locus_tag=BALIOE_09525;product=hypothetical protein;Parent=BALIOE_09525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3822 c1 Prodigal gene 1908017 1908532 . - . ID=BALIOE_09530_gene;locus_tag=BALIOE_09530 | |
| 3823 c1 Prodigal CDS 1908017 1908532 . - 0 ID=BALIOE_09530;Name=hypothetical protein;locus_tag=BALIOE_09530;product=hypothetical protein;Parent=BALIOE_09530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3824 c1 Prodigal gene 1908543 1909235 . - . ID=BALIOE_09535_gene;locus_tag=BALIOE_09535 | |
| 3825 c1 Prodigal CDS 1908543 1909235 . - 0 ID=BALIOE_09535;Name=hypothetical protein;locus_tag=BALIOE_09535;product=hypothetical protein;Parent=BALIOE_09535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3826 c1 Prodigal gene 1909346 1910233 . - . ID=BALIOE_09540_gene;locus_tag=BALIOE_09540 | |
| 3827 c1 Prodigal CDS 1909346 1910233 . - 0 ID=BALIOE_09540;Name=hypothetical protein;locus_tag=BALIOE_09540;product=hypothetical protein;Parent=BALIOE_09540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3828 c1 Prodigal gene 1910233 1910559 . - . ID=BALIOE_09545_gene;locus_tag=BALIOE_09545 | |
| 3829 c1 Prodigal CDS 1910233 1910559 . - 0 ID=BALIOE_09545;Name=hypothetical protein;locus_tag=BALIOE_09545;product=hypothetical protein;Parent=BALIOE_09545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3830 c1 Prodigal gene 1910585 1911382 . - . ID=BALIOE_09550_gene;locus_tag=BALIOE_09550 | |
| 3831 c1 Prodigal CDS 1910585 1911382 . - 0 ID=BALIOE_09550;Name=hypothetical protein;locus_tag=BALIOE_09550;product=hypothetical protein;Parent=BALIOE_09550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3832 c1 Prodigal gene 1911419 1912864 . - . ID=BALIOE_09555_gene;locus_tag=BALIOE_09555 | |
| 3833 c1 Prodigal CDS 1911419 1912864 . - 0 ID=BALIOE_09555;Name=hypothetical protein;locus_tag=BALIOE_09555;product=hypothetical protein;Parent=BALIOE_09555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3834 c1 Prodigal gene 1912864 1914174 . - . ID=BALIOE_09560_gene;locus_tag=BALIOE_09560 | |
| 3835 c1 Prodigal CDS 1912864 1914174 . - 0 ID=BALIOE_09560;Name=hypothetical protein;locus_tag=BALIOE_09560;product=hypothetical protein;Parent=BALIOE_09560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3836 c1 Prodigal gene 1914350 1915258 . + . ID=BALIOE_09565_gene;locus_tag=BALIOE_09565 | |
| 3837 c1 Prodigal CDS 1914350 1915258 . + 0 ID=BALIOE_09565;Name=hypothetical protein;locus_tag=BALIOE_09565;product=hypothetical protein;Parent=BALIOE_09565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3838 c1 Prodigal gene 1915588 1916151 . + . ID=BALIOE_09570_gene;locus_tag=BALIOE_09570 | |
| 3839 c1 Prodigal CDS 1915588 1916151 . + 0 ID=BALIOE_09570;Name=hypothetical protein;locus_tag=BALIOE_09570;product=hypothetical protein;Parent=BALIOE_09570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3840 c1 Prodigal gene 1916172 1917404 . - . ID=BALIOE_09575_gene;locus_tag=BALIOE_09575 | |
| 3841 c1 Prodigal CDS 1916172 1917404 . - 0 ID=BALIOE_09575;Name=hypothetical protein;locus_tag=BALIOE_09575;product=hypothetical protein;Parent=BALIOE_09575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3842 c1 Prodigal gene 1917659 1918642 . + . ID=BALIOE_09580_gene;locus_tag=BALIOE_09580 | |
| 3843 c1 Prodigal CDS 1917659 1918642 . + 0 ID=BALIOE_09580;Name=hypothetical protein;locus_tag=BALIOE_09580;product=hypothetical protein;Parent=BALIOE_09580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3844 c1 Prodigal gene 1918917 1919087 . + . ID=BALIOE_09585_gene;locus_tag=BALIOE_09585 | |
| 3845 c1 Prodigal CDS 1918917 1919087 . + 0 ID=BALIOE_09585;Name=hypothetical protein;locus_tag=BALIOE_09585;product=hypothetical protein;Parent=BALIOE_09585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3846 c1 Prodigal gene 1919120 1920493 . + . ID=BALIOE_09590_gene;locus_tag=BALIOE_09590 | |
| 3847 c1 Prodigal CDS 1919120 1920493 . + 0 ID=BALIOE_09590;Name=hypothetical protein;locus_tag=BALIOE_09590;product=hypothetical protein;Parent=BALIOE_09590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3848 c1 Prodigal gene 1920622 1921557 . - . ID=BALIOE_09595_gene;locus_tag=BALIOE_09595 | |
| 3849 c1 Prodigal CDS 1920622 1921557 . - 0 ID=BALIOE_09595;Name=hypothetical protein;locus_tag=BALIOE_09595;product=hypothetical protein;Parent=BALIOE_09595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3850 c1 Prodigal gene 1921609 1922844 . - . ID=BALIOE_09600_gene;locus_tag=BALIOE_09600 | |
| 3851 c1 Prodigal CDS 1921609 1922844 . - 0 ID=BALIOE_09600;Name=hypothetical protein;locus_tag=BALIOE_09600;product=hypothetical protein;Parent=BALIOE_09600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3852 c1 Prodigal gene 1922846 1923061 . - . ID=BALIOE_09605_gene;locus_tag=BALIOE_09605 | |
| 3853 c1 Prodigal CDS 1922846 1923061 . - 0 ID=BALIOE_09605;Name=hypothetical protein;locus_tag=BALIOE_09605;product=hypothetical protein;Parent=BALIOE_09605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3854 c1 Prodigal gene 1923161 1923349 . - . ID=BALIOE_09610_gene;locus_tag=BALIOE_09610 | |
| 3855 c1 Prodigal CDS 1923161 1923349 . - 0 ID=BALIOE_09610;Name=hypothetical protein;locus_tag=BALIOE_09610;product=hypothetical protein;Parent=BALIOE_09610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3856 c1 Prodigal gene 1923592 1924401 . - . ID=BALIOE_09615_gene;locus_tag=BALIOE_09615 | |
| 3857 c1 Prodigal CDS 1923592 1924401 . - 0 ID=BALIOE_09615;Name=hypothetical protein;locus_tag=BALIOE_09615;product=hypothetical protein;Parent=BALIOE_09615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3858 c1 Prodigal gene 1924394 1926994 . - . ID=BALIOE_09620_gene;locus_tag=BALIOE_09620 | |
| 3859 c1 Prodigal CDS 1924394 1926994 . - 0 ID=BALIOE_09620;Name=hypothetical protein;locus_tag=BALIOE_09620;product=hypothetical protein;Parent=BALIOE_09620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3860 c1 Prodigal gene 1927096 1927371 . - . ID=BALIOE_09625_gene;locus_tag=BALIOE_09625 | |
| 3861 c1 Prodigal CDS 1927096 1927371 . - 0 ID=BALIOE_09625;Name=hypothetical protein;locus_tag=BALIOE_09625;product=hypothetical protein;Parent=BALIOE_09625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3862 c1 Prodigal gene 1927446 1927616 . - . ID=BALIOE_09630_gene;locus_tag=BALIOE_09630 | |
| 3863 c1 Prodigal CDS 1927446 1927616 . - 0 ID=BALIOE_09630;Name=hypothetical protein;locus_tag=BALIOE_09630;product=hypothetical protein;Parent=BALIOE_09630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3864 c1 Prodigal gene 1927616 1927837 . - . ID=BALIOE_09635_gene;locus_tag=BALIOE_09635 | |
| 3865 c1 Prodigal CDS 1927616 1927837 . - 0 ID=BALIOE_09635;Name=hypothetical protein;locus_tag=BALIOE_09635;product=hypothetical protein;Parent=BALIOE_09635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3866 c1 Prodigal gene 1928156 1928767 . + . ID=BALIOE_09640_gene;locus_tag=BALIOE_09640 | |
| 3867 c1 Prodigal CDS 1928156 1928767 . + 0 ID=BALIOE_09640;Name=hypothetical protein;locus_tag=BALIOE_09640;product=hypothetical protein;Parent=BALIOE_09640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3868 c1 Prodigal gene 1928764 1928919 . - . ID=BALIOE_09645_gene;locus_tag=BALIOE_09645 | |
| 3869 c1 Prodigal CDS 1928764 1928919 . - 0 ID=BALIOE_09645;Name=hypothetical protein;locus_tag=BALIOE_09645;product=hypothetical protein;Parent=BALIOE_09645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3870 c1 Prodigal gene 1928930 1929064 . - . ID=BALIOE_09650_gene;locus_tag=BALIOE_09650 | |
| 3871 c1 Prodigal CDS 1928930 1929064 . - 0 ID=BALIOE_09650;Name=hypothetical protein;locus_tag=BALIOE_09650;product=hypothetical protein;Parent=BALIOE_09650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3872 c1 Prodigal gene 1929352 1929771 . - . ID=BALIOE_09655_gene;locus_tag=BALIOE_09655 | |
| 3873 c1 Prodigal CDS 1929352 1929771 . - 0 ID=BALIOE_09655;Name=hypothetical protein;locus_tag=BALIOE_09655;product=hypothetical protein;Parent=BALIOE_09655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3874 c1 Prodigal gene 1929851 1930105 . + . ID=BALIOE_09660_gene;locus_tag=BALIOE_09660 | |
| 3875 c1 Prodigal CDS 1929851 1930105 . + 0 ID=BALIOE_09660;Name=hypothetical protein;locus_tag=BALIOE_09660;product=hypothetical protein;Parent=BALIOE_09660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3876 c1 Prodigal gene 1930102 1930524 . + . ID=BALIOE_09665_gene;locus_tag=BALIOE_09665 | |
| 3877 c1 Prodigal CDS 1930102 1930524 . + 0 ID=BALIOE_09665;Name=hypothetical protein;locus_tag=BALIOE_09665;product=hypothetical protein;Parent=BALIOE_09665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3878 c1 Prodigal gene 1930602 1931390 . + . ID=BALIOE_09670_gene;locus_tag=BALIOE_09670 | |
| 3879 c1 Prodigal CDS 1930602 1931390 . + 0 ID=BALIOE_09670;Name=hypothetical protein;locus_tag=BALIOE_09670;product=hypothetical protein;Parent=BALIOE_09670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3880 c1 Prodigal gene 1931397 1932143 . + . ID=BALIOE_09675_gene;locus_tag=BALIOE_09675 | |
| 3881 c1 Prodigal CDS 1931397 1932143 . + 0 ID=BALIOE_09675;Name=hypothetical protein;locus_tag=BALIOE_09675;product=hypothetical protein;Parent=BALIOE_09675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3882 c1 Prodigal gene 1932166 1932927 . + . ID=BALIOE_09680_gene;locus_tag=BALIOE_09680 | |
| 3883 c1 Prodigal CDS 1932166 1932927 . + 0 ID=BALIOE_09680;Name=hypothetical protein;locus_tag=BALIOE_09680;product=hypothetical protein;Parent=BALIOE_09680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3884 c1 Prodigal gene 1932943 1933365 . + . ID=BALIOE_09685_gene;locus_tag=BALIOE_09685 | |
| 3885 c1 Prodigal CDS 1932943 1933365 . + 0 ID=BALIOE_09685;Name=hypothetical protein;locus_tag=BALIOE_09685;product=hypothetical protein;Parent=BALIOE_09685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3886 c1 Prodigal gene 1933471 1933683 . + . ID=BALIOE_09690_gene;locus_tag=BALIOE_09690 | |
| 3887 c1 Prodigal CDS 1933471 1933683 . + 0 ID=BALIOE_09690;Name=hypothetical protein;locus_tag=BALIOE_09690;product=hypothetical protein;Parent=BALIOE_09690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3888 c1 Prodigal gene 1933935 1934198 . + . ID=BALIOE_09695_gene;locus_tag=BALIOE_09695 | |
| 3889 c1 Prodigal CDS 1933935 1934198 . + 0 ID=BALIOE_09695;Name=hypothetical protein;locus_tag=BALIOE_09695;product=hypothetical protein;Parent=BALIOE_09695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3890 c1 Prodigal gene 1934209 1934370 . + . ID=BALIOE_09700_gene;locus_tag=BALIOE_09700 | |
| 3891 c1 Prodigal CDS 1934209 1934370 . + 0 ID=BALIOE_09700;Name=hypothetical protein;locus_tag=BALIOE_09700;product=hypothetical protein;Parent=BALIOE_09700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3892 c1 Prodigal gene 1935126 1936277 . + . ID=BALIOE_09705_gene;locus_tag=BALIOE_09705 | |
| 3893 c1 Prodigal CDS 1935126 1936277 . + 0 ID=BALIOE_09705;Name=hypothetical protein;locus_tag=BALIOE_09705;product=hypothetical protein;Parent=BALIOE_09705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3894 c1 Prodigal gene 1936245 1937234 . - . ID=BALIOE_09710_gene;locus_tag=BALIOE_09710 | |
| 3895 c1 Prodigal CDS 1936245 1937234 . - 0 ID=BALIOE_09710;Name=hypothetical protein;locus_tag=BALIOE_09710;product=hypothetical protein;Parent=BALIOE_09710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3896 c1 Prodigal gene 1937234 1938625 . - . ID=BALIOE_09715_gene;locus_tag=BALIOE_09715 | |
| 3897 c1 Prodigal CDS 1937234 1938625 . - 0 ID=BALIOE_09715;Name=hypothetical protein;locus_tag=BALIOE_09715;product=hypothetical protein;Parent=BALIOE_09715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3898 c1 Prodigal gene 1939125 1939724 . + . ID=BALIOE_09720_gene;locus_tag=BALIOE_09720 | |
| 3899 c1 Prodigal CDS 1939125 1939724 . + 0 ID=BALIOE_09720;Name=hypothetical protein;locus_tag=BALIOE_09720;product=hypothetical protein;Parent=BALIOE_09720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3900 c1 Prodigal gene 1939724 1940014 . + . ID=BALIOE_09725_gene;locus_tag=BALIOE_09725 | |
| 3901 c1 Prodigal CDS 1939724 1940014 . + 0 ID=BALIOE_09725;Name=hypothetical protein;locus_tag=BALIOE_09725;product=hypothetical protein;Parent=BALIOE_09725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3902 c1 Prodigal gene 1940011 1940565 . + . ID=BALIOE_09730_gene;locus_tag=BALIOE_09730 | |
| 3903 c1 Prodigal CDS 1940011 1940565 . + 0 ID=BALIOE_09730;Name=hypothetical protein;locus_tag=BALIOE_09730;product=hypothetical protein;Parent=BALIOE_09730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3904 c1 tRNAscan-SE gene 1940705 1940780 . + . ID=BALIOE_09735_gene;locus_tag=BALIOE_09735;gene=Ile2_trna | |
| 3905 c1 tRNAscan-SE tRNA 1940705 1940780 . + . ID=BALIOE_09735;Name=tRNA-Ile2;locus_tag=BALIOE_09735;product=tRNA-Ile2;gene=Ile2_trna;Parent=BALIOE_09735_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 3906 c1 tRNAscan-SE gene 1940881 1940957 . + . ID=BALIOE_09740_gene;locus_tag=BALIOE_09740;gene=Arg_trna | |
| 3907 c1 tRNAscan-SE tRNA 1940881 1940957 . + . ID=BALIOE_09740;Name=tRNA-Arg;locus_tag=BALIOE_09740;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_09740_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 3908 c1 Prodigal gene 1941127 1941558 . + . ID=BALIOE_09745_gene;locus_tag=BALIOE_09745 | |
| 3909 c1 Prodigal CDS 1941127 1941558 . + 0 ID=BALIOE_09745;Name=hypothetical protein;locus_tag=BALIOE_09745;product=hypothetical protein;Parent=BALIOE_09745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3910 c1 Prodigal gene 1941371 1941889 . - . ID=BALIOE_09750_gene;locus_tag=BALIOE_09750 | |
| 3911 c1 Prodigal CDS 1941371 1941889 . - 0 ID=BALIOE_09750;Name=hypothetical protein;locus_tag=BALIOE_09750;product=hypothetical protein;Parent=BALIOE_09750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3912 c1 Prodigal gene 1942133 1943986 . + . ID=BALIOE_09755_gene;locus_tag=BALIOE_09755 | |
| 3913 c1 Prodigal CDS 1942133 1943986 . + 0 ID=BALIOE_09755;Name=hypothetical protein;locus_tag=BALIOE_09755;product=hypothetical protein;Parent=BALIOE_09755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3914 c1 Prodigal gene 1944136 1944351 . + . ID=BALIOE_09760_gene;locus_tag=BALIOE_09760 | |
| 3915 c1 Prodigal CDS 1944136 1944351 . + 0 ID=BALIOE_09760;Name=hypothetical protein;locus_tag=BALIOE_09760;product=hypothetical protein;Parent=BALIOE_09760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3916 c1 Prodigal gene 1944356 1944700 . + . ID=BALIOE_09765_gene;locus_tag=BALIOE_09765 | |
| 3917 c1 Prodigal CDS 1944356 1944700 . + 0 ID=BALIOE_09765;Name=hypothetical protein;locus_tag=BALIOE_09765;product=hypothetical protein;Parent=BALIOE_09765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3918 c1 Prodigal gene 1944751 1945284 . + . ID=BALIOE_09770_gene;locus_tag=BALIOE_09770 | |
| 3919 c1 Prodigal CDS 1944751 1945284 . + 0 ID=BALIOE_09770;Name=hypothetical protein;locus_tag=BALIOE_09770;product=hypothetical protein;Parent=BALIOE_09770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3920 c1 Prodigal gene 1945555 1946124 . + . ID=BALIOE_09775_gene;locus_tag=BALIOE_09775 | |
| 3921 c1 Prodigal CDS 1945555 1946124 . + 0 ID=BALIOE_09775;Name=hypothetical protein;locus_tag=BALIOE_09775;product=hypothetical protein;Parent=BALIOE_09775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3922 c1 Prodigal gene 1946124 1946270 . + . ID=BALIOE_09780_gene;locus_tag=BALIOE_09780 | |
| 3923 c1 Prodigal CDS 1946124 1946270 . + 0 ID=BALIOE_09780;Name=hypothetical protein;locus_tag=BALIOE_09780;product=hypothetical protein;Parent=BALIOE_09780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3924 c1 Prodigal gene 1946278 1946745 . + . ID=BALIOE_09785_gene;locus_tag=BALIOE_09785 | |
| 3925 c1 Prodigal CDS 1946278 1946745 . + 0 ID=BALIOE_09785;Name=hypothetical protein;locus_tag=BALIOE_09785;product=hypothetical protein;Parent=BALIOE_09785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3926 c1 Prodigal gene 1947108 1947335 . - . ID=BALIOE_09790_gene;locus_tag=BALIOE_09790 | |
| 3927 c1 Prodigal CDS 1947108 1947335 . - 0 ID=BALIOE_09790;Name=hypothetical protein;locus_tag=BALIOE_09790;product=hypothetical protein;Parent=BALIOE_09790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3928 c1 Prodigal gene 1947377 1947742 . + . ID=BALIOE_09795_gene;locus_tag=BALIOE_09795 | |
| 3929 c1 Prodigal CDS 1947377 1947742 . + 0 ID=BALIOE_09795;Name=hypothetical protein;locus_tag=BALIOE_09795;product=hypothetical protein;Parent=BALIOE_09795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3930 c1 Prodigal gene 1948032 1948595 . + . ID=BALIOE_09800_gene;locus_tag=BALIOE_09800 | |
| 3931 c1 Prodigal CDS 1948032 1948595 . + 0 ID=BALIOE_09800;Name=hypothetical protein;locus_tag=BALIOE_09800;product=hypothetical protein;Parent=BALIOE_09800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3932 c1 Prodigal gene 1948592 1950253 . + . ID=BALIOE_09805_gene;locus_tag=BALIOE_09805 | |
| 3933 c1 Prodigal CDS 1948592 1950253 . + 0 ID=BALIOE_09805;Name=hypothetical protein;locus_tag=BALIOE_09805;product=hypothetical protein;Parent=BALIOE_09805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3934 c1 Prodigal gene 1950317 1952254 . + . ID=BALIOE_09810_gene;locus_tag=BALIOE_09810 | |
| 3935 c1 Prodigal CDS 1950317 1952254 . + 0 ID=BALIOE_09810;Name=hypothetical protein;locus_tag=BALIOE_09810;product=hypothetical protein;Parent=BALIOE_09810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3936 c1 Prodigal gene 1952299 1952520 . + . ID=BALIOE_09815_gene;locus_tag=BALIOE_09815 | |
| 3937 c1 Prodigal CDS 1952299 1952520 . + 0 ID=BALIOE_09815;Name=hypothetical protein;locus_tag=BALIOE_09815;product=hypothetical protein;Parent=BALIOE_09815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3938 c1 Prodigal gene 1952466 1953830 . + . ID=BALIOE_09820_gene;locus_tag=BALIOE_09820 | |
| 3939 c1 Prodigal CDS 1952466 1953830 . + 0 ID=BALIOE_09820;Name=hypothetical protein;locus_tag=BALIOE_09820;product=hypothetical protein;Parent=BALIOE_09820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3940 c1 Prodigal gene 1953827 1955050 . + . ID=BALIOE_09825_gene;locus_tag=BALIOE_09825 | |
| 3941 c1 Prodigal CDS 1953827 1955050 . + 0 ID=BALIOE_09825;Name=hypothetical protein;locus_tag=BALIOE_09825;product=hypothetical protein;Parent=BALIOE_09825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3942 c1 Prodigal gene 1955047 1955373 . + . ID=BALIOE_09830_gene;locus_tag=BALIOE_09830 | |
| 3943 c1 Prodigal CDS 1955047 1955373 . + 0 ID=BALIOE_09830;Name=hypothetical protein;locus_tag=BALIOE_09830;product=hypothetical protein;Parent=BALIOE_09830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3944 c1 Prodigal gene 1955383 1955733 . + . ID=BALIOE_09835_gene;locus_tag=BALIOE_09835 | |
| 3945 c1 Prodigal CDS 1955383 1955733 . + 0 ID=BALIOE_09835;Name=hypothetical protein;locus_tag=BALIOE_09835;product=hypothetical protein;Parent=BALIOE_09835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3946 c1 Prodigal gene 1955730 1956176 . + . ID=BALIOE_09840_gene;locus_tag=BALIOE_09840 | |
| 3947 c1 Prodigal CDS 1955730 1956176 . + 0 ID=BALIOE_09840;Name=hypothetical protein;locus_tag=BALIOE_09840;product=hypothetical protein;Parent=BALIOE_09840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3948 c1 Prodigal gene 1956173 1956517 . + . ID=BALIOE_09845_gene;locus_tag=BALIOE_09845 | |
| 3949 c1 Prodigal CDS 1956173 1956517 . + 0 ID=BALIOE_09845;Name=hypothetical protein;locus_tag=BALIOE_09845;product=hypothetical protein;Parent=BALIOE_09845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3950 c1 Prodigal gene 1956586 1957302 . + . ID=BALIOE_09850_gene;locus_tag=BALIOE_09850 | |
| 3951 c1 Prodigal CDS 1956586 1957302 . + 0 ID=BALIOE_09850;Name=hypothetical protein;locus_tag=BALIOE_09850;product=hypothetical protein;Parent=BALIOE_09850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3952 c1 Prodigal gene 1957308 1957682 . + . ID=BALIOE_09855_gene;locus_tag=BALIOE_09855 | |
| 3953 c1 Prodigal CDS 1957308 1957682 . + 0 ID=BALIOE_09855;Name=hypothetical protein;locus_tag=BALIOE_09855;product=hypothetical protein;Parent=BALIOE_09855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3954 c1 Prodigal gene 1957778 1957987 . + . ID=BALIOE_09860_gene;locus_tag=BALIOE_09860 | |
| 3955 c1 Prodigal CDS 1957778 1957987 . + 0 ID=BALIOE_09860;Name=hypothetical protein;locus_tag=BALIOE_09860;product=hypothetical protein;Parent=BALIOE_09860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3956 c1 Prodigal gene 1958039 1961119 . + . ID=BALIOE_09865_gene;locus_tag=BALIOE_09865 | |
| 3957 c1 Prodigal CDS 1958039 1961119 . + 0 ID=BALIOE_09865;Name=hypothetical protein;locus_tag=BALIOE_09865;product=hypothetical protein;Parent=BALIOE_09865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3958 c1 Prodigal gene 1961112 1961453 . + . ID=BALIOE_09870_gene;locus_tag=BALIOE_09870 | |
| 3959 c1 Prodigal CDS 1961112 1961453 . + 0 ID=BALIOE_09870;Name=hypothetical protein;locus_tag=BALIOE_09870;product=hypothetical protein;Parent=BALIOE_09870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3960 c1 Prodigal gene 1961453 1962151 . + . ID=BALIOE_09875_gene;locus_tag=BALIOE_09875 | |
| 3961 c1 Prodigal CDS 1961453 1962151 . + 0 ID=BALIOE_09875;Name=hypothetical protein;locus_tag=BALIOE_09875;product=hypothetical protein;Parent=BALIOE_09875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3962 c1 Prodigal gene 1962162 1962905 . + . ID=BALIOE_09880_gene;locus_tag=BALIOE_09880 | |
| 3963 c1 Prodigal CDS 1962162 1962905 . + 0 ID=BALIOE_09880;Name=hypothetical protein;locus_tag=BALIOE_09880;product=hypothetical protein;Parent=BALIOE_09880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3964 c1 Prodigal gene 1962902 1963483 . + . ID=BALIOE_09885_gene;locus_tag=BALIOE_09885 | |
| 3965 c1 Prodigal CDS 1962902 1963483 . + 0 ID=BALIOE_09885;Name=hypothetical protein;locus_tag=BALIOE_09885;product=hypothetical protein;Parent=BALIOE_09885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3966 c1 Prodigal gene 1963674 1964201 . - . ID=BALIOE_09890_gene;locus_tag=BALIOE_09890 | |
| 3967 c1 Prodigal CDS 1963674 1964201 . - 0 ID=BALIOE_09890;Name=hypothetical protein;locus_tag=BALIOE_09890;product=hypothetical protein;Parent=BALIOE_09890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3968 c1 Prodigal gene 1964335 1967832 . + . ID=BALIOE_09895_gene;locus_tag=BALIOE_09895 | |
| 3969 c1 Prodigal CDS 1964335 1967832 . + 0 ID=BALIOE_09895;Name=hypothetical protein;locus_tag=BALIOE_09895;product=hypothetical protein;Parent=BALIOE_09895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3970 c1 Prodigal gene 1967903 1968502 . + . ID=BALIOE_09900_gene;locus_tag=BALIOE_09900 | |
| 3971 c1 Prodigal CDS 1967903 1968502 . + 0 ID=BALIOE_09900;Name=hypothetical protein;locus_tag=BALIOE_09900;product=hypothetical protein;Parent=BALIOE_09900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3972 c1 Prodigal gene 1968567 1969880 . + . ID=BALIOE_09905_gene;locus_tag=BALIOE_09905 | |
| 3973 c1 Prodigal CDS 1968567 1969880 . + 0 ID=BALIOE_09905;Name=hypothetical protein;locus_tag=BALIOE_09905;product=hypothetical protein;Parent=BALIOE_09905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3974 c1 Prodigal gene 1969882 1970151 . + . ID=BALIOE_09910_gene;locus_tag=BALIOE_09910 | |
| 3975 c1 Prodigal CDS 1969882 1970151 . + 0 ID=BALIOE_09910;Name=hypothetical protein;locus_tag=BALIOE_09910;product=hypothetical protein;Parent=BALIOE_09910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3976 c1 Prodigal gene 1970264 1970839 . + . ID=BALIOE_09915_gene;locus_tag=BALIOE_09915 | |
| 3977 c1 Prodigal CDS 1970264 1970839 . + 0 ID=BALIOE_09915;Name=hypothetical protein;locus_tag=BALIOE_09915;product=hypothetical protein;Parent=BALIOE_09915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3978 c1 Prodigal gene 1970912 1971541 . + . ID=BALIOE_09920_gene;locus_tag=BALIOE_09920 | |
| 3979 c1 Prodigal CDS 1970912 1971541 . + 0 ID=BALIOE_09920;Name=hypothetical protein;locus_tag=BALIOE_09920;product=hypothetical protein;Parent=BALIOE_09920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3980 c1 Prodigal gene 1971623 1972264 . + . ID=BALIOE_09925_gene;locus_tag=BALIOE_09925 | |
| 3981 c1 Prodigal CDS 1971623 1972264 . + 0 ID=BALIOE_09925;Name=hypothetical protein;locus_tag=BALIOE_09925;product=hypothetical protein;Parent=BALIOE_09925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3982 c1 Prodigal gene 1972845 1973279 . - . ID=BALIOE_09930_gene;locus_tag=BALIOE_09930 | |
| 3983 c1 Prodigal CDS 1972845 1973279 . - 0 ID=BALIOE_09930;Name=hypothetical protein;locus_tag=BALIOE_09930;product=hypothetical protein;Parent=BALIOE_09930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3984 c1 Prodigal gene 1973420 1974187 . - . ID=BALIOE_09935_gene;locus_tag=BALIOE_09935 | |
| 3985 c1 Prodigal CDS 1973420 1974187 . - 0 ID=BALIOE_09935;Name=hypothetical protein;locus_tag=BALIOE_09935;product=hypothetical protein;Parent=BALIOE_09935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3986 c1 Prodigal gene 1974162 1974533 . - . ID=BALIOE_09940_gene;locus_tag=BALIOE_09940 | |
| 3987 c1 Prodigal CDS 1974162 1974533 . - 0 ID=BALIOE_09940;Name=hypothetical protein;locus_tag=BALIOE_09940;product=hypothetical protein;Parent=BALIOE_09940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3988 c1 Prodigal gene 1974899 1978423 . - . ID=BALIOE_09945_gene;locus_tag=BALIOE_09945 | |
| 3989 c1 Prodigal CDS 1974899 1978423 . - 0 ID=BALIOE_09945;Name=hypothetical protein;locus_tag=BALIOE_09945;product=hypothetical protein;Parent=BALIOE_09945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3990 c1 Prodigal gene 1978697 1978963 . + . ID=BALIOE_09950_gene;locus_tag=BALIOE_09950 | |
| 3991 c1 Prodigal CDS 1978697 1978963 . + 0 ID=BALIOE_09950;Name=hypothetical protein;locus_tag=BALIOE_09950;product=hypothetical protein;Parent=BALIOE_09950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3992 c1 Prodigal gene 1978960 1979382 . - . ID=BALIOE_09955_gene;locus_tag=BALIOE_09955 | |
| 3993 c1 Prodigal CDS 1978960 1979382 . - 0 ID=BALIOE_09955;Name=hypothetical protein;locus_tag=BALIOE_09955;product=hypothetical protein;Parent=BALIOE_09955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3994 c1 Prodigal gene 1979493 1980482 . - . ID=BALIOE_09960_gene;locus_tag=BALIOE_09960 | |
| 3995 c1 Prodigal CDS 1979493 1980482 . - 0 ID=BALIOE_09960;Name=hypothetical protein;locus_tag=BALIOE_09960;product=hypothetical protein;Parent=BALIOE_09960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3996 c1 Prodigal gene 1980690 1983329 . + . ID=BALIOE_09965_gene;locus_tag=BALIOE_09965 | |
| 3997 c1 Prodigal CDS 1980690 1983329 . + 0 ID=BALIOE_09965;Name=hypothetical protein;locus_tag=BALIOE_09965;product=hypothetical protein;Parent=BALIOE_09965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 3998 c1 Prodigal gene 1983326 1983511 . + . ID=BALIOE_09970_gene;locus_tag=BALIOE_09970 | |
| 3999 c1 Prodigal CDS 1983326 1983511 . + 0 ID=BALIOE_09970;Name=hypothetical protein;locus_tag=BALIOE_09970;product=hypothetical protein;Parent=BALIOE_09970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4000 c1 Prodigal gene 1983519 1983842 . + . ID=BALIOE_09975_gene;locus_tag=BALIOE_09975 | |
| 4001 c1 Prodigal CDS 1983519 1983842 . + 0 ID=BALIOE_09975;Name=hypothetical protein;locus_tag=BALIOE_09975;product=hypothetical protein;Parent=BALIOE_09975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4002 c1 Prodigal gene 1984256 1987291 . + . ID=BALIOE_09980_gene;locus_tag=BALIOE_09980 | |
| 4003 c1 Prodigal CDS 1984256 1987291 . + 0 ID=BALIOE_09980;Name=hypothetical protein;locus_tag=BALIOE_09980;product=hypothetical protein;Parent=BALIOE_09980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4004 c1 Prodigal gene 1987511 1989970 . + . ID=BALIOE_09985_gene;locus_tag=BALIOE_09985 | |
| 4005 c1 Prodigal CDS 1987511 1989970 . + 0 ID=BALIOE_09985;Name=hypothetical protein;locus_tag=BALIOE_09985;product=hypothetical protein;Parent=BALIOE_09985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4006 c1 Prodigal gene 1990190 1991050 . + . ID=BALIOE_09990_gene;locus_tag=BALIOE_09990 | |
| 4007 c1 Prodigal CDS 1990190 1991050 . + 0 ID=BALIOE_09990;Name=hypothetical protein;locus_tag=BALIOE_09990;product=hypothetical protein;Parent=BALIOE_09990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4008 c1 Prodigal gene 1991114 1993420 . + . ID=BALIOE_09995_gene;locus_tag=BALIOE_09995 | |
| 4009 c1 Prodigal CDS 1991114 1993420 . + 0 ID=BALIOE_09995;Name=hypothetical protein;locus_tag=BALIOE_09995;product=hypothetical protein;Parent=BALIOE_09995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4010 c1 Prodigal gene 1993591 1994196 . + . ID=BALIOE_10000_gene;locus_tag=BALIOE_10000 | |
| 4011 c1 Prodigal CDS 1993591 1994196 . + 0 ID=BALIOE_10000;Name=hypothetical protein;locus_tag=BALIOE_10000;product=hypothetical protein;Parent=BALIOE_10000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4012 c1 Prodigal gene 1994196 1995092 . + . ID=BALIOE_10005_gene;locus_tag=BALIOE_10005 | |
| 4013 c1 Prodigal CDS 1994196 1995092 . + 0 ID=BALIOE_10005;Name=hypothetical protein;locus_tag=BALIOE_10005;product=hypothetical protein;Parent=BALIOE_10005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4014 c1 Prodigal gene 1995108 1996865 . + . ID=BALIOE_10010_gene;locus_tag=BALIOE_10010 | |
| 4015 c1 Prodigal CDS 1995108 1996865 . + 0 ID=BALIOE_10010;Name=hypothetical protein;locus_tag=BALIOE_10010;product=hypothetical protein;Parent=BALIOE_10010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4016 c1 Prodigal gene 1996855 1998171 . + . ID=BALIOE_10015_gene;locus_tag=BALIOE_10015 | |
| 4017 c1 Prodigal CDS 1996855 1998171 . + 0 ID=BALIOE_10015;Name=hypothetical protein;locus_tag=BALIOE_10015;product=hypothetical protein;Parent=BALIOE_10015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4018 c1 Prodigal gene 1998222 1998827 . - . ID=BALIOE_10020_gene;locus_tag=BALIOE_10020 | |
| 4019 c1 Prodigal CDS 1998222 1998827 . - 0 ID=BALIOE_10020;Name=hypothetical protein;locus_tag=BALIOE_10020;product=hypothetical protein;Parent=BALIOE_10020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4020 c1 Prodigal gene 1999028 2002930 . + . ID=BALIOE_10025_gene;locus_tag=BALIOE_10025 | |
| 4021 c1 Prodigal CDS 1999028 2002930 . + 0 ID=BALIOE_10025;Name=hypothetical protein;locus_tag=BALIOE_10025;product=hypothetical protein;Parent=BALIOE_10025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4022 c1 Prodigal gene 2003076 2003501 . + . ID=BALIOE_10030_gene;locus_tag=BALIOE_10030 | |
| 4023 c1 Prodigal CDS 2003076 2003501 . + 0 ID=BALIOE_10030;Name=hypothetical protein;locus_tag=BALIOE_10030;product=hypothetical protein;Parent=BALIOE_10030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4024 c1 Prodigal gene 2003506 2003844 . + . ID=BALIOE_10035_gene;locus_tag=BALIOE_10035 | |
| 4025 c1 Prodigal CDS 2003506 2003844 . + 0 ID=BALIOE_10035;Name=hypothetical protein;locus_tag=BALIOE_10035;product=hypothetical protein;Parent=BALIOE_10035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4026 c1 Prodigal gene 2003831 2004262 . + . ID=BALIOE_10040_gene;locus_tag=BALIOE_10040 | |
| 4027 c1 Prodigal CDS 2003831 2004262 . + 0 ID=BALIOE_10040;Name=hypothetical protein;locus_tag=BALIOE_10040;product=hypothetical protein;Parent=BALIOE_10040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4028 c1 Prodigal gene 2004387 2004764 . + . ID=BALIOE_10045_gene;locus_tag=BALIOE_10045 | |
| 4029 c1 Prodigal CDS 2004387 2004764 . + 0 ID=BALIOE_10045;Name=hypothetical protein;locus_tag=BALIOE_10045;product=hypothetical protein;Parent=BALIOE_10045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4030 c1 Prodigal gene 2004880 2005680 . + . ID=BALIOE_10050_gene;locus_tag=BALIOE_10050 | |
| 4031 c1 Prodigal CDS 2004880 2005680 . + 0 ID=BALIOE_10050;Name=hypothetical protein;locus_tag=BALIOE_10050;product=hypothetical protein;Parent=BALIOE_10050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4032 c1 Prodigal gene 2005877 2007316 . + . ID=BALIOE_10055_gene;locus_tag=BALIOE_10055 | |
| 4033 c1 Prodigal CDS 2005877 2007316 . + 0 ID=BALIOE_10055;Name=hypothetical protein;locus_tag=BALIOE_10055;product=hypothetical protein;Parent=BALIOE_10055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4034 c1 Prodigal gene 2007358 2008359 . - . ID=BALIOE_10060_gene;locus_tag=BALIOE_10060 | |
| 4035 c1 Prodigal CDS 2007358 2008359 . - 0 ID=BALIOE_10060;Name=hypothetical protein;locus_tag=BALIOE_10060;product=hypothetical protein;Parent=BALIOE_10060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4036 c1 Prodigal gene 2008548 2009078 . + . ID=BALIOE_10065_gene;locus_tag=BALIOE_10065 | |
| 4037 c1 Prodigal CDS 2008548 2009078 . + 0 ID=BALIOE_10065;Name=hypothetical protein;locus_tag=BALIOE_10065;product=hypothetical protein;Parent=BALIOE_10065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4038 c1 Prodigal gene 2009323 2009496 . + . ID=BALIOE_10070_gene;locus_tag=BALIOE_10070 | |
| 4039 c1 Prodigal CDS 2009323 2009496 . + 0 ID=BALIOE_10070;Name=hypothetical protein;locus_tag=BALIOE_10070;product=hypothetical protein;Parent=BALIOE_10070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4040 c1 Prodigal gene 2009608 2009775 . - . ID=BALIOE_10075_gene;locus_tag=BALIOE_10075 | |
| 4041 c1 Prodigal CDS 2009608 2009775 . - 0 ID=BALIOE_10075;Name=hypothetical protein;locus_tag=BALIOE_10075;product=hypothetical protein;Parent=BALIOE_10075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4042 c1 Prodigal gene 2010116 2011756 . + . ID=BALIOE_10080_gene;locus_tag=BALIOE_10080 | |
| 4043 c1 Prodigal CDS 2010116 2011756 . + 0 ID=BALIOE_10080;Name=hypothetical protein;locus_tag=BALIOE_10080;product=hypothetical protein;Parent=BALIOE_10080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4044 c1 Prodigal gene 2011794 2012717 . - . ID=BALIOE_10085_gene;locus_tag=BALIOE_10085 | |
| 4045 c1 Prodigal CDS 2011794 2012717 . - 0 ID=BALIOE_10085;Name=hypothetical protein;locus_tag=BALIOE_10085;product=hypothetical protein;Parent=BALIOE_10085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4046 c1 Prodigal gene 2012934 2014277 . + . ID=BALIOE_10090_gene;locus_tag=BALIOE_10090 | |
| 4047 c1 Prodigal CDS 2012934 2014277 . + 0 ID=BALIOE_10090;Name=hypothetical protein;locus_tag=BALIOE_10090;product=hypothetical protein;Parent=BALIOE_10090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4048 c1 Prodigal gene 2014538 2016157 . + . ID=BALIOE_10095_gene;locus_tag=BALIOE_10095 | |
| 4049 c1 Prodigal CDS 2014538 2016157 . + 0 ID=BALIOE_10095;Name=hypothetical protein;locus_tag=BALIOE_10095;product=hypothetical protein;Parent=BALIOE_10095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4050 c1 Prodigal gene 2016297 2016521 . + . ID=BALIOE_10100_gene;locus_tag=BALIOE_10100 | |
| 4051 c1 Prodigal CDS 2016297 2016521 . + 0 ID=BALIOE_10100;Name=hypothetical protein;locus_tag=BALIOE_10100;product=hypothetical protein;Parent=BALIOE_10100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4052 c1 Prodigal gene 2016584 2016880 . + . ID=BALIOE_10105_gene;locus_tag=BALIOE_10105 | |
| 4053 c1 Prodigal CDS 2016584 2016880 . + 0 ID=BALIOE_10105;Name=hypothetical protein;locus_tag=BALIOE_10105;product=hypothetical protein;Parent=BALIOE_10105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4054 c1 Prodigal gene 2017115 2018095 . - . ID=BALIOE_10110_gene;locus_tag=BALIOE_10110 | |
| 4055 c1 Prodigal CDS 2017115 2018095 . - 0 ID=BALIOE_10110;Name=hypothetical protein;locus_tag=BALIOE_10110;product=hypothetical protein;Parent=BALIOE_10110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4056 c1 Prodigal gene 2018219 2019211 . + . ID=BALIOE_10115_gene;locus_tag=BALIOE_10115 | |
| 4057 c1 Prodigal CDS 2018219 2019211 . + 0 ID=BALIOE_10115;Name=hypothetical protein;locus_tag=BALIOE_10115;product=hypothetical protein;Parent=BALIOE_10115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4058 c1 Prodigal gene 2019208 2019801 . + . ID=BALIOE_10120_gene;locus_tag=BALIOE_10120 | |
| 4059 c1 Prodigal CDS 2019208 2019801 . + 0 ID=BALIOE_10120;Name=hypothetical protein;locus_tag=BALIOE_10120;product=hypothetical protein;Parent=BALIOE_10120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4060 c1 Prodigal gene 2020105 2020773 . + . ID=BALIOE_10125_gene;locus_tag=BALIOE_10125 | |
| 4061 c1 Prodigal CDS 2020105 2020773 . + 0 ID=BALIOE_10125;Name=hypothetical protein;locus_tag=BALIOE_10125;product=hypothetical protein;Parent=BALIOE_10125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4062 c1 Prodigal gene 2020808 2021980 . - . ID=BALIOE_10130_gene;locus_tag=BALIOE_10130 | |
| 4063 c1 Prodigal CDS 2020808 2021980 . - 0 ID=BALIOE_10130;Name=hypothetical protein;locus_tag=BALIOE_10130;product=hypothetical protein;Parent=BALIOE_10130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4064 c1 Prodigal gene 2022072 2022608 . + . ID=BALIOE_10135_gene;locus_tag=BALIOE_10135 | |
| 4065 c1 Prodigal CDS 2022072 2022608 . + 0 ID=BALIOE_10135;Name=hypothetical protein;locus_tag=BALIOE_10135;product=hypothetical protein;Parent=BALIOE_10135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4066 c1 Prodigal gene 2022639 2024642 . + . ID=BALIOE_10140_gene;locus_tag=BALIOE_10140 | |
| 4067 c1 Prodigal CDS 2022639 2024642 . + 0 ID=BALIOE_10140;Name=hypothetical protein;locus_tag=BALIOE_10140;product=hypothetical protein;Parent=BALIOE_10140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4068 c1 Prodigal gene 2024734 2024904 . - . ID=BALIOE_10145_gene;locus_tag=BALIOE_10145 | |
| 4069 c1 Prodigal CDS 2024734 2024904 . - 0 ID=BALIOE_10145;Name=hypothetical protein;locus_tag=BALIOE_10145;product=hypothetical protein;Parent=BALIOE_10145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4070 c1 Prodigal gene 2025186 2025362 . + . ID=BALIOE_10150_gene;locus_tag=BALIOE_10150 | |
| 4071 c1 Prodigal CDS 2025186 2025362 . + 0 ID=BALIOE_10150;Name=hypothetical protein;locus_tag=BALIOE_10150;product=hypothetical protein;Parent=BALIOE_10150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4072 c1 Prodigal gene 2025387 2025824 . + . ID=BALIOE_10155_gene;locus_tag=BALIOE_10155 | |
| 4073 c1 Prodigal CDS 2025387 2025824 . + 0 ID=BALIOE_10155;Name=hypothetical protein;locus_tag=BALIOE_10155;product=hypothetical protein;Parent=BALIOE_10155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4074 c1 Prodigal gene 2025903 2027309 . + . ID=BALIOE_10160_gene;locus_tag=BALIOE_10160 | |
| 4075 c1 Prodigal CDS 2025903 2027309 . + 0 ID=BALIOE_10160;Name=hypothetical protein;locus_tag=BALIOE_10160;product=hypothetical protein;Parent=BALIOE_10160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4076 c1 Prodigal gene 2027554 2028699 . + . ID=BALIOE_10165_gene;locus_tag=BALIOE_10165 | |
| 4077 c1 Prodigal CDS 2027554 2028699 . + 0 ID=BALIOE_10165;Name=hypothetical protein;locus_tag=BALIOE_10165;product=hypothetical protein;Parent=BALIOE_10165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4078 c1 Prodigal gene 2028717 2029730 . + . ID=BALIOE_10170_gene;locus_tag=BALIOE_10170 | |
| 4079 c1 Prodigal CDS 2028717 2029730 . + 0 ID=BALIOE_10170;Name=hypothetical protein;locus_tag=BALIOE_10170;product=hypothetical protein;Parent=BALIOE_10170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4080 c1 Prodigal gene 2029731 2030672 . + . ID=BALIOE_10175_gene;locus_tag=BALIOE_10175 | |
| 4081 c1 Prodigal CDS 2029731 2030672 . + 0 ID=BALIOE_10175;Name=hypothetical protein;locus_tag=BALIOE_10175;product=hypothetical protein;Parent=BALIOE_10175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4082 c1 Prodigal gene 2030662 2031456 . + . ID=BALIOE_10180_gene;locus_tag=BALIOE_10180 | |
| 4083 c1 Prodigal CDS 2030662 2031456 . + 0 ID=BALIOE_10180;Name=hypothetical protein;locus_tag=BALIOE_10180;product=hypothetical protein;Parent=BALIOE_10180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4084 c1 Prodigal gene 2031478 2032902 . + . ID=BALIOE_10185_gene;locus_tag=BALIOE_10185 | |
| 4085 c1 Prodigal CDS 2031478 2032902 . + 0 ID=BALIOE_10185;Name=hypothetical protein;locus_tag=BALIOE_10185;product=hypothetical protein;Parent=BALIOE_10185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4086 c1 Prodigal gene 2033289 2033462 . + . ID=BALIOE_10190_gene;locus_tag=BALIOE_10190 | |
| 4087 c1 Prodigal CDS 2033289 2033462 . + 0 ID=BALIOE_10190;Name=hypothetical protein;locus_tag=BALIOE_10190;product=hypothetical protein;Parent=BALIOE_10190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4088 c1 Prodigal gene 2033548 2033781 . + . ID=BALIOE_10195_gene;locus_tag=BALIOE_10195 | |
| 4089 c1 Prodigal CDS 2033548 2033781 . + 0 ID=BALIOE_10195;Name=hypothetical protein;locus_tag=BALIOE_10195;product=hypothetical protein;Parent=BALIOE_10195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4090 c1 Prodigal gene 2033782 2034231 . - . ID=BALIOE_10200_gene;locus_tag=BALIOE_10200 | |
| 4091 c1 Prodigal CDS 2033782 2034231 . - 0 ID=BALIOE_10200;Name=hypothetical protein;locus_tag=BALIOE_10200;product=hypothetical protein;Parent=BALIOE_10200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4092 c1 Prodigal gene 2034228 2034746 . - . ID=BALIOE_10205_gene;locus_tag=BALIOE_10205 | |
| 4093 c1 Prodigal CDS 2034228 2034746 . - 0 ID=BALIOE_10205;Name=hypothetical protein;locus_tag=BALIOE_10205;product=hypothetical protein;Parent=BALIOE_10205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4094 c1 Prodigal gene 2034927 2035964 . + . ID=BALIOE_10210_gene;locus_tag=BALIOE_10210 | |
| 4095 c1 Prodigal CDS 2034927 2035964 . + 0 ID=BALIOE_10210;Name=hypothetical protein;locus_tag=BALIOE_10210;product=hypothetical protein;Parent=BALIOE_10210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4096 c1 Prodigal gene 2036162 2036827 . + . ID=BALIOE_10215_gene;locus_tag=BALIOE_10215 | |
| 4097 c1 Prodigal CDS 2036162 2036827 . + 0 ID=BALIOE_10215;Name=hypothetical protein;locus_tag=BALIOE_10215;product=hypothetical protein;Parent=BALIOE_10215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4098 c1 Prodigal gene 2036863 2038965 . - . ID=BALIOE_10220_gene;locus_tag=BALIOE_10220 | |
| 4099 c1 Prodigal CDS 2036863 2038965 . - 0 ID=BALIOE_10220;Name=hypothetical protein;locus_tag=BALIOE_10220;product=hypothetical protein;Parent=BALIOE_10220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4100 c1 Prodigal gene 2039207 2040268 . + . ID=BALIOE_10225_gene;locus_tag=BALIOE_10225 | |
| 4101 c1 Prodigal CDS 2039207 2040268 . + 0 ID=BALIOE_10225;Name=hypothetical protein;locus_tag=BALIOE_10225;product=hypothetical protein;Parent=BALIOE_10225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4102 c1 Prodigal gene 2040383 2041882 . - . ID=BALIOE_10230_gene;locus_tag=BALIOE_10230 | |
| 4103 c1 Prodigal CDS 2040383 2041882 . - 0 ID=BALIOE_10230;Name=hypothetical protein;locus_tag=BALIOE_10230;product=hypothetical protein;Parent=BALIOE_10230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4104 c1 Prodigal gene 2042149 2042766 . + . ID=BALIOE_10235_gene;locus_tag=BALIOE_10235 | |
| 4105 c1 Prodigal CDS 2042149 2042766 . + 0 ID=BALIOE_10235;Name=hypothetical protein;locus_tag=BALIOE_10235;product=hypothetical protein;Parent=BALIOE_10235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4106 c1 Prodigal gene 2042842 2043054 . + . ID=BALIOE_10240_gene;locus_tag=BALIOE_10240 | |
| 4107 c1 Prodigal CDS 2042842 2043054 . + 0 ID=BALIOE_10240;Name=hypothetical protein;locus_tag=BALIOE_10240;product=hypothetical protein;Parent=BALIOE_10240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4108 c1 Prodigal gene 2043875 2045983 . + . ID=BALIOE_10245_gene;locus_tag=BALIOE_10245 | |
| 4109 c1 Prodigal CDS 2043875 2045983 . + 0 ID=BALIOE_10245;Name=hypothetical protein;locus_tag=BALIOE_10245;product=hypothetical protein;Parent=BALIOE_10245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4110 c1 Prodigal gene 2046050 2050252 . + . ID=BALIOE_10250_gene;locus_tag=BALIOE_10250 | |
| 4111 c1 Prodigal CDS 2046050 2050252 . + 0 ID=BALIOE_10250;Name=hypothetical protein;locus_tag=BALIOE_10250;product=hypothetical protein;Parent=BALIOE_10250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4112 c1 Prodigal gene 2050264 2050449 . + . ID=BALIOE_10255_gene;locus_tag=BALIOE_10255 | |
| 4113 c1 Prodigal CDS 2050264 2050449 . + 0 ID=BALIOE_10255;Name=hypothetical protein;locus_tag=BALIOE_10255;product=hypothetical protein;Parent=BALIOE_10255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4114 c1 Prodigal gene 2050449 2050658 . + . ID=BALIOE_10260_gene;locus_tag=BALIOE_10260 | |
| 4115 c1 Prodigal CDS 2050449 2050658 . + 0 ID=BALIOE_10260;Name=hypothetical protein;locus_tag=BALIOE_10260;product=hypothetical protein;Parent=BALIOE_10260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4116 c1 Prodigal gene 2051166 2051345 . + . ID=BALIOE_10265_gene;locus_tag=BALIOE_10265 | |
| 4117 c1 Prodigal CDS 2051166 2051345 . + 0 ID=BALIOE_10265;Name=hypothetical protein;locus_tag=BALIOE_10265;product=hypothetical protein;Parent=BALIOE_10265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4118 c1 Prodigal gene 2051445 2052056 . + . ID=BALIOE_10270_gene;locus_tag=BALIOE_10270 | |
| 4119 c1 Prodigal CDS 2051445 2052056 . + 0 ID=BALIOE_10270;Name=hypothetical protein;locus_tag=BALIOE_10270;product=hypothetical protein;Parent=BALIOE_10270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4120 c1 Prodigal gene 2052425 2052652 . + . ID=BALIOE_10275_gene;locus_tag=BALIOE_10275 | |
| 4121 c1 Prodigal CDS 2052425 2052652 . + 0 ID=BALIOE_10275;Name=hypothetical protein;locus_tag=BALIOE_10275;product=hypothetical protein;Parent=BALIOE_10275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4122 c1 Prodigal gene 2052656 2053099 . - . ID=BALIOE_10280_gene;locus_tag=BALIOE_10280 | |
| 4123 c1 Prodigal CDS 2052656 2053099 . - 0 ID=BALIOE_10280;Name=hypothetical protein;locus_tag=BALIOE_10280;product=hypothetical protein;Parent=BALIOE_10280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4124 c1 Prodigal gene 2053103 2053225 . - . ID=BALIOE_10285_gene;locus_tag=BALIOE_10285 | |
| 4125 c1 Prodigal CDS 2053103 2053225 . - 0 ID=BALIOE_10285;Name=hypothetical protein;locus_tag=BALIOE_10285;product=hypothetical protein;Parent=BALIOE_10285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4126 c1 Prodigal gene 2053398 2054132 . + . ID=BALIOE_10290_gene;locus_tag=BALIOE_10290 | |
| 4127 c1 Prodigal CDS 2053398 2054132 . + 0 ID=BALIOE_10290;Name=hypothetical protein;locus_tag=BALIOE_10290;product=hypothetical protein;Parent=BALIOE_10290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4128 c1 Prodigal gene 2054132 2054242 . + . ID=BALIOE_10295_gene;locus_tag=BALIOE_10295 | |
| 4129 c1 Prodigal CDS 2054132 2054242 . + 0 ID=BALIOE_10295;Name=hypothetical protein;locus_tag=BALIOE_10295;product=hypothetical protein;Parent=BALIOE_10295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4130 c1 Prodigal gene 2054338 2055231 . - . ID=BALIOE_10300_gene;locus_tag=BALIOE_10300 | |
| 4131 c1 Prodigal CDS 2054338 2055231 . - 0 ID=BALIOE_10300;Name=hypothetical protein;locus_tag=BALIOE_10300;product=hypothetical protein;Parent=BALIOE_10300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4132 c1 Prodigal gene 2055310 2055990 . - . ID=BALIOE_10305_gene;locus_tag=BALIOE_10305 | |
| 4133 c1 Prodigal CDS 2055310 2055990 . - 0 ID=BALIOE_10305;Name=hypothetical protein;locus_tag=BALIOE_10305;product=hypothetical protein;Parent=BALIOE_10305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4134 c1 Prodigal gene 2055987 2056682 . - . ID=BALIOE_10310_gene;locus_tag=BALIOE_10310 | |
| 4135 c1 Prodigal CDS 2055987 2056682 . - 0 ID=BALIOE_10310;Name=hypothetical protein;locus_tag=BALIOE_10310;product=hypothetical protein;Parent=BALIOE_10310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4136 c1 Prodigal gene 2056682 2058226 . - . ID=BALIOE_10315_gene;locus_tag=BALIOE_10315 | |
| 4137 c1 Prodigal CDS 2056682 2058226 . - 0 ID=BALIOE_10315;Name=hypothetical protein;locus_tag=BALIOE_10315;product=hypothetical protein;Parent=BALIOE_10315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4138 c1 Prodigal gene 2058223 2061963 . - . ID=BALIOE_10320_gene;locus_tag=BALIOE_10320 | |
| 4139 c1 Prodigal CDS 2058223 2061963 . - 0 ID=BALIOE_10320;Name=hypothetical protein;locus_tag=BALIOE_10320;product=hypothetical protein;Parent=BALIOE_10320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4140 c1 Prodigal gene 2062045 2063433 . - . ID=BALIOE_10325_gene;locus_tag=BALIOE_10325 | |
| 4141 c1 Prodigal CDS 2062045 2063433 . - 0 ID=BALIOE_10325;Name=hypothetical protein;locus_tag=BALIOE_10325;product=hypothetical protein;Parent=BALIOE_10325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4142 c1 Prodigal gene 2063739 2064998 . - . ID=BALIOE_10330_gene;locus_tag=BALIOE_10330 | |
| 4143 c1 Prodigal CDS 2063739 2064998 . - 0 ID=BALIOE_10330;Name=hypothetical protein;locus_tag=BALIOE_10330;product=hypothetical protein;Parent=BALIOE_10330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4144 c1 Prodigal gene 2065061 2065693 . - . ID=BALIOE_10335_gene;locus_tag=BALIOE_10335 | |
| 4145 c1 Prodigal CDS 2065061 2065693 . - 0 ID=BALIOE_10335;Name=hypothetical protein;locus_tag=BALIOE_10335;product=hypothetical protein;Parent=BALIOE_10335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4146 c1 Prodigal gene 2065816 2066319 . - . ID=BALIOE_10340_gene;locus_tag=BALIOE_10340 | |
| 4147 c1 Prodigal CDS 2065816 2066319 . - 0 ID=BALIOE_10340;Name=hypothetical protein;locus_tag=BALIOE_10340;product=hypothetical protein;Parent=BALIOE_10340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4148 c1 Prodigal gene 2066488 2067588 . - . ID=BALIOE_10345_gene;locus_tag=BALIOE_10345 | |
| 4149 c1 Prodigal CDS 2066488 2067588 . - 0 ID=BALIOE_10345;Name=hypothetical protein;locus_tag=BALIOE_10345;product=hypothetical protein;Parent=BALIOE_10345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4150 c1 Prodigal gene 2067847 2068671 . - . ID=BALIOE_10350_gene;locus_tag=BALIOE_10350 | |
| 4151 c1 Prodigal CDS 2067847 2068671 . - 0 ID=BALIOE_10350;Name=hypothetical protein;locus_tag=BALIOE_10350;product=hypothetical protein;Parent=BALIOE_10350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4152 c1 Prodigal gene 2068960 2069547 . + . ID=BALIOE_10355_gene;locus_tag=BALIOE_10355 | |
| 4153 c1 Prodigal CDS 2068960 2069547 . + 0 ID=BALIOE_10355;Name=hypothetical protein;locus_tag=BALIOE_10355;product=hypothetical protein;Parent=BALIOE_10355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4154 c1 Prodigal gene 2069596 2072007 . + . ID=BALIOE_10360_gene;locus_tag=BALIOE_10360 | |
| 4155 c1 Prodigal CDS 2069596 2072007 . + 0 ID=BALIOE_10360;Name=hypothetical protein;locus_tag=BALIOE_10360;product=hypothetical protein;Parent=BALIOE_10360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4156 c1 Prodigal gene 2072020 2072904 . + . ID=BALIOE_10365_gene;locus_tag=BALIOE_10365 | |
| 4157 c1 Prodigal CDS 2072020 2072904 . + 0 ID=BALIOE_10365;Name=hypothetical protein;locus_tag=BALIOE_10365;product=hypothetical protein;Parent=BALIOE_10365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4158 c1 Prodigal gene 2072897 2073550 . + . ID=BALIOE_10370_gene;locus_tag=BALIOE_10370 | |
| 4159 c1 Prodigal CDS 2072897 2073550 . + 0 ID=BALIOE_10370;Name=hypothetical protein;locus_tag=BALIOE_10370;product=hypothetical protein;Parent=BALIOE_10370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4160 c1 Prodigal gene 2073778 2074062 . - . ID=BALIOE_10375_gene;locus_tag=BALIOE_10375 | |
| 4161 c1 Prodigal CDS 2073778 2074062 . - 0 ID=BALIOE_10375;Name=hypothetical protein;locus_tag=BALIOE_10375;product=hypothetical protein;Parent=BALIOE_10375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4162 c1 Prodigal gene 2074208 2075218 . - . ID=BALIOE_10380_gene;locus_tag=BALIOE_10380 | |
| 4163 c1 Prodigal CDS 2074208 2075218 . - 0 ID=BALIOE_10380;Name=hypothetical protein;locus_tag=BALIOE_10380;product=hypothetical protein;Parent=BALIOE_10380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4164 c1 Prodigal gene 2075352 2077049 . - . ID=BALIOE_10385_gene;locus_tag=BALIOE_10385 | |
| 4165 c1 Prodigal CDS 2075352 2077049 . - 0 ID=BALIOE_10385;Name=hypothetical protein;locus_tag=BALIOE_10385;product=hypothetical protein;Parent=BALIOE_10385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4166 c1 Prodigal gene 2077206 2077343 . - . ID=BALIOE_10390_gene;locus_tag=BALIOE_10390 | |
| 4167 c1 Prodigal CDS 2077206 2077343 . - 0 ID=BALIOE_10390;Name=hypothetical protein;locus_tag=BALIOE_10390;product=hypothetical protein;Parent=BALIOE_10390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4168 c1 Prodigal gene 2077445 2077660 . - . ID=BALIOE_10395_gene;locus_tag=BALIOE_10395 | |
| 4169 c1 Prodigal CDS 2077445 2077660 . - 0 ID=BALIOE_10395;Name=hypothetical protein;locus_tag=BALIOE_10395;product=hypothetical protein;Parent=BALIOE_10395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4170 c1 Prodigal gene 2078005 2078436 . + . ID=BALIOE_10400_gene;locus_tag=BALIOE_10400 | |
| 4171 c1 Prodigal CDS 2078005 2078436 . + 0 ID=BALIOE_10400;Name=hypothetical protein;locus_tag=BALIOE_10400;product=hypothetical protein;Parent=BALIOE_10400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4172 c1 Prodigal gene 2078492 2079418 . - . ID=BALIOE_10405_gene;locus_tag=BALIOE_10405 | |
| 4173 c1 Prodigal CDS 2078492 2079418 . - 0 ID=BALIOE_10405;Name=hypothetical protein;locus_tag=BALIOE_10405;product=hypothetical protein;Parent=BALIOE_10405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4174 c1 Prodigal gene 2079411 2080397 . - . ID=BALIOE_10410_gene;locus_tag=BALIOE_10410 | |
| 4175 c1 Prodigal CDS 2079411 2080397 . - 0 ID=BALIOE_10410;Name=hypothetical protein;locus_tag=BALIOE_10410;product=hypothetical protein;Parent=BALIOE_10410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4176 c1 Prodigal gene 2080394 2081290 . - . ID=BALIOE_10415_gene;locus_tag=BALIOE_10415 | |
| 4177 c1 Prodigal CDS 2080394 2081290 . - 0 ID=BALIOE_10415;Name=hypothetical protein;locus_tag=BALIOE_10415;product=hypothetical protein;Parent=BALIOE_10415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4178 c1 Prodigal gene 2081287 2082267 . - . ID=BALIOE_10420_gene;locus_tag=BALIOE_10420 | |
| 4179 c1 Prodigal CDS 2081287 2082267 . - 0 ID=BALIOE_10420;Name=hypothetical protein;locus_tag=BALIOE_10420;product=hypothetical protein;Parent=BALIOE_10420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4180 c1 Prodigal gene 2082310 2083860 . - . ID=BALIOE_10425_gene;locus_tag=BALIOE_10425 | |
| 4181 c1 Prodigal CDS 2082310 2083860 . - 0 ID=BALIOE_10425;Name=hypothetical protein;locus_tag=BALIOE_10425;product=hypothetical protein;Parent=BALIOE_10425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4182 c1 Prodigal gene 2083874 2084455 . - . ID=BALIOE_10430_gene;locus_tag=BALIOE_10430 | |
| 4183 c1 Prodigal CDS 2083874 2084455 . - 0 ID=BALIOE_10430;Name=hypothetical protein;locus_tag=BALIOE_10430;product=hypothetical protein;Parent=BALIOE_10430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4184 c1 Prodigal gene 2084713 2085864 . - . ID=BALIOE_10435_gene;locus_tag=BALIOE_10435 | |
| 4185 c1 Prodigal CDS 2084713 2085864 . - 0 ID=BALIOE_10435;Name=hypothetical protein;locus_tag=BALIOE_10435;product=hypothetical protein;Parent=BALIOE_10435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4186 c1 Prodigal gene 2085861 2087102 . - . ID=BALIOE_10440_gene;locus_tag=BALIOE_10440 | |
| 4187 c1 Prodigal CDS 2085861 2087102 . - 0 ID=BALIOE_10440;Name=hypothetical protein;locus_tag=BALIOE_10440;product=hypothetical protein;Parent=BALIOE_10440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4188 c1 Prodigal gene 2087127 2088509 . - . ID=BALIOE_10445_gene;locus_tag=BALIOE_10445 | |
| 4189 c1 Prodigal CDS 2087127 2088509 . - 0 ID=BALIOE_10445;Name=hypothetical protein;locus_tag=BALIOE_10445;product=hypothetical protein;Parent=BALIOE_10445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4190 c1 Prodigal gene 2088886 2090205 . - . ID=BALIOE_10450_gene;locus_tag=BALIOE_10450 | |
| 4191 c1 Prodigal CDS 2088886 2090205 . - 0 ID=BALIOE_10450;Name=hypothetical protein;locus_tag=BALIOE_10450;product=hypothetical protein;Parent=BALIOE_10450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4192 c1 Prodigal gene 2090336 2091871 . - . ID=BALIOE_10455_gene;locus_tag=BALIOE_10455 | |
| 4193 c1 Prodigal CDS 2090336 2091871 . - 0 ID=BALIOE_10455;Name=hypothetical protein;locus_tag=BALIOE_10455;product=hypothetical protein;Parent=BALIOE_10455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4194 c1 Prodigal gene 2092027 2093427 . - . ID=BALIOE_10460_gene;locus_tag=BALIOE_10460 | |
| 4195 c1 Prodigal CDS 2092027 2093427 . - 0 ID=BALIOE_10460;Name=hypothetical protein;locus_tag=BALIOE_10460;product=hypothetical protein;Parent=BALIOE_10460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4196 c1 Prodigal gene 2093788 2096571 . - . ID=BALIOE_10465_gene;locus_tag=BALIOE_10465 | |
| 4197 c1 Prodigal CDS 2093788 2096571 . - 0 ID=BALIOE_10465;Name=hypothetical protein;locus_tag=BALIOE_10465;product=hypothetical protein;Parent=BALIOE_10465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4198 c1 Prodigal gene 2096628 2099000 . - . ID=BALIOE_10470_gene;locus_tag=BALIOE_10470 | |
| 4199 c1 Prodigal CDS 2096628 2099000 . - 0 ID=BALIOE_10470;Name=hypothetical protein;locus_tag=BALIOE_10470;product=hypothetical protein;Parent=BALIOE_10470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4200 c1 Prodigal gene 2099038 2100696 . - . ID=BALIOE_10475_gene;locus_tag=BALIOE_10475 | |
| 4201 c1 Prodigal CDS 2099038 2100696 . - 0 ID=BALIOE_10475;Name=hypothetical protein;locus_tag=BALIOE_10475;product=hypothetical protein;Parent=BALIOE_10475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4202 c1 Prodigal gene 2101014 2102171 . - . ID=BALIOE_10480_gene;locus_tag=BALIOE_10480 | |
| 4203 c1 Prodigal CDS 2101014 2102171 . - 0 ID=BALIOE_10480;Name=hypothetical protein;locus_tag=BALIOE_10480;product=hypothetical protein;Parent=BALIOE_10480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4204 c1 Prodigal gene 2102223 2103905 . - . ID=BALIOE_10485_gene;locus_tag=BALIOE_10485 | |
| 4205 c1 Prodigal CDS 2102223 2103905 . - 0 ID=BALIOE_10485;Name=hypothetical protein;locus_tag=BALIOE_10485;product=hypothetical protein;Parent=BALIOE_10485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4206 c1 Prodigal gene 2104309 2105070 . - . ID=BALIOE_10490_gene;locus_tag=BALIOE_10490 | |
| 4207 c1 Prodigal CDS 2104309 2105070 . - 0 ID=BALIOE_10490;Name=hypothetical protein;locus_tag=BALIOE_10490;product=hypothetical protein;Parent=BALIOE_10490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4208 c1 Prodigal gene 2105144 2105341 . - . ID=BALIOE_10495_gene;locus_tag=BALIOE_10495 | |
| 4209 c1 Prodigal CDS 2105144 2105341 . - 0 ID=BALIOE_10495;Name=hypothetical protein;locus_tag=BALIOE_10495;product=hypothetical protein;Parent=BALIOE_10495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4210 c1 Prodigal gene 2105589 2107868 . - . ID=BALIOE_10500_gene;locus_tag=BALIOE_10500 | |
| 4211 c1 Prodigal CDS 2105589 2107868 . - 0 ID=BALIOE_10500;Name=hypothetical protein;locus_tag=BALIOE_10500;product=hypothetical protein;Parent=BALIOE_10500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4212 c1 Prodigal gene 2108202 2109116 . - . ID=BALIOE_10505_gene;locus_tag=BALIOE_10505 | |
| 4213 c1 Prodigal CDS 2108202 2109116 . - 0 ID=BALIOE_10505;Name=hypothetical protein;locus_tag=BALIOE_10505;product=hypothetical protein;Parent=BALIOE_10505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4214 c1 Prodigal gene 2109176 2109679 . - . ID=BALIOE_10510_gene;locus_tag=BALIOE_10510 | |
| 4215 c1 Prodigal CDS 2109176 2109679 . - 0 ID=BALIOE_10510;Name=hypothetical protein;locus_tag=BALIOE_10510;product=hypothetical protein;Parent=BALIOE_10510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4216 c1 Prodigal gene 2109692 2110222 . - . ID=BALIOE_10515_gene;locus_tag=BALIOE_10515 | |
| 4217 c1 Prodigal CDS 2109692 2110222 . - 0 ID=BALIOE_10515;Name=hypothetical protein;locus_tag=BALIOE_10515;product=hypothetical protein;Parent=BALIOE_10515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4218 c1 Prodigal gene 2110236 2112887 . - . ID=BALIOE_10520_gene;locus_tag=BALIOE_10520 | |
| 4219 c1 Prodigal CDS 2110236 2112887 . - 0 ID=BALIOE_10520;Name=hypothetical protein;locus_tag=BALIOE_10520;product=hypothetical protein;Parent=BALIOE_10520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4220 c1 Prodigal gene 2112929 2113639 . - . ID=BALIOE_10525_gene;locus_tag=BALIOE_10525 | |
| 4221 c1 Prodigal CDS 2112929 2113639 . - 0 ID=BALIOE_10525;Name=hypothetical protein;locus_tag=BALIOE_10525;product=hypothetical protein;Parent=BALIOE_10525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4222 c1 Prodigal gene 2114000 2114563 . - . ID=BALIOE_10530_gene;locus_tag=BALIOE_10530 | |
| 4223 c1 Prodigal CDS 2114000 2114563 . - 0 ID=BALIOE_10530;Name=hypothetical protein;locus_tag=BALIOE_10530;product=hypothetical protein;Parent=BALIOE_10530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4224 c1 Prodigal gene 2115537 2116559 . - . ID=BALIOE_10535_gene;locus_tag=BALIOE_10535 | |
| 4225 c1 Prodigal CDS 2115537 2116559 . - 0 ID=BALIOE_10535;Name=hypothetical protein;locus_tag=BALIOE_10535;product=hypothetical protein;Parent=BALIOE_10535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4226 c1 Prodigal gene 2116717 2118117 . - . ID=BALIOE_10540_gene;locus_tag=BALIOE_10540 | |
| 4227 c1 Prodigal CDS 2116717 2118117 . - 0 ID=BALIOE_10540;Name=hypothetical protein;locus_tag=BALIOE_10540;product=hypothetical protein;Parent=BALIOE_10540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4228 c1 Prodigal gene 2118114 2122145 . - . ID=BALIOE_10545_gene;locus_tag=BALIOE_10545 | |
| 4229 c1 Prodigal CDS 2118114 2122145 . - 0 ID=BALIOE_10545;Name=hypothetical protein;locus_tag=BALIOE_10545;product=hypothetical protein;Parent=BALIOE_10545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4230 c1 Prodigal gene 2122676 2124268 . - . ID=BALIOE_10550_gene;locus_tag=BALIOE_10550 | |
| 4231 c1 Prodigal CDS 2122676 2124268 . - 0 ID=BALIOE_10550;Name=hypothetical protein;locus_tag=BALIOE_10550;product=hypothetical protein;Parent=BALIOE_10550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4232 c1 Prodigal gene 2124347 2125300 . - . ID=BALIOE_10555_gene;locus_tag=BALIOE_10555 | |
| 4233 c1 Prodigal CDS 2124347 2125300 . - 0 ID=BALIOE_10555;Name=hypothetical protein;locus_tag=BALIOE_10555;product=hypothetical protein;Parent=BALIOE_10555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4234 c1 Prodigal gene 2125549 2127084 . + . ID=BALIOE_10560_gene;locus_tag=BALIOE_10560 | |
| 4235 c1 Prodigal CDS 2125549 2127084 . + 0 ID=BALIOE_10560;Name=hypothetical protein;locus_tag=BALIOE_10560;product=hypothetical protein;Parent=BALIOE_10560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4236 c1 Prodigal gene 2127078 2128106 . + . ID=BALIOE_10565_gene;locus_tag=BALIOE_10565 | |
| 4237 c1 Prodigal CDS 2127078 2128106 . + 0 ID=BALIOE_10565;Name=hypothetical protein;locus_tag=BALIOE_10565;product=hypothetical protein;Parent=BALIOE_10565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4238 c1 Prodigal gene 2128106 2129098 . + . ID=BALIOE_10570_gene;locus_tag=BALIOE_10570 | |
| 4239 c1 Prodigal CDS 2128106 2129098 . + 0 ID=BALIOE_10570;Name=hypothetical protein;locus_tag=BALIOE_10570;product=hypothetical protein;Parent=BALIOE_10570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4240 c1 Prodigal gene 2129110 2130132 . + . ID=BALIOE_10575_gene;locus_tag=BALIOE_10575 | |
| 4241 c1 Prodigal CDS 2129110 2130132 . + 0 ID=BALIOE_10575;Name=hypothetical protein;locus_tag=BALIOE_10575;product=hypothetical protein;Parent=BALIOE_10575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4242 c1 Prodigal gene 2130159 2131034 . + . ID=BALIOE_10580_gene;locus_tag=BALIOE_10580 | |
| 4243 c1 Prodigal CDS 2130159 2131034 . + 0 ID=BALIOE_10580;Name=hypothetical protein;locus_tag=BALIOE_10580;product=hypothetical protein;Parent=BALIOE_10580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4244 c1 Prodigal gene 2131058 2131348 . + . ID=BALIOE_10585_gene;locus_tag=BALIOE_10585 | |
| 4245 c1 Prodigal CDS 2131058 2131348 . + 0 ID=BALIOE_10585;Name=hypothetical protein;locus_tag=BALIOE_10585;product=hypothetical protein;Parent=BALIOE_10585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4246 c1 Prodigal gene 2131405 2132163 . + . ID=BALIOE_10590_gene;locus_tag=BALIOE_10590 | |
| 4247 c1 Prodigal CDS 2131405 2132163 . + 0 ID=BALIOE_10590;Name=hypothetical protein;locus_tag=BALIOE_10590;product=hypothetical protein;Parent=BALIOE_10590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4248 c1 Prodigal gene 2132167 2133081 . - . ID=BALIOE_10595_gene;locus_tag=BALIOE_10595 | |
| 4249 c1 Prodigal CDS 2132167 2133081 . - 0 ID=BALIOE_10595;Name=hypothetical protein;locus_tag=BALIOE_10595;product=hypothetical protein;Parent=BALIOE_10595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4250 c1 Prodigal gene 2133278 2134729 . - . ID=BALIOE_10600_gene;locus_tag=BALIOE_10600 | |
| 4251 c1 Prodigal CDS 2133278 2134729 . - 0 ID=BALIOE_10600;Name=hypothetical protein;locus_tag=BALIOE_10600;product=hypothetical protein;Parent=BALIOE_10600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4252 c1 Prodigal gene 2134956 2136374 . - . ID=BALIOE_10605_gene;locus_tag=BALIOE_10605 | |
| 4253 c1 Prodigal CDS 2134956 2136374 . - 0 ID=BALIOE_10605;Name=hypothetical protein;locus_tag=BALIOE_10605;product=hypothetical protein;Parent=BALIOE_10605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4254 c1 Prodigal gene 2136513 2136872 . - . ID=BALIOE_10610_gene;locus_tag=BALIOE_10610 | |
| 4255 c1 Prodigal CDS 2136513 2136872 . - 0 ID=BALIOE_10610;Name=hypothetical protein;locus_tag=BALIOE_10610;product=hypothetical protein;Parent=BALIOE_10610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4256 c1 Prodigal gene 2136872 2137798 . - . ID=BALIOE_10615_gene;locus_tag=BALIOE_10615 | |
| 4257 c1 Prodigal CDS 2136872 2137798 . - 0 ID=BALIOE_10615;Name=hypothetical protein;locus_tag=BALIOE_10615;product=hypothetical protein;Parent=BALIOE_10615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4258 c1 Prodigal gene 2137862 2139250 . - . ID=BALIOE_10620_gene;locus_tag=BALIOE_10620 | |
| 4259 c1 Prodigal CDS 2137862 2139250 . - 0 ID=BALIOE_10620;Name=hypothetical protein;locus_tag=BALIOE_10620;product=hypothetical protein;Parent=BALIOE_10620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4260 c1 Prodigal gene 2139351 2140232 . + . ID=BALIOE_10625_gene;locus_tag=BALIOE_10625 | |
| 4261 c1 Prodigal CDS 2139351 2140232 . + 0 ID=BALIOE_10625;Name=hypothetical protein;locus_tag=BALIOE_10625;product=hypothetical protein;Parent=BALIOE_10625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4262 c1 Prodigal gene 2140310 2141098 . + . ID=BALIOE_10630_gene;locus_tag=BALIOE_10630 | |
| 4263 c1 Prodigal CDS 2140310 2141098 . + 0 ID=BALIOE_10630;Name=hypothetical protein;locus_tag=BALIOE_10630;product=hypothetical protein;Parent=BALIOE_10630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4264 c1 Prodigal gene 2141177 2141425 . + . ID=BALIOE_10635_gene;locus_tag=BALIOE_10635 | |
| 4265 c1 Prodigal CDS 2141177 2141425 . + 0 ID=BALIOE_10635;Name=hypothetical protein;locus_tag=BALIOE_10635;product=hypothetical protein;Parent=BALIOE_10635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4266 c1 Prodigal gene 2141576 2142766 . + . ID=BALIOE_10640_gene;locus_tag=BALIOE_10640 | |
| 4267 c1 Prodigal CDS 2141576 2142766 . + 0 ID=BALIOE_10640;Name=hypothetical protein;locus_tag=BALIOE_10640;product=hypothetical protein;Parent=BALIOE_10640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4268 c1 Prodigal gene 2142791 2143456 . - . ID=BALIOE_10645_gene;locus_tag=BALIOE_10645 | |
| 4269 c1 Prodigal CDS 2142791 2143456 . - 0 ID=BALIOE_10645;Name=hypothetical protein;locus_tag=BALIOE_10645;product=hypothetical protein;Parent=BALIOE_10645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4270 c1 Prodigal gene 2143668 2144102 . + . ID=BALIOE_10650_gene;locus_tag=BALIOE_10650 | |
| 4271 c1 Prodigal CDS 2143668 2144102 . + 0 ID=BALIOE_10650;Name=hypothetical protein;locus_tag=BALIOE_10650;product=hypothetical protein;Parent=BALIOE_10650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4272 c1 Prodigal gene 2144122 2144505 . + . ID=BALIOE_10655_gene;locus_tag=BALIOE_10655 | |
| 4273 c1 Prodigal CDS 2144122 2144505 . + 0 ID=BALIOE_10655;Name=hypothetical protein;locus_tag=BALIOE_10655;product=hypothetical protein;Parent=BALIOE_10655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4274 c1 Prodigal gene 2144537 2144755 . + . ID=BALIOE_10660_gene;locus_tag=BALIOE_10660 | |
| 4275 c1 Prodigal CDS 2144537 2144755 . + 0 ID=BALIOE_10660;Name=hypothetical protein;locus_tag=BALIOE_10660;product=hypothetical protein;Parent=BALIOE_10660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4276 c1 Prodigal gene 2144786 2145685 . - . ID=BALIOE_10665_gene;locus_tag=BALIOE_10665 | |
| 4277 c1 Prodigal CDS 2144786 2145685 . - 0 ID=BALIOE_10665;Name=hypothetical protein;locus_tag=BALIOE_10665;product=hypothetical protein;Parent=BALIOE_10665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4278 c1 Prodigal gene 2145880 2147067 . + . ID=BALIOE_10670_gene;locus_tag=BALIOE_10670 | |
| 4279 c1 Prodigal CDS 2145880 2147067 . + 0 ID=BALIOE_10670;Name=hypothetical protein;locus_tag=BALIOE_10670;product=hypothetical protein;Parent=BALIOE_10670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4280 c1 Prodigal gene 2147108 2147503 . - . ID=BALIOE_10675_gene;locus_tag=BALIOE_10675 | |
| 4281 c1 Prodigal CDS 2147108 2147503 . - 0 ID=BALIOE_10675;Name=hypothetical protein;locus_tag=BALIOE_10675;product=hypothetical protein;Parent=BALIOE_10675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4282 c1 Prodigal gene 2147598 2148569 . + . ID=BALIOE_10680_gene;locus_tag=BALIOE_10680 | |
| 4283 c1 Prodigal CDS 2147598 2148569 . + 0 ID=BALIOE_10680;Name=hypothetical protein;locus_tag=BALIOE_10680;product=hypothetical protein;Parent=BALIOE_10680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4284 c1 Prodigal gene 2148677 2148772 . + . ID=BALIOE_10685_gene;locus_tag=BALIOE_10685 | |
| 4285 c1 Prodigal CDS 2148677 2148772 . + 0 ID=BALIOE_10685;Name=hypothetical protein;locus_tag=BALIOE_10685;product=hypothetical protein;Parent=BALIOE_10685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4286 c1 Prodigal gene 2148991 2149881 . - . ID=BALIOE_10690_gene;locus_tag=BALIOE_10690 | |
| 4287 c1 Prodigal CDS 2148991 2149881 . - 0 ID=BALIOE_10690;Name=hypothetical protein;locus_tag=BALIOE_10690;product=hypothetical protein;Parent=BALIOE_10690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4288 c1 Prodigal gene 2150136 2150528 . - . ID=BALIOE_10695_gene;locus_tag=BALIOE_10695 | |
| 4289 c1 Prodigal CDS 2150136 2150528 . - 0 ID=BALIOE_10695;Name=hypothetical protein;locus_tag=BALIOE_10695;product=hypothetical protein;Parent=BALIOE_10695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4290 c1 Prodigal gene 2150804 2151322 . + . ID=BALIOE_10700_gene;locus_tag=BALIOE_10700 | |
| 4291 c1 Prodigal CDS 2150804 2151322 . + 0 ID=BALIOE_10700;Name=hypothetical protein;locus_tag=BALIOE_10700;product=hypothetical protein;Parent=BALIOE_10700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4292 c1 Prodigal gene 2151367 2153412 . - . ID=BALIOE_10705_gene;locus_tag=BALIOE_10705 | |
| 4293 c1 Prodigal CDS 2151367 2153412 . - 0 ID=BALIOE_10705;Name=hypothetical protein;locus_tag=BALIOE_10705;product=hypothetical protein;Parent=BALIOE_10705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4294 c1 Prodigal gene 2153549 2154295 . + . ID=BALIOE_10710_gene;locus_tag=BALIOE_10710 | |
| 4295 c1 Prodigal CDS 2153549 2154295 . + 0 ID=BALIOE_10710;Name=hypothetical protein;locus_tag=BALIOE_10710;product=hypothetical protein;Parent=BALIOE_10710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4296 c1 Prodigal gene 2154384 2155070 . + . ID=BALIOE_10715_gene;locus_tag=BALIOE_10715 | |
| 4297 c1 Prodigal CDS 2154384 2155070 . + 0 ID=BALIOE_10715;Name=hypothetical protein;locus_tag=BALIOE_10715;product=hypothetical protein;Parent=BALIOE_10715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4298 c1 Prodigal gene 2155247 2155450 . + . ID=BALIOE_10720_gene;locus_tag=BALIOE_10720 | |
| 4299 c1 Prodigal CDS 2155247 2155450 . + 0 ID=BALIOE_10720;Name=hypothetical protein;locus_tag=BALIOE_10720;product=hypothetical protein;Parent=BALIOE_10720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4300 c1 Prodigal gene 2155486 2156946 . - . ID=BALIOE_10725_gene;locus_tag=BALIOE_10725 | |
| 4301 c1 Prodigal CDS 2155486 2156946 . - 0 ID=BALIOE_10725;Name=hypothetical protein;locus_tag=BALIOE_10725;product=hypothetical protein;Parent=BALIOE_10725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4302 c1 Prodigal gene 2157035 2158318 . - . ID=BALIOE_10730_gene;locus_tag=BALIOE_10730 | |
| 4303 c1 Prodigal CDS 2157035 2158318 . - 0 ID=BALIOE_10730;Name=hypothetical protein;locus_tag=BALIOE_10730;product=hypothetical protein;Parent=BALIOE_10730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4304 c1 Prodigal gene 2158378 2158692 . + . ID=BALIOE_10735_gene;locus_tag=BALIOE_10735 | |
| 4305 c1 Prodigal CDS 2158378 2158692 . + 0 ID=BALIOE_10735;Name=hypothetical protein;locus_tag=BALIOE_10735;product=hypothetical protein;Parent=BALIOE_10735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4306 c1 Prodigal gene 2158854 2159495 . - . ID=BALIOE_10740_gene;locus_tag=BALIOE_10740 | |
| 4307 c1 Prodigal CDS 2158854 2159495 . - 0 ID=BALIOE_10740;Name=hypothetical protein;locus_tag=BALIOE_10740;product=hypothetical protein;Parent=BALIOE_10740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4308 c1 Prodigal gene 2159577 2160206 . - . ID=BALIOE_10745_gene;locus_tag=BALIOE_10745 | |
| 4309 c1 Prodigal CDS 2159577 2160206 . - 0 ID=BALIOE_10745;Name=hypothetical protein;locus_tag=BALIOE_10745;product=hypothetical protein;Parent=BALIOE_10745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4310 c1 Prodigal gene 2160279 2160854 . - . ID=BALIOE_10750_gene;locus_tag=BALIOE_10750 | |
| 4311 c1 Prodigal CDS 2160279 2160854 . - 0 ID=BALIOE_10750;Name=hypothetical protein;locus_tag=BALIOE_10750;product=hypothetical protein;Parent=BALIOE_10750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4312 c1 Prodigal gene 2160968 2161237 . - . ID=BALIOE_10755_gene;locus_tag=BALIOE_10755 | |
| 4313 c1 Prodigal CDS 2160968 2161237 . - 0 ID=BALIOE_10755;Name=hypothetical protein;locus_tag=BALIOE_10755;product=hypothetical protein;Parent=BALIOE_10755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4314 c1 Prodigal gene 2161239 2161517 . - . ID=BALIOE_10760_gene;locus_tag=BALIOE_10760 | |
| 4315 c1 Prodigal CDS 2161239 2161517 . - 0 ID=BALIOE_10760;Name=hypothetical protein;locus_tag=BALIOE_10760;product=hypothetical protein;Parent=BALIOE_10760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4316 c1 Prodigal gene 2161651 2162460 . - . ID=BALIOE_10765_gene;locus_tag=BALIOE_10765 | |
| 4317 c1 Prodigal CDS 2161651 2162460 . - 0 ID=BALIOE_10765;Name=hypothetical protein;locus_tag=BALIOE_10765;product=hypothetical protein;Parent=BALIOE_10765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4318 c1 Prodigal gene 2162525 2163124 . - . ID=BALIOE_10770_gene;locus_tag=BALIOE_10770 | |
| 4319 c1 Prodigal CDS 2162525 2163124 . - 0 ID=BALIOE_10770;Name=hypothetical protein;locus_tag=BALIOE_10770;product=hypothetical protein;Parent=BALIOE_10770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4320 c1 Prodigal gene 2163192 2166671 . - . ID=BALIOE_10775_gene;locus_tag=BALIOE_10775 | |
| 4321 c1 Prodigal CDS 2163192 2166671 . - 0 ID=BALIOE_10775;Name=hypothetical protein;locus_tag=BALIOE_10775;product=hypothetical protein;Parent=BALIOE_10775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4322 c1 Prodigal gene 2166912 2167490 . - . ID=BALIOE_10780_gene;locus_tag=BALIOE_10780 | |
| 4323 c1 Prodigal CDS 2166912 2167490 . - 0 ID=BALIOE_10780;Name=hypothetical protein;locus_tag=BALIOE_10780;product=hypothetical protein;Parent=BALIOE_10780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4324 c1 Prodigal gene 2167487 2168230 . - . ID=BALIOE_10785_gene;locus_tag=BALIOE_10785 | |
| 4325 c1 Prodigal CDS 2167487 2168230 . - 0 ID=BALIOE_10785;Name=hypothetical protein;locus_tag=BALIOE_10785;product=hypothetical protein;Parent=BALIOE_10785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4326 c1 Prodigal gene 2168241 2168939 . - . ID=BALIOE_10790_gene;locus_tag=BALIOE_10790 | |
| 4327 c1 Prodigal CDS 2168241 2168939 . - 0 ID=BALIOE_10790;Name=hypothetical protein;locus_tag=BALIOE_10790;product=hypothetical protein;Parent=BALIOE_10790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4328 c1 Prodigal gene 2168939 2169268 . - . ID=BALIOE_10795_gene;locus_tag=BALIOE_10795 | |
| 4329 c1 Prodigal CDS 2168939 2169268 . - 0 ID=BALIOE_10795;Name=hypothetical protein;locus_tag=BALIOE_10795;product=hypothetical protein;Parent=BALIOE_10795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4330 c1 Prodigal gene 2169265 2171877 . - . ID=BALIOE_10800_gene;locus_tag=BALIOE_10800 | |
| 4331 c1 Prodigal CDS 2169265 2171877 . - 0 ID=BALIOE_10800;Name=hypothetical protein;locus_tag=BALIOE_10800;product=hypothetical protein;Parent=BALIOE_10800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4332 c1 Prodigal gene 2171858 2172271 . - . ID=BALIOE_10805_gene;locus_tag=BALIOE_10805 | |
| 4333 c1 Prodigal CDS 2171858 2172271 . - 0 ID=BALIOE_10805;Name=hypothetical protein;locus_tag=BALIOE_10805;product=hypothetical protein;Parent=BALIOE_10805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4334 c1 Prodigal gene 2172298 2172720 . - . ID=BALIOE_10810_gene;locus_tag=BALIOE_10810 | |
| 4335 c1 Prodigal CDS 2172298 2172720 . - 0 ID=BALIOE_10810;Name=hypothetical protein;locus_tag=BALIOE_10810;product=hypothetical protein;Parent=BALIOE_10810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4336 c1 Prodigal gene 2172734 2173486 . - . ID=BALIOE_10815_gene;locus_tag=BALIOE_10815 | |
| 4337 c1 Prodigal CDS 2172734 2173486 . - 0 ID=BALIOE_10815;Name=hypothetical protein;locus_tag=BALIOE_10815;product=hypothetical protein;Parent=BALIOE_10815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4338 c1 Prodigal gene 2173494 2173889 . - . ID=BALIOE_10820_gene;locus_tag=BALIOE_10820 | |
| 4339 c1 Prodigal CDS 2173494 2173889 . - 0 ID=BALIOE_10820;Name=hypothetical protein;locus_tag=BALIOE_10820;product=hypothetical protein;Parent=BALIOE_10820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4340 c1 Prodigal gene 2173886 2174419 . - . ID=BALIOE_10825_gene;locus_tag=BALIOE_10825 | |
| 4341 c1 Prodigal CDS 2173886 2174419 . - 0 ID=BALIOE_10825;Name=hypothetical protein;locus_tag=BALIOE_10825;product=hypothetical protein;Parent=BALIOE_10825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4342 c1 Prodigal gene 2174434 2174787 . - . ID=BALIOE_10830_gene;locus_tag=BALIOE_10830 | |
| 4343 c1 Prodigal CDS 2174434 2174787 . - 0 ID=BALIOE_10830;Name=hypothetical protein;locus_tag=BALIOE_10830;product=hypothetical protein;Parent=BALIOE_10830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4344 c1 Prodigal gene 2174799 2175197 . - . ID=BALIOE_10835_gene;locus_tag=BALIOE_10835 | |
| 4345 c1 Prodigal CDS 2174799 2175197 . - 0 ID=BALIOE_10835;Name=hypothetical protein;locus_tag=BALIOE_10835;product=hypothetical protein;Parent=BALIOE_10835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4346 c1 Prodigal gene 2175239 2176264 . - . ID=BALIOE_10840_gene;locus_tag=BALIOE_10840 | |
| 4347 c1 Prodigal CDS 2175239 2176264 . - 0 ID=BALIOE_10840;Name=hypothetical protein;locus_tag=BALIOE_10840;product=hypothetical protein;Parent=BALIOE_10840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4348 c1 Prodigal gene 2176320 2176652 . - . ID=BALIOE_10845_gene;locus_tag=BALIOE_10845 | |
| 4349 c1 Prodigal CDS 2176320 2176652 . - 0 ID=BALIOE_10845;Name=hypothetical protein;locus_tag=BALIOE_10845;product=hypothetical protein;Parent=BALIOE_10845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4350 c1 Prodigal gene 2176662 2177981 . - . ID=BALIOE_10850_gene;locus_tag=BALIOE_10850 | |
| 4351 c1 Prodigal CDS 2176662 2177981 . - 0 ID=BALIOE_10850;Name=hypothetical protein;locus_tag=BALIOE_10850;product=hypothetical protein;Parent=BALIOE_10850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4352 c1 Prodigal gene 2177962 2179563 . - . ID=BALIOE_10855_gene;locus_tag=BALIOE_10855 | |
| 4353 c1 Prodigal CDS 2177962 2179563 . - 0 ID=BALIOE_10855;Name=hypothetical protein;locus_tag=BALIOE_10855;product=hypothetical protein;Parent=BALIOE_10855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4354 c1 Prodigal gene 2179560 2179766 . - . ID=BALIOE_10860_gene;locus_tag=BALIOE_10860 | |
| 4355 c1 Prodigal CDS 2179560 2179766 . - 0 ID=BALIOE_10860;Name=hypothetical protein;locus_tag=BALIOE_10860;product=hypothetical protein;Parent=BALIOE_10860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4356 c1 Prodigal gene 2179763 2181688 . - . ID=BALIOE_10865_gene;locus_tag=BALIOE_10865 | |
| 4357 c1 Prodigal CDS 2179763 2181688 . - 0 ID=BALIOE_10865;Name=hypothetical protein;locus_tag=BALIOE_10865;product=hypothetical protein;Parent=BALIOE_10865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4358 c1 Prodigal gene 2181663 2182208 . - . ID=BALIOE_10870_gene;locus_tag=BALIOE_10870 | |
| 4359 c1 Prodigal CDS 2181663 2182208 . - 0 ID=BALIOE_10870;Name=hypothetical protein;locus_tag=BALIOE_10870;product=hypothetical protein;Parent=BALIOE_10870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4360 c1 Prodigal gene 2182901 2183215 . - . ID=BALIOE_10875_gene;locus_tag=BALIOE_10875 | |
| 4361 c1 Prodigal CDS 2182901 2183215 . - 0 ID=BALIOE_10875;Name=hypothetical protein;locus_tag=BALIOE_10875;product=hypothetical protein;Parent=BALIOE_10875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4362 c1 Prodigal gene 2183679 2184137 . - . ID=BALIOE_10880_gene;locus_tag=BALIOE_10880 | |
| 4363 c1 Prodigal CDS 2183679 2184137 . - 0 ID=BALIOE_10880;Name=hypothetical protein;locus_tag=BALIOE_10880;product=hypothetical protein;Parent=BALIOE_10880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4364 c1 Prodigal gene 2184149 2184295 . - . ID=BALIOE_10885_gene;locus_tag=BALIOE_10885 | |
| 4365 c1 Prodigal CDS 2184149 2184295 . - 0 ID=BALIOE_10885;Name=hypothetical protein;locus_tag=BALIOE_10885;product=hypothetical protein;Parent=BALIOE_10885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4366 c1 Prodigal gene 2184295 2184864 . - . ID=BALIOE_10890_gene;locus_tag=BALIOE_10890 | |
| 4367 c1 Prodigal CDS 2184295 2184864 . - 0 ID=BALIOE_10890;Name=hypothetical protein;locus_tag=BALIOE_10890;product=hypothetical protein;Parent=BALIOE_10890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4368 c1 Prodigal gene 2185135 2185668 . - . ID=BALIOE_10895_gene;locus_tag=BALIOE_10895 | |
| 4369 c1 Prodigal CDS 2185135 2185668 . - 0 ID=BALIOE_10895;Name=hypothetical protein;locus_tag=BALIOE_10895;product=hypothetical protein;Parent=BALIOE_10895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4370 c1 Prodigal gene 2185719 2186063 . - . ID=BALIOE_10900_gene;locus_tag=BALIOE_10900 | |
| 4371 c1 Prodigal CDS 2185719 2186063 . - 0 ID=BALIOE_10900;Name=hypothetical protein;locus_tag=BALIOE_10900;product=hypothetical protein;Parent=BALIOE_10900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4372 c1 Prodigal gene 2186068 2186274 . - . ID=BALIOE_10905_gene;locus_tag=BALIOE_10905 | |
| 4373 c1 Prodigal CDS 2186068 2186274 . - 0 ID=BALIOE_10905;Name=hypothetical protein;locus_tag=BALIOE_10905;product=hypothetical protein;Parent=BALIOE_10905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4374 c1 Prodigal gene 2186722 2188572 . - . ID=BALIOE_10910_gene;locus_tag=BALIOE_10910 | |
| 4375 c1 Prodigal CDS 2186722 2188572 . - 0 ID=BALIOE_10910;Name=hypothetical protein;locus_tag=BALIOE_10910;product=hypothetical protein;Parent=BALIOE_10910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4376 c1 Prodigal gene 2188886 2189053 . - . ID=BALIOE_10915_gene;locus_tag=BALIOE_10915 | |
| 4377 c1 Prodigal CDS 2188886 2189053 . - 0 ID=BALIOE_10915;Name=hypothetical protein;locus_tag=BALIOE_10915;product=hypothetical protein;Parent=BALIOE_10915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4378 c1 Prodigal gene 2189050 2189481 . - . ID=BALIOE_10920_gene;locus_tag=BALIOE_10920 | |
| 4379 c1 Prodigal CDS 2189050 2189481 . - 0 ID=BALIOE_10920;Name=hypothetical protein;locus_tag=BALIOE_10920;product=hypothetical protein;Parent=BALIOE_10920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4380 c1 tRNAscan-SE gene 2189651 2189727 . - . ID=BALIOE_10925_gene;locus_tag=BALIOE_10925;gene=Arg_trna | |
| 4381 c1 tRNAscan-SE tRNA 2189651 2189727 . - . ID=BALIOE_10925;Name=tRNA-Arg;locus_tag=BALIOE_10925;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_10925_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 4382 c1 tRNAscan-SE gene 2189828 2189903 . - . ID=BALIOE_10930_gene;locus_tag=BALIOE_10930;gene=Ile2_trna | |
| 4383 c1 tRNAscan-SE tRNA 2189828 2189903 . - . ID=BALIOE_10930;Name=tRNA-Ile2;locus_tag=BALIOE_10930;product=tRNA-Ile2;gene=Ile2_trna;Parent=BALIOE_10930_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 4384 c1 Prodigal gene 2189932 2190519 . - . ID=BALIOE_10935_gene;locus_tag=BALIOE_10935 | |
| 4385 c1 Prodigal CDS 2189932 2190519 . - 0 ID=BALIOE_10935;Name=hypothetical protein;locus_tag=BALIOE_10935;product=hypothetical protein;Parent=BALIOE_10935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4386 c1 Prodigal gene 2190781 2190978 . - . ID=BALIOE_10940_gene;locus_tag=BALIOE_10940 | |
| 4387 c1 Prodigal CDS 2190781 2190978 . - 0 ID=BALIOE_10940;Name=hypothetical protein;locus_tag=BALIOE_10940;product=hypothetical protein;Parent=BALIOE_10940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4388 c1 Prodigal gene 2191203 2191757 . - . ID=BALIOE_10945_gene;locus_tag=BALIOE_10945 | |
| 4389 c1 Prodigal CDS 2191203 2191757 . - 0 ID=BALIOE_10945;Name=hypothetical protein;locus_tag=BALIOE_10945;product=hypothetical protein;Parent=BALIOE_10945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4390 c1 Prodigal gene 2191820 2192125 . - . ID=BALIOE_10950_gene;locus_tag=BALIOE_10950 | |
| 4391 c1 Prodigal CDS 2191820 2192125 . - 0 ID=BALIOE_10950;Name=hypothetical protein;locus_tag=BALIOE_10950;product=hypothetical protein;Parent=BALIOE_10950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4392 c1 Prodigal gene 2192138 2193187 . - . ID=BALIOE_10955_gene;locus_tag=BALIOE_10955 | |
| 4393 c1 Prodigal CDS 2192138 2193187 . - 0 ID=BALIOE_10955;Name=hypothetical protein;locus_tag=BALIOE_10955;product=hypothetical protein;Parent=BALIOE_10955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4394 c1 Prodigal gene 2193189 2193461 . - . ID=BALIOE_10960_gene;locus_tag=BALIOE_10960 | |
| 4395 c1 Prodigal CDS 2193189 2193461 . - 0 ID=BALIOE_10960;Name=hypothetical protein;locus_tag=BALIOE_10960;product=hypothetical protein;Parent=BALIOE_10960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4396 c1 Prodigal gene 2193583 2193927 . - . ID=BALIOE_10965_gene;locus_tag=BALIOE_10965 | |
| 4397 c1 Prodigal CDS 2193583 2193927 . - 0 ID=BALIOE_10965;Name=hypothetical protein;locus_tag=BALIOE_10965;product=hypothetical protein;Parent=BALIOE_10965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4398 c1 Prodigal gene 2194047 2194259 . - . ID=BALIOE_10970_gene;locus_tag=BALIOE_10970 | |
| 4399 c1 Prodigal CDS 2194047 2194259 . - 0 ID=BALIOE_10970;Name=hypothetical protein;locus_tag=BALIOE_10970;product=hypothetical protein;Parent=BALIOE_10970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4400 c1 Prodigal gene 2194493 2195050 . - . ID=BALIOE_10975_gene;locus_tag=BALIOE_10975 | |
| 4401 c1 Prodigal CDS 2194493 2195050 . - 0 ID=BALIOE_10975;Name=hypothetical protein;locus_tag=BALIOE_10975;product=hypothetical protein;Parent=BALIOE_10975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4402 c1 Prodigal gene 2195398 2195709 . - . ID=BALIOE_10980_gene;locus_tag=BALIOE_10980 | |
| 4403 c1 Prodigal CDS 2195398 2195709 . - 0 ID=BALIOE_10980;Name=hypothetical protein;locus_tag=BALIOE_10980;product=hypothetical protein;Parent=BALIOE_10980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4404 c1 Prodigal gene 2195702 2195929 . - . ID=BALIOE_10985_gene;locus_tag=BALIOE_10985 | |
| 4405 c1 Prodigal CDS 2195702 2195929 . - 0 ID=BALIOE_10985;Name=hypothetical protein;locus_tag=BALIOE_10985;product=hypothetical protein;Parent=BALIOE_10985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4406 c1 Prodigal gene 2195926 2196207 . - . ID=BALIOE_10990_gene;locus_tag=BALIOE_10990 | |
| 4407 c1 Prodigal CDS 2195926 2196207 . - 0 ID=BALIOE_10990;Name=hypothetical protein;locus_tag=BALIOE_10990;product=hypothetical protein;Parent=BALIOE_10990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4408 c1 Prodigal gene 2196240 2196956 . - . ID=BALIOE_10995_gene;locus_tag=BALIOE_10995 | |
| 4409 c1 Prodigal CDS 2196240 2196956 . - 0 ID=BALIOE_10995;Name=hypothetical protein;locus_tag=BALIOE_10995;product=hypothetical protein;Parent=BALIOE_10995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4410 c1 Prodigal gene 2196990 2197451 . - . ID=BALIOE_11000_gene;locus_tag=BALIOE_11000 | |
| 4411 c1 Prodigal CDS 2196990 2197451 . - 0 ID=BALIOE_11000;Name=hypothetical protein;locus_tag=BALIOE_11000;product=hypothetical protein;Parent=BALIOE_11000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4412 c1 Prodigal gene 2197444 2198487 . - . ID=BALIOE_11005_gene;locus_tag=BALIOE_11005 | |
| 4413 c1 Prodigal CDS 2197444 2198487 . - 0 ID=BALIOE_11005;Name=hypothetical protein;locus_tag=BALIOE_11005;product=hypothetical protein;Parent=BALIOE_11005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4414 c1 Prodigal gene 2198556 2198981 . - . ID=BALIOE_11010_gene;locus_tag=BALIOE_11010 | |
| 4415 c1 Prodigal CDS 2198556 2198981 . - 0 ID=BALIOE_11010;Name=hypothetical protein;locus_tag=BALIOE_11010;product=hypothetical protein;Parent=BALIOE_11010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4416 c1 Prodigal gene 2198965 2199207 . - . ID=BALIOE_11015_gene;locus_tag=BALIOE_11015 | |
| 4417 c1 Prodigal CDS 2198965 2199207 . - 0 ID=BALIOE_11015;Name=hypothetical protein;locus_tag=BALIOE_11015;product=hypothetical protein;Parent=BALIOE_11015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4418 c1 Prodigal gene 2199599 2199937 . + . ID=BALIOE_11020_gene;locus_tag=BALIOE_11020 | |
| 4419 c1 Prodigal CDS 2199599 2199937 . + 0 ID=BALIOE_11020;Name=hypothetical protein;locus_tag=BALIOE_11020;product=hypothetical protein;Parent=BALIOE_11020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4420 c1 Prodigal gene 2200149 2200382 . + . ID=BALIOE_11025_gene;locus_tag=BALIOE_11025 | |
| 4421 c1 Prodigal CDS 2200149 2200382 . + 0 ID=BALIOE_11025;Name=hypothetical protein;locus_tag=BALIOE_11025;product=hypothetical protein;Parent=BALIOE_11025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4422 c1 Prodigal gene 2200394 2201032 . + . ID=BALIOE_11030_gene;locus_tag=BALIOE_11030 | |
| 4423 c1 Prodigal CDS 2200394 2201032 . + 0 ID=BALIOE_11030;Name=hypothetical protein;locus_tag=BALIOE_11030;product=hypothetical protein;Parent=BALIOE_11030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4424 c1 Prodigal gene 2201033 2201242 . - . ID=BALIOE_11035_gene;locus_tag=BALIOE_11035 | |
| 4425 c1 Prodigal CDS 2201033 2201242 . - 0 ID=BALIOE_11035;Name=hypothetical protein;locus_tag=BALIOE_11035;product=hypothetical protein;Parent=BALIOE_11035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4426 c1 Prodigal gene 2201807 2201995 . + . ID=BALIOE_11040_gene;locus_tag=BALIOE_11040 | |
| 4427 c1 Prodigal CDS 2201807 2201995 . + 0 ID=BALIOE_11040;Name=hypothetical protein;locus_tag=BALIOE_11040;product=hypothetical protein;Parent=BALIOE_11040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4428 c1 Prodigal gene 2201992 2202180 . + . ID=BALIOE_11045_gene;locus_tag=BALIOE_11045 | |
| 4429 c1 Prodigal CDS 2201992 2202180 . + 0 ID=BALIOE_11045;Name=hypothetical protein;locus_tag=BALIOE_11045;product=hypothetical protein;Parent=BALIOE_11045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4430 c1 Prodigal gene 2202273 2203517 . + . ID=BALIOE_11050_gene;locus_tag=BALIOE_11050 | |
| 4431 c1 Prodigal CDS 2202273 2203517 . + 0 ID=BALIOE_11050;Name=hypothetical protein;locus_tag=BALIOE_11050;product=hypothetical protein;Parent=BALIOE_11050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4432 c1 Prodigal gene 2203514 2204050 . + . ID=BALIOE_11055_gene;locus_tag=BALIOE_11055 | |
| 4433 c1 Prodigal CDS 2203514 2204050 . + 0 ID=BALIOE_11055;Name=hypothetical protein;locus_tag=BALIOE_11055;product=hypothetical protein;Parent=BALIOE_11055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4434 c1 Prodigal gene 2204156 2204410 . + . ID=BALIOE_11060_gene;locus_tag=BALIOE_11060 | |
| 4435 c1 Prodigal CDS 2204156 2204410 . + 0 ID=BALIOE_11060;Name=hypothetical protein;locus_tag=BALIOE_11060;product=hypothetical protein;Parent=BALIOE_11060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4436 c1 Prodigal gene 2204413 2205300 . - . ID=BALIOE_11065_gene;locus_tag=BALIOE_11065 | |
| 4437 c1 Prodigal CDS 2204413 2205300 . - 0 ID=BALIOE_11065;Name=hypothetical protein;locus_tag=BALIOE_11065;product=hypothetical protein;Parent=BALIOE_11065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4438 c1 Prodigal gene 2205300 2205626 . - . ID=BALIOE_11070_gene;locus_tag=BALIOE_11070 | |
| 4439 c1 Prodigal CDS 2205300 2205626 . - 0 ID=BALIOE_11070;Name=hypothetical protein;locus_tag=BALIOE_11070;product=hypothetical protein;Parent=BALIOE_11070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4440 c1 Prodigal gene 2205833 2206702 . - . ID=BALIOE_11075_gene;locus_tag=BALIOE_11075 | |
| 4441 c1 Prodigal CDS 2205833 2206702 . - 0 ID=BALIOE_11075;Name=hypothetical protein;locus_tag=BALIOE_11075;product=hypothetical protein;Parent=BALIOE_11075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4442 c1 Prodigal gene 2206746 2207126 . + . ID=BALIOE_11080_gene;locus_tag=BALIOE_11080 | |
| 4443 c1 Prodigal CDS 2206746 2207126 . + 0 ID=BALIOE_11080;Name=hypothetical protein;locus_tag=BALIOE_11080;product=hypothetical protein;Parent=BALIOE_11080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4444 c1 Prodigal gene 2207123 2207470 . + . ID=BALIOE_11085_gene;locus_tag=BALIOE_11085 | |
| 4445 c1 Prodigal CDS 2207123 2207470 . + 0 ID=BALIOE_11085;Name=hypothetical protein;locus_tag=BALIOE_11085;product=hypothetical protein;Parent=BALIOE_11085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4446 c1 Prodigal gene 2207520 2209058 . + . ID=BALIOE_11090_gene;locus_tag=BALIOE_11090 | |
| 4447 c1 Prodigal CDS 2207520 2209058 . + 0 ID=BALIOE_11090;Name=hypothetical protein;locus_tag=BALIOE_11090;product=hypothetical protein;Parent=BALIOE_11090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4448 c1 Prodigal gene 2209069 2209491 . - . ID=BALIOE_11095_gene;locus_tag=BALIOE_11095 | |
| 4449 c1 Prodigal CDS 2209069 2209491 . - 0 ID=BALIOE_11095;Name=hypothetical protein;locus_tag=BALIOE_11095;product=hypothetical protein;Parent=BALIOE_11095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4450 c1 Prodigal gene 2209641 2210291 . - . ID=BALIOE_11100_gene;locus_tag=BALIOE_11100 | |
| 4451 c1 Prodigal CDS 2209641 2210291 . - 0 ID=BALIOE_11100;Name=hypothetical protein;locus_tag=BALIOE_11100;product=hypothetical protein;Parent=BALIOE_11100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4452 c1 Prodigal gene 2210565 2210711 . - . ID=BALIOE_11105_gene;locus_tag=BALIOE_11105 | |
| 4453 c1 Prodigal CDS 2210565 2210711 . - 0 ID=BALIOE_11105;Name=hypothetical protein;locus_tag=BALIOE_11105;product=hypothetical protein;Parent=BALIOE_11105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4454 c1 Prodigal gene 2211002 2211511 . - . ID=BALIOE_11110_gene;locus_tag=BALIOE_11110 | |
| 4455 c1 Prodigal CDS 2211002 2211511 . - 0 ID=BALIOE_11110;Name=hypothetical protein;locus_tag=BALIOE_11110;product=hypothetical protein;Parent=BALIOE_11110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4456 c1 Prodigal gene 2211691 2211960 . - . ID=BALIOE_11115_gene;locus_tag=BALIOE_11115 | |
| 4457 c1 Prodigal CDS 2211691 2211960 . - 0 ID=BALIOE_11115;Name=hypothetical protein;locus_tag=BALIOE_11115;product=hypothetical protein;Parent=BALIOE_11115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4458 c1 Prodigal gene 2211962 2213185 . - . ID=BALIOE_11120_gene;locus_tag=BALIOE_11120 | |
| 4459 c1 Prodigal CDS 2211962 2213185 . - 0 ID=BALIOE_11120;Name=hypothetical protein;locus_tag=BALIOE_11120;product=hypothetical protein;Parent=BALIOE_11120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4460 c1 Prodigal gene 2213250 2213849 . - . ID=BALIOE_11125_gene;locus_tag=BALIOE_11125 | |
| 4461 c1 Prodigal CDS 2213250 2213849 . - 0 ID=BALIOE_11125;Name=hypothetical protein;locus_tag=BALIOE_11125;product=hypothetical protein;Parent=BALIOE_11125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4462 c1 Prodigal gene 2213917 2214132 . - . ID=BALIOE_11130_gene;locus_tag=BALIOE_11130 | |
| 4463 c1 Prodigal CDS 2213917 2214132 . - 0 ID=BALIOE_11130;Name=hypothetical protein;locus_tag=BALIOE_11130;product=hypothetical protein;Parent=BALIOE_11130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4464 c1 Prodigal gene 2214135 2216264 . - . ID=BALIOE_11135_gene;locus_tag=BALIOE_11135 | |
| 4465 c1 Prodigal CDS 2214135 2216264 . - 0 ID=BALIOE_11135;Name=hypothetical protein;locus_tag=BALIOE_11135;product=hypothetical protein;Parent=BALIOE_11135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4466 c1 Prodigal gene 2216216 2217391 . - . ID=BALIOE_11140_gene;locus_tag=BALIOE_11140 | |
| 4467 c1 Prodigal CDS 2216216 2217391 . - 0 ID=BALIOE_11140;Name=hypothetical protein;locus_tag=BALIOE_11140;product=hypothetical protein;Parent=BALIOE_11140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4468 c1 Prodigal gene 2217733 2218314 . - . ID=BALIOE_11145_gene;locus_tag=BALIOE_11145 | |
| 4469 c1 Prodigal CDS 2217733 2218314 . - 0 ID=BALIOE_11145;Name=hypothetical protein;locus_tag=BALIOE_11145;product=hypothetical protein;Parent=BALIOE_11145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4470 c1 Prodigal gene 2218311 2219054 . - . ID=BALIOE_11150_gene;locus_tag=BALIOE_11150 | |
| 4471 c1 Prodigal CDS 2218311 2219054 . - 0 ID=BALIOE_11150;Name=hypothetical protein;locus_tag=BALIOE_11150;product=hypothetical protein;Parent=BALIOE_11150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4472 c1 Prodigal gene 2219065 2219763 . - . ID=BALIOE_11155_gene;locus_tag=BALIOE_11155 | |
| 4473 c1 Prodigal CDS 2219065 2219763 . - 0 ID=BALIOE_11155;Name=hypothetical protein;locus_tag=BALIOE_11155;product=hypothetical protein;Parent=BALIOE_11155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4474 c1 Prodigal gene 2219763 2220104 . - . ID=BALIOE_11160_gene;locus_tag=BALIOE_11160 | |
| 4475 c1 Prodigal CDS 2219763 2220104 . - 0 ID=BALIOE_11160;Name=hypothetical protein;locus_tag=BALIOE_11160;product=hypothetical protein;Parent=BALIOE_11160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4476 c1 Prodigal gene 2220097 2223339 . - . ID=BALIOE_11165_gene;locus_tag=BALIOE_11165 | |
| 4477 c1 Prodigal CDS 2220097 2223339 . - 0 ID=BALIOE_11165;Name=hypothetical protein;locus_tag=BALIOE_11165;product=hypothetical protein;Parent=BALIOE_11165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4478 c1 Prodigal gene 2223387 2223596 . - . ID=BALIOE_11170_gene;locus_tag=BALIOE_11170 | |
| 4479 c1 Prodigal CDS 2223387 2223596 . - 0 ID=BALIOE_11170;Name=hypothetical protein;locus_tag=BALIOE_11170;product=hypothetical protein;Parent=BALIOE_11170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4480 c1 Prodigal gene 2223692 2224066 . - . ID=BALIOE_11175_gene;locus_tag=BALIOE_11175 | |
| 4481 c1 Prodigal CDS 2223692 2224066 . - 0 ID=BALIOE_11175;Name=hypothetical protein;locus_tag=BALIOE_11175;product=hypothetical protein;Parent=BALIOE_11175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4482 c1 Prodigal gene 2224081 2224797 . - . ID=BALIOE_11180_gene;locus_tag=BALIOE_11180 | |
| 4483 c1 Prodigal CDS 2224081 2224797 . - 0 ID=BALIOE_11180;Name=hypothetical protein;locus_tag=BALIOE_11180;product=hypothetical protein;Parent=BALIOE_11180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4484 c1 Prodigal gene 2224863 2225207 . - . ID=BALIOE_11185_gene;locus_tag=BALIOE_11185 | |
| 4485 c1 Prodigal CDS 2224863 2225207 . - 0 ID=BALIOE_11185;Name=hypothetical protein;locus_tag=BALIOE_11185;product=hypothetical protein;Parent=BALIOE_11185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4486 c1 Prodigal gene 2225204 2225650 . - . ID=BALIOE_11190_gene;locus_tag=BALIOE_11190 | |
| 4487 c1 Prodigal CDS 2225204 2225650 . - 0 ID=BALIOE_11190;Name=hypothetical protein;locus_tag=BALIOE_11190;product=hypothetical protein;Parent=BALIOE_11190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4488 c1 Prodigal gene 2225647 2225997 . - . ID=BALIOE_11195_gene;locus_tag=BALIOE_11195 | |
| 4489 c1 Prodigal CDS 2225647 2225997 . - 0 ID=BALIOE_11195;Name=hypothetical protein;locus_tag=BALIOE_11195;product=hypothetical protein;Parent=BALIOE_11195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4490 c1 Prodigal gene 2226007 2226333 . - . ID=BALIOE_11200_gene;locus_tag=BALIOE_11200 | |
| 4491 c1 Prodigal CDS 2226007 2226333 . - 0 ID=BALIOE_11200;Name=hypothetical protein;locus_tag=BALIOE_11200;product=hypothetical protein;Parent=BALIOE_11200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4492 c1 Prodigal gene 2226336 2228915 . - . ID=BALIOE_11205_gene;locus_tag=BALIOE_11205 | |
| 4493 c1 Prodigal CDS 2226336 2228915 . - 0 ID=BALIOE_11205;Name=hypothetical protein;locus_tag=BALIOE_11205;product=hypothetical protein;Parent=BALIOE_11205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4494 c1 Prodigal gene 2228861 2229082 . - . ID=BALIOE_11210_gene;locus_tag=BALIOE_11210 | |
| 4495 c1 Prodigal CDS 2228861 2229082 . - 0 ID=BALIOE_11210;Name=hypothetical protein;locus_tag=BALIOE_11210;product=hypothetical protein;Parent=BALIOE_11210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4496 c1 Prodigal gene 2229127 2231064 . - . ID=BALIOE_11215_gene;locus_tag=BALIOE_11215 | |
| 4497 c1 Prodigal CDS 2229127 2231064 . - 0 ID=BALIOE_11215;Name=hypothetical protein;locus_tag=BALIOE_11215;product=hypothetical protein;Parent=BALIOE_11215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4498 c1 Prodigal gene 2231128 2232789 . - . ID=BALIOE_11220_gene;locus_tag=BALIOE_11220 | |
| 4499 c1 Prodigal CDS 2231128 2232789 . - 0 ID=BALIOE_11220;Name=hypothetical protein;locus_tag=BALIOE_11220;product=hypothetical protein;Parent=BALIOE_11220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4500 c1 Prodigal gene 2232786 2233349 . - . ID=BALIOE_11225_gene;locus_tag=BALIOE_11225 | |
| 4501 c1 Prodigal CDS 2232786 2233349 . - 0 ID=BALIOE_11225;Name=hypothetical protein;locus_tag=BALIOE_11225;product=hypothetical protein;Parent=BALIOE_11225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4502 c1 Prodigal gene 2233639 2234004 . - . ID=BALIOE_11230_gene;locus_tag=BALIOE_11230 | |
| 4503 c1 Prodigal CDS 2233639 2234004 . - 0 ID=BALIOE_11230;Name=hypothetical protein;locus_tag=BALIOE_11230;product=hypothetical protein;Parent=BALIOE_11230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4504 c1 Prodigal gene 2234046 2234273 . + . ID=BALIOE_11235_gene;locus_tag=BALIOE_11235 | |
| 4505 c1 Prodigal CDS 2234046 2234273 . + 0 ID=BALIOE_11235;Name=hypothetical protein;locus_tag=BALIOE_11235;product=hypothetical protein;Parent=BALIOE_11235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4506 c1 Prodigal gene 2234636 2235103 . - . ID=BALIOE_11240_gene;locus_tag=BALIOE_11240 | |
| 4507 c1 Prodigal CDS 2234636 2235103 . - 0 ID=BALIOE_11240;Name=hypothetical protein;locus_tag=BALIOE_11240;product=hypothetical protein;Parent=BALIOE_11240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4508 c1 Prodigal gene 2235111 2235257 . - . ID=BALIOE_11245_gene;locus_tag=BALIOE_11245 | |
| 4509 c1 Prodigal CDS 2235111 2235257 . - 0 ID=BALIOE_11245;Name=hypothetical protein;locus_tag=BALIOE_11245;product=hypothetical protein;Parent=BALIOE_11245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4510 c1 Prodigal gene 2235257 2235826 . - . ID=BALIOE_11250_gene;locus_tag=BALIOE_11250 | |
| 4511 c1 Prodigal CDS 2235257 2235826 . - 0 ID=BALIOE_11250;Name=hypothetical protein;locus_tag=BALIOE_11250;product=hypothetical protein;Parent=BALIOE_11250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4512 c1 Prodigal gene 2236097 2236630 . - . ID=BALIOE_11255_gene;locus_tag=BALIOE_11255 | |
| 4513 c1 Prodigal CDS 2236097 2236630 . - 0 ID=BALIOE_11255;Name=hypothetical protein;locus_tag=BALIOE_11255;product=hypothetical protein;Parent=BALIOE_11255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4514 c1 Prodigal gene 2236681 2237025 . - . ID=BALIOE_11260_gene;locus_tag=BALIOE_11260 | |
| 4515 c1 Prodigal CDS 2236681 2237025 . - 0 ID=BALIOE_11260;Name=hypothetical protein;locus_tag=BALIOE_11260;product=hypothetical protein;Parent=BALIOE_11260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4516 c1 Prodigal gene 2237030 2237236 . - . ID=BALIOE_11265_gene;locus_tag=BALIOE_11265 | |
| 4517 c1 Prodigal CDS 2237030 2237236 . - 0 ID=BALIOE_11265;Name=hypothetical protein;locus_tag=BALIOE_11265;product=hypothetical protein;Parent=BALIOE_11265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4518 c1 Prodigal gene 2237685 2239535 . - . ID=BALIOE_11270_gene;locus_tag=BALIOE_11270 | |
| 4519 c1 Prodigal CDS 2237685 2239535 . - 0 ID=BALIOE_11270;Name=hypothetical protein;locus_tag=BALIOE_11270;product=hypothetical protein;Parent=BALIOE_11270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4520 c1 Prodigal gene 2239850 2240017 . - . ID=BALIOE_11275_gene;locus_tag=BALIOE_11275 | |
| 4521 c1 Prodigal CDS 2239850 2240017 . - 0 ID=BALIOE_11275;Name=hypothetical protein;locus_tag=BALIOE_11275;product=hypothetical protein;Parent=BALIOE_11275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4522 c1 Prodigal gene 2240014 2240442 . - . ID=BALIOE_11280_gene;locus_tag=BALIOE_11280 | |
| 4523 c1 Prodigal CDS 2240014 2240442 . - 0 ID=BALIOE_11280;Name=hypothetical protein;locus_tag=BALIOE_11280;product=hypothetical protein;Parent=BALIOE_11280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4524 c1 tRNAscan-SE gene 2240622 2240698 . - . ID=BALIOE_11285_gene;locus_tag=BALIOE_11285;gene=Arg_trna | |
| 4525 c1 tRNAscan-SE tRNA 2240622 2240698 . - . ID=BALIOE_11285;Name=tRNA-Arg;locus_tag=BALIOE_11285;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_11285_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 4526 c1 tRNAscan-SE gene 2240712 2240788 . - . ID=BALIOE_11290_gene;locus_tag=BALIOE_11290;gene=Arg_trna | |
| 4527 c1 tRNAscan-SE tRNA 2240712 2240788 . - . ID=BALIOE_11290;Name=tRNA-Arg;locus_tag=BALIOE_11290;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_11290_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 4528 c1 tRNAscan-SE gene 2240796 2240871 . - . ID=BALIOE_11295_gene;locus_tag=BALIOE_11295;gene=Ile2_trna | |
| 4529 c1 tRNAscan-SE tRNA 2240796 2240871 . - . ID=BALIOE_11295;Name=tRNA-Ile2;locus_tag=BALIOE_11295;product=tRNA-Ile2;gene=Ile2_trna;Parent=BALIOE_11295_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 4530 c1 Prodigal gene 2241082 2241771 . - . ID=BALIOE_11300_gene;locus_tag=BALIOE_11300 | |
| 4531 c1 Prodigal CDS 2241082 2241771 . - 0 ID=BALIOE_11300;Name=hypothetical protein;locus_tag=BALIOE_11300;product=hypothetical protein;Parent=BALIOE_11300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4532 c1 Prodigal gene 2241768 2242127 . - . ID=BALIOE_11305_gene;locus_tag=BALIOE_11305 | |
| 4533 c1 Prodigal CDS 2241768 2242127 . - 0 ID=BALIOE_11305;Name=hypothetical protein;locus_tag=BALIOE_11305;product=hypothetical protein;Parent=BALIOE_11305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4534 c1 Prodigal gene 2242140 2243189 . - . ID=BALIOE_11310_gene;locus_tag=BALIOE_11310 | |
| 4535 c1 Prodigal CDS 2242140 2243189 . - 0 ID=BALIOE_11310;Name=hypothetical protein;locus_tag=BALIOE_11310;product=hypothetical protein;Parent=BALIOE_11310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4536 c1 Prodigal gene 2243637 2243849 . - . ID=BALIOE_11315_gene;locus_tag=BALIOE_11315 | |
| 4537 c1 Prodigal CDS 2243637 2243849 . - 0 ID=BALIOE_11315;Name=hypothetical protein;locus_tag=BALIOE_11315;product=hypothetical protein;Parent=BALIOE_11315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4538 c1 Prodigal gene 2243894 2244049 . + . ID=BALIOE_11320_gene;locus_tag=BALIOE_11320 | |
| 4539 c1 Prodigal CDS 2243894 2244049 . + 0 ID=BALIOE_11320;Name=hypothetical protein;locus_tag=BALIOE_11320;product=hypothetical protein;Parent=BALIOE_11320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4540 c1 Prodigal gene 2244038 2244142 . - . ID=BALIOE_11325_gene;locus_tag=BALIOE_11325 | |
| 4541 c1 Prodigal CDS 2244038 2244142 . - 0 ID=BALIOE_11325;Name=hypothetical protein;locus_tag=BALIOE_11325;product=hypothetical protein;Parent=BALIOE_11325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4542 c1 Prodigal gene 2244258 2244842 . - . ID=BALIOE_11330_gene;locus_tag=BALIOE_11330 | |
| 4543 c1 Prodigal CDS 2244258 2244842 . - 0 ID=BALIOE_11330;Name=hypothetical protein;locus_tag=BALIOE_11330;product=hypothetical protein;Parent=BALIOE_11330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4544 c1 Prodigal gene 2244899 2245294 . - . ID=BALIOE_11335_gene;locus_tag=BALIOE_11335 | |
| 4545 c1 Prodigal CDS 2244899 2245294 . - 0 ID=BALIOE_11335;Name=hypothetical protein;locus_tag=BALIOE_11335;product=hypothetical protein;Parent=BALIOE_11335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4546 c1 Prodigal gene 2245310 2245978 . - . ID=BALIOE_11340_gene;locus_tag=BALIOE_11340 | |
| 4547 c1 Prodigal CDS 2245310 2245978 . - 0 ID=BALIOE_11340;Name=hypothetical protein;locus_tag=BALIOE_11340;product=hypothetical protein;Parent=BALIOE_11340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4548 c1 Prodigal gene 2246105 2246845 . - . ID=BALIOE_11345_gene;locus_tag=BALIOE_11345 | |
| 4549 c1 Prodigal CDS 2246105 2246845 . - 0 ID=BALIOE_11345;Name=hypothetical protein;locus_tag=BALIOE_11345;product=hypothetical protein;Parent=BALIOE_11345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4550 c1 Prodigal gene 2246852 2247814 . - . ID=BALIOE_11350_gene;locus_tag=BALIOE_11350 | |
| 4551 c1 Prodigal CDS 2246852 2247814 . - 0 ID=BALIOE_11350;Name=hypothetical protein;locus_tag=BALIOE_11350;product=hypothetical protein;Parent=BALIOE_11350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4552 c1 Prodigal gene 2247837 2248262 . - . ID=BALIOE_11355_gene;locus_tag=BALIOE_11355 | |
| 4553 c1 Prodigal CDS 2247837 2248262 . - 0 ID=BALIOE_11355;Name=hypothetical protein;locus_tag=BALIOE_11355;product=hypothetical protein;Parent=BALIOE_11355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4554 c1 Prodigal gene 2248259 2248561 . - . ID=BALIOE_11360_gene;locus_tag=BALIOE_11360 | |
| 4555 c1 Prodigal CDS 2248259 2248561 . - 0 ID=BALIOE_11360;Name=hypothetical protein;locus_tag=BALIOE_11360;product=hypothetical protein;Parent=BALIOE_11360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4556 c1 Prodigal gene 2248659 2249030 . + . ID=BALIOE_11365_gene;locus_tag=BALIOE_11365 | |
| 4557 c1 Prodigal CDS 2248659 2249030 . + 0 ID=BALIOE_11365;Name=hypothetical protein;locus_tag=BALIOE_11365;product=hypothetical protein;Parent=BALIOE_11365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4558 c1 Prodigal gene 2249051 2249242 . + . ID=BALIOE_11370_gene;locus_tag=BALIOE_11370 | |
| 4559 c1 Prodigal CDS 2249051 2249242 . + 0 ID=BALIOE_11370;Name=hypothetical protein;locus_tag=BALIOE_11370;product=hypothetical protein;Parent=BALIOE_11370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4560 c1 Prodigal gene 2249244 2249522 . + . ID=BALIOE_11375_gene;locus_tag=BALIOE_11375 | |
| 4561 c1 Prodigal CDS 2249244 2249522 . + 0 ID=BALIOE_11375;Name=hypothetical protein;locus_tag=BALIOE_11375;product=hypothetical protein;Parent=BALIOE_11375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4562 c1 Prodigal gene 2249953 2250153 . - . ID=BALIOE_11380_gene;locus_tag=BALIOE_11380 | |
| 4563 c1 Prodigal CDS 2249953 2250153 . - 0 ID=BALIOE_11380;Name=hypothetical protein;locus_tag=BALIOE_11380;product=hypothetical protein;Parent=BALIOE_11380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4564 c1 Prodigal gene 2250246 2250464 . + . ID=BALIOE_11385_gene;locus_tag=BALIOE_11385 | |
| 4565 c1 Prodigal CDS 2250246 2250464 . + 0 ID=BALIOE_11385;Name=hypothetical protein;locus_tag=BALIOE_11385;product=hypothetical protein;Parent=BALIOE_11385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4566 c1 Prodigal gene 2250468 2250632 . - . ID=BALIOE_11390_gene;locus_tag=BALIOE_11390 | |
| 4567 c1 Prodigal CDS 2250468 2250632 . - 0 ID=BALIOE_11390;Name=hypothetical protein;locus_tag=BALIOE_11390;product=hypothetical protein;Parent=BALIOE_11390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4568 c1 Prodigal gene 2251033 2251221 . + . ID=BALIOE_11395_gene;locus_tag=BALIOE_11395 | |
| 4569 c1 Prodigal CDS 2251033 2251221 . + 0 ID=BALIOE_11395;Name=hypothetical protein;locus_tag=BALIOE_11395;product=hypothetical protein;Parent=BALIOE_11395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4570 c1 Prodigal gene 2251218 2251409 . + . ID=BALIOE_11400_gene;locus_tag=BALIOE_11400 | |
| 4571 c1 Prodigal CDS 2251218 2251409 . + 0 ID=BALIOE_11400;Name=hypothetical protein;locus_tag=BALIOE_11400;product=hypothetical protein;Parent=BALIOE_11400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4572 c1 Prodigal gene 2251502 2253973 . + . ID=BALIOE_11405_gene;locus_tag=BALIOE_11405 | |
| 4573 c1 Prodigal CDS 2251502 2253973 . + 0 ID=BALIOE_11405;Name=hypothetical protein;locus_tag=BALIOE_11405;product=hypothetical protein;Parent=BALIOE_11405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4574 c1 Prodigal gene 2254061 2254297 . + . ID=BALIOE_11410_gene;locus_tag=BALIOE_11410 | |
| 4575 c1 Prodigal CDS 2254061 2254297 . + 0 ID=BALIOE_11410;Name=hypothetical protein;locus_tag=BALIOE_11410;product=hypothetical protein;Parent=BALIOE_11410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4576 c1 Prodigal gene 2254332 2254487 . + . ID=BALIOE_11415_gene;locus_tag=BALIOE_11415 | |
| 4577 c1 Prodigal CDS 2254332 2254487 . + 0 ID=BALIOE_11415;Name=hypothetical protein;locus_tag=BALIOE_11415;product=hypothetical protein;Parent=BALIOE_11415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4578 c1 Prodigal gene 2254988 2255080 . - . ID=BALIOE_11420_gene;locus_tag=BALIOE_11420 | |
| 4579 c1 Prodigal CDS 2254988 2255080 . - 0 ID=BALIOE_11420;Name=hypothetical protein;locus_tag=BALIOE_11420;product=hypothetical protein;Parent=BALIOE_11420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4580 c1 Prodigal gene 2255286 2255612 . - . ID=BALIOE_11425_gene;locus_tag=BALIOE_11425 | |
| 4581 c1 Prodigal CDS 2255286 2255612 . - 0 ID=BALIOE_11425;Name=hypothetical protein;locus_tag=BALIOE_11425;product=hypothetical protein;Parent=BALIOE_11425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4582 c1 Prodigal gene 2255747 2256088 . + . ID=BALIOE_11430_gene;locus_tag=BALIOE_11430 | |
| 4583 c1 Prodigal CDS 2255747 2256088 . + 0 ID=BALIOE_11430;Name=hypothetical protein;locus_tag=BALIOE_11430;product=hypothetical protein;Parent=BALIOE_11430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4584 c1 Prodigal gene 2256123 2256683 . + . ID=BALIOE_11435_gene;locus_tag=BALIOE_11435 | |
| 4585 c1 Prodigal CDS 2256123 2256683 . + 0 ID=BALIOE_11435;Name=hypothetical protein;locus_tag=BALIOE_11435;product=hypothetical protein;Parent=BALIOE_11435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4586 c1 Prodigal gene 2256686 2257432 . - . ID=BALIOE_11440_gene;locus_tag=BALIOE_11440 | |
| 4587 c1 Prodigal CDS 2256686 2257432 . - 0 ID=BALIOE_11440;Name=hypothetical protein;locus_tag=BALIOE_11440;product=hypothetical protein;Parent=BALIOE_11440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4588 c1 Prodigal gene 2257504 2257809 . + . ID=BALIOE_11445_gene;locus_tag=BALIOE_11445 | |
| 4589 c1 Prodigal CDS 2257504 2257809 . + 0 ID=BALIOE_11445;Name=hypothetical protein;locus_tag=BALIOE_11445;product=hypothetical protein;Parent=BALIOE_11445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4590 c1 Prodigal gene 2258008 2260434 . + . ID=BALIOE_11450_gene;locus_tag=BALIOE_11450 | |
| 4591 c1 Prodigal CDS 2258008 2260434 . + 0 ID=BALIOE_11450;Name=hypothetical protein;locus_tag=BALIOE_11450;product=hypothetical protein;Parent=BALIOE_11450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4592 c1 Prodigal gene 2260522 2262918 . + . ID=BALIOE_11455_gene;locus_tag=BALIOE_11455 | |
| 4593 c1 Prodigal CDS 2260522 2262918 . + 0 ID=BALIOE_11455;Name=hypothetical protein;locus_tag=BALIOE_11455;product=hypothetical protein;Parent=BALIOE_11455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4594 c1 Prodigal gene 2262929 2263546 . + . ID=BALIOE_11460_gene;locus_tag=BALIOE_11460 | |
| 4595 c1 Prodigal CDS 2262929 2263546 . + 0 ID=BALIOE_11460;Name=hypothetical protein;locus_tag=BALIOE_11460;product=hypothetical protein;Parent=BALIOE_11460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4596 c1 Prodigal gene 2263548 2264402 . + . ID=BALIOE_11465_gene;locus_tag=BALIOE_11465 | |
| 4597 c1 Prodigal CDS 2263548 2264402 . + 0 ID=BALIOE_11465;Name=hypothetical protein;locus_tag=BALIOE_11465;product=hypothetical protein;Parent=BALIOE_11465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4598 c1 Prodigal gene 2264445 2265059 . + . ID=BALIOE_11470_gene;locus_tag=BALIOE_11470 | |
| 4599 c1 Prodigal CDS 2264445 2265059 . + 0 ID=BALIOE_11470;Name=hypothetical protein;locus_tag=BALIOE_11470;product=hypothetical protein;Parent=BALIOE_11470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4600 c1 Prodigal gene 2265253 2266509 . + . ID=BALIOE_11475_gene;locus_tag=BALIOE_11475 | |
| 4601 c1 Prodigal CDS 2265253 2266509 . + 0 ID=BALIOE_11475;Name=hypothetical protein;locus_tag=BALIOE_11475;product=hypothetical protein;Parent=BALIOE_11475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4602 c1 Prodigal gene 2266462 2267157 . - . ID=BALIOE_11480_gene;locus_tag=BALIOE_11480 | |
| 4603 c1 Prodigal CDS 2266462 2267157 . - 0 ID=BALIOE_11480;Name=hypothetical protein;locus_tag=BALIOE_11480;product=hypothetical protein;Parent=BALIOE_11480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4604 c1 Prodigal gene 2267282 2268502 . - . ID=BALIOE_11485_gene;locus_tag=BALIOE_11485 | |
| 4605 c1 Prodigal CDS 2267282 2268502 . - 0 ID=BALIOE_11485;Name=hypothetical protein;locus_tag=BALIOE_11485;product=hypothetical protein;Parent=BALIOE_11485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4606 c1 Prodigal gene 2268637 2269530 . - . ID=BALIOE_11490_gene;locus_tag=BALIOE_11490 | |
| 4607 c1 Prodigal CDS 2268637 2269530 . - 0 ID=BALIOE_11490;Name=hypothetical protein;locus_tag=BALIOE_11490;product=hypothetical protein;Parent=BALIOE_11490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4608 c1 Prodigal gene 2269637 2270890 . + . ID=BALIOE_11495_gene;locus_tag=BALIOE_11495 | |
| 4609 c1 Prodigal CDS 2269637 2270890 . + 0 ID=BALIOE_11495;Name=hypothetical protein;locus_tag=BALIOE_11495;product=hypothetical protein;Parent=BALIOE_11495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4610 c1 Prodigal gene 2271314 2271622 . + . ID=BALIOE_11500_gene;locus_tag=BALIOE_11500 | |
| 4611 c1 Prodigal CDS 2271314 2271622 . + 0 ID=BALIOE_11500;Name=hypothetical protein;locus_tag=BALIOE_11500;product=hypothetical protein;Parent=BALIOE_11500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4612 c1 Prodigal gene 2271898 2272719 . + . ID=BALIOE_11505_gene;locus_tag=BALIOE_11505 | |
| 4613 c1 Prodigal CDS 2271898 2272719 . + 0 ID=BALIOE_11505;Name=hypothetical protein;locus_tag=BALIOE_11505;product=hypothetical protein;Parent=BALIOE_11505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4614 c1 Prodigal gene 2272758 2273087 . - . ID=BALIOE_11510_gene;locus_tag=BALIOE_11510 | |
| 4615 c1 Prodigal CDS 2272758 2273087 . - 0 ID=BALIOE_11510;Name=hypothetical protein;locus_tag=BALIOE_11510;product=hypothetical protein;Parent=BALIOE_11510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4616 c1 Prodigal gene 2273074 2273439 . - . ID=BALIOE_11515_gene;locus_tag=BALIOE_11515 | |
| 4617 c1 Prodigal CDS 2273074 2273439 . - 0 ID=BALIOE_11515;Name=hypothetical protein;locus_tag=BALIOE_11515;product=hypothetical protein;Parent=BALIOE_11515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4618 c1 Prodigal gene 2273851 2274885 . + . ID=BALIOE_11520_gene;locus_tag=BALIOE_11520 | |
| 4619 c1 Prodigal CDS 2273851 2274885 . + 0 ID=BALIOE_11520;Name=hypothetical protein;locus_tag=BALIOE_11520;product=hypothetical protein;Parent=BALIOE_11520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4620 c1 Prodigal gene 2274910 2276298 . - . ID=BALIOE_11525_gene;locus_tag=BALIOE_11525 | |
| 4621 c1 Prodigal CDS 2274910 2276298 . - 0 ID=BALIOE_11525;Name=hypothetical protein;locus_tag=BALIOE_11525;product=hypothetical protein;Parent=BALIOE_11525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4622 c1 Prodigal gene 2276309 2277841 . - . ID=BALIOE_11530_gene;locus_tag=BALIOE_11530 | |
| 4623 c1 Prodigal CDS 2276309 2277841 . - 0 ID=BALIOE_11530;Name=hypothetical protein;locus_tag=BALIOE_11530;product=hypothetical protein;Parent=BALIOE_11530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4624 c1 Prodigal gene 2278365 2279309 . + . ID=BALIOE_11535_gene;locus_tag=BALIOE_11535 | |
| 4625 c1 Prodigal CDS 2278365 2279309 . + 0 ID=BALIOE_11535;Name=hypothetical protein;locus_tag=BALIOE_11535;product=hypothetical protein;Parent=BALIOE_11535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4626 c1 Prodigal gene 2279495 2280877 . + . ID=BALIOE_11540_gene;locus_tag=BALIOE_11540 | |
| 4627 c1 Prodigal CDS 2279495 2280877 . + 0 ID=BALIOE_11540;Name=hypothetical protein;locus_tag=BALIOE_11540;product=hypothetical protein;Parent=BALIOE_11540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4628 c1 Prodigal gene 2280914 2281636 . + . ID=BALIOE_11545_gene;locus_tag=BALIOE_11545 | |
| 4629 c1 Prodigal CDS 2280914 2281636 . + 0 ID=BALIOE_11545;Name=hypothetical protein;locus_tag=BALIOE_11545;product=hypothetical protein;Parent=BALIOE_11545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4630 c1 Prodigal gene 2281633 2281968 . - . ID=BALIOE_11550_gene;locus_tag=BALIOE_11550 | |
| 4631 c1 Prodigal CDS 2281633 2281968 . - 0 ID=BALIOE_11550;Name=hypothetical protein;locus_tag=BALIOE_11550;product=hypothetical protein;Parent=BALIOE_11550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4632 c1 Prodigal gene 2282097 2282816 . + . ID=BALIOE_11555_gene;locus_tag=BALIOE_11555 | |
| 4633 c1 Prodigal CDS 2282097 2282816 . + 0 ID=BALIOE_11555;Name=hypothetical protein;locus_tag=BALIOE_11555;product=hypothetical protein;Parent=BALIOE_11555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4634 c1 Prodigal gene 2282820 2284121 . + . ID=BALIOE_11560_gene;locus_tag=BALIOE_11560 | |
| 4635 c1 Prodigal CDS 2282820 2284121 . + 0 ID=BALIOE_11560;Name=hypothetical protein;locus_tag=BALIOE_11560;product=hypothetical protein;Parent=BALIOE_11560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4636 c1 Prodigal gene 2284197 2285126 . + . ID=BALIOE_11565_gene;locus_tag=BALIOE_11565 | |
| 4637 c1 Prodigal CDS 2284197 2285126 . + 0 ID=BALIOE_11565;Name=hypothetical protein;locus_tag=BALIOE_11565;product=hypothetical protein;Parent=BALIOE_11565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4638 c1 Prodigal gene 2285123 2286526 . - . ID=BALIOE_11570_gene;locus_tag=BALIOE_11570 | |
| 4639 c1 Prodigal CDS 2285123 2286526 . - 0 ID=BALIOE_11570;Name=hypothetical protein;locus_tag=BALIOE_11570;product=hypothetical protein;Parent=BALIOE_11570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4640 c1 Prodigal gene 2286669 2288315 . - . ID=BALIOE_11575_gene;locus_tag=BALIOE_11575 | |
| 4641 c1 Prodigal CDS 2286669 2288315 . - 0 ID=BALIOE_11575;Name=hypothetical protein;locus_tag=BALIOE_11575;product=hypothetical protein;Parent=BALIOE_11575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4642 c1 Prodigal gene 2288514 2289689 . + . ID=BALIOE_11580_gene;locus_tag=BALIOE_11580 | |
| 4643 c1 Prodigal CDS 2288514 2289689 . + 0 ID=BALIOE_11580;Name=hypothetical protein;locus_tag=BALIOE_11580;product=hypothetical protein;Parent=BALIOE_11580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4644 c1 Prodigal gene 2289790 2291298 . + . ID=BALIOE_11585_gene;locus_tag=BALIOE_11585 | |
| 4645 c1 Prodigal CDS 2289790 2291298 . + 0 ID=BALIOE_11585;Name=hypothetical protein;locus_tag=BALIOE_11585;product=hypothetical protein;Parent=BALIOE_11585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4646 c1 Prodigal gene 2291343 2291564 . - . ID=BALIOE_11590_gene;locus_tag=BALIOE_11590 | |
| 4647 c1 Prodigal CDS 2291343 2291564 . - 0 ID=BALIOE_11590;Name=hypothetical protein;locus_tag=BALIOE_11590;product=hypothetical protein;Parent=BALIOE_11590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4648 c1 Prodigal gene 2291579 2292607 . - . ID=BALIOE_11595_gene;locus_tag=BALIOE_11595 | |
| 4649 c1 Prodigal CDS 2291579 2292607 . - 0 ID=BALIOE_11595;Name=hypothetical protein;locus_tag=BALIOE_11595;product=hypothetical protein;Parent=BALIOE_11595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4650 c1 Prodigal gene 2292646 2294019 . - . ID=BALIOE_11600_gene;locus_tag=BALIOE_11600 | |
| 4651 c1 Prodigal CDS 2292646 2294019 . - 0 ID=BALIOE_11600;Name=hypothetical protein;locus_tag=BALIOE_11600;product=hypothetical protein;Parent=BALIOE_11600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4652 c1 Prodigal gene 2294016 2295122 . - . ID=BALIOE_11605_gene;locus_tag=BALIOE_11605 | |
| 4653 c1 Prodigal CDS 2294016 2295122 . - 0 ID=BALIOE_11605;Name=hypothetical protein;locus_tag=BALIOE_11605;product=hypothetical protein;Parent=BALIOE_11605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4654 c1 Prodigal gene 2295116 2295829 . - . ID=BALIOE_11610_gene;locus_tag=BALIOE_11610 | |
| 4655 c1 Prodigal CDS 2295116 2295829 . - 0 ID=BALIOE_11610;Name=hypothetical protein;locus_tag=BALIOE_11610;product=hypothetical protein;Parent=BALIOE_11610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4656 c1 Prodigal gene 2296220 2296810 . - . ID=BALIOE_11615_gene;locus_tag=BALIOE_11615 | |
| 4657 c1 Prodigal CDS 2296220 2296810 . - 0 ID=BALIOE_11615;Name=hypothetical protein;locus_tag=BALIOE_11615;product=hypothetical protein;Parent=BALIOE_11615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4658 c1 Prodigal gene 2297039 2297806 . - . ID=BALIOE_11620_gene;locus_tag=BALIOE_11620 | |
| 4659 c1 Prodigal CDS 2297039 2297806 . - 0 ID=BALIOE_11620;Name=hypothetical protein;locus_tag=BALIOE_11620;product=hypothetical protein;Parent=BALIOE_11620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4660 c1 Prodigal gene 2297918 2298946 . - . ID=BALIOE_11625_gene;locus_tag=BALIOE_11625 | |
| 4661 c1 Prodigal CDS 2297918 2298946 . - 0 ID=BALIOE_11625;Name=hypothetical protein;locus_tag=BALIOE_11625;product=hypothetical protein;Parent=BALIOE_11625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4662 c1 Prodigal gene 2299121 2300713 . + . ID=BALIOE_11630_gene;locus_tag=BALIOE_11630 | |
| 4663 c1 Prodigal CDS 2299121 2300713 . + 0 ID=BALIOE_11630;Name=hypothetical protein;locus_tag=BALIOE_11630;product=hypothetical protein;Parent=BALIOE_11630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4664 c1 Prodigal gene 2300723 2301895 . + . ID=BALIOE_11635_gene;locus_tag=BALIOE_11635 | |
| 4665 c1 Prodigal CDS 2300723 2301895 . + 0 ID=BALIOE_11635;Name=hypothetical protein;locus_tag=BALIOE_11635;product=hypothetical protein;Parent=BALIOE_11635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4666 c1 Prodigal gene 2301999 2303000 . + . ID=BALIOE_11640_gene;locus_tag=BALIOE_11640 | |
| 4667 c1 Prodigal CDS 2301999 2303000 . + 0 ID=BALIOE_11640;Name=hypothetical protein;locus_tag=BALIOE_11640;product=hypothetical protein;Parent=BALIOE_11640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4668 c1 Prodigal gene 2303036 2304076 . - . ID=BALIOE_11645_gene;locus_tag=BALIOE_11645 | |
| 4669 c1 Prodigal CDS 2303036 2304076 . - 0 ID=BALIOE_11645;Name=hypothetical protein;locus_tag=BALIOE_11645;product=hypothetical protein;Parent=BALIOE_11645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4670 c1 Prodigal gene 2304319 2304444 . + . ID=BALIOE_11650_gene;locus_tag=BALIOE_11650 | |
| 4671 c1 Prodigal CDS 2304319 2304444 . + 0 ID=BALIOE_11650;Name=hypothetical protein;locus_tag=BALIOE_11650;product=hypothetical protein;Parent=BALIOE_11650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4672 c1 Prodigal gene 2304717 2304932 . + . ID=BALIOE_11655_gene;locus_tag=BALIOE_11655 | |
| 4673 c1 Prodigal CDS 2304717 2304932 . + 0 ID=BALIOE_11655;Name=hypothetical protein;locus_tag=BALIOE_11655;product=hypothetical protein;Parent=BALIOE_11655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4674 c1 Prodigal gene 2305018 2305458 . + . ID=BALIOE_11660_gene;locus_tag=BALIOE_11660 | |
| 4675 c1 Prodigal CDS 2305018 2305458 . + 0 ID=BALIOE_11660;Name=hypothetical protein;locus_tag=BALIOE_11660;product=hypothetical protein;Parent=BALIOE_11660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4676 c1 Prodigal gene 2305535 2306116 . + . ID=BALIOE_11665_gene;locus_tag=BALIOE_11665 | |
| 4677 c1 Prodigal CDS 2305535 2306116 . + 0 ID=BALIOE_11665;Name=hypothetical protein;locus_tag=BALIOE_11665;product=hypothetical protein;Parent=BALIOE_11665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4678 c1 Prodigal gene 2306116 2306694 . + . ID=BALIOE_11670_gene;locus_tag=BALIOE_11670 | |
| 4679 c1 Prodigal CDS 2306116 2306694 . + 0 ID=BALIOE_11670;Name=hypothetical protein;locus_tag=BALIOE_11670;product=hypothetical protein;Parent=BALIOE_11670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4680 c1 Prodigal gene 2306687 2309005 . + . ID=BALIOE_11675_gene;locus_tag=BALIOE_11675 | |
| 4681 c1 Prodigal CDS 2306687 2309005 . + 0 ID=BALIOE_11675;Name=hypothetical protein;locus_tag=BALIOE_11675;product=hypothetical protein;Parent=BALIOE_11675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4682 c1 Prodigal gene 2309006 2310064 . + . ID=BALIOE_11680_gene;locus_tag=BALIOE_11680 | |
| 4683 c1 Prodigal CDS 2309006 2310064 . + 0 ID=BALIOE_11680;Name=hypothetical protein;locus_tag=BALIOE_11680;product=hypothetical protein;Parent=BALIOE_11680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4684 c1 Prodigal gene 2310068 2310688 . + . ID=BALIOE_11685_gene;locus_tag=BALIOE_11685 | |
| 4685 c1 Prodigal CDS 2310068 2310688 . + 0 ID=BALIOE_11685;Name=hypothetical protein;locus_tag=BALIOE_11685;product=hypothetical protein;Parent=BALIOE_11685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4686 c1 Prodigal gene 2310692 2311387 . + . ID=BALIOE_11690_gene;locus_tag=BALIOE_11690 | |
| 4687 c1 Prodigal CDS 2310692 2311387 . + 0 ID=BALIOE_11690;Name=hypothetical protein;locus_tag=BALIOE_11690;product=hypothetical protein;Parent=BALIOE_11690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4688 c1 Prodigal gene 2311387 2312022 . + . ID=BALIOE_11695_gene;locus_tag=BALIOE_11695 | |
| 4689 c1 Prodigal CDS 2311387 2312022 . + 0 ID=BALIOE_11695;Name=hypothetical protein;locus_tag=BALIOE_11695;product=hypothetical protein;Parent=BALIOE_11695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4690 c1 Prodigal gene 2312150 2312350 . + . ID=BALIOE_11700_gene;locus_tag=BALIOE_11700 | |
| 4691 c1 Prodigal CDS 2312150 2312350 . + 0 ID=BALIOE_11700;Name=hypothetical protein;locus_tag=BALIOE_11700;product=hypothetical protein;Parent=BALIOE_11700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4692 c1 Prodigal gene 2312633 2314135 . + . ID=BALIOE_11705_gene;locus_tag=BALIOE_11705 | |
| 4693 c1 Prodigal CDS 2312633 2314135 . + 0 ID=BALIOE_11705;Name=hypothetical protein;locus_tag=BALIOE_11705;product=hypothetical protein;Parent=BALIOE_11705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4694 c1 Prodigal gene 2314241 2314846 . + . ID=BALIOE_11710_gene;locus_tag=BALIOE_11710 | |
| 4695 c1 Prodigal CDS 2314241 2314846 . + 0 ID=BALIOE_11710;Name=hypothetical protein;locus_tag=BALIOE_11710;product=hypothetical protein;Parent=BALIOE_11710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4696 c1 Prodigal gene 2314890 2315750 . - . ID=BALIOE_11715_gene;locus_tag=BALIOE_11715 | |
| 4697 c1 Prodigal CDS 2314890 2315750 . - 0 ID=BALIOE_11715;Name=hypothetical protein;locus_tag=BALIOE_11715;product=hypothetical protein;Parent=BALIOE_11715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4698 c1 Prodigal gene 2315812 2317086 . - . ID=BALIOE_11720_gene;locus_tag=BALIOE_11720 | |
| 4699 c1 Prodigal CDS 2315812 2317086 . - 0 ID=BALIOE_11720;Name=hypothetical protein;locus_tag=BALIOE_11720;product=hypothetical protein;Parent=BALIOE_11720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4700 c1 Prodigal gene 2317215 2317871 . - . ID=BALIOE_11725_gene;locus_tag=BALIOE_11725 | |
| 4701 c1 Prodigal CDS 2317215 2317871 . - 0 ID=BALIOE_11725;Name=hypothetical protein;locus_tag=BALIOE_11725;product=hypothetical protein;Parent=BALIOE_11725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4702 c1 Prodigal gene 2317930 2318253 . - . ID=BALIOE_11730_gene;locus_tag=BALIOE_11730 | |
| 4703 c1 Prodigal CDS 2317930 2318253 . - 0 ID=BALIOE_11730;Name=hypothetical protein;locus_tag=BALIOE_11730;product=hypothetical protein;Parent=BALIOE_11730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4704 c1 Prodigal gene 2318357 2319466 . - . ID=BALIOE_11735_gene;locus_tag=BALIOE_11735 | |
| 4705 c1 Prodigal CDS 2318357 2319466 . - 0 ID=BALIOE_11735;Name=hypothetical protein;locus_tag=BALIOE_11735;product=hypothetical protein;Parent=BALIOE_11735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4706 c1 Prodigal gene 2319739 2320206 . + . ID=BALIOE_11740_gene;locus_tag=BALIOE_11740 | |
| 4707 c1 Prodigal CDS 2319739 2320206 . + 0 ID=BALIOE_11740;Name=hypothetical protein;locus_tag=BALIOE_11740;product=hypothetical protein;Parent=BALIOE_11740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4708 c1 Prodigal gene 2320253 2320687 . - . ID=BALIOE_11745_gene;locus_tag=BALIOE_11745 | |
| 4709 c1 Prodigal CDS 2320253 2320687 . - 0 ID=BALIOE_11745;Name=hypothetical protein;locus_tag=BALIOE_11745;product=hypothetical protein;Parent=BALIOE_11745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4710 c1 Prodigal gene 2320888 2321124 . + . ID=BALIOE_11750_gene;locus_tag=BALIOE_11750 | |
| 4711 c1 Prodigal CDS 2320888 2321124 . + 0 ID=BALIOE_11750;Name=hypothetical protein;locus_tag=BALIOE_11750;product=hypothetical protein;Parent=BALIOE_11750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4712 c1 Prodigal gene 2321127 2321984 . + . ID=BALIOE_11755_gene;locus_tag=BALIOE_11755 | |
| 4713 c1 Prodigal CDS 2321127 2321984 . + 0 ID=BALIOE_11755;Name=hypothetical protein;locus_tag=BALIOE_11755;product=hypothetical protein;Parent=BALIOE_11755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4714 c1 Prodigal gene 2321984 2323996 . + . ID=BALIOE_11760_gene;locus_tag=BALIOE_11760 | |
| 4715 c1 Prodigal CDS 2321984 2323996 . + 0 ID=BALIOE_11760;Name=hypothetical protein;locus_tag=BALIOE_11760;product=hypothetical protein;Parent=BALIOE_11760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4716 c1 Prodigal gene 2323997 2324518 . - . ID=BALIOE_11765_gene;locus_tag=BALIOE_11765 | |
| 4717 c1 Prodigal CDS 2323997 2324518 . - 0 ID=BALIOE_11765;Name=hypothetical protein;locus_tag=BALIOE_11765;product=hypothetical protein;Parent=BALIOE_11765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4718 c1 Prodigal gene 2324707 2325495 . - . ID=BALIOE_11770_gene;locus_tag=BALIOE_11770 | |
| 4719 c1 Prodigal CDS 2324707 2325495 . - 0 ID=BALIOE_11770;Name=hypothetical protein;locus_tag=BALIOE_11770;product=hypothetical protein;Parent=BALIOE_11770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4720 c1 Prodigal gene 2325544 2325783 . - . ID=BALIOE_11775_gene;locus_tag=BALIOE_11775 | |
| 4721 c1 Prodigal CDS 2325544 2325783 . - 0 ID=BALIOE_11775;Name=hypothetical protein;locus_tag=BALIOE_11775;product=hypothetical protein;Parent=BALIOE_11775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4722 c1 Prodigal gene 2325886 2326485 . + . ID=BALIOE_11780_gene;locus_tag=BALIOE_11780 | |
| 4723 c1 Prodigal CDS 2325886 2326485 . + 0 ID=BALIOE_11780;Name=hypothetical protein;locus_tag=BALIOE_11780;product=hypothetical protein;Parent=BALIOE_11780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4724 c1 Prodigal gene 2326522 2327619 . + . ID=BALIOE_11785_gene;locus_tag=BALIOE_11785 | |
| 4725 c1 Prodigal CDS 2326522 2327619 . + 0 ID=BALIOE_11785;Name=hypothetical protein;locus_tag=BALIOE_11785;product=hypothetical protein;Parent=BALIOE_11785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4726 c1 Prodigal gene 2327700 2328107 . + . ID=BALIOE_11790_gene;locus_tag=BALIOE_11790 | |
| 4727 c1 Prodigal CDS 2327700 2328107 . + 0 ID=BALIOE_11790;Name=hypothetical protein;locus_tag=BALIOE_11790;product=hypothetical protein;Parent=BALIOE_11790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4728 c1 Prodigal gene 2328210 2328857 . + . ID=BALIOE_11795_gene;locus_tag=BALIOE_11795 | |
| 4729 c1 Prodigal CDS 2328210 2328857 . + 0 ID=BALIOE_11795;Name=hypothetical protein;locus_tag=BALIOE_11795;product=hypothetical protein;Parent=BALIOE_11795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4730 c1 Prodigal gene 2328950 2333566 . + . ID=BALIOE_11800_gene;locus_tag=BALIOE_11800 | |
| 4731 c1 Prodigal CDS 2328950 2333566 . + 0 ID=BALIOE_11800;Name=hypothetical protein;locus_tag=BALIOE_11800;product=hypothetical protein;Parent=BALIOE_11800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4732 c1 Prodigal gene 2333617 2333964 . - . ID=BALIOE_11805_gene;locus_tag=BALIOE_11805 | |
| 4733 c1 Prodigal CDS 2333617 2333964 . - 0 ID=BALIOE_11805;Name=hypothetical protein;locus_tag=BALIOE_11805;product=hypothetical protein;Parent=BALIOE_11805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4734 c1 Prodigal gene 2334299 2335114 . + . ID=BALIOE_11810_gene;locus_tag=BALIOE_11810 | |
| 4735 c1 Prodigal CDS 2334299 2335114 . + 0 ID=BALIOE_11810;Name=hypothetical protein;locus_tag=BALIOE_11810;product=hypothetical protein;Parent=BALIOE_11810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4736 c1 Prodigal gene 2335242 2335823 . + . ID=BALIOE_11815_gene;locus_tag=BALIOE_11815 | |
| 4737 c1 Prodigal CDS 2335242 2335823 . + 0 ID=BALIOE_11815;Name=hypothetical protein;locus_tag=BALIOE_11815;product=hypothetical protein;Parent=BALIOE_11815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4738 c1 Prodigal gene 2335969 2337138 . - . ID=BALIOE_11820_gene;locus_tag=BALIOE_11820 | |
| 4739 c1 Prodigal CDS 2335969 2337138 . - 0 ID=BALIOE_11820;Name=hypothetical protein;locus_tag=BALIOE_11820;product=hypothetical protein;Parent=BALIOE_11820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4740 c1 Prodigal gene 2337304 2337393 . - . ID=BALIOE_11825_gene;locus_tag=BALIOE_11825 | |
| 4741 c1 Prodigal CDS 2337304 2337393 . - 0 ID=BALIOE_11825;Name=hypothetical protein;locus_tag=BALIOE_11825;product=hypothetical protein;Parent=BALIOE_11825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4742 c1 Prodigal gene 2337692 2338717 . + . ID=BALIOE_11830_gene;locus_tag=BALIOE_11830 | |
| 4743 c1 Prodigal CDS 2337692 2338717 . + 0 ID=BALIOE_11830;Name=hypothetical protein;locus_tag=BALIOE_11830;product=hypothetical protein;Parent=BALIOE_11830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4744 c1 Prodigal gene 2338714 2339646 . - . ID=BALIOE_11835_gene;locus_tag=BALIOE_11835 | |
| 4745 c1 Prodigal CDS 2338714 2339646 . - 0 ID=BALIOE_11835;Name=hypothetical protein;locus_tag=BALIOE_11835;product=hypothetical protein;Parent=BALIOE_11835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4746 c1 Prodigal gene 2339759 2340970 . + . ID=BALIOE_11840_gene;locus_tag=BALIOE_11840 | |
| 4747 c1 Prodigal CDS 2339759 2340970 . + 0 ID=BALIOE_11840;Name=hypothetical protein;locus_tag=BALIOE_11840;product=hypothetical protein;Parent=BALIOE_11840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4748 c1 Prodigal gene 2341261 2342409 . + . ID=BALIOE_11845_gene;locus_tag=BALIOE_11845 | |
| 4749 c1 Prodigal CDS 2341261 2342409 . + 0 ID=BALIOE_11845;Name=hypothetical protein;locus_tag=BALIOE_11845;product=hypothetical protein;Parent=BALIOE_11845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4750 c1 Prodigal gene 2342449 2343090 . - . ID=BALIOE_11850_gene;locus_tag=BALIOE_11850 | |
| 4751 c1 Prodigal CDS 2342449 2343090 . - 0 ID=BALIOE_11850;Name=hypothetical protein;locus_tag=BALIOE_11850;product=hypothetical protein;Parent=BALIOE_11850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4752 c1 Prodigal gene 2343305 2344678 . + . ID=BALIOE_11855_gene;locus_tag=BALIOE_11855 | |
| 4753 c1 Prodigal CDS 2343305 2344678 . + 0 ID=BALIOE_11855;Name=hypothetical protein;locus_tag=BALIOE_11855;product=hypothetical protein;Parent=BALIOE_11855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4754 c1 Prodigal gene 2344719 2345975 . - . ID=BALIOE_11860_gene;locus_tag=BALIOE_11860 | |
| 4755 c1 Prodigal CDS 2344719 2345975 . - 0 ID=BALIOE_11860;Name=hypothetical protein;locus_tag=BALIOE_11860;product=hypothetical protein;Parent=BALIOE_11860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4756 c1 tRNAscan-SE gene 2346283 2346359 . + . ID=BALIOE_11865_gene;locus_tag=BALIOE_11865;gene=Val_trna | |
| 4757 c1 tRNAscan-SE tRNA 2346283 2346359 . + . ID=BALIOE_11865;Name=tRNA-Val;locus_tag=BALIOE_11865;product=tRNA-Val;gene=Val_trna;Parent=BALIOE_11865_gene;inference=profile:tRNAscan:2.0;Note=SO:0000273 | |
| 4758 c1 tRNAscan-SE gene 2346364 2346440 . + . ID=BALIOE_11870_gene;locus_tag=BALIOE_11870;gene=Val_trna | |
| 4759 c1 tRNAscan-SE tRNA 2346364 2346440 . + . ID=BALIOE_11870;Name=tRNA-Val;locus_tag=BALIOE_11870;product=tRNA-Val;gene=Val_trna;Parent=BALIOE_11870_gene;inference=profile:tRNAscan:2.0;Note=SO:0000273 | |
| 4760 c1 Prodigal gene 2346548 2346853 . + . ID=BALIOE_11875_gene;locus_tag=BALIOE_11875 | |
| 4761 c1 Prodigal CDS 2346548 2346853 . + 0 ID=BALIOE_11875;Name=hypothetical protein;locus_tag=BALIOE_11875;product=hypothetical protein;Parent=BALIOE_11875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4762 c1 Prodigal gene 2346979 2348583 . + . ID=BALIOE_11880_gene;locus_tag=BALIOE_11880 | |
| 4763 c1 Prodigal CDS 2346979 2348583 . + 0 ID=BALIOE_11880;Name=hypothetical protein;locus_tag=BALIOE_11880;product=hypothetical protein;Parent=BALIOE_11880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4764 c1 Prodigal gene 2348595 2349359 . - . ID=BALIOE_11885_gene;locus_tag=BALIOE_11885 | |
| 4765 c1 Prodigal CDS 2348595 2349359 . - 0 ID=BALIOE_11885;Name=hypothetical protein;locus_tag=BALIOE_11885;product=hypothetical protein;Parent=BALIOE_11885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4766 c1 Prodigal gene 2349411 2350196 . - . ID=BALIOE_11890_gene;locus_tag=BALIOE_11890 | |
| 4767 c1 Prodigal CDS 2349411 2350196 . - 0 ID=BALIOE_11890;Name=hypothetical protein;locus_tag=BALIOE_11890;product=hypothetical protein;Parent=BALIOE_11890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4768 c1 Prodigal gene 2350193 2350861 . - . ID=BALIOE_11895_gene;locus_tag=BALIOE_11895 | |
| 4769 c1 Prodigal CDS 2350193 2350861 . - 0 ID=BALIOE_11895;Name=hypothetical protein;locus_tag=BALIOE_11895;product=hypothetical protein;Parent=BALIOE_11895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4770 c1 Prodigal gene 2350925 2351563 . - . ID=BALIOE_11900_gene;locus_tag=BALIOE_11900 | |
| 4771 c1 Prodigal CDS 2350925 2351563 . - 0 ID=BALIOE_11900;Name=hypothetical protein;locus_tag=BALIOE_11900;product=hypothetical protein;Parent=BALIOE_11900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4772 c1 Prodigal gene 2351576 2353678 . - . ID=BALIOE_11905_gene;locus_tag=BALIOE_11905 | |
| 4773 c1 Prodigal CDS 2351576 2353678 . - 0 ID=BALIOE_11905;Name=hypothetical protein;locus_tag=BALIOE_11905;product=hypothetical protein;Parent=BALIOE_11905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4774 c1 Prodigal gene 2353699 2354325 . - . ID=BALIOE_11910_gene;locus_tag=BALIOE_11910 | |
| 4775 c1 Prodigal CDS 2353699 2354325 . - 0 ID=BALIOE_11910;Name=hypothetical protein;locus_tag=BALIOE_11910;product=hypothetical protein;Parent=BALIOE_11910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4776 c1 Prodigal gene 2354781 2354990 . - . ID=BALIOE_11915_gene;locus_tag=BALIOE_11915 | |
| 4777 c1 Prodigal CDS 2354781 2354990 . - 0 ID=BALIOE_11915;Name=hypothetical protein;locus_tag=BALIOE_11915;product=hypothetical protein;Parent=BALIOE_11915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4778 c1 Prodigal gene 2355547 2356959 . + . ID=BALIOE_11920_gene;locus_tag=BALIOE_11920 | |
| 4779 c1 Prodigal CDS 2355547 2356959 . + 0 ID=BALIOE_11920;Name=hypothetical protein;locus_tag=BALIOE_11920;product=hypothetical protein;Parent=BALIOE_11920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4780 c1 Prodigal gene 2357270 2357506 . + . ID=BALIOE_11925_gene;locus_tag=BALIOE_11925 | |
| 4781 c1 Prodigal CDS 2357270 2357506 . + 0 ID=BALIOE_11925;Name=hypothetical protein;locus_tag=BALIOE_11925;product=hypothetical protein;Parent=BALIOE_11925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4782 c1 Prodigal gene 2357569 2358573 . - . ID=BALIOE_11930_gene;locus_tag=BALIOE_11930 | |
| 4783 c1 Prodigal CDS 2357569 2358573 . - 0 ID=BALIOE_11930;Name=hypothetical protein;locus_tag=BALIOE_11930;product=hypothetical protein;Parent=BALIOE_11930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4784 c1 Prodigal gene 2358722 2359138 . - . ID=BALIOE_11935_gene;locus_tag=BALIOE_11935 | |
| 4785 c1 Prodigal CDS 2358722 2359138 . - 0 ID=BALIOE_11935;Name=hypothetical protein;locus_tag=BALIOE_11935;product=hypothetical protein;Parent=BALIOE_11935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4786 c1 Prodigal gene 2359151 2360371 . - . ID=BALIOE_11940_gene;locus_tag=BALIOE_11940 | |
| 4787 c1 Prodigal CDS 2359151 2360371 . - 0 ID=BALIOE_11940;Name=hypothetical protein;locus_tag=BALIOE_11940;product=hypothetical protein;Parent=BALIOE_11940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4788 c1 Prodigal gene 2360368 2361639 . - . ID=BALIOE_11945_gene;locus_tag=BALIOE_11945 | |
| 4789 c1 Prodigal CDS 2360368 2361639 . - 0 ID=BALIOE_11945;Name=hypothetical protein;locus_tag=BALIOE_11945;product=hypothetical protein;Parent=BALIOE_11945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4790 c1 Prodigal gene 2361614 2362360 . - . ID=BALIOE_11950_gene;locus_tag=BALIOE_11950 | |
| 4791 c1 Prodigal CDS 2361614 2362360 . - 0 ID=BALIOE_11950;Name=hypothetical protein;locus_tag=BALIOE_11950;product=hypothetical protein;Parent=BALIOE_11950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4792 c1 Prodigal gene 2362370 2363857 . - . ID=BALIOE_11955_gene;locus_tag=BALIOE_11955 | |
| 4793 c1 Prodigal CDS 2362370 2363857 . - 0 ID=BALIOE_11955;Name=hypothetical protein;locus_tag=BALIOE_11955;product=hypothetical protein;Parent=BALIOE_11955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4794 c1 Prodigal gene 2363866 2364234 . - . ID=BALIOE_11960_gene;locus_tag=BALIOE_11960 | |
| 4795 c1 Prodigal CDS 2363866 2364234 . - 0 ID=BALIOE_11960;Name=hypothetical protein;locus_tag=BALIOE_11960;product=hypothetical protein;Parent=BALIOE_11960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4796 c1 Prodigal gene 2364783 2364971 . - . ID=BALIOE_11965_gene;locus_tag=BALIOE_11965 | |
| 4797 c1 Prodigal CDS 2364783 2364971 . - 0 ID=BALIOE_11965;Name=hypothetical protein;locus_tag=BALIOE_11965;product=hypothetical protein;Parent=BALIOE_11965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4798 c1 Prodigal gene 2365071 2365481 . - . ID=BALIOE_11970_gene;locus_tag=BALIOE_11970 | |
| 4799 c1 Prodigal CDS 2365071 2365481 . - 0 ID=BALIOE_11970;Name=hypothetical protein;locus_tag=BALIOE_11970;product=hypothetical protein;Parent=BALIOE_11970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4800 c1 Prodigal gene 2365478 2368534 . - . ID=BALIOE_11975_gene;locus_tag=BALIOE_11975 | |
| 4801 c1 Prodigal CDS 2365478 2368534 . - 0 ID=BALIOE_11975;Name=hypothetical protein;locus_tag=BALIOE_11975;product=hypothetical protein;Parent=BALIOE_11975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4802 c1 Prodigal gene 2368923 2370035 . + . ID=BALIOE_11980_gene;locus_tag=BALIOE_11980 | |
| 4803 c1 Prodigal CDS 2368923 2370035 . + 0 ID=BALIOE_11980;Name=hypothetical protein;locus_tag=BALIOE_11980;product=hypothetical protein;Parent=BALIOE_11980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4804 c1 Prodigal gene 2370464 2370820 . + . ID=BALIOE_11985_gene;locus_tag=BALIOE_11985 | |
| 4805 c1 Prodigal CDS 2370464 2370820 . + 0 ID=BALIOE_11985;Name=hypothetical protein;locus_tag=BALIOE_11985;product=hypothetical protein;Parent=BALIOE_11985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4806 c1 Prodigal gene 2370920 2372134 . + . ID=BALIOE_11990_gene;locus_tag=BALIOE_11990 | |
| 4807 c1 Prodigal CDS 2370920 2372134 . + 0 ID=BALIOE_11990;Name=hypothetical protein;locus_tag=BALIOE_11990;product=hypothetical protein;Parent=BALIOE_11990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4808 c1 Prodigal gene 2372361 2373626 . + . ID=BALIOE_11995_gene;locus_tag=BALIOE_11995 | |
| 4809 c1 Prodigal CDS 2372361 2373626 . + 0 ID=BALIOE_11995;Name=hypothetical protein;locus_tag=BALIOE_11995;product=hypothetical protein;Parent=BALIOE_11995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4810 c1 Prodigal gene 2373638 2374504 . + . ID=BALIOE_12000_gene;locus_tag=BALIOE_12000 | |
| 4811 c1 Prodigal CDS 2373638 2374504 . + 0 ID=BALIOE_12000;Name=hypothetical protein;locus_tag=BALIOE_12000;product=hypothetical protein;Parent=BALIOE_12000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4812 c1 Prodigal gene 2374535 2375293 . + . ID=BALIOE_12005_gene;locus_tag=BALIOE_12005 | |
| 4813 c1 Prodigal CDS 2374535 2375293 . + 0 ID=BALIOE_12005;Name=hypothetical protein;locus_tag=BALIOE_12005;product=hypothetical protein;Parent=BALIOE_12005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4814 c1 Prodigal gene 2375438 2377033 . + . ID=BALIOE_12010_gene;locus_tag=BALIOE_12010 | |
| 4815 c1 Prodigal CDS 2375438 2377033 . + 0 ID=BALIOE_12010;Name=hypothetical protein;locus_tag=BALIOE_12010;product=hypothetical protein;Parent=BALIOE_12010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4816 c1 Prodigal gene 2377047 2378198 . + . ID=BALIOE_12015_gene;locus_tag=BALIOE_12015 | |
| 4817 c1 Prodigal CDS 2377047 2378198 . + 0 ID=BALIOE_12015;Name=hypothetical protein;locus_tag=BALIOE_12015;product=hypothetical protein;Parent=BALIOE_12015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4818 c1 Prodigal gene 2378241 2379152 . - . ID=BALIOE_12020_gene;locus_tag=BALIOE_12020 | |
| 4819 c1 Prodigal CDS 2378241 2379152 . - 0 ID=BALIOE_12020;Name=hypothetical protein;locus_tag=BALIOE_12020;product=hypothetical protein;Parent=BALIOE_12020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4820 c1 Prodigal gene 2379255 2379431 . - . ID=BALIOE_12025_gene;locus_tag=BALIOE_12025 | |
| 4821 c1 Prodigal CDS 2379255 2379431 . - 0 ID=BALIOE_12025;Name=hypothetical protein;locus_tag=BALIOE_12025;product=hypothetical protein;Parent=BALIOE_12025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4822 c1 Prodigal gene 2379468 2380232 . + . ID=BALIOE_12030_gene;locus_tag=BALIOE_12030 | |
| 4823 c1 Prodigal CDS 2379468 2380232 . + 0 ID=BALIOE_12030;Name=hypothetical protein;locus_tag=BALIOE_12030;product=hypothetical protein;Parent=BALIOE_12030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4824 c1 Prodigal gene 2380252 2381190 . + . ID=BALIOE_12035_gene;locus_tag=BALIOE_12035 | |
| 4825 c1 Prodigal CDS 2380252 2381190 . + 0 ID=BALIOE_12035;Name=hypothetical protein;locus_tag=BALIOE_12035;product=hypothetical protein;Parent=BALIOE_12035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4826 c1 Prodigal gene 2381246 2382535 . + . ID=BALIOE_12040_gene;locus_tag=BALIOE_12040 | |
| 4827 c1 Prodigal CDS 2381246 2382535 . + 0 ID=BALIOE_12040;Name=hypothetical protein;locus_tag=BALIOE_12040;product=hypothetical protein;Parent=BALIOE_12040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4828 c1 Prodigal gene 2382532 2382825 . + . ID=BALIOE_12045_gene;locus_tag=BALIOE_12045 | |
| 4829 c1 Prodigal CDS 2382532 2382825 . + 0 ID=BALIOE_12045;Name=hypothetical protein;locus_tag=BALIOE_12045;product=hypothetical protein;Parent=BALIOE_12045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4830 c1 Prodigal gene 2382882 2384528 . + . ID=BALIOE_12050_gene;locus_tag=BALIOE_12050 | |
| 4831 c1 Prodigal CDS 2382882 2384528 . + 0 ID=BALIOE_12050;Name=hypothetical protein;locus_tag=BALIOE_12050;product=hypothetical protein;Parent=BALIOE_12050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4832 c1 Prodigal gene 2384585 2386963 . - . ID=BALIOE_12055_gene;locus_tag=BALIOE_12055 | |
| 4833 c1 Prodigal CDS 2384585 2386963 . - 0 ID=BALIOE_12055;Name=hypothetical protein;locus_tag=BALIOE_12055;product=hypothetical protein;Parent=BALIOE_12055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4834 c1 Prodigal gene 2387296 2388129 . + . ID=BALIOE_12060_gene;locus_tag=BALIOE_12060 | |
| 4835 c1 Prodigal CDS 2387296 2388129 . + 0 ID=BALIOE_12060;Name=hypothetical protein;locus_tag=BALIOE_12060;product=hypothetical protein;Parent=BALIOE_12060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4836 c1 Prodigal gene 2388286 2389332 . + . ID=BALIOE_12065_gene;locus_tag=BALIOE_12065 | |
| 4837 c1 Prodigal CDS 2388286 2389332 . + 0 ID=BALIOE_12065;Name=hypothetical protein;locus_tag=BALIOE_12065;product=hypothetical protein;Parent=BALIOE_12065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4838 c1 Prodigal gene 2389464 2389655 . + . ID=BALIOE_12070_gene;locus_tag=BALIOE_12070 | |
| 4839 c1 Prodigal CDS 2389464 2389655 . + 0 ID=BALIOE_12070;Name=hypothetical protein;locus_tag=BALIOE_12070;product=hypothetical protein;Parent=BALIOE_12070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4840 c1 Prodigal gene 2389659 2391095 . - . ID=BALIOE_12075_gene;locus_tag=BALIOE_12075 | |
| 4841 c1 Prodigal CDS 2389659 2391095 . - 0 ID=BALIOE_12075;Name=hypothetical protein;locus_tag=BALIOE_12075;product=hypothetical protein;Parent=BALIOE_12075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4842 c1 Prodigal gene 2391158 2391871 . - . ID=BALIOE_12080_gene;locus_tag=BALIOE_12080 | |
| 4843 c1 Prodigal CDS 2391158 2391871 . - 0 ID=BALIOE_12080;Name=hypothetical protein;locus_tag=BALIOE_12080;product=hypothetical protein;Parent=BALIOE_12080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4844 c1 Prodigal gene 2392118 2392582 . - . ID=BALIOE_12085_gene;locus_tag=BALIOE_12085 | |
| 4845 c1 Prodigal CDS 2392118 2392582 . - 0 ID=BALIOE_12085;Name=hypothetical protein;locus_tag=BALIOE_12085;product=hypothetical protein;Parent=BALIOE_12085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4846 c1 Prodigal gene 2392660 2393409 . - . ID=BALIOE_12090_gene;locus_tag=BALIOE_12090 | |
| 4847 c1 Prodigal CDS 2392660 2393409 . - 0 ID=BALIOE_12090;Name=hypothetical protein;locus_tag=BALIOE_12090;product=hypothetical protein;Parent=BALIOE_12090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4848 c1 Prodigal gene 2393409 2393960 . - . ID=BALIOE_12095_gene;locus_tag=BALIOE_12095 | |
| 4849 c1 Prodigal CDS 2393409 2393960 . - 0 ID=BALIOE_12095;Name=hypothetical protein;locus_tag=BALIOE_12095;product=hypothetical protein;Parent=BALIOE_12095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4850 c1 Prodigal gene 2394023 2395003 . - . ID=BALIOE_12100_gene;locus_tag=BALIOE_12100 | |
| 4851 c1 Prodigal CDS 2394023 2395003 . - 0 ID=BALIOE_12100;Name=hypothetical protein;locus_tag=BALIOE_12100;product=hypothetical protein;Parent=BALIOE_12100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4852 c1 Prodigal gene 2395104 2395403 . - . ID=BALIOE_12105_gene;locus_tag=BALIOE_12105 | |
| 4853 c1 Prodigal CDS 2395104 2395403 . - 0 ID=BALIOE_12105;Name=hypothetical protein;locus_tag=BALIOE_12105;product=hypothetical protein;Parent=BALIOE_12105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4854 c1 Prodigal gene 2395408 2397795 . - . ID=BALIOE_12110_gene;locus_tag=BALIOE_12110 | |
| 4855 c1 Prodigal CDS 2395408 2397795 . - 0 ID=BALIOE_12110;Name=hypothetical protein;locus_tag=BALIOE_12110;product=hypothetical protein;Parent=BALIOE_12110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4856 c1 Prodigal gene 2397810 2398793 . - . ID=BALIOE_12115_gene;locus_tag=BALIOE_12115 | |
| 4857 c1 Prodigal CDS 2397810 2398793 . - 0 ID=BALIOE_12115;Name=hypothetical protein;locus_tag=BALIOE_12115;product=hypothetical protein;Parent=BALIOE_12115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4858 c1 Prodigal gene 2399243 2399599 . - . ID=BALIOE_12120_gene;locus_tag=BALIOE_12120 | |
| 4859 c1 Prodigal CDS 2399243 2399599 . - 0 ID=BALIOE_12120;Name=hypothetical protein;locus_tag=BALIOE_12120;product=hypothetical protein;Parent=BALIOE_12120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4860 c1 Prodigal gene 2399652 2399849 . - . ID=BALIOE_12125_gene;locus_tag=BALIOE_12125 | |
| 4861 c1 Prodigal CDS 2399652 2399849 . - 0 ID=BALIOE_12125;Name=hypothetical protein;locus_tag=BALIOE_12125;product=hypothetical protein;Parent=BALIOE_12125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4862 c1 Prodigal gene 2399946 2400380 . - . ID=BALIOE_12130_gene;locus_tag=BALIOE_12130 | |
| 4863 c1 Prodigal CDS 2399946 2400380 . - 0 ID=BALIOE_12130;Name=hypothetical protein;locus_tag=BALIOE_12130;product=hypothetical protein;Parent=BALIOE_12130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4864 c1 Prodigal gene 2400492 2402420 . - . ID=BALIOE_12135_gene;locus_tag=BALIOE_12135 | |
| 4865 c1 Prodigal CDS 2400492 2402420 . - 0 ID=BALIOE_12135;Name=hypothetical protein;locus_tag=BALIOE_12135;product=hypothetical protein;Parent=BALIOE_12135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4866 c1 Prodigal gene 2402943 2404841 . + . ID=BALIOE_12140_gene;locus_tag=BALIOE_12140 | |
| 4867 c1 Prodigal CDS 2402943 2404841 . + 0 ID=BALIOE_12140;Name=hypothetical protein;locus_tag=BALIOE_12140;product=hypothetical protein;Parent=BALIOE_12140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4868 c1 Prodigal gene 2405016 2405123 . + . ID=BALIOE_12145_gene;locus_tag=BALIOE_12145 | |
| 4869 c1 Prodigal CDS 2405016 2405123 . + 0 ID=BALIOE_12145;Name=hypothetical protein;locus_tag=BALIOE_12145;product=hypothetical protein;Parent=BALIOE_12145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4870 c1 Prodigal gene 2405176 2405934 . - . ID=BALIOE_12150_gene;locus_tag=BALIOE_12150 | |
| 4871 c1 Prodigal CDS 2405176 2405934 . - 0 ID=BALIOE_12150;Name=hypothetical protein;locus_tag=BALIOE_12150;product=hypothetical protein;Parent=BALIOE_12150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4872 c1 Prodigal gene 2406221 2407150 . + . ID=BALIOE_12155_gene;locus_tag=BALIOE_12155 | |
| 4873 c1 Prodigal CDS 2406221 2407150 . + 0 ID=BALIOE_12155;Name=hypothetical protein;locus_tag=BALIOE_12155;product=hypothetical protein;Parent=BALIOE_12155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4874 c1 Prodigal gene 2407251 2407541 . + . ID=BALIOE_12160_gene;locus_tag=BALIOE_12160 | |
| 4875 c1 Prodigal CDS 2407251 2407541 . + 0 ID=BALIOE_12160;Name=hypothetical protein;locus_tag=BALIOE_12160;product=hypothetical protein;Parent=BALIOE_12160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4876 c1 Prodigal gene 2407647 2408507 . + . ID=BALIOE_12165_gene;locus_tag=BALIOE_12165 | |
| 4877 c1 Prodigal CDS 2407647 2408507 . + 0 ID=BALIOE_12165;Name=hypothetical protein;locus_tag=BALIOE_12165;product=hypothetical protein;Parent=BALIOE_12165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4878 c1 Prodigal gene 2408548 2409084 . - . ID=BALIOE_12170_gene;locus_tag=BALIOE_12170 | |
| 4879 c1 Prodigal CDS 2408548 2409084 . - 0 ID=BALIOE_12170;Name=hypothetical protein;locus_tag=BALIOE_12170;product=hypothetical protein;Parent=BALIOE_12170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4880 c1 Prodigal gene 2409231 2409899 . + . ID=BALIOE_12175_gene;locus_tag=BALIOE_12175 | |
| 4881 c1 Prodigal CDS 2409231 2409899 . + 0 ID=BALIOE_12175;Name=hypothetical protein;locus_tag=BALIOE_12175;product=hypothetical protein;Parent=BALIOE_12175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4882 c1 Prodigal gene 2410062 2410652 . + . ID=BALIOE_12180_gene;locus_tag=BALIOE_12180 | |
| 4883 c1 Prodigal CDS 2410062 2410652 . + 0 ID=BALIOE_12180;Name=hypothetical protein;locus_tag=BALIOE_12180;product=hypothetical protein;Parent=BALIOE_12180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4884 c1 Prodigal gene 2410785 2412176 . + . ID=BALIOE_12185_gene;locus_tag=BALIOE_12185 | |
| 4885 c1 Prodigal CDS 2410785 2412176 . + 0 ID=BALIOE_12185;Name=hypothetical protein;locus_tag=BALIOE_12185;product=hypothetical protein;Parent=BALIOE_12185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4886 c1 Prodigal gene 2412227 2412982 . - . ID=BALIOE_12190_gene;locus_tag=BALIOE_12190 | |
| 4887 c1 Prodigal CDS 2412227 2412982 . - 0 ID=BALIOE_12190;Name=hypothetical protein;locus_tag=BALIOE_12190;product=hypothetical protein;Parent=BALIOE_12190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4888 c1 Prodigal gene 2413271 2413534 . - . ID=BALIOE_12195_gene;locus_tag=BALIOE_12195 | |
| 4889 c1 Prodigal CDS 2413271 2413534 . - 0 ID=BALIOE_12195;Name=hypothetical protein;locus_tag=BALIOE_12195;product=hypothetical protein;Parent=BALIOE_12195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4890 c1 Prodigal gene 2413717 2415978 . + . ID=BALIOE_12200_gene;locus_tag=BALIOE_12200 | |
| 4891 c1 Prodigal CDS 2413717 2415978 . + 0 ID=BALIOE_12200;Name=hypothetical protein;locus_tag=BALIOE_12200;product=hypothetical protein;Parent=BALIOE_12200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4892 c1 Prodigal gene 2416025 2416783 . - . ID=BALIOE_12205_gene;locus_tag=BALIOE_12205 | |
| 4893 c1 Prodigal CDS 2416025 2416783 . - 0 ID=BALIOE_12205;Name=hypothetical protein;locus_tag=BALIOE_12205;product=hypothetical protein;Parent=BALIOE_12205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4894 c1 Prodigal gene 2416796 2418148 . - . ID=BALIOE_12210_gene;locus_tag=BALIOE_12210 | |
| 4895 c1 Prodigal CDS 2416796 2418148 . - 0 ID=BALIOE_12210;Name=hypothetical protein;locus_tag=BALIOE_12210;product=hypothetical protein;Parent=BALIOE_12210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4896 c1 Prodigal gene 2418254 2419093 . - . ID=BALIOE_12215_gene;locus_tag=BALIOE_12215 | |
| 4897 c1 Prodigal CDS 2418254 2419093 . - 0 ID=BALIOE_12215;Name=hypothetical protein;locus_tag=BALIOE_12215;product=hypothetical protein;Parent=BALIOE_12215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4898 c1 Prodigal gene 2419104 2419454 . - . ID=BALIOE_12220_gene;locus_tag=BALIOE_12220 | |
| 4899 c1 Prodigal CDS 2419104 2419454 . - 0 ID=BALIOE_12220;Name=hypothetical protein;locus_tag=BALIOE_12220;product=hypothetical protein;Parent=BALIOE_12220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4900 c1 Prodigal gene 2419505 2420863 . - . ID=BALIOE_12225_gene;locus_tag=BALIOE_12225 | |
| 4901 c1 Prodigal CDS 2419505 2420863 . - 0 ID=BALIOE_12225;Name=hypothetical protein;locus_tag=BALIOE_12225;product=hypothetical protein;Parent=BALIOE_12225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4902 c1 Prodigal gene 2420948 2421268 . - . ID=BALIOE_12230_gene;locus_tag=BALIOE_12230 | |
| 4903 c1 Prodigal CDS 2420948 2421268 . - 0 ID=BALIOE_12230;Name=hypothetical protein;locus_tag=BALIOE_12230;product=hypothetical protein;Parent=BALIOE_12230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4904 c1 Prodigal gene 2421568 2421906 . - . ID=BALIOE_12235_gene;locus_tag=BALIOE_12235 | |
| 4905 c1 Prodigal CDS 2421568 2421906 . - 0 ID=BALIOE_12235;Name=hypothetical protein;locus_tag=BALIOE_12235;product=hypothetical protein;Parent=BALIOE_12235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4906 c1 Prodigal gene 2422108 2422935 . + . ID=BALIOE_12240_gene;locus_tag=BALIOE_12240 | |
| 4907 c1 Prodigal CDS 2422108 2422935 . + 0 ID=BALIOE_12240;Name=hypothetical protein;locus_tag=BALIOE_12240;product=hypothetical protein;Parent=BALIOE_12240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4908 c1 Prodigal gene 2423165 2424052 . + . ID=BALIOE_12245_gene;locus_tag=BALIOE_12245 | |
| 4909 c1 Prodigal CDS 2423165 2424052 . + 0 ID=BALIOE_12245;Name=hypothetical protein;locus_tag=BALIOE_12245;product=hypothetical protein;Parent=BALIOE_12245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4910 c1 Prodigal gene 2424012 2424587 . - . ID=BALIOE_12250_gene;locus_tag=BALIOE_12250 | |
| 4911 c1 Prodigal CDS 2424012 2424587 . - 0 ID=BALIOE_12250;Name=hypothetical protein;locus_tag=BALIOE_12250;product=hypothetical protein;Parent=BALIOE_12250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4912 c1 Prodigal gene 2424790 2425275 . - . ID=BALIOE_12255_gene;locus_tag=BALIOE_12255 | |
| 4913 c1 Prodigal CDS 2424790 2425275 . - 0 ID=BALIOE_12255;Name=hypothetical protein;locus_tag=BALIOE_12255;product=hypothetical protein;Parent=BALIOE_12255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4914 c1 Prodigal gene 2425604 2426572 . - . ID=BALIOE_12260_gene;locus_tag=BALIOE_12260 | |
| 4915 c1 Prodigal CDS 2425604 2426572 . - 0 ID=BALIOE_12260;Name=hypothetical protein;locus_tag=BALIOE_12260;product=hypothetical protein;Parent=BALIOE_12260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4916 c1 Prodigal gene 2426565 2427908 . - . ID=BALIOE_12265_gene;locus_tag=BALIOE_12265 | |
| 4917 c1 Prodigal CDS 2426565 2427908 . - 0 ID=BALIOE_12265;Name=hypothetical protein;locus_tag=BALIOE_12265;product=hypothetical protein;Parent=BALIOE_12265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4918 c1 Prodigal gene 2427905 2429383 . - . ID=BALIOE_12270_gene;locus_tag=BALIOE_12270 | |
| 4919 c1 Prodigal CDS 2427905 2429383 . - 0 ID=BALIOE_12270;Name=hypothetical protein;locus_tag=BALIOE_12270;product=hypothetical protein;Parent=BALIOE_12270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4920 c1 Prodigal gene 2429380 2430414 . - . ID=BALIOE_12275_gene;locus_tag=BALIOE_12275 | |
| 4921 c1 Prodigal CDS 2429380 2430414 . - 0 ID=BALIOE_12275;Name=hypothetical protein;locus_tag=BALIOE_12275;product=hypothetical protein;Parent=BALIOE_12275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4922 c1 Prodigal gene 2430411 2431631 . - . ID=BALIOE_12280_gene;locus_tag=BALIOE_12280 | |
| 4923 c1 Prodigal CDS 2430411 2431631 . - 0 ID=BALIOE_12280;Name=hypothetical protein;locus_tag=BALIOE_12280;product=hypothetical protein;Parent=BALIOE_12280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4924 c1 Prodigal gene 2432077 2432883 . + . ID=BALIOE_12285_gene;locus_tag=BALIOE_12285 | |
| 4925 c1 Prodigal CDS 2432077 2432883 . + 0 ID=BALIOE_12285;Name=hypothetical protein;locus_tag=BALIOE_12285;product=hypothetical protein;Parent=BALIOE_12285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4926 c1 Prodigal gene 2433050 2433760 . + . ID=BALIOE_12290_gene;locus_tag=BALIOE_12290 | |
| 4927 c1 Prodigal CDS 2433050 2433760 . + 0 ID=BALIOE_12290;Name=hypothetical protein;locus_tag=BALIOE_12290;product=hypothetical protein;Parent=BALIOE_12290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4928 c1 Prodigal gene 2433765 2434442 . + . ID=BALIOE_12295_gene;locus_tag=BALIOE_12295 | |
| 4929 c1 Prodigal CDS 2433765 2434442 . + 0 ID=BALIOE_12295;Name=hypothetical protein;locus_tag=BALIOE_12295;product=hypothetical protein;Parent=BALIOE_12295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4930 c1 Prodigal gene 2434457 2435164 . + . ID=BALIOE_12300_gene;locus_tag=BALIOE_12300 | |
| 4931 c1 Prodigal CDS 2434457 2435164 . + 0 ID=BALIOE_12300;Name=hypothetical protein;locus_tag=BALIOE_12300;product=hypothetical protein;Parent=BALIOE_12300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4932 c1 Prodigal gene 2435164 2435712 . + . ID=BALIOE_12305_gene;locus_tag=BALIOE_12305 | |
| 4933 c1 Prodigal CDS 2435164 2435712 . + 0 ID=BALIOE_12305;Name=hypothetical protein;locus_tag=BALIOE_12305;product=hypothetical protein;Parent=BALIOE_12305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4934 c1 Prodigal gene 2435722 2436888 . + . ID=BALIOE_12310_gene;locus_tag=BALIOE_12310 | |
| 4935 c1 Prodigal CDS 2435722 2436888 . + 0 ID=BALIOE_12310;Name=hypothetical protein;locus_tag=BALIOE_12310;product=hypothetical protein;Parent=BALIOE_12310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4936 c1 Prodigal gene 2436861 2438396 . + . ID=BALIOE_12315_gene;locus_tag=BALIOE_12315 | |
| 4937 c1 Prodigal CDS 2436861 2438396 . + 0 ID=BALIOE_12315;Name=hypothetical protein;locus_tag=BALIOE_12315;product=hypothetical protein;Parent=BALIOE_12315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4938 c1 Prodigal gene 2438396 2439049 . + . ID=BALIOE_12320_gene;locus_tag=BALIOE_12320 | |
| 4939 c1 Prodigal CDS 2438396 2439049 . + 0 ID=BALIOE_12320;Name=hypothetical protein;locus_tag=BALIOE_12320;product=hypothetical protein;Parent=BALIOE_12320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4940 c1 Prodigal gene 2439116 2440423 . + . ID=BALIOE_12325_gene;locus_tag=BALIOE_12325 | |
| 4941 c1 Prodigal CDS 2439116 2440423 . + 0 ID=BALIOE_12325;Name=hypothetical protein;locus_tag=BALIOE_12325;product=hypothetical protein;Parent=BALIOE_12325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4942 c1 Prodigal gene 2440432 2441052 . - . ID=BALIOE_12330_gene;locus_tag=BALIOE_12330 | |
| 4943 c1 Prodigal CDS 2440432 2441052 . - 0 ID=BALIOE_12330;Name=hypothetical protein;locus_tag=BALIOE_12330;product=hypothetical protein;Parent=BALIOE_12330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4944 c1 Prodigal gene 2441139 2441546 . + . ID=BALIOE_12335_gene;locus_tag=BALIOE_12335 | |
| 4945 c1 Prodigal CDS 2441139 2441546 . + 0 ID=BALIOE_12335;Name=hypothetical protein;locus_tag=BALIOE_12335;product=hypothetical protein;Parent=BALIOE_12335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4946 c1 Prodigal gene 2441512 2441784 . - . ID=BALIOE_12340_gene;locus_tag=BALIOE_12340 | |
| 4947 c1 Prodigal CDS 2441512 2441784 . - 0 ID=BALIOE_12340;Name=hypothetical protein;locus_tag=BALIOE_12340;product=hypothetical protein;Parent=BALIOE_12340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4948 c1 Prodigal gene 2442020 2443363 . + . ID=BALIOE_12345_gene;locus_tag=BALIOE_12345 | |
| 4949 c1 Prodigal CDS 2442020 2443363 . + 0 ID=BALIOE_12345;Name=hypothetical protein;locus_tag=BALIOE_12345;product=hypothetical protein;Parent=BALIOE_12345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4950 c1 Prodigal gene 2443480 2444520 . - . ID=BALIOE_12350_gene;locus_tag=BALIOE_12350 | |
| 4951 c1 Prodigal CDS 2443480 2444520 . - 0 ID=BALIOE_12350;Name=hypothetical protein;locus_tag=BALIOE_12350;product=hypothetical protein;Parent=BALIOE_12350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4952 c1 Prodigal gene 2444648 2446609 . - . ID=BALIOE_12355_gene;locus_tag=BALIOE_12355 | |
| 4953 c1 Prodigal CDS 2444648 2446609 . - 0 ID=BALIOE_12355;Name=hypothetical protein;locus_tag=BALIOE_12355;product=hypothetical protein;Parent=BALIOE_12355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4954 c1 Prodigal gene 2446614 2447657 . - . ID=BALIOE_12360_gene;locus_tag=BALIOE_12360 | |
| 4955 c1 Prodigal CDS 2446614 2447657 . - 0 ID=BALIOE_12360;Name=hypothetical protein;locus_tag=BALIOE_12360;product=hypothetical protein;Parent=BALIOE_12360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4956 c1 Prodigal gene 2447774 2448325 . - . ID=BALIOE_12365_gene;locus_tag=BALIOE_12365 | |
| 4957 c1 Prodigal CDS 2447774 2448325 . - 0 ID=BALIOE_12365;Name=hypothetical protein;locus_tag=BALIOE_12365;product=hypothetical protein;Parent=BALIOE_12365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4958 c1 Prodigal gene 2448486 2450342 . + . ID=BALIOE_12370_gene;locus_tag=BALIOE_12370 | |
| 4959 c1 Prodigal CDS 2448486 2450342 . + 0 ID=BALIOE_12370;Name=hypothetical protein;locus_tag=BALIOE_12370;product=hypothetical protein;Parent=BALIOE_12370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4960 c1 Prodigal gene 2450458 2451168 . + . ID=BALIOE_12375_gene;locus_tag=BALIOE_12375 | |
| 4961 c1 Prodigal CDS 2450458 2451168 . + 0 ID=BALIOE_12375;Name=hypothetical protein;locus_tag=BALIOE_12375;product=hypothetical protein;Parent=BALIOE_12375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4962 c1 Prodigal gene 2451300 2452316 . + . ID=BALIOE_12380_gene;locus_tag=BALIOE_12380 | |
| 4963 c1 Prodigal CDS 2451300 2452316 . + 0 ID=BALIOE_12380;Name=hypothetical protein;locus_tag=BALIOE_12380;product=hypothetical protein;Parent=BALIOE_12380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4964 c1 Prodigal gene 2452327 2452968 . + . ID=BALIOE_12385_gene;locus_tag=BALIOE_12385 | |
| 4965 c1 Prodigal CDS 2452327 2452968 . + 0 ID=BALIOE_12385;Name=hypothetical protein;locus_tag=BALIOE_12385;product=hypothetical protein;Parent=BALIOE_12385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4966 c1 Prodigal gene 2453061 2454221 . - . ID=BALIOE_12390_gene;locus_tag=BALIOE_12390 | |
| 4967 c1 Prodigal CDS 2453061 2454221 . - 0 ID=BALIOE_12390;Name=hypothetical protein;locus_tag=BALIOE_12390;product=hypothetical protein;Parent=BALIOE_12390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4968 c1 Prodigal gene 2454374 2454700 . + . ID=BALIOE_12395_gene;locus_tag=BALIOE_12395 | |
| 4969 c1 Prodigal CDS 2454374 2454700 . + 0 ID=BALIOE_12395;Name=hypothetical protein;locus_tag=BALIOE_12395;product=hypothetical protein;Parent=BALIOE_12395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4970 c1 Prodigal gene 2454700 2455587 . + . ID=BALIOE_12400_gene;locus_tag=BALIOE_12400 | |
| 4971 c1 Prodigal CDS 2454700 2455587 . + 0 ID=BALIOE_12400;Name=hypothetical protein;locus_tag=BALIOE_12400;product=hypothetical protein;Parent=BALIOE_12400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4972 c1 Prodigal gene 2455562 2455732 . - . ID=BALIOE_12405_gene;locus_tag=BALIOE_12405 | |
| 4973 c1 Prodigal CDS 2455562 2455732 . - 0 ID=BALIOE_12405;Name=hypothetical protein;locus_tag=BALIOE_12405;product=hypothetical protein;Parent=BALIOE_12405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4974 c1 Prodigal gene 2455850 2456608 . - . ID=BALIOE_12410_gene;locus_tag=BALIOE_12410 | |
| 4975 c1 Prodigal CDS 2455850 2456608 . - 0 ID=BALIOE_12410;Name=hypothetical protein;locus_tag=BALIOE_12410;product=hypothetical protein;Parent=BALIOE_12410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4976 c1 Prodigal gene 2456745 2457725 . - . ID=BALIOE_12415_gene;locus_tag=BALIOE_12415 | |
| 4977 c1 Prodigal CDS 2456745 2457725 . - 0 ID=BALIOE_12415;Name=hypothetical protein;locus_tag=BALIOE_12415;product=hypothetical protein;Parent=BALIOE_12415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4978 c1 Prodigal gene 2457735 2458667 . - . ID=BALIOE_12420_gene;locus_tag=BALIOE_12420 | |
| 4979 c1 Prodigal CDS 2457735 2458667 . - 0 ID=BALIOE_12420;Name=hypothetical protein;locus_tag=BALIOE_12420;product=hypothetical protein;Parent=BALIOE_12420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4980 c1 Prodigal gene 2458672 2459508 . - . ID=BALIOE_12425_gene;locus_tag=BALIOE_12425 | |
| 4981 c1 Prodigal CDS 2458672 2459508 . - 0 ID=BALIOE_12425;Name=hypothetical protein;locus_tag=BALIOE_12425;product=hypothetical protein;Parent=BALIOE_12425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4982 c1 Prodigal gene 2459529 2460572 . - . ID=BALIOE_12430_gene;locus_tag=BALIOE_12430 | |
| 4983 c1 Prodigal CDS 2459529 2460572 . - 0 ID=BALIOE_12430;Name=hypothetical protein;locus_tag=BALIOE_12430;product=hypothetical protein;Parent=BALIOE_12430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4984 c1 Prodigal gene 2460589 2461968 . - . ID=BALIOE_12435_gene;locus_tag=BALIOE_12435 | |
| 4985 c1 Prodigal CDS 2460589 2461968 . - 0 ID=BALIOE_12435;Name=hypothetical protein;locus_tag=BALIOE_12435;product=hypothetical protein;Parent=BALIOE_12435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4986 c1 Prodigal gene 2461995 2463071 . - . ID=BALIOE_12440_gene;locus_tag=BALIOE_12440 | |
| 4987 c1 Prodigal CDS 2461995 2463071 . - 0 ID=BALIOE_12440;Name=hypothetical protein;locus_tag=BALIOE_12440;product=hypothetical protein;Parent=BALIOE_12440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4988 c1 Prodigal gene 2463441 2463713 . - . ID=BALIOE_12445_gene;locus_tag=BALIOE_12445 | |
| 4989 c1 Prodigal CDS 2463441 2463713 . - 0 ID=BALIOE_12445;Name=hypothetical protein;locus_tag=BALIOE_12445;product=hypothetical protein;Parent=BALIOE_12445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4990 c1 Prodigal gene 2463755 2464168 . - . ID=BALIOE_12450_gene;locus_tag=BALIOE_12450 | |
| 4991 c1 Prodigal CDS 2463755 2464168 . - 0 ID=BALIOE_12450;Name=hypothetical protein;locus_tag=BALIOE_12450;product=hypothetical protein;Parent=BALIOE_12450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4992 c1 Prodigal gene 2464510 2465505 . + . ID=BALIOE_12455_gene;locus_tag=BALIOE_12455 | |
| 4993 c1 Prodigal CDS 2464510 2465505 . + 0 ID=BALIOE_12455;Name=hypothetical protein;locus_tag=BALIOE_12455;product=hypothetical protein;Parent=BALIOE_12455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4994 c1 Prodigal gene 2465589 2466473 . + . ID=BALIOE_12460_gene;locus_tag=BALIOE_12460 | |
| 4995 c1 Prodigal CDS 2465589 2466473 . + 0 ID=BALIOE_12460;Name=hypothetical protein;locus_tag=BALIOE_12460;product=hypothetical protein;Parent=BALIOE_12460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4996 c1 Prodigal gene 2466524 2467378 . - . ID=BALIOE_12465_gene;locus_tag=BALIOE_12465 | |
| 4997 c1 Prodigal CDS 2466524 2467378 . - 0 ID=BALIOE_12465;Name=hypothetical protein;locus_tag=BALIOE_12465;product=hypothetical protein;Parent=BALIOE_12465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 4998 c1 Prodigal gene 2467468 2468214 . - . ID=BALIOE_12470_gene;locus_tag=BALIOE_12470 | |
| 4999 c1 Prodigal CDS 2467468 2468214 . - 0 ID=BALIOE_12470;Name=hypothetical protein;locus_tag=BALIOE_12470;product=hypothetical protein;Parent=BALIOE_12470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5000 c1 Prodigal gene 2468650 2470584 . + . ID=BALIOE_12475_gene;locus_tag=BALIOE_12475 | |
| 5001 c1 Prodigal CDS 2468650 2470584 . + 0 ID=BALIOE_12475;Name=hypothetical protein;locus_tag=BALIOE_12475;product=hypothetical protein;Parent=BALIOE_12475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5002 c1 Prodigal gene 2470697 2471980 . + . ID=BALIOE_12480_gene;locus_tag=BALIOE_12480 | |
| 5003 c1 Prodigal CDS 2470697 2471980 . + 0 ID=BALIOE_12480;Name=hypothetical protein;locus_tag=BALIOE_12480;product=hypothetical protein;Parent=BALIOE_12480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5004 c1 Prodigal gene 2472259 2473602 . + . ID=BALIOE_12485_gene;locus_tag=BALIOE_12485 | |
| 5005 c1 Prodigal CDS 2472259 2473602 . + 0 ID=BALIOE_12485;Name=hypothetical protein;locus_tag=BALIOE_12485;product=hypothetical protein;Parent=BALIOE_12485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5006 c1 Prodigal gene 2473783 2475273 . + . ID=BALIOE_12490_gene;locus_tag=BALIOE_12490 | |
| 5007 c1 Prodigal CDS 2473783 2475273 . + 0 ID=BALIOE_12490;Name=hypothetical protein;locus_tag=BALIOE_12490;product=hypothetical protein;Parent=BALIOE_12490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5008 c1 Prodigal gene 2475316 2475819 . + . ID=BALIOE_12495_gene;locus_tag=BALIOE_12495 | |
| 5009 c1 Prodigal CDS 2475316 2475819 . + 0 ID=BALIOE_12495;Name=hypothetical protein;locus_tag=BALIOE_12495;product=hypothetical protein;Parent=BALIOE_12495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5010 c1 Prodigal gene 2476094 2476540 . + . ID=BALIOE_12500_gene;locus_tag=BALIOE_12500 | |
| 5011 c1 Prodigal CDS 2476094 2476540 . + 0 ID=BALIOE_12500;Name=hypothetical protein;locus_tag=BALIOE_12500;product=hypothetical protein;Parent=BALIOE_12500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5012 c1 Prodigal gene 2476497 2477315 . - . ID=BALIOE_12505_gene;locus_tag=BALIOE_12505 | |
| 5013 c1 Prodigal CDS 2476497 2477315 . - 0 ID=BALIOE_12505;Name=hypothetical protein;locus_tag=BALIOE_12505;product=hypothetical protein;Parent=BALIOE_12505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5014 c1 Prodigal gene 2477415 2478596 . + . ID=BALIOE_12510_gene;locus_tag=BALIOE_12510 | |
| 5015 c1 Prodigal CDS 2477415 2478596 . + 0 ID=BALIOE_12510;Name=hypothetical protein;locus_tag=BALIOE_12510;product=hypothetical protein;Parent=BALIOE_12510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5016 c1 Prodigal gene 2478651 2478998 . + . ID=BALIOE_12515_gene;locus_tag=BALIOE_12515 | |
| 5017 c1 Prodigal CDS 2478651 2478998 . + 0 ID=BALIOE_12515;Name=hypothetical protein;locus_tag=BALIOE_12515;product=hypothetical protein;Parent=BALIOE_12515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5018 c1 Prodigal gene 2479020 2479274 . - . ID=BALIOE_12520_gene;locus_tag=BALIOE_12520 | |
| 5019 c1 Prodigal CDS 2479020 2479274 . - 0 ID=BALIOE_12520;Name=hypothetical protein;locus_tag=BALIOE_12520;product=hypothetical protein;Parent=BALIOE_12520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5020 c1 Prodigal gene 2479457 2480305 . + . ID=BALIOE_12525_gene;locus_tag=BALIOE_12525 | |
| 5021 c1 Prodigal CDS 2479457 2480305 . + 0 ID=BALIOE_12525;Name=hypothetical protein;locus_tag=BALIOE_12525;product=hypothetical protein;Parent=BALIOE_12525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5022 c1 Prodigal gene 2480749 2480997 . - . ID=BALIOE_12530_gene;locus_tag=BALIOE_12530 | |
| 5023 c1 Prodigal CDS 2480749 2480997 . - 0 ID=BALIOE_12530;Name=hypothetical protein;locus_tag=BALIOE_12530;product=hypothetical protein;Parent=BALIOE_12530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5024 c1 Prodigal gene 2481144 2481326 . - . ID=BALIOE_12535_gene;locus_tag=BALIOE_12535 | |
| 5025 c1 Prodigal CDS 2481144 2481326 . - 0 ID=BALIOE_12535;Name=hypothetical protein;locus_tag=BALIOE_12535;product=hypothetical protein;Parent=BALIOE_12535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5026 c1 Prodigal gene 2481330 2481689 . - . ID=BALIOE_12540_gene;locus_tag=BALIOE_12540 | |
| 5027 c1 Prodigal CDS 2481330 2481689 . - 0 ID=BALIOE_12540;Name=hypothetical protein;locus_tag=BALIOE_12540;product=hypothetical protein;Parent=BALIOE_12540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5028 c1 Prodigal gene 2481862 2482500 . - . ID=BALIOE_12545_gene;locus_tag=BALIOE_12545 | |
| 5029 c1 Prodigal CDS 2481862 2482500 . - 0 ID=BALIOE_12545;Name=hypothetical protein;locus_tag=BALIOE_12545;product=hypothetical protein;Parent=BALIOE_12545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5030 c1 Prodigal gene 2482627 2483550 . - . ID=BALIOE_12550_gene;locus_tag=BALIOE_12550 | |
| 5031 c1 Prodigal CDS 2482627 2483550 . - 0 ID=BALIOE_12550;Name=hypothetical protein;locus_tag=BALIOE_12550;product=hypothetical protein;Parent=BALIOE_12550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5032 c1 Prodigal gene 2483653 2484738 . + . ID=BALIOE_12555_gene;locus_tag=BALIOE_12555 | |
| 5033 c1 Prodigal CDS 2483653 2484738 . + 0 ID=BALIOE_12555;Name=hypothetical protein;locus_tag=BALIOE_12555;product=hypothetical protein;Parent=BALIOE_12555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5034 c1 Prodigal gene 2484989 2486599 . + . ID=BALIOE_12560_gene;locus_tag=BALIOE_12560 | |
| 5035 c1 Prodigal CDS 2484989 2486599 . + 0 ID=BALIOE_12560;Name=hypothetical protein;locus_tag=BALIOE_12560;product=hypothetical protein;Parent=BALIOE_12560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5036 c1 Prodigal gene 2486631 2487755 . + . ID=BALIOE_12565_gene;locus_tag=BALIOE_12565 | |
| 5037 c1 Prodigal CDS 2486631 2487755 . + 0 ID=BALIOE_12565;Name=hypothetical protein;locus_tag=BALIOE_12565;product=hypothetical protein;Parent=BALIOE_12565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5038 c1 Prodigal gene 2487811 2488776 . + . ID=BALIOE_12570_gene;locus_tag=BALIOE_12570 | |
| 5039 c1 Prodigal CDS 2487811 2488776 . + 0 ID=BALIOE_12570;Name=hypothetical protein;locus_tag=BALIOE_12570;product=hypothetical protein;Parent=BALIOE_12570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5040 c1 Prodigal gene 2488830 2489945 . - . ID=BALIOE_12575_gene;locus_tag=BALIOE_12575 | |
| 5041 c1 Prodigal CDS 2488830 2489945 . - 0 ID=BALIOE_12575;Name=hypothetical protein;locus_tag=BALIOE_12575;product=hypothetical protein;Parent=BALIOE_12575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5042 c1 Prodigal gene 2490027 2491778 . - . ID=BALIOE_12580_gene;locus_tag=BALIOE_12580 | |
| 5043 c1 Prodigal CDS 2490027 2491778 . - 0 ID=BALIOE_12580;Name=hypothetical protein;locus_tag=BALIOE_12580;product=hypothetical protein;Parent=BALIOE_12580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5044 c1 Prodigal gene 2491917 2492498 . - . ID=BALIOE_12585_gene;locus_tag=BALIOE_12585 | |
| 5045 c1 Prodigal CDS 2491917 2492498 . - 0 ID=BALIOE_12585;Name=hypothetical protein;locus_tag=BALIOE_12585;product=hypothetical protein;Parent=BALIOE_12585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5046 c1 Prodigal gene 2492538 2493233 . - . ID=BALIOE_12590_gene;locus_tag=BALIOE_12590 | |
| 5047 c1 Prodigal CDS 2492538 2493233 . - 0 ID=BALIOE_12590;Name=hypothetical protein;locus_tag=BALIOE_12590;product=hypothetical protein;Parent=BALIOE_12590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5048 c1 Prodigal gene 2493291 2495201 . - . ID=BALIOE_12595_gene;locus_tag=BALIOE_12595 | |
| 5049 c1 Prodigal CDS 2493291 2495201 . - 0 ID=BALIOE_12595;Name=hypothetical protein;locus_tag=BALIOE_12595;product=hypothetical protein;Parent=BALIOE_12595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5050 c1 Prodigal gene 2495330 2495677 . + . ID=BALIOE_12600_gene;locus_tag=BALIOE_12600 | |
| 5051 c1 Prodigal CDS 2495330 2495677 . + 0 ID=BALIOE_12600;Name=hypothetical protein;locus_tag=BALIOE_12600;product=hypothetical protein;Parent=BALIOE_12600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5052 c1 Prodigal gene 2496099 2496398 . + . ID=BALIOE_12605_gene;locus_tag=BALIOE_12605 | |
| 5053 c1 Prodigal CDS 2496099 2496398 . + 0 ID=BALIOE_12605;Name=hypothetical protein;locus_tag=BALIOE_12605;product=hypothetical protein;Parent=BALIOE_12605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5054 c1 Prodigal gene 2496518 2496697 . - . ID=BALIOE_12610_gene;locus_tag=BALIOE_12610 | |
| 5055 c1 Prodigal CDS 2496518 2496697 . - 0 ID=BALIOE_12610;Name=hypothetical protein;locus_tag=BALIOE_12610;product=hypothetical protein;Parent=BALIOE_12610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5056 c1 Prodigal gene 2496771 2498132 . + . ID=BALIOE_12615_gene;locus_tag=BALIOE_12615 | |
| 5057 c1 Prodigal CDS 2496771 2498132 . + 0 ID=BALIOE_12615;Name=hypothetical protein;locus_tag=BALIOE_12615;product=hypothetical protein;Parent=BALIOE_12615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5058 c1 Prodigal gene 2498136 2498714 . + . ID=BALIOE_12620_gene;locus_tag=BALIOE_12620 | |
| 5059 c1 Prodigal CDS 2498136 2498714 . + 0 ID=BALIOE_12620;Name=hypothetical protein;locus_tag=BALIOE_12620;product=hypothetical protein;Parent=BALIOE_12620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5060 c1 Prodigal gene 2498898 2500262 . + . ID=BALIOE_12625_gene;locus_tag=BALIOE_12625 | |
| 5061 c1 Prodigal CDS 2498898 2500262 . + 0 ID=BALIOE_12625;Name=hypothetical protein;locus_tag=BALIOE_12625;product=hypothetical protein;Parent=BALIOE_12625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5062 c1 Prodigal gene 2500393 2501991 . + . ID=BALIOE_12630_gene;locus_tag=BALIOE_12630 | |
| 5063 c1 Prodigal CDS 2500393 2501991 . + 0 ID=BALIOE_12630;Name=hypothetical protein;locus_tag=BALIOE_12630;product=hypothetical protein;Parent=BALIOE_12630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5064 c1 Prodigal gene 2501995 2503551 . - . ID=BALIOE_12635_gene;locus_tag=BALIOE_12635 | |
| 5065 c1 Prodigal CDS 2501995 2503551 . - 0 ID=BALIOE_12635;Name=hypothetical protein;locus_tag=BALIOE_12635;product=hypothetical protein;Parent=BALIOE_12635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5066 c1 Prodigal gene 2504014 2504985 . + . ID=BALIOE_12640_gene;locus_tag=BALIOE_12640 | |
| 5067 c1 Prodigal CDS 2504014 2504985 . + 0 ID=BALIOE_12640;Name=hypothetical protein;locus_tag=BALIOE_12640;product=hypothetical protein;Parent=BALIOE_12640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5068 c1 Prodigal gene 2505048 2505848 . + . ID=BALIOE_12645_gene;locus_tag=BALIOE_12645 | |
| 5069 c1 Prodigal CDS 2505048 2505848 . + 0 ID=BALIOE_12645;Name=hypothetical protein;locus_tag=BALIOE_12645;product=hypothetical protein;Parent=BALIOE_12645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5070 c1 Prodigal gene 2505861 2506712 . + . ID=BALIOE_12650_gene;locus_tag=BALIOE_12650 | |
| 5071 c1 Prodigal CDS 2505861 2506712 . + 0 ID=BALIOE_12650;Name=hypothetical protein;locus_tag=BALIOE_12650;product=hypothetical protein;Parent=BALIOE_12650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5072 c1 Prodigal gene 2506767 2507225 . + . ID=BALIOE_12655_gene;locus_tag=BALIOE_12655 | |
| 5073 c1 Prodigal CDS 2506767 2507225 . + 0 ID=BALIOE_12655;Name=hypothetical protein;locus_tag=BALIOE_12655;product=hypothetical protein;Parent=BALIOE_12655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5074 c1 Prodigal gene 2507536 2507658 . + . ID=BALIOE_12660_gene;locus_tag=BALIOE_12660 | |
| 5075 c1 Prodigal CDS 2507536 2507658 . + 0 ID=BALIOE_12660;Name=hypothetical protein;locus_tag=BALIOE_12660;product=hypothetical protein;Parent=BALIOE_12660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5076 c1 Prodigal gene 2507655 2508221 . + . ID=BALIOE_12665_gene;locus_tag=BALIOE_12665 | |
| 5077 c1 Prodigal CDS 2507655 2508221 . + 0 ID=BALIOE_12665;Name=hypothetical protein;locus_tag=BALIOE_12665;product=hypothetical protein;Parent=BALIOE_12665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5078 c1 Prodigal gene 2508218 2509027 . - . ID=BALIOE_12670_gene;locus_tag=BALIOE_12670 | |
| 5079 c1 Prodigal CDS 2508218 2509027 . - 0 ID=BALIOE_12670;Name=hypothetical protein;locus_tag=BALIOE_12670;product=hypothetical protein;Parent=BALIOE_12670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5080 c1 Prodigal gene 2509193 2509402 . - . ID=BALIOE_12675_gene;locus_tag=BALIOE_12675 | |
| 5081 c1 Prodigal CDS 2509193 2509402 . - 0 ID=BALIOE_12675;Name=hypothetical protein;locus_tag=BALIOE_12675;product=hypothetical protein;Parent=BALIOE_12675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5082 c1 Prodigal gene 2510227 2510514 . - . ID=BALIOE_12680_gene;locus_tag=BALIOE_12680 | |
| 5083 c1 Prodigal CDS 2510227 2510514 . - 0 ID=BALIOE_12680;Name=hypothetical protein;locus_tag=BALIOE_12680;product=hypothetical protein;Parent=BALIOE_12680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5084 c1 Prodigal gene 2510892 2511131 . + . ID=BALIOE_12685_gene;locus_tag=BALIOE_12685 | |
| 5085 c1 Prodigal CDS 2510892 2511131 . + 0 ID=BALIOE_12685;Name=hypothetical protein;locus_tag=BALIOE_12685;product=hypothetical protein;Parent=BALIOE_12685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5086 c1 Prodigal gene 2511275 2512066 . - . ID=BALIOE_12690_gene;locus_tag=BALIOE_12690 | |
| 5087 c1 Prodigal CDS 2511275 2512066 . - 0 ID=BALIOE_12690;Name=hypothetical protein;locus_tag=BALIOE_12690;product=hypothetical protein;Parent=BALIOE_12690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5088 c1 Prodigal gene 2512243 2513616 . + . ID=BALIOE_12695_gene;locus_tag=BALIOE_12695 | |
| 5089 c1 Prodigal CDS 2512243 2513616 . + 0 ID=BALIOE_12695;Name=hypothetical protein;locus_tag=BALIOE_12695;product=hypothetical protein;Parent=BALIOE_12695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5090 c1 Prodigal gene 2513662 2514543 . - . ID=BALIOE_12700_gene;locus_tag=BALIOE_12700 | |
| 5091 c1 Prodigal CDS 2513662 2514543 . - 0 ID=BALIOE_12700;Name=hypothetical protein;locus_tag=BALIOE_12700;product=hypothetical protein;Parent=BALIOE_12700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5092 c1 Prodigal gene 2514735 2516783 . - . ID=BALIOE_12705_gene;locus_tag=BALIOE_12705 | |
| 5093 c1 Prodigal CDS 2514735 2516783 . - 0 ID=BALIOE_12705;Name=hypothetical protein;locus_tag=BALIOE_12705;product=hypothetical protein;Parent=BALIOE_12705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5094 c1 Prodigal gene 2516803 2517501 . - . ID=BALIOE_12710_gene;locus_tag=BALIOE_12710 | |
| 5095 c1 Prodigal CDS 2516803 2517501 . - 0 ID=BALIOE_12710;Name=hypothetical protein;locus_tag=BALIOE_12710;product=hypothetical protein;Parent=BALIOE_12710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5096 c1 Prodigal gene 2517598 2518149 . - . ID=BALIOE_12715_gene;locus_tag=BALIOE_12715 | |
| 5097 c1 Prodigal CDS 2517598 2518149 . - 0 ID=BALIOE_12715;Name=hypothetical protein;locus_tag=BALIOE_12715;product=hypothetical protein;Parent=BALIOE_12715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5098 c1 Prodigal gene 2518225 2519508 . + . ID=BALIOE_12720_gene;locus_tag=BALIOE_12720 | |
| 5099 c1 Prodigal CDS 2518225 2519508 . + 0 ID=BALIOE_12720;Name=hypothetical protein;locus_tag=BALIOE_12720;product=hypothetical protein;Parent=BALIOE_12720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5100 c1 Prodigal gene 2519477 2522110 . + . ID=BALIOE_12725_gene;locus_tag=BALIOE_12725 | |
| 5101 c1 Prodigal CDS 2519477 2522110 . + 0 ID=BALIOE_12725;Name=hypothetical protein;locus_tag=BALIOE_12725;product=hypothetical protein;Parent=BALIOE_12725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5102 c1 Prodigal gene 2522110 2523630 . + . ID=BALIOE_12730_gene;locus_tag=BALIOE_12730 | |
| 5103 c1 Prodigal CDS 2522110 2523630 . + 0 ID=BALIOE_12730;Name=hypothetical protein;locus_tag=BALIOE_12730;product=hypothetical protein;Parent=BALIOE_12730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5104 c1 Prodigal gene 2523748 2523984 . + . ID=BALIOE_12735_gene;locus_tag=BALIOE_12735 | |
| 5105 c1 Prodigal CDS 2523748 2523984 . + 0 ID=BALIOE_12735;Name=hypothetical protein;locus_tag=BALIOE_12735;product=hypothetical protein;Parent=BALIOE_12735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5106 c1 Prodigal gene 2524005 2524280 . + . ID=BALIOE_12740_gene;locus_tag=BALIOE_12740 | |
| 5107 c1 Prodigal CDS 2524005 2524280 . + 0 ID=BALIOE_12740;Name=hypothetical protein;locus_tag=BALIOE_12740;product=hypothetical protein;Parent=BALIOE_12740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5108 c1 Prodigal gene 2524281 2524937 . - . ID=BALIOE_12745_gene;locus_tag=BALIOE_12745 | |
| 5109 c1 Prodigal CDS 2524281 2524937 . - 0 ID=BALIOE_12745;Name=hypothetical protein;locus_tag=BALIOE_12745;product=hypothetical protein;Parent=BALIOE_12745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5110 c1 Prodigal gene 2525333 2525674 . - . ID=BALIOE_12750_gene;locus_tag=BALIOE_12750 | |
| 5111 c1 Prodigal CDS 2525333 2525674 . - 0 ID=BALIOE_12750;Name=hypothetical protein;locus_tag=BALIOE_12750;product=hypothetical protein;Parent=BALIOE_12750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5112 c1 Prodigal gene 2525687 2526559 . - . ID=BALIOE_12755_gene;locus_tag=BALIOE_12755 | |
| 5113 c1 Prodigal CDS 2525687 2526559 . - 0 ID=BALIOE_12755;Name=hypothetical protein;locus_tag=BALIOE_12755;product=hypothetical protein;Parent=BALIOE_12755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5114 c1 Prodigal gene 2526563 2526937 . - . ID=BALIOE_12760_gene;locus_tag=BALIOE_12760 | |
| 5115 c1 Prodigal CDS 2526563 2526937 . - 0 ID=BALIOE_12760;Name=hypothetical protein;locus_tag=BALIOE_12760;product=hypothetical protein;Parent=BALIOE_12760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5116 c1 Prodigal gene 2527076 2527306 . + . ID=BALIOE_12765_gene;locus_tag=BALIOE_12765 | |
| 5117 c1 Prodigal CDS 2527076 2527306 . + 0 ID=BALIOE_12765;Name=hypothetical protein;locus_tag=BALIOE_12765;product=hypothetical protein;Parent=BALIOE_12765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5118 c1 Prodigal gene 2527408 2528064 . + . ID=BALIOE_12770_gene;locus_tag=BALIOE_12770 | |
| 5119 c1 Prodigal CDS 2527408 2528064 . + 0 ID=BALIOE_12770;Name=hypothetical protein;locus_tag=BALIOE_12770;product=hypothetical protein;Parent=BALIOE_12770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5120 c1 Prodigal gene 2528088 2528750 . + . ID=BALIOE_12775_gene;locus_tag=BALIOE_12775 | |
| 5121 c1 Prodigal CDS 2528088 2528750 . + 0 ID=BALIOE_12775;Name=hypothetical protein;locus_tag=BALIOE_12775;product=hypothetical protein;Parent=BALIOE_12775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5122 c1 Prodigal gene 2528747 2530807 . - . ID=BALIOE_12780_gene;locus_tag=BALIOE_12780 | |
| 5123 c1 Prodigal CDS 2528747 2530807 . - 0 ID=BALIOE_12780;Name=hypothetical protein;locus_tag=BALIOE_12780;product=hypothetical protein;Parent=BALIOE_12780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5124 c1 Prodigal gene 2531016 2531675 . - . ID=BALIOE_12785_gene;locus_tag=BALIOE_12785 | |
| 5125 c1 Prodigal CDS 2531016 2531675 . - 0 ID=BALIOE_12785;Name=hypothetical protein;locus_tag=BALIOE_12785;product=hypothetical protein;Parent=BALIOE_12785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5126 c1 Prodigal gene 2531735 2531845 . + . ID=BALIOE_12790_gene;locus_tag=BALIOE_12790 | |
| 5127 c1 Prodigal CDS 2531735 2531845 . + 0 ID=BALIOE_12790;Name=hypothetical protein;locus_tag=BALIOE_12790;product=hypothetical protein;Parent=BALIOE_12790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5128 c1 Prodigal gene 2531882 2532088 . + . ID=BALIOE_12795_gene;locus_tag=BALIOE_12795 | |
| 5129 c1 Prodigal CDS 2531882 2532088 . + 0 ID=BALIOE_12795;Name=hypothetical protein;locus_tag=BALIOE_12795;product=hypothetical protein;Parent=BALIOE_12795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5130 c1 Prodigal gene 2532002 2532358 . - . ID=BALIOE_12800_gene;locus_tag=BALIOE_12800 | |
| 5131 c1 Prodigal CDS 2532002 2532358 . - 0 ID=BALIOE_12800;Name=hypothetical protein;locus_tag=BALIOE_12800;product=hypothetical protein;Parent=BALIOE_12800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5132 c1 Prodigal gene 2532425 2532715 . - . ID=BALIOE_12805_gene;locus_tag=BALIOE_12805 | |
| 5133 c1 Prodigal CDS 2532425 2532715 . - 0 ID=BALIOE_12805;Name=hypothetical protein;locus_tag=BALIOE_12805;product=hypothetical protein;Parent=BALIOE_12805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5134 c1 Prodigal gene 2532849 2534027 . + . ID=BALIOE_12810_gene;locus_tag=BALIOE_12810 | |
| 5135 c1 Prodigal CDS 2532849 2534027 . + 0 ID=BALIOE_12810;Name=hypothetical protein;locus_tag=BALIOE_12810;product=hypothetical protein;Parent=BALIOE_12810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5136 c1 Prodigal gene 2534083 2534724 . - . ID=BALIOE_12815_gene;locus_tag=BALIOE_12815 | |
| 5137 c1 Prodigal CDS 2534083 2534724 . - 0 ID=BALIOE_12815;Name=hypothetical protein;locus_tag=BALIOE_12815;product=hypothetical protein;Parent=BALIOE_12815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5138 c1 Prodigal gene 2534761 2536572 . - . ID=BALIOE_12820_gene;locus_tag=BALIOE_12820 | |
| 5139 c1 Prodigal CDS 2534761 2536572 . - 0 ID=BALIOE_12820;Name=hypothetical protein;locus_tag=BALIOE_12820;product=hypothetical protein;Parent=BALIOE_12820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5140 c1 Prodigal gene 2536807 2538282 . - . ID=BALIOE_12825_gene;locus_tag=BALIOE_12825 | |
| 5141 c1 Prodigal CDS 2536807 2538282 . - 0 ID=BALIOE_12825;Name=hypothetical protein;locus_tag=BALIOE_12825;product=hypothetical protein;Parent=BALIOE_12825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5142 c1 Prodigal gene 2538448 2538597 . - . ID=BALIOE_12830_gene;locus_tag=BALIOE_12830 | |
| 5143 c1 Prodigal CDS 2538448 2538597 . - 0 ID=BALIOE_12830;Name=hypothetical protein;locus_tag=BALIOE_12830;product=hypothetical protein;Parent=BALIOE_12830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5144 c1 Prodigal gene 2538620 2539489 . + . ID=BALIOE_12835_gene;locus_tag=BALIOE_12835 | |
| 5145 c1 Prodigal CDS 2538620 2539489 . + 0 ID=BALIOE_12835;Name=hypothetical protein;locus_tag=BALIOE_12835;product=hypothetical protein;Parent=BALIOE_12835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5146 c1 Prodigal gene 2539617 2541059 . + . ID=BALIOE_12840_gene;locus_tag=BALIOE_12840 | |
| 5147 c1 Prodigal CDS 2539617 2541059 . + 0 ID=BALIOE_12840;Name=hypothetical protein;locus_tag=BALIOE_12840;product=hypothetical protein;Parent=BALIOE_12840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5148 c1 Prodigal gene 2541190 2542161 . - . ID=BALIOE_12845_gene;locus_tag=BALIOE_12845 | |
| 5149 c1 Prodigal CDS 2541190 2542161 . - 0 ID=BALIOE_12845;Name=hypothetical protein;locus_tag=BALIOE_12845;product=hypothetical protein;Parent=BALIOE_12845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5150 c1 Prodigal gene 2542281 2543603 . - . ID=BALIOE_12850_gene;locus_tag=BALIOE_12850 | |
| 5151 c1 Prodigal CDS 2542281 2543603 . - 0 ID=BALIOE_12850;Name=hypothetical protein;locus_tag=BALIOE_12850;product=hypothetical protein;Parent=BALIOE_12850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5152 c1 Prodigal gene 2543619 2544605 . - . ID=BALIOE_12855_gene;locus_tag=BALIOE_12855 | |
| 5153 c1 Prodigal CDS 2543619 2544605 . - 0 ID=BALIOE_12855;Name=hypothetical protein;locus_tag=BALIOE_12855;product=hypothetical protein;Parent=BALIOE_12855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5154 c1 Prodigal gene 2544630 2545385 . + . ID=BALIOE_12860_gene;locus_tag=BALIOE_12860 | |
| 5155 c1 Prodigal CDS 2544630 2545385 . + 0 ID=BALIOE_12860;Name=hypothetical protein;locus_tag=BALIOE_12860;product=hypothetical protein;Parent=BALIOE_12860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5156 c1 Prodigal gene 2545382 2546167 . + . ID=BALIOE_12865_gene;locus_tag=BALIOE_12865 | |
| 5157 c1 Prodigal CDS 2545382 2546167 . + 0 ID=BALIOE_12865;Name=hypothetical protein;locus_tag=BALIOE_12865;product=hypothetical protein;Parent=BALIOE_12865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5158 c1 Infernal gene 2546239 2546314 . - . ID=BALIOE_12870_gene;locus_tag=BALIOE_12870;gene=naRNA4 | |
| 5159 c1 Infernal ncRNA 2546239 2546314 1.8e-08 - . ID=BALIOE_12870;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_12870;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_12870_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 5160 c1 Prodigal gene 2546413 2547423 . - . ID=BALIOE_12875_gene;locus_tag=BALIOE_12875 | |
| 5161 c1 Prodigal CDS 2546413 2547423 . - 0 ID=BALIOE_12875;Name=hypothetical protein;locus_tag=BALIOE_12875;product=hypothetical protein;Parent=BALIOE_12875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5162 c1 Prodigal gene 2547432 2548043 . - . ID=BALIOE_12880_gene;locus_tag=BALIOE_12880 | |
| 5163 c1 Prodigal CDS 2547432 2548043 . - 0 ID=BALIOE_12880;Name=hypothetical protein;locus_tag=BALIOE_12880;product=hypothetical protein;Parent=BALIOE_12880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5164 c1 Prodigal gene 2548318 2548920 . + . ID=BALIOE_12885_gene;locus_tag=BALIOE_12885 | |
| 5165 c1 Prodigal CDS 2548318 2548920 . + 0 ID=BALIOE_12885;Name=hypothetical protein;locus_tag=BALIOE_12885;product=hypothetical protein;Parent=BALIOE_12885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5166 c1 Prodigal gene 2548922 2549443 . - . ID=BALIOE_12890_gene;locus_tag=BALIOE_12890 | |
| 5167 c1 Prodigal CDS 2548922 2549443 . - 0 ID=BALIOE_12890;Name=hypothetical protein;locus_tag=BALIOE_12890;product=hypothetical protein;Parent=BALIOE_12890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5168 c1 Prodigal gene 2549478 2550218 . - . ID=BALIOE_12895_gene;locus_tag=BALIOE_12895 | |
| 5169 c1 Prodigal CDS 2549478 2550218 . - 0 ID=BALIOE_12895;Name=hypothetical protein;locus_tag=BALIOE_12895;product=hypothetical protein;Parent=BALIOE_12895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5170 c1 Prodigal gene 2550247 2550756 . - . ID=BALIOE_12900_gene;locus_tag=BALIOE_12900 | |
| 5171 c1 Prodigal CDS 2550247 2550756 . - 0 ID=BALIOE_12900;Name=hypothetical protein;locus_tag=BALIOE_12900;product=hypothetical protein;Parent=BALIOE_12900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5172 c1 Prodigal gene 2550817 2552589 . - . ID=BALIOE_12905_gene;locus_tag=BALIOE_12905 | |
| 5173 c1 Prodigal CDS 2550817 2552589 . - 0 ID=BALIOE_12905;Name=hypothetical protein;locus_tag=BALIOE_12905;product=hypothetical protein;Parent=BALIOE_12905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5174 c1 Prodigal gene 2552899 2553465 . + . ID=BALIOE_12910_gene;locus_tag=BALIOE_12910 | |
| 5175 c1 Prodigal CDS 2552899 2553465 . + 0 ID=BALIOE_12910;Name=hypothetical protein;locus_tag=BALIOE_12910;product=hypothetical protein;Parent=BALIOE_12910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5176 c1 Prodigal gene 2553462 2554280 . + . ID=BALIOE_12915_gene;locus_tag=BALIOE_12915 | |
| 5177 c1 Prodigal CDS 2553462 2554280 . + 0 ID=BALIOE_12915;Name=hypothetical protein;locus_tag=BALIOE_12915;product=hypothetical protein;Parent=BALIOE_12915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5178 c1 Prodigal gene 2554333 2554728 . + . ID=BALIOE_12920_gene;locus_tag=BALIOE_12920 | |
| 5179 c1 Prodigal CDS 2554333 2554728 . + 0 ID=BALIOE_12920;Name=hypothetical protein;locus_tag=BALIOE_12920;product=hypothetical protein;Parent=BALIOE_12920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5180 c1 Prodigal gene 2554769 2555512 . + . ID=BALIOE_12925_gene;locus_tag=BALIOE_12925 | |
| 5181 c1 Prodigal CDS 2554769 2555512 . + 0 ID=BALIOE_12925;Name=hypothetical protein;locus_tag=BALIOE_12925;product=hypothetical protein;Parent=BALIOE_12925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5182 c1 Prodigal gene 2555509 2556480 . + . ID=BALIOE_12930_gene;locus_tag=BALIOE_12930 | |
| 5183 c1 Prodigal CDS 2555509 2556480 . + 0 ID=BALIOE_12930;Name=hypothetical protein;locus_tag=BALIOE_12930;product=hypothetical protein;Parent=BALIOE_12930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5184 c1 Prodigal gene 2556645 2559074 . - . ID=BALIOE_12935_gene;locus_tag=BALIOE_12935 | |
| 5185 c1 Prodigal CDS 2556645 2559074 . - 0 ID=BALIOE_12935;Name=hypothetical protein;locus_tag=BALIOE_12935;product=hypothetical protein;Parent=BALIOE_12935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5186 c1 Prodigal gene 2559099 2560199 . - . ID=BALIOE_12940_gene;locus_tag=BALIOE_12940 | |
| 5187 c1 Prodigal CDS 2559099 2560199 . - 0 ID=BALIOE_12940;Name=hypothetical protein;locus_tag=BALIOE_12940;product=hypothetical protein;Parent=BALIOE_12940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5188 c1 Prodigal gene 2560587 2561333 . - . ID=BALIOE_12945_gene;locus_tag=BALIOE_12945 | |
| 5189 c1 Prodigal CDS 2560587 2561333 . - 0 ID=BALIOE_12945;Name=hypothetical protein;locus_tag=BALIOE_12945;product=hypothetical protein;Parent=BALIOE_12945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5190 c1 Prodigal gene 2561347 2561913 . - . ID=BALIOE_12950_gene;locus_tag=BALIOE_12950 | |
| 5191 c1 Prodigal CDS 2561347 2561913 . - 0 ID=BALIOE_12950;Name=hypothetical protein;locus_tag=BALIOE_12950;product=hypothetical protein;Parent=BALIOE_12950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5192 c1 Prodigal gene 2562129 2563862 . + . ID=BALIOE_12955_gene;locus_tag=BALIOE_12955 | |
| 5193 c1 Prodigal CDS 2562129 2563862 . + 0 ID=BALIOE_12955;Name=hypothetical protein;locus_tag=BALIOE_12955;product=hypothetical protein;Parent=BALIOE_12955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5194 c1 Prodigal gene 2564039 2564527 . + . ID=BALIOE_12960_gene;locus_tag=BALIOE_12960 | |
| 5195 c1 Prodigal CDS 2564039 2564527 . + 0 ID=BALIOE_12960;Name=hypothetical protein;locus_tag=BALIOE_12960;product=hypothetical protein;Parent=BALIOE_12960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5196 c1 Prodigal gene 2564647 2565042 . - . ID=BALIOE_12965_gene;locus_tag=BALIOE_12965 | |
| 5197 c1 Prodigal CDS 2564647 2565042 . - 0 ID=BALIOE_12965;Name=hypothetical protein;locus_tag=BALIOE_12965;product=hypothetical protein;Parent=BALIOE_12965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5198 c1 Prodigal gene 2565039 2567117 . - . ID=BALIOE_12970_gene;locus_tag=BALIOE_12970 | |
| 5199 c1 Prodigal CDS 2565039 2567117 . - 0 ID=BALIOE_12970;Name=hypothetical protein;locus_tag=BALIOE_12970;product=hypothetical protein;Parent=BALIOE_12970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5200 c1 Prodigal gene 2567110 2568258 . - . ID=BALIOE_12975_gene;locus_tag=BALIOE_12975 | |
| 5201 c1 Prodigal CDS 2567110 2568258 . - 0 ID=BALIOE_12975;Name=hypothetical protein;locus_tag=BALIOE_12975;product=hypothetical protein;Parent=BALIOE_12975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5202 c1 Prodigal gene 2568460 2569104 . - . ID=BALIOE_12980_gene;locus_tag=BALIOE_12980 | |
| 5203 c1 Prodigal CDS 2568460 2569104 . - 0 ID=BALIOE_12980;Name=hypothetical protein;locus_tag=BALIOE_12980;product=hypothetical protein;Parent=BALIOE_12980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5204 c1 Prodigal gene 2569115 2569504 . - . ID=BALIOE_12985_gene;locus_tag=BALIOE_12985 | |
| 5205 c1 Prodigal CDS 2569115 2569504 . - 0 ID=BALIOE_12985;Name=hypothetical protein;locus_tag=BALIOE_12985;product=hypothetical protein;Parent=BALIOE_12985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5206 c1 Prodigal gene 2569519 2570568 . - . ID=BALIOE_12990_gene;locus_tag=BALIOE_12990 | |
| 5207 c1 Prodigal CDS 2569519 2570568 . - 0 ID=BALIOE_12990;Name=hypothetical protein;locus_tag=BALIOE_12990;product=hypothetical protein;Parent=BALIOE_12990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5208 c1 Prodigal gene 2570571 2571431 . - . ID=BALIOE_12995_gene;locus_tag=BALIOE_12995 | |
| 5209 c1 Prodigal CDS 2570571 2571431 . - 0 ID=BALIOE_12995;Name=hypothetical protein;locus_tag=BALIOE_12995;product=hypothetical protein;Parent=BALIOE_12995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5210 c1 Prodigal gene 2571450 2573051 . - . ID=BALIOE_13000_gene;locus_tag=BALIOE_13000 | |
| 5211 c1 Prodigal CDS 2571450 2573051 . - 0 ID=BALIOE_13000;Name=hypothetical protein;locus_tag=BALIOE_13000;product=hypothetical protein;Parent=BALIOE_13000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5212 c1 Prodigal gene 2573097 2574758 . - . ID=BALIOE_13005_gene;locus_tag=BALIOE_13005 | |
| 5213 c1 Prodigal CDS 2573097 2574758 . - 0 ID=BALIOE_13005;Name=hypothetical protein;locus_tag=BALIOE_13005;product=hypothetical protein;Parent=BALIOE_13005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5214 c1 Prodigal gene 2574901 2575404 . - . ID=BALIOE_13010_gene;locus_tag=BALIOE_13010 | |
| 5215 c1 Prodigal CDS 2574901 2575404 . - 0 ID=BALIOE_13010;Name=hypothetical protein;locus_tag=BALIOE_13010;product=hypothetical protein;Parent=BALIOE_13010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5216 c1 Prodigal gene 2575425 2577389 . - . ID=BALIOE_13015_gene;locus_tag=BALIOE_13015 | |
| 5217 c1 Prodigal CDS 2575425 2577389 . - 0 ID=BALIOE_13015;Name=hypothetical protein;locus_tag=BALIOE_13015;product=hypothetical protein;Parent=BALIOE_13015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5218 c1 Prodigal gene 2577394 2578320 . - . ID=BALIOE_13020_gene;locus_tag=BALIOE_13020 | |
| 5219 c1 Prodigal CDS 2577394 2578320 . - 0 ID=BALIOE_13020;Name=hypothetical protein;locus_tag=BALIOE_13020;product=hypothetical protein;Parent=BALIOE_13020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5220 c1 Prodigal gene 2578317 2579204 . - . ID=BALIOE_13025_gene;locus_tag=BALIOE_13025 | |
| 5221 c1 Prodigal CDS 2578317 2579204 . - 0 ID=BALIOE_13025;Name=hypothetical protein;locus_tag=BALIOE_13025;product=hypothetical protein;Parent=BALIOE_13025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5222 c1 Prodigal gene 2579331 2579909 . - . ID=BALIOE_13030_gene;locus_tag=BALIOE_13030 | |
| 5223 c1 Prodigal CDS 2579331 2579909 . - 0 ID=BALIOE_13030;Name=hypothetical protein;locus_tag=BALIOE_13030;product=hypothetical protein;Parent=BALIOE_13030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5224 c1 Prodigal gene 2579912 2580262 . - . ID=BALIOE_13035_gene;locus_tag=BALIOE_13035 | |
| 5225 c1 Prodigal CDS 2579912 2580262 . - 0 ID=BALIOE_13035;Name=hypothetical protein;locus_tag=BALIOE_13035;product=hypothetical protein;Parent=BALIOE_13035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5226 c1 Prodigal gene 2581042 2581470 . + . ID=BALIOE_13040_gene;locus_tag=BALIOE_13040 | |
| 5227 c1 Prodigal CDS 2581042 2581470 . + 0 ID=BALIOE_13040;Name=hypothetical protein;locus_tag=BALIOE_13040;product=hypothetical protein;Parent=BALIOE_13040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5228 c1 Prodigal gene 2581477 2582901 . - . ID=BALIOE_13045_gene;locus_tag=BALIOE_13045 | |
| 5229 c1 Prodigal CDS 2581477 2582901 . - 0 ID=BALIOE_13045;Name=hypothetical protein;locus_tag=BALIOE_13045;product=hypothetical protein;Parent=BALIOE_13045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5230 c1 Prodigal gene 2582876 2583676 . - . ID=BALIOE_13050_gene;locus_tag=BALIOE_13050 | |
| 5231 c1 Prodigal CDS 2582876 2583676 . - 0 ID=BALIOE_13050;Name=hypothetical protein;locus_tag=BALIOE_13050;product=hypothetical protein;Parent=BALIOE_13050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5232 c1 Prodigal gene 2583843 2584550 . - . ID=BALIOE_13055_gene;locus_tag=BALIOE_13055 | |
| 5233 c1 Prodigal CDS 2583843 2584550 . - 0 ID=BALIOE_13055;Name=hypothetical protein;locus_tag=BALIOE_13055;product=hypothetical protein;Parent=BALIOE_13055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5234 c1 Prodigal gene 2584569 2584829 . - . ID=BALIOE_13060_gene;locus_tag=BALIOE_13060 | |
| 5235 c1 Prodigal CDS 2584569 2584829 . - 0 ID=BALIOE_13060;Name=hypothetical protein;locus_tag=BALIOE_13060;product=hypothetical protein;Parent=BALIOE_13060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5236 c1 Prodigal gene 2584844 2586358 . - . ID=BALIOE_13065_gene;locus_tag=BALIOE_13065 | |
| 5237 c1 Prodigal CDS 2584844 2586358 . - 0 ID=BALIOE_13065;Name=hypothetical protein;locus_tag=BALIOE_13065;product=hypothetical protein;Parent=BALIOE_13065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5238 c1 Prodigal gene 2586428 2587417 . - . ID=BALIOE_13070_gene;locus_tag=BALIOE_13070 | |
| 5239 c1 Prodigal CDS 2586428 2587417 . - 0 ID=BALIOE_13070;Name=hypothetical protein;locus_tag=BALIOE_13070;product=hypothetical protein;Parent=BALIOE_13070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5240 c1 Prodigal gene 2588214 2588717 . + . ID=BALIOE_13075_gene;locus_tag=BALIOE_13075 | |
| 5241 c1 Prodigal CDS 2588214 2588717 . + 0 ID=BALIOE_13075;Name=hypothetical protein;locus_tag=BALIOE_13075;product=hypothetical protein;Parent=BALIOE_13075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5242 c1 Prodigal gene 2588797 2589048 . - . ID=BALIOE_13080_gene;locus_tag=BALIOE_13080 | |
| 5243 c1 Prodigal CDS 2588797 2589048 . - 0 ID=BALIOE_13080;Name=hypothetical protein;locus_tag=BALIOE_13080;product=hypothetical protein;Parent=BALIOE_13080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5244 c1 Prodigal gene 2589511 2589834 . + . ID=BALIOE_13085_gene;locus_tag=BALIOE_13085 | |
| 5245 c1 Prodigal CDS 2589511 2589834 . + 0 ID=BALIOE_13085;Name=hypothetical protein;locus_tag=BALIOE_13085;product=hypothetical protein;Parent=BALIOE_13085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5246 c1 Prodigal gene 2590005 2590502 . + . ID=BALIOE_13090_gene;locus_tag=BALIOE_13090 | |
| 5247 c1 Prodigal CDS 2590005 2590502 . + 0 ID=BALIOE_13090;Name=hypothetical protein;locus_tag=BALIOE_13090;product=hypothetical protein;Parent=BALIOE_13090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5248 c1 Prodigal gene 2590539 2590778 . - . ID=BALIOE_13095_gene;locus_tag=BALIOE_13095 | |
| 5249 c1 Prodigal CDS 2590539 2590778 . - 0 ID=BALIOE_13095;Name=hypothetical protein;locus_tag=BALIOE_13095;product=hypothetical protein;Parent=BALIOE_13095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5250 c1 Prodigal gene 2590970 2592181 . + . ID=BALIOE_13100_gene;locus_tag=BALIOE_13100 | |
| 5251 c1 Prodigal CDS 2590970 2592181 . + 0 ID=BALIOE_13100;Name=hypothetical protein;locus_tag=BALIOE_13100;product=hypothetical protein;Parent=BALIOE_13100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5252 c1 Prodigal gene 2592243 2592908 . - . ID=BALIOE_13105_gene;locus_tag=BALIOE_13105 | |
| 5253 c1 Prodigal CDS 2592243 2592908 . - 0 ID=BALIOE_13105;Name=hypothetical protein;locus_tag=BALIOE_13105;product=hypothetical protein;Parent=BALIOE_13105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5254 c1 Prodigal gene 2593265 2594266 . - . ID=BALIOE_13110_gene;locus_tag=BALIOE_13110 | |
| 5255 c1 Prodigal CDS 2593265 2594266 . - 0 ID=BALIOE_13110;Name=hypothetical protein;locus_tag=BALIOE_13110;product=hypothetical protein;Parent=BALIOE_13110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5256 c1 Prodigal gene 2594272 2594619 . - . ID=BALIOE_13115_gene;locus_tag=BALIOE_13115 | |
| 5257 c1 Prodigal CDS 2594272 2594619 . - 0 ID=BALIOE_13115;Name=hypothetical protein;locus_tag=BALIOE_13115;product=hypothetical protein;Parent=BALIOE_13115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5258 c1 Prodigal gene 2594649 2595299 . - . ID=BALIOE_13120_gene;locus_tag=BALIOE_13120 | |
| 5259 c1 Prodigal CDS 2594649 2595299 . - 0 ID=BALIOE_13120;Name=hypothetical protein;locus_tag=BALIOE_13120;product=hypothetical protein;Parent=BALIOE_13120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5260 c1 Prodigal gene 2595315 2595719 . - . ID=BALIOE_13125_gene;locus_tag=BALIOE_13125 | |
| 5261 c1 Prodigal CDS 2595315 2595719 . - 0 ID=BALIOE_13125;Name=hypothetical protein;locus_tag=BALIOE_13125;product=hypothetical protein;Parent=BALIOE_13125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5262 c1 Prodigal gene 2596018 2596221 . + . ID=BALIOE_13130_gene;locus_tag=BALIOE_13130 | |
| 5263 c1 Prodigal CDS 2596018 2596221 . + 0 ID=BALIOE_13130;Name=hypothetical protein;locus_tag=BALIOE_13130;product=hypothetical protein;Parent=BALIOE_13130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5264 c1 Prodigal gene 2596243 2596593 . + . ID=BALIOE_13135_gene;locus_tag=BALIOE_13135 | |
| 5265 c1 Prodigal CDS 2596243 2596593 . + 0 ID=BALIOE_13135;Name=hypothetical protein;locus_tag=BALIOE_13135;product=hypothetical protein;Parent=BALIOE_13135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5266 c1 Prodigal gene 2596604 2596882 . + . ID=BALIOE_13140_gene;locus_tag=BALIOE_13140 | |
| 5267 c1 Prodigal CDS 2596604 2596882 . + 0 ID=BALIOE_13140;Name=hypothetical protein;locus_tag=BALIOE_13140;product=hypothetical protein;Parent=BALIOE_13140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5268 c1 Prodigal gene 2596894 2597136 . + . ID=BALIOE_13145_gene;locus_tag=BALIOE_13145 | |
| 5269 c1 Prodigal CDS 2596894 2597136 . + 0 ID=BALIOE_13145;Name=hypothetical protein;locus_tag=BALIOE_13145;product=hypothetical protein;Parent=BALIOE_13145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5270 c1 Prodigal gene 2597133 2597246 . + . ID=BALIOE_13150_gene;locus_tag=BALIOE_13150 | |
| 5271 c1 Prodigal CDS 2597133 2597246 . + 0 ID=BALIOE_13150;Name=hypothetical protein;locus_tag=BALIOE_13150;product=hypothetical protein;Parent=BALIOE_13150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5272 c1 Prodigal gene 2597339 2597755 . + . ID=BALIOE_13155_gene;locus_tag=BALIOE_13155 | |
| 5273 c1 Prodigal CDS 2597339 2597755 . + 0 ID=BALIOE_13155;Name=hypothetical protein;locus_tag=BALIOE_13155;product=hypothetical protein;Parent=BALIOE_13155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5274 c1 Prodigal gene 2597779 2597982 . + . ID=BALIOE_13160_gene;locus_tag=BALIOE_13160 | |
| 5275 c1 Prodigal CDS 2597779 2597982 . + 0 ID=BALIOE_13160;Name=hypothetical protein;locus_tag=BALIOE_13160;product=hypothetical protein;Parent=BALIOE_13160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5276 c1 Prodigal gene 2597979 2598245 . + . ID=BALIOE_13165_gene;locus_tag=BALIOE_13165 | |
| 5277 c1 Prodigal CDS 2597979 2598245 . + 0 ID=BALIOE_13165;Name=hypothetical protein;locus_tag=BALIOE_13165;product=hypothetical protein;Parent=BALIOE_13165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5278 c1 Prodigal gene 2598242 2598541 . + . ID=BALIOE_13170_gene;locus_tag=BALIOE_13170 | |
| 5279 c1 Prodigal CDS 2598242 2598541 . + 0 ID=BALIOE_13170;Name=hypothetical protein;locus_tag=BALIOE_13170;product=hypothetical protein;Parent=BALIOE_13170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5280 c1 Prodigal gene 2598864 2599094 . + . ID=BALIOE_13175_gene;locus_tag=BALIOE_13175 | |
| 5281 c1 Prodigal CDS 2598864 2599094 . + 0 ID=BALIOE_13175;Name=hypothetical protein;locus_tag=BALIOE_13175;product=hypothetical protein;Parent=BALIOE_13175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5282 c1 Prodigal gene 2599167 2599532 . + . ID=BALIOE_13180_gene;locus_tag=BALIOE_13180 | |
| 5283 c1 Prodigal CDS 2599167 2599532 . + 0 ID=BALIOE_13180;Name=hypothetical protein;locus_tag=BALIOE_13180;product=hypothetical protein;Parent=BALIOE_13180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5284 c1 Prodigal gene 2599539 2602361 . + . ID=BALIOE_13185_gene;locus_tag=BALIOE_13185 | |
| 5285 c1 Prodigal CDS 2599539 2602361 . + 0 ID=BALIOE_13185;Name=hypothetical protein;locus_tag=BALIOE_13185;product=hypothetical protein;Parent=BALIOE_13185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5286 c1 Prodigal gene 2602438 2603397 . + . ID=BALIOE_13190_gene;locus_tag=BALIOE_13190 | |
| 5287 c1 Prodigal CDS 2602438 2603397 . + 0 ID=BALIOE_13190;Name=hypothetical protein;locus_tag=BALIOE_13190;product=hypothetical protein;Parent=BALIOE_13190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5288 c1 Prodigal gene 2603402 2603716 . + . ID=BALIOE_13195_gene;locus_tag=BALIOE_13195 | |
| 5289 c1 Prodigal CDS 2603402 2603716 . + 0 ID=BALIOE_13195;Name=hypothetical protein;locus_tag=BALIOE_13195;product=hypothetical protein;Parent=BALIOE_13195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5290 c1 Prodigal gene 2603736 2604425 . - . ID=BALIOE_13200_gene;locus_tag=BALIOE_13200 | |
| 5291 c1 Prodigal CDS 2603736 2604425 . - 0 ID=BALIOE_13200;Name=hypothetical protein;locus_tag=BALIOE_13200;product=hypothetical protein;Parent=BALIOE_13200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5292 c1 Prodigal gene 2604425 2604751 . - . ID=BALIOE_13205_gene;locus_tag=BALIOE_13205 | |
| 5293 c1 Prodigal CDS 2604425 2604751 . - 0 ID=BALIOE_13205;Name=hypothetical protein;locus_tag=BALIOE_13205;product=hypothetical protein;Parent=BALIOE_13205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5294 c1 Prodigal gene 2604922 2605338 . + . ID=BALIOE_13210_gene;locus_tag=BALIOE_13210 | |
| 5295 c1 Prodigal CDS 2604922 2605338 . + 0 ID=BALIOE_13210;Name=hypothetical protein;locus_tag=BALIOE_13210;product=hypothetical protein;Parent=BALIOE_13210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5296 c1 Prodigal gene 2605382 2605954 . - . ID=BALIOE_13215_gene;locus_tag=BALIOE_13215 | |
| 5297 c1 Prodigal CDS 2605382 2605954 . - 0 ID=BALIOE_13215;Name=hypothetical protein;locus_tag=BALIOE_13215;product=hypothetical protein;Parent=BALIOE_13215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5298 c1 Prodigal gene 2606111 2606599 . - . ID=BALIOE_13220_gene;locus_tag=BALIOE_13220 | |
| 5299 c1 Prodigal CDS 2606111 2606599 . - 0 ID=BALIOE_13220;Name=hypothetical protein;locus_tag=BALIOE_13220;product=hypothetical protein;Parent=BALIOE_13220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5300 c1 Prodigal gene 2606612 2607313 . - . ID=BALIOE_13225_gene;locus_tag=BALIOE_13225 | |
| 5301 c1 Prodigal CDS 2606612 2607313 . - 0 ID=BALIOE_13225;Name=hypothetical protein;locus_tag=BALIOE_13225;product=hypothetical protein;Parent=BALIOE_13225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5302 c1 Prodigal gene 2607325 2609415 . - . ID=BALIOE_13230_gene;locus_tag=BALIOE_13230 | |
| 5303 c1 Prodigal CDS 2607325 2609415 . - 0 ID=BALIOE_13230;Name=hypothetical protein;locus_tag=BALIOE_13230;product=hypothetical protein;Parent=BALIOE_13230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5304 c1 Prodigal gene 2609566 2609931 . - . ID=BALIOE_13235_gene;locus_tag=BALIOE_13235 | |
| 5305 c1 Prodigal CDS 2609566 2609931 . - 0 ID=BALIOE_13235;Name=hypothetical protein;locus_tag=BALIOE_13235;product=hypothetical protein;Parent=BALIOE_13235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5306 c1 Prodigal gene 2609986 2610498 . - . ID=BALIOE_13240_gene;locus_tag=BALIOE_13240 | |
| 5307 c1 Prodigal CDS 2609986 2610498 . - 0 ID=BALIOE_13240;Name=hypothetical protein;locus_tag=BALIOE_13240;product=hypothetical protein;Parent=BALIOE_13240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5308 c1 Prodigal gene 2610498 2611682 . - . ID=BALIOE_13245_gene;locus_tag=BALIOE_13245 | |
| 5309 c1 Prodigal CDS 2610498 2611682 . - 0 ID=BALIOE_13245;Name=hypothetical protein;locus_tag=BALIOE_13245;product=hypothetical protein;Parent=BALIOE_13245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5310 c1 Prodigal gene 2611840 2612163 . + . ID=BALIOE_13250_gene;locus_tag=BALIOE_13250 | |
| 5311 c1 Prodigal CDS 2611840 2612163 . + 0 ID=BALIOE_13250;Name=hypothetical protein;locus_tag=BALIOE_13250;product=hypothetical protein;Parent=BALIOE_13250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5312 c1 Prodigal gene 2612114 2613145 . - . ID=BALIOE_13255_gene;locus_tag=BALIOE_13255 | |
| 5313 c1 Prodigal CDS 2612114 2613145 . - 0 ID=BALIOE_13255;Name=hypothetical protein;locus_tag=BALIOE_13255;product=hypothetical protein;Parent=BALIOE_13255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5314 c1 tRNAscan-SE gene 2614224 2614310 . - . ID=BALIOE_13260_gene;locus_tag=BALIOE_13260;gene=Leu_trna | |
| 5315 c1 tRNAscan-SE tRNA 2614224 2614310 . - . ID=BALIOE_13260;Name=tRNA-Leu;locus_tag=BALIOE_13260;product=tRNA-Leu;gene=Leu_trna;Parent=BALIOE_13260_gene;inference=profile:tRNAscan:2.0;Note=SO:0000264 | |
| 5316 c1 tRNAscan-SE gene 2614323 2614396 . - . ID=BALIOE_13265_gene;locus_tag=BALIOE_13265;gene=Cys_trna | |
| 5317 c1 tRNAscan-SE tRNA 2614323 2614396 . - . ID=BALIOE_13265;Name=tRNA-Cys;locus_tag=BALIOE_13265;product=tRNA-Cys;gene=Cys_trna;Parent=BALIOE_13265_gene;inference=profile:tRNAscan:2.0;Note=SO:0000258 | |
| 5318 c1 tRNAscan-SE gene 2614450 2614525 . - . ID=BALIOE_13270_gene;locus_tag=BALIOE_13270;gene=Gly_trna | |
| 5319 c1 tRNAscan-SE tRNA 2614450 2614525 . - . ID=BALIOE_13270;Name=tRNA-Gly;locus_tag=BALIOE_13270;product=tRNA-Gly;gene=Gly_trna;Parent=BALIOE_13270_gene;inference=profile:tRNAscan:2.0;Note=SO:0000260 | |
| 5320 c1 Prodigal gene 2614677 2615225 . - . ID=BALIOE_13275_gene;locus_tag=BALIOE_13275 | |
| 5321 c1 Prodigal CDS 2614677 2615225 . - 0 ID=BALIOE_13275;Name=hypothetical protein;locus_tag=BALIOE_13275;product=hypothetical protein;Parent=BALIOE_13275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5322 c1 Prodigal gene 2615282 2617114 . - . ID=BALIOE_13280_gene;locus_tag=BALIOE_13280 | |
| 5323 c1 Prodigal CDS 2615282 2617114 . - 0 ID=BALIOE_13280;Name=hypothetical protein;locus_tag=BALIOE_13280;product=hypothetical protein;Parent=BALIOE_13280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5324 c1 Prodigal gene 2617111 2617767 . - . ID=BALIOE_13285_gene;locus_tag=BALIOE_13285 | |
| 5325 c1 Prodigal CDS 2617111 2617767 . - 0 ID=BALIOE_13285;Name=hypothetical protein;locus_tag=BALIOE_13285;product=hypothetical protein;Parent=BALIOE_13285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5326 c1 Prodigal gene 2618226 2618450 . + . ID=BALIOE_13290_gene;locus_tag=BALIOE_13290 | |
| 5327 c1 Prodigal CDS 2618226 2618450 . + 0 ID=BALIOE_13290;Name=hypothetical protein;locus_tag=BALIOE_13290;product=hypothetical protein;Parent=BALIOE_13290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5328 c1 Prodigal gene 2618518 2619240 . - . ID=BALIOE_13295_gene;locus_tag=BALIOE_13295 | |
| 5329 c1 Prodigal CDS 2618518 2619240 . - 0 ID=BALIOE_13295;Name=hypothetical protein;locus_tag=BALIOE_13295;product=hypothetical protein;Parent=BALIOE_13295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5330 c1 Prodigal gene 2619470 2620222 . - . ID=BALIOE_13300_gene;locus_tag=BALIOE_13300 | |
| 5331 c1 Prodigal CDS 2619470 2620222 . - 0 ID=BALIOE_13300;Name=hypothetical protein;locus_tag=BALIOE_13300;product=hypothetical protein;Parent=BALIOE_13300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5332 c1 Prodigal gene 2620219 2620887 . - . ID=BALIOE_13305_gene;locus_tag=BALIOE_13305 | |
| 5333 c1 Prodigal CDS 2620219 2620887 . - 0 ID=BALIOE_13305;Name=hypothetical protein;locus_tag=BALIOE_13305;product=hypothetical protein;Parent=BALIOE_13305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5334 c1 Prodigal gene 2620902 2621381 . - . ID=BALIOE_13310_gene;locus_tag=BALIOE_13310 | |
| 5335 c1 Prodigal CDS 2620902 2621381 . - 0 ID=BALIOE_13310;Name=hypothetical protein;locus_tag=BALIOE_13310;product=hypothetical protein;Parent=BALIOE_13310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5336 c1 Prodigal gene 2621387 2621887 . - . ID=BALIOE_13315_gene;locus_tag=BALIOE_13315 | |
| 5337 c1 Prodigal CDS 2621387 2621887 . - 0 ID=BALIOE_13315;Name=hypothetical protein;locus_tag=BALIOE_13315;product=hypothetical protein;Parent=BALIOE_13315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5338 c1 Prodigal gene 2621992 2622849 . - . ID=BALIOE_13320_gene;locus_tag=BALIOE_13320 | |
| 5339 c1 Prodigal CDS 2621992 2622849 . - 0 ID=BALIOE_13320;Name=hypothetical protein;locus_tag=BALIOE_13320;product=hypothetical protein;Parent=BALIOE_13320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5340 c1 Prodigal gene 2622880 2623431 . - . ID=BALIOE_13325_gene;locus_tag=BALIOE_13325 | |
| 5341 c1 Prodigal CDS 2622880 2623431 . - 0 ID=BALIOE_13325;Name=hypothetical protein;locus_tag=BALIOE_13325;product=hypothetical protein;Parent=BALIOE_13325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5342 c1 Prodigal gene 2623477 2624196 . - . ID=BALIOE_13330_gene;locus_tag=BALIOE_13330 | |
| 5343 c1 Prodigal CDS 2623477 2624196 . - 0 ID=BALIOE_13330;Name=hypothetical protein;locus_tag=BALIOE_13330;product=hypothetical protein;Parent=BALIOE_13330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5344 c1 Prodigal gene 2624516 2626273 . - . ID=BALIOE_13335_gene;locus_tag=BALIOE_13335 | |
| 5345 c1 Prodigal CDS 2624516 2626273 . - 0 ID=BALIOE_13335;Name=hypothetical protein;locus_tag=BALIOE_13335;product=hypothetical protein;Parent=BALIOE_13335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5346 c1 Prodigal gene 2626539 2627936 . + . ID=BALIOE_13340_gene;locus_tag=BALIOE_13340 | |
| 5347 c1 Prodigal CDS 2626539 2627936 . + 0 ID=BALIOE_13340;Name=hypothetical protein;locus_tag=BALIOE_13340;product=hypothetical protein;Parent=BALIOE_13340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5348 c1 Prodigal gene 2627961 2628371 . + . ID=BALIOE_13345_gene;locus_tag=BALIOE_13345 | |
| 5349 c1 Prodigal CDS 2627961 2628371 . + 0 ID=BALIOE_13345;Name=hypothetical protein;locus_tag=BALIOE_13345;product=hypothetical protein;Parent=BALIOE_13345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5350 c1 Prodigal gene 2628371 2628736 . + . ID=BALIOE_13350_gene;locus_tag=BALIOE_13350 | |
| 5351 c1 Prodigal CDS 2628371 2628736 . + 0 ID=BALIOE_13350;Name=hypothetical protein;locus_tag=BALIOE_13350;product=hypothetical protein;Parent=BALIOE_13350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5352 c1 Prodigal gene 2628814 2630301 . + . ID=BALIOE_13355_gene;locus_tag=BALIOE_13355 | |
| 5353 c1 Prodigal CDS 2628814 2630301 . + 0 ID=BALIOE_13355;Name=hypothetical protein;locus_tag=BALIOE_13355;product=hypothetical protein;Parent=BALIOE_13355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5354 c1 Prodigal gene 2630335 2630748 . - . ID=BALIOE_13360_gene;locus_tag=BALIOE_13360 | |
| 5355 c1 Prodigal CDS 2630335 2630748 . - 0 ID=BALIOE_13360;Name=hypothetical protein;locus_tag=BALIOE_13360;product=hypothetical protein;Parent=BALIOE_13360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5356 c1 Prodigal gene 2630935 2632140 . + . ID=BALIOE_13365_gene;locus_tag=BALIOE_13365 | |
| 5357 c1 Prodigal CDS 2630935 2632140 . + 0 ID=BALIOE_13365;Name=hypothetical protein;locus_tag=BALIOE_13365;product=hypothetical protein;Parent=BALIOE_13365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5358 c1 Prodigal gene 2632137 2632370 . + . ID=BALIOE_13370_gene;locus_tag=BALIOE_13370 | |
| 5359 c1 Prodigal CDS 2632137 2632370 . + 0 ID=BALIOE_13370;Name=hypothetical protein;locus_tag=BALIOE_13370;product=hypothetical protein;Parent=BALIOE_13370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5360 c1 Prodigal gene 2632479 2633147 . + . ID=BALIOE_13375_gene;locus_tag=BALIOE_13375 | |
| 5361 c1 Prodigal CDS 2632479 2633147 . + 0 ID=BALIOE_13375;Name=hypothetical protein;locus_tag=BALIOE_13375;product=hypothetical protein;Parent=BALIOE_13375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5362 c1 Prodigal gene 2633258 2633737 . + . ID=BALIOE_13380_gene;locus_tag=BALIOE_13380 | |
| 5363 c1 Prodigal CDS 2633258 2633737 . + 0 ID=BALIOE_13380;Name=hypothetical protein;locus_tag=BALIOE_13380;product=hypothetical protein;Parent=BALIOE_13380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5364 c1 Prodigal gene 2633875 2635014 . - . ID=BALIOE_13385_gene;locus_tag=BALIOE_13385 | |
| 5365 c1 Prodigal CDS 2633875 2635014 . - 0 ID=BALIOE_13385;Name=hypothetical protein;locus_tag=BALIOE_13385;product=hypothetical protein;Parent=BALIOE_13385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5366 c1 Prodigal gene 2635833 2636972 . - . ID=BALIOE_13390_gene;locus_tag=BALIOE_13390 | |
| 5367 c1 Prodigal CDS 2635833 2636972 . - 0 ID=BALIOE_13390;Name=hypothetical protein;locus_tag=BALIOE_13390;product=hypothetical protein;Parent=BALIOE_13390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5368 c1 Prodigal gene 2637321 2637635 . - . ID=BALIOE_13395_gene;locus_tag=BALIOE_13395 | |
| 5369 c1 Prodigal CDS 2637321 2637635 . - 0 ID=BALIOE_13395;Name=hypothetical protein;locus_tag=BALIOE_13395;product=hypothetical protein;Parent=BALIOE_13395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5370 c1 Prodigal gene 2637850 2639508 . + . ID=BALIOE_13400_gene;locus_tag=BALIOE_13400 | |
| 5371 c1 Prodigal CDS 2637850 2639508 . + 0 ID=BALIOE_13400;Name=hypothetical protein;locus_tag=BALIOE_13400;product=hypothetical protein;Parent=BALIOE_13400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5372 c1 Prodigal gene 2639501 2640496 . + . ID=BALIOE_13405_gene;locus_tag=BALIOE_13405 | |
| 5373 c1 Prodigal CDS 2639501 2640496 . + 0 ID=BALIOE_13405;Name=hypothetical protein;locus_tag=BALIOE_13405;product=hypothetical protein;Parent=BALIOE_13405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5374 c1 Prodigal gene 2640489 2641175 . + . ID=BALIOE_13410_gene;locus_tag=BALIOE_13410 | |
| 5375 c1 Prodigal CDS 2640489 2641175 . + 0 ID=BALIOE_13410;Name=hypothetical protein;locus_tag=BALIOE_13410;product=hypothetical protein;Parent=BALIOE_13410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5376 c1 Prodigal gene 2641237 2642610 . + . ID=BALIOE_13415_gene;locus_tag=BALIOE_13415 | |
| 5377 c1 Prodigal CDS 2641237 2642610 . + 0 ID=BALIOE_13415;Name=hypothetical protein;locus_tag=BALIOE_13415;product=hypothetical protein;Parent=BALIOE_13415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5378 c1 Prodigal gene 2642629 2643072 . + . ID=BALIOE_13420_gene;locus_tag=BALIOE_13420 | |
| 5379 c1 Prodigal CDS 2642629 2643072 . + 0 ID=BALIOE_13420;Name=hypothetical protein;locus_tag=BALIOE_13420;product=hypothetical protein;Parent=BALIOE_13420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5380 c1 Prodigal gene 2643069 2644196 . + . ID=BALIOE_13425_gene;locus_tag=BALIOE_13425 | |
| 5381 c1 Prodigal CDS 2643069 2644196 . + 0 ID=BALIOE_13425;Name=hypothetical protein;locus_tag=BALIOE_13425;product=hypothetical protein;Parent=BALIOE_13425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5382 c1 Prodigal gene 2644301 2644765 . + . ID=BALIOE_13430_gene;locus_tag=BALIOE_13430 | |
| 5383 c1 Prodigal CDS 2644301 2644765 . + 0 ID=BALIOE_13430;Name=hypothetical protein;locus_tag=BALIOE_13430;product=hypothetical protein;Parent=BALIOE_13430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5384 c1 Prodigal gene 2644770 2645774 . + . ID=BALIOE_13435_gene;locus_tag=BALIOE_13435 | |
| 5385 c1 Prodigal CDS 2644770 2645774 . + 0 ID=BALIOE_13435;Name=hypothetical protein;locus_tag=BALIOE_13435;product=hypothetical protein;Parent=BALIOE_13435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5386 c1 Prodigal gene 2645771 2646184 . + . ID=BALIOE_13440_gene;locus_tag=BALIOE_13440 | |
| 5387 c1 Prodigal CDS 2645771 2646184 . + 0 ID=BALIOE_13440;Name=hypothetical protein;locus_tag=BALIOE_13440;product=hypothetical protein;Parent=BALIOE_13440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5388 c1 Prodigal gene 2646187 2646552 . + . ID=BALIOE_13445_gene;locus_tag=BALIOE_13445 | |
| 5389 c1 Prodigal CDS 2646187 2646552 . + 0 ID=BALIOE_13445;Name=hypothetical protein;locus_tag=BALIOE_13445;product=hypothetical protein;Parent=BALIOE_13445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5390 c1 Prodigal gene 2646552 2647289 . + . ID=BALIOE_13450_gene;locus_tag=BALIOE_13450 | |
| 5391 c1 Prodigal CDS 2646552 2647289 . + 0 ID=BALIOE_13450;Name=hypothetical protein;locus_tag=BALIOE_13450;product=hypothetical protein;Parent=BALIOE_13450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5392 c1 Prodigal gene 2647299 2647568 . + . ID=BALIOE_13455_gene;locus_tag=BALIOE_13455 | |
| 5393 c1 Prodigal CDS 2647299 2647568 . + 0 ID=BALIOE_13455;Name=hypothetical protein;locus_tag=BALIOE_13455;product=hypothetical protein;Parent=BALIOE_13455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5394 c1 Prodigal gene 2647576 2648361 . + . ID=BALIOE_13460_gene;locus_tag=BALIOE_13460 | |
| 5395 c1 Prodigal CDS 2647576 2648361 . + 0 ID=BALIOE_13460;Name=hypothetical protein;locus_tag=BALIOE_13460;product=hypothetical protein;Parent=BALIOE_13460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5396 c1 Prodigal gene 2648651 2649274 . + . ID=BALIOE_13465_gene;locus_tag=BALIOE_13465 | |
| 5397 c1 Prodigal CDS 2648651 2649274 . + 0 ID=BALIOE_13465;Name=hypothetical protein;locus_tag=BALIOE_13465;product=hypothetical protein;Parent=BALIOE_13465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5398 c1 Prodigal gene 2649318 2649506 . - . ID=BALIOE_13470_gene;locus_tag=BALIOE_13470 | |
| 5399 c1 Prodigal CDS 2649318 2649506 . - 0 ID=BALIOE_13470;Name=hypothetical protein;locus_tag=BALIOE_13470;product=hypothetical protein;Parent=BALIOE_13470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5400 c1 Prodigal gene 2649669 2649896 . + . ID=BALIOE_13475_gene;locus_tag=BALIOE_13475 | |
| 5401 c1 Prodigal CDS 2649669 2649896 . + 0 ID=BALIOE_13475;Name=hypothetical protein;locus_tag=BALIOE_13475;product=hypothetical protein;Parent=BALIOE_13475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5402 c1 Prodigal gene 2650194 2651009 . + . ID=BALIOE_13480_gene;locus_tag=BALIOE_13480 | |
| 5403 c1 Prodigal CDS 2650194 2651009 . + 0 ID=BALIOE_13480;Name=hypothetical protein;locus_tag=BALIOE_13480;product=hypothetical protein;Parent=BALIOE_13480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5404 c1 Prodigal gene 2651006 2652700 . - . ID=BALIOE_13485_gene;locus_tag=BALIOE_13485 | |
| 5405 c1 Prodigal CDS 2651006 2652700 . - 0 ID=BALIOE_13485;Name=hypothetical protein;locus_tag=BALIOE_13485;product=hypothetical protein;Parent=BALIOE_13485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5406 c1 Prodigal gene 2652871 2653053 . - . ID=BALIOE_13490_gene;locus_tag=BALIOE_13490 | |
| 5407 c1 Prodigal CDS 2652871 2653053 . - 0 ID=BALIOE_13490;Name=hypothetical protein;locus_tag=BALIOE_13490;product=hypothetical protein;Parent=BALIOE_13490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5408 c1 Prodigal gene 2653132 2654049 . - . ID=BALIOE_13495_gene;locus_tag=BALIOE_13495 | |
| 5409 c1 Prodigal CDS 2653132 2654049 . - 0 ID=BALIOE_13495;Name=hypothetical protein;locus_tag=BALIOE_13495;product=hypothetical protein;Parent=BALIOE_13495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5410 c1 Prodigal gene 2654222 2655142 . + . ID=BALIOE_13500_gene;locus_tag=BALIOE_13500 | |
| 5411 c1 Prodigal CDS 2654222 2655142 . + 0 ID=BALIOE_13500;Name=hypothetical protein;locus_tag=BALIOE_13500;product=hypothetical protein;Parent=BALIOE_13500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5412 c1 Prodigal gene 2655131 2655601 . - . ID=BALIOE_13505_gene;locus_tag=BALIOE_13505 | |
| 5413 c1 Prodigal CDS 2655131 2655601 . - 0 ID=BALIOE_13505;Name=hypothetical protein;locus_tag=BALIOE_13505;product=hypothetical protein;Parent=BALIOE_13505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5414 c1 Prodigal gene 2655582 2657000 . - . ID=BALIOE_13510_gene;locus_tag=BALIOE_13510 | |
| 5415 c1 Prodigal CDS 2655582 2657000 . - 0 ID=BALIOE_13510;Name=hypothetical protein;locus_tag=BALIOE_13510;product=hypothetical protein;Parent=BALIOE_13510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5416 c1 Prodigal gene 2657067 2657762 . - . ID=BALIOE_13515_gene;locus_tag=BALIOE_13515 | |
| 5417 c1 Prodigal CDS 2657067 2657762 . - 0 ID=BALIOE_13515;Name=hypothetical protein;locus_tag=BALIOE_13515;product=hypothetical protein;Parent=BALIOE_13515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5418 c1 Prodigal gene 2658733 2659377 . + . ID=BALIOE_13520_gene;locus_tag=BALIOE_13520 | |
| 5419 c1 Prodigal CDS 2658733 2659377 . + 0 ID=BALIOE_13520;Name=hypothetical protein;locus_tag=BALIOE_13520;product=hypothetical protein;Parent=BALIOE_13520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5420 c1 Prodigal gene 2659344 2659919 . + . ID=BALIOE_13525_gene;locus_tag=BALIOE_13525 | |
| 5421 c1 Prodigal CDS 2659344 2659919 . + 0 ID=BALIOE_13525;Name=hypothetical protein;locus_tag=BALIOE_13525;product=hypothetical protein;Parent=BALIOE_13525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5422 c1 Prodigal gene 2660511 2661362 . + . ID=BALIOE_13530_gene;locus_tag=BALIOE_13530 | |
| 5423 c1 Prodigal CDS 2660511 2661362 . + 0 ID=BALIOE_13530;Name=hypothetical protein;locus_tag=BALIOE_13530;product=hypothetical protein;Parent=BALIOE_13530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5424 c1 Prodigal gene 2661470 2662828 . - . ID=BALIOE_13535_gene;locus_tag=BALIOE_13535 | |
| 5425 c1 Prodigal CDS 2661470 2662828 . - 0 ID=BALIOE_13535;Name=hypothetical protein;locus_tag=BALIOE_13535;product=hypothetical protein;Parent=BALIOE_13535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5426 c1 Prodigal gene 2662828 2663610 . - . ID=BALIOE_13540_gene;locus_tag=BALIOE_13540 | |
| 5427 c1 Prodigal CDS 2662828 2663610 . - 0 ID=BALIOE_13540;Name=hypothetical protein;locus_tag=BALIOE_13540;product=hypothetical protein;Parent=BALIOE_13540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5428 c1 Prodigal gene 2663632 2664045 . + . ID=BALIOE_13545_gene;locus_tag=BALIOE_13545 | |
| 5429 c1 Prodigal CDS 2663632 2664045 . + 0 ID=BALIOE_13545;Name=hypothetical protein;locus_tag=BALIOE_13545;product=hypothetical protein;Parent=BALIOE_13545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5430 c1 Prodigal gene 2664153 2665157 . + . ID=BALIOE_13550_gene;locus_tag=BALIOE_13550 | |
| 5431 c1 Prodigal CDS 2664153 2665157 . + 0 ID=BALIOE_13550;Name=hypothetical protein;locus_tag=BALIOE_13550;product=hypothetical protein;Parent=BALIOE_13550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5432 c1 Prodigal gene 2665158 2665793 . + . ID=BALIOE_13555_gene;locus_tag=BALIOE_13555 | |
| 5433 c1 Prodigal CDS 2665158 2665793 . + 0 ID=BALIOE_13555;Name=hypothetical protein;locus_tag=BALIOE_13555;product=hypothetical protein;Parent=BALIOE_13555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5434 c1 Prodigal gene 2666029 2666700 . + . ID=BALIOE_13560_gene;locus_tag=BALIOE_13560 | |
| 5435 c1 Prodigal CDS 2666029 2666700 . + 0 ID=BALIOE_13560;Name=hypothetical protein;locus_tag=BALIOE_13560;product=hypothetical protein;Parent=BALIOE_13560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5436 c1 Prodigal gene 2667043 2667573 . + . ID=BALIOE_13565_gene;locus_tag=BALIOE_13565 | |
| 5437 c1 Prodigal CDS 2667043 2667573 . + 0 ID=BALIOE_13565;Name=hypothetical protein;locus_tag=BALIOE_13565;product=hypothetical protein;Parent=BALIOE_13565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5438 c1 tRNAscan-SE gene 2668144 2668233 . - . ID=BALIOE_13570_gene;locus_tag=BALIOE_13570;pseudo=true | |
| 5439 c1 tRNAscan-SE tRNA 2668144 2668233 . - . ID=BALIOE_13570;Name=(pseudo) tRNA-Xxx;locus_tag=BALIOE_13570;product=(pseudo) tRNA-Xxx;pseudo=true;Parent=BALIOE_13570_gene;inference=profile:tRNAscan:2.0 | |
| 5440 c1 Prodigal gene 2668284 2668502 . + . ID=BALIOE_13575_gene;locus_tag=BALIOE_13575 | |
| 5441 c1 Prodigal CDS 2668284 2668502 . + 0 ID=BALIOE_13575;Name=hypothetical protein;locus_tag=BALIOE_13575;product=hypothetical protein;Parent=BALIOE_13575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5442 c1 Prodigal gene 2668710 2669363 . + . ID=BALIOE_13580_gene;locus_tag=BALIOE_13580 | |
| 5443 c1 Prodigal CDS 2668710 2669363 . + 0 ID=BALIOE_13580;Name=hypothetical protein;locus_tag=BALIOE_13580;product=hypothetical protein;Parent=BALIOE_13580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5444 c1 Prodigal gene 2669688 2670701 . + . ID=BALIOE_13585_gene;locus_tag=BALIOE_13585 | |
| 5445 c1 Prodigal CDS 2669688 2670701 . + 0 ID=BALIOE_13585;Name=hypothetical protein;locus_tag=BALIOE_13585;product=hypothetical protein;Parent=BALIOE_13585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5446 c1 Prodigal gene 2670827 2671096 . - . ID=BALIOE_13590_gene;locus_tag=BALIOE_13590 | |
| 5447 c1 Prodigal CDS 2670827 2671096 . - 0 ID=BALIOE_13590;Name=hypothetical protein;locus_tag=BALIOE_13590;product=hypothetical protein;Parent=BALIOE_13590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5448 c1 Prodigal gene 2671098 2672411 . - . ID=BALIOE_13595_gene;locus_tag=BALIOE_13595 | |
| 5449 c1 Prodigal CDS 2671098 2672411 . - 0 ID=BALIOE_13595;Name=hypothetical protein;locus_tag=BALIOE_13595;product=hypothetical protein;Parent=BALIOE_13595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5450 c1 Prodigal gene 2672476 2673075 . - . ID=BALIOE_13600_gene;locus_tag=BALIOE_13600 | |
| 5451 c1 Prodigal CDS 2672476 2673075 . - 0 ID=BALIOE_13600;Name=hypothetical protein;locus_tag=BALIOE_13600;product=hypothetical protein;Parent=BALIOE_13600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5452 c1 Prodigal gene 2673143 2675494 . - . ID=BALIOE_13605_gene;locus_tag=BALIOE_13605 | |
| 5453 c1 Prodigal CDS 2673143 2675494 . - 0 ID=BALIOE_13605;Name=hypothetical protein;locus_tag=BALIOE_13605;product=hypothetical protein;Parent=BALIOE_13605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5454 c1 Prodigal gene 2675446 2676621 . - . ID=BALIOE_13610_gene;locus_tag=BALIOE_13610 | |
| 5455 c1 Prodigal CDS 2675446 2676621 . - 0 ID=BALIOE_13610;Name=hypothetical protein;locus_tag=BALIOE_13610;product=hypothetical protein;Parent=BALIOE_13610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5456 c1 Prodigal gene 2676862 2677440 . - . ID=BALIOE_13615_gene;locus_tag=BALIOE_13615 | |
| 5457 c1 Prodigal CDS 2676862 2677440 . - 0 ID=BALIOE_13615;Name=hypothetical protein;locus_tag=BALIOE_13615;product=hypothetical protein;Parent=BALIOE_13615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5458 c1 Prodigal gene 2677437 2678180 . - . ID=BALIOE_13620_gene;locus_tag=BALIOE_13620 | |
| 5459 c1 Prodigal CDS 2677437 2678180 . - 0 ID=BALIOE_13620;Name=hypothetical protein;locus_tag=BALIOE_13620;product=hypothetical protein;Parent=BALIOE_13620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5460 c1 Prodigal gene 2678191 2678889 . - . ID=BALIOE_13625_gene;locus_tag=BALIOE_13625 | |
| 5461 c1 Prodigal CDS 2678191 2678889 . - 0 ID=BALIOE_13625;Name=hypothetical protein;locus_tag=BALIOE_13625;product=hypothetical protein;Parent=BALIOE_13625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5462 c1 Prodigal gene 2678889 2679218 . - . ID=BALIOE_13630_gene;locus_tag=BALIOE_13630 | |
| 5463 c1 Prodigal CDS 2678889 2679218 . - 0 ID=BALIOE_13630;Name=hypothetical protein;locus_tag=BALIOE_13630;product=hypothetical protein;Parent=BALIOE_13630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5464 c1 Prodigal gene 2679215 2679979 . - . ID=BALIOE_13635_gene;locus_tag=BALIOE_13635 | |
| 5465 c1 Prodigal CDS 2679215 2679979 . - 0 ID=BALIOE_13635;Name=hypothetical protein;locus_tag=BALIOE_13635;product=hypothetical protein;Parent=BALIOE_13635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5466 c1 Prodigal gene 2679931 2681793 . - . ID=BALIOE_13640_gene;locus_tag=BALIOE_13640 | |
| 5467 c1 Prodigal CDS 2679931 2681793 . - 0 ID=BALIOE_13640;Name=hypothetical protein;locus_tag=BALIOE_13640;product=hypothetical protein;Parent=BALIOE_13640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5468 c1 Prodigal gene 2681774 2682187 . - . ID=BALIOE_13645_gene;locus_tag=BALIOE_13645 | |
| 5469 c1 Prodigal CDS 2681774 2682187 . - 0 ID=BALIOE_13645;Name=hypothetical protein;locus_tag=BALIOE_13645;product=hypothetical protein;Parent=BALIOE_13645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5470 c1 Prodigal gene 2682214 2682645 . - . ID=BALIOE_13650_gene;locus_tag=BALIOE_13650 | |
| 5471 c1 Prodigal CDS 2682214 2682645 . - 0 ID=BALIOE_13650;Name=hypothetical protein;locus_tag=BALIOE_13650;product=hypothetical protein;Parent=BALIOE_13650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5472 c1 Prodigal gene 2682659 2683288 . - . ID=BALIOE_13655_gene;locus_tag=BALIOE_13655 | |
| 5473 c1 Prodigal CDS 2682659 2683288 . - 0 ID=BALIOE_13655;Name=hypothetical protein;locus_tag=BALIOE_13655;product=hypothetical protein;Parent=BALIOE_13655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5474 c1 Prodigal gene 2683381 2683647 . - . ID=BALIOE_13660_gene;locus_tag=BALIOE_13660 | |
| 5475 c1 Prodigal CDS 2683381 2683647 . - 0 ID=BALIOE_13660;Name=hypothetical protein;locus_tag=BALIOE_13660;product=hypothetical protein;Parent=BALIOE_13660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5476 c1 Prodigal gene 2683705 2684052 . - . ID=BALIOE_13665_gene;locus_tag=BALIOE_13665 | |
| 5477 c1 Prodigal CDS 2683705 2684052 . - 0 ID=BALIOE_13665;Name=hypothetical protein;locus_tag=BALIOE_13665;product=hypothetical protein;Parent=BALIOE_13665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5478 c1 Prodigal gene 2684089 2685594 . - . ID=BALIOE_13670_gene;locus_tag=BALIOE_13670 | |
| 5479 c1 Prodigal CDS 2684089 2685594 . - 0 ID=BALIOE_13670;Name=hypothetical protein;locus_tag=BALIOE_13670;product=hypothetical protein;Parent=BALIOE_13670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5480 c1 Prodigal gene 2685584 2687176 . - . ID=BALIOE_13675_gene;locus_tag=BALIOE_13675 | |
| 5481 c1 Prodigal CDS 2685584 2687176 . - 0 ID=BALIOE_13675;Name=hypothetical protein;locus_tag=BALIOE_13675;product=hypothetical protein;Parent=BALIOE_13675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5482 c1 Prodigal gene 2687173 2687379 . - . ID=BALIOE_13680_gene;locus_tag=BALIOE_13680 | |
| 5483 c1 Prodigal CDS 2687173 2687379 . - 0 ID=BALIOE_13680;Name=hypothetical protein;locus_tag=BALIOE_13680;product=hypothetical protein;Parent=BALIOE_13680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5484 c1 Prodigal gene 2687363 2689291 . - . ID=BALIOE_13685_gene;locus_tag=BALIOE_13685 | |
| 5485 c1 Prodigal CDS 2687363 2689291 . - 0 ID=BALIOE_13685;Name=hypothetical protein;locus_tag=BALIOE_13685;product=hypothetical protein;Parent=BALIOE_13685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5486 c1 Prodigal gene 2689263 2689772 . - . ID=BALIOE_13690_gene;locus_tag=BALIOE_13690 | |
| 5487 c1 Prodigal CDS 2689263 2689772 . - 0 ID=BALIOE_13690;Name=hypothetical protein;locus_tag=BALIOE_13690;product=hypothetical protein;Parent=BALIOE_13690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5488 c1 Prodigal gene 2690473 2690787 . - . ID=BALIOE_13695_gene;locus_tag=BALIOE_13695 | |
| 5489 c1 Prodigal CDS 2690473 2690787 . - 0 ID=BALIOE_13695;Name=hypothetical protein;locus_tag=BALIOE_13695;product=hypothetical protein;Parent=BALIOE_13695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5490 c1 Prodigal gene 2691252 2691719 . - . ID=BALIOE_13700_gene;locus_tag=BALIOE_13700 | |
| 5491 c1 Prodigal CDS 2691252 2691719 . - 0 ID=BALIOE_13700;Name=hypothetical protein;locus_tag=BALIOE_13700;product=hypothetical protein;Parent=BALIOE_13700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5492 c1 Prodigal gene 2691727 2691858 . - . ID=BALIOE_13705_gene;locus_tag=BALIOE_13705 | |
| 5493 c1 Prodigal CDS 2691727 2691858 . - 0 ID=BALIOE_13705;Name=hypothetical protein;locus_tag=BALIOE_13705;product=hypothetical protein;Parent=BALIOE_13705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5494 c1 Prodigal gene 2691871 2692053 . - . ID=BALIOE_13710_gene;locus_tag=BALIOE_13710 | |
| 5495 c1 Prodigal CDS 2691871 2692053 . - 0 ID=BALIOE_13710;Name=hypothetical protein;locus_tag=BALIOE_13710;product=hypothetical protein;Parent=BALIOE_13710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5496 c1 Prodigal gene 2692209 2692742 . - . ID=BALIOE_13715_gene;locus_tag=BALIOE_13715 | |
| 5497 c1 Prodigal CDS 2692209 2692742 . - 0 ID=BALIOE_13715;Name=hypothetical protein;locus_tag=BALIOE_13715;product=hypothetical protein;Parent=BALIOE_13715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5498 c1 Prodigal gene 2692793 2693137 . - . ID=BALIOE_13720_gene;locus_tag=BALIOE_13720 | |
| 5499 c1 Prodigal CDS 2692793 2693137 . - 0 ID=BALIOE_13720;Name=hypothetical protein;locus_tag=BALIOE_13720;product=hypothetical protein;Parent=BALIOE_13720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5500 c1 Prodigal gene 2693142 2693348 . - . ID=BALIOE_13725_gene;locus_tag=BALIOE_13725 | |
| 5501 c1 Prodigal CDS 2693142 2693348 . - 0 ID=BALIOE_13725;Name=hypothetical protein;locus_tag=BALIOE_13725;product=hypothetical protein;Parent=BALIOE_13725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5502 c1 Prodigal gene 2693668 2693994 . + . ID=BALIOE_13730_gene;locus_tag=BALIOE_13730 | |
| 5503 c1 Prodigal CDS 2693668 2693994 . + 0 ID=BALIOE_13730;Name=hypothetical protein;locus_tag=BALIOE_13730;product=hypothetical protein;Parent=BALIOE_13730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5504 c1 Prodigal gene 2693994 2694881 . + . ID=BALIOE_13735_gene;locus_tag=BALIOE_13735 | |
| 5505 c1 Prodigal CDS 2693994 2694881 . + 0 ID=BALIOE_13735;Name=hypothetical protein;locus_tag=BALIOE_13735;product=hypothetical protein;Parent=BALIOE_13735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5506 c1 Prodigal gene 2694963 2696813 . - . ID=BALIOE_13740_gene;locus_tag=BALIOE_13740 | |
| 5507 c1 Prodigal CDS 2694963 2696813 . - 0 ID=BALIOE_13740;Name=hypothetical protein;locus_tag=BALIOE_13740;product=hypothetical protein;Parent=BALIOE_13740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5508 c1 Prodigal gene 2697127 2697294 . - . ID=BALIOE_13745_gene;locus_tag=BALIOE_13745 | |
| 5509 c1 Prodigal CDS 2697127 2697294 . - 0 ID=BALIOE_13745;Name=hypothetical protein;locus_tag=BALIOE_13745;product=hypothetical protein;Parent=BALIOE_13745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5510 c1 Prodigal gene 2697291 2697719 . - . ID=BALIOE_13750_gene;locus_tag=BALIOE_13750 | |
| 5511 c1 Prodigal CDS 2697291 2697719 . - 0 ID=BALIOE_13750;Name=hypothetical protein;locus_tag=BALIOE_13750;product=hypothetical protein;Parent=BALIOE_13750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5512 c1 tRNAscan-SE gene 2697893 2697969 . - . ID=BALIOE_13755_gene;locus_tag=BALIOE_13755;gene=Arg_trna | |
| 5513 c1 tRNAscan-SE tRNA 2697893 2697969 . - . ID=BALIOE_13755;Name=tRNA-Arg;locus_tag=BALIOE_13755;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_13755_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 5514 c1 tRNAscan-SE gene 2697983 2698059 . - . ID=BALIOE_13760_gene;locus_tag=BALIOE_13760;gene=Arg_trna | |
| 5515 c1 tRNAscan-SE tRNA 2697983 2698059 . - . ID=BALIOE_13760;Name=tRNA-Arg;locus_tag=BALIOE_13760;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_13760_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 5516 c1 tRNAscan-SE gene 2698067 2698142 . - . ID=BALIOE_13765_gene;locus_tag=BALIOE_13765;gene=Ile2_trna | |
| 5517 c1 tRNAscan-SE tRNA 2698067 2698142 . - . ID=BALIOE_13765;Name=tRNA-Ile2;locus_tag=BALIOE_13765;product=tRNA-Ile2;gene=Ile2_trna;Parent=BALIOE_13765_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 5518 c1 Prodigal gene 2698353 2699042 . - . ID=BALIOE_13770_gene;locus_tag=BALIOE_13770 | |
| 5519 c1 Prodigal CDS 2698353 2699042 . - 0 ID=BALIOE_13770;Name=hypothetical protein;locus_tag=BALIOE_13770;product=hypothetical protein;Parent=BALIOE_13770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5520 c1 Prodigal gene 2699039 2699398 . - . ID=BALIOE_13775_gene;locus_tag=BALIOE_13775 | |
| 5521 c1 Prodigal CDS 2699039 2699398 . - 0 ID=BALIOE_13775;Name=hypothetical protein;locus_tag=BALIOE_13775;product=hypothetical protein;Parent=BALIOE_13775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5522 c1 Prodigal gene 2699411 2700460 . - . ID=BALIOE_13780_gene;locus_tag=BALIOE_13780 | |
| 5523 c1 Prodigal CDS 2699411 2700460 . - 0 ID=BALIOE_13780;Name=hypothetical protein;locus_tag=BALIOE_13780;product=hypothetical protein;Parent=BALIOE_13780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5524 c1 Prodigal gene 2700908 2701120 . - . ID=BALIOE_13785_gene;locus_tag=BALIOE_13785 | |
| 5525 c1 Prodigal CDS 2700908 2701120 . - 0 ID=BALIOE_13785;Name=hypothetical protein;locus_tag=BALIOE_13785;product=hypothetical protein;Parent=BALIOE_13785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5526 c1 Prodigal gene 2701307 2701411 . - . ID=BALIOE_13790_gene;locus_tag=BALIOE_13790 | |
| 5527 c1 Prodigal CDS 2701307 2701411 . - 0 ID=BALIOE_13790;Name=hypothetical protein;locus_tag=BALIOE_13790;product=hypothetical protein;Parent=BALIOE_13790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5528 c1 Prodigal gene 2701521 2702084 . - . ID=BALIOE_13795_gene;locus_tag=BALIOE_13795 | |
| 5529 c1 Prodigal CDS 2701521 2702084 . - 0 ID=BALIOE_13795;Name=hypothetical protein;locus_tag=BALIOE_13795;product=hypothetical protein;Parent=BALIOE_13795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5530 c1 Prodigal gene 2702211 2702522 . - . ID=BALIOE_13800_gene;locus_tag=BALIOE_13800 | |
| 5531 c1 Prodigal CDS 2702211 2702522 . - 0 ID=BALIOE_13800;Name=hypothetical protein;locus_tag=BALIOE_13800;product=hypothetical protein;Parent=BALIOE_13800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5532 c1 Prodigal gene 2702519 2702671 . - . ID=BALIOE_13805_gene;locus_tag=BALIOE_13805 | |
| 5533 c1 Prodigal CDS 2702519 2702671 . - 0 ID=BALIOE_13805;Name=hypothetical protein;locus_tag=BALIOE_13805;product=hypothetical protein;Parent=BALIOE_13805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5534 c1 Prodigal gene 2702704 2703060 . - . ID=BALIOE_13810_gene;locus_tag=BALIOE_13810 | |
| 5535 c1 Prodigal CDS 2702704 2703060 . - 0 ID=BALIOE_13810;Name=hypothetical protein;locus_tag=BALIOE_13810;product=hypothetical protein;Parent=BALIOE_13810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5536 c1 Prodigal gene 2703057 2703281 . - . ID=BALIOE_13815_gene;locus_tag=BALIOE_13815 | |
| 5537 c1 Prodigal CDS 2703057 2703281 . - 0 ID=BALIOE_13815;Name=hypothetical protein;locus_tag=BALIOE_13815;product=hypothetical protein;Parent=BALIOE_13815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5538 c1 Prodigal gene 2703303 2704001 . - . ID=BALIOE_13820_gene;locus_tag=BALIOE_13820 | |
| 5539 c1 Prodigal CDS 2703303 2704001 . - 0 ID=BALIOE_13820;Name=hypothetical protein;locus_tag=BALIOE_13820;product=hypothetical protein;Parent=BALIOE_13820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5540 c1 Prodigal gene 2704036 2704458 . - . ID=BALIOE_13825_gene;locus_tag=BALIOE_13825 | |
| 5541 c1 Prodigal CDS 2704036 2704458 . - 0 ID=BALIOE_13825;Name=hypothetical protein;locus_tag=BALIOE_13825;product=hypothetical protein;Parent=BALIOE_13825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5542 c1 Prodigal gene 2704490 2705527 . - . ID=BALIOE_13830_gene;locus_tag=BALIOE_13830 | |
| 5543 c1 Prodigal CDS 2704490 2705527 . - 0 ID=BALIOE_13830;Name=hypothetical protein;locus_tag=BALIOE_13830;product=hypothetical protein;Parent=BALIOE_13830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5544 c1 Prodigal gene 2705596 2706021 . - . ID=BALIOE_13835_gene;locus_tag=BALIOE_13835 | |
| 5545 c1 Prodigal CDS 2705596 2706021 . - 0 ID=BALIOE_13835;Name=hypothetical protein;locus_tag=BALIOE_13835;product=hypothetical protein;Parent=BALIOE_13835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5546 c1 Prodigal gene 2706018 2706245 . - . ID=BALIOE_13840_gene;locus_tag=BALIOE_13840 | |
| 5547 c1 Prodigal CDS 2706018 2706245 . - 0 ID=BALIOE_13840;Name=hypothetical protein;locus_tag=BALIOE_13840;product=hypothetical protein;Parent=BALIOE_13840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5548 c1 Prodigal gene 2706343 2706987 . + . ID=BALIOE_13845_gene;locus_tag=BALIOE_13845 | |
| 5549 c1 Prodigal CDS 2706343 2706987 . + 0 ID=BALIOE_13845;Name=hypothetical protein;locus_tag=BALIOE_13845;product=hypothetical protein;Parent=BALIOE_13845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5550 c1 Prodigal gene 2707262 2707414 . + . ID=BALIOE_13850_gene;locus_tag=BALIOE_13850 | |
| 5551 c1 Prodigal CDS 2707262 2707414 . + 0 ID=BALIOE_13850;Name=hypothetical protein;locus_tag=BALIOE_13850;product=hypothetical protein;Parent=BALIOE_13850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5552 c1 Prodigal gene 2707895 2708083 . + . ID=BALIOE_13855_gene;locus_tag=BALIOE_13855 | |
| 5553 c1 Prodigal CDS 2707895 2708083 . + 0 ID=BALIOE_13855;Name=hypothetical protein;locus_tag=BALIOE_13855;product=hypothetical protein;Parent=BALIOE_13855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5554 c1 Prodigal gene 2708080 2708268 . + . ID=BALIOE_13860_gene;locus_tag=BALIOE_13860 | |
| 5555 c1 Prodigal CDS 2708080 2708268 . + 0 ID=BALIOE_13860;Name=hypothetical protein;locus_tag=BALIOE_13860;product=hypothetical protein;Parent=BALIOE_13860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5556 c1 Prodigal gene 2708364 2710835 . + . ID=BALIOE_13865_gene;locus_tag=BALIOE_13865 | |
| 5557 c1 Prodigal CDS 2708364 2710835 . + 0 ID=BALIOE_13865;Name=hypothetical protein;locus_tag=BALIOE_13865;product=hypothetical protein;Parent=BALIOE_13865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5558 c1 Prodigal gene 2710894 2711097 . + . ID=BALIOE_13870_gene;locus_tag=BALIOE_13870 | |
| 5559 c1 Prodigal CDS 2710894 2711097 . + 0 ID=BALIOE_13870;Name=hypothetical protein;locus_tag=BALIOE_13870;product=hypothetical protein;Parent=BALIOE_13870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5560 c1 Prodigal gene 2711097 2712119 . + . ID=BALIOE_13875_gene;locus_tag=BALIOE_13875 | |
| 5561 c1 Prodigal CDS 2711097 2712119 . + 0 ID=BALIOE_13875;Name=hypothetical protein;locus_tag=BALIOE_13875;product=hypothetical protein;Parent=BALIOE_13875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5562 c1 tRNAscan-SE gene 2712172 2712261 . - . ID=BALIOE_13880_gene;locus_tag=BALIOE_13880;gene=Ser_trna | |
| 5563 c1 tRNAscan-SE tRNA 2712172 2712261 . - . ID=BALIOE_13880;Name=tRNA-Ser;locus_tag=BALIOE_13880;product=tRNA-Ser;gene=Ser_trna;Parent=BALIOE_13880_gene;inference=profile:tRNAscan:2.0;Note=SO:0000269 | |
| 5564 c1 Prodigal gene 2712355 2713152 . + . ID=BALIOE_13885_gene;locus_tag=BALIOE_13885 | |
| 5565 c1 Prodigal CDS 2712355 2713152 . + 0 ID=BALIOE_13885;Name=hypothetical protein;locus_tag=BALIOE_13885;product=hypothetical protein;Parent=BALIOE_13885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5566 c1 tRNAscan-SE gene 2713253 2713328 . + . ID=BALIOE_13890_gene;locus_tag=BALIOE_13890;gene=Asn_trna | |
| 5567 c1 tRNAscan-SE tRNA 2713253 2713328 . + . ID=BALIOE_13890;Name=tRNA-Asn;locus_tag=BALIOE_13890;product=tRNA-Asn;gene=Asn_trna;Parent=BALIOE_13890_gene;inference=profile:tRNAscan:2.0;Note=SO:0000257 | |
| 5568 c1 Prodigal gene 2713452 2713601 . + . ID=BALIOE_13895_gene;locus_tag=BALIOE_13895 | |
| 5569 c1 Prodigal CDS 2713452 2713601 . + 0 ID=BALIOE_13895;Name=hypothetical protein;locus_tag=BALIOE_13895;product=hypothetical protein;Parent=BALIOE_13895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5570 c1 Prodigal gene 2713615 2717622 . + . ID=BALIOE_13900_gene;locus_tag=BALIOE_13900 | |
| 5571 c1 Prodigal CDS 2713615 2717622 . + 0 ID=BALIOE_13900;Name=hypothetical protein;locus_tag=BALIOE_13900;product=hypothetical protein;Parent=BALIOE_13900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5572 c1 Prodigal gene 2717588 2721625 . + . ID=BALIOE_13905_gene;locus_tag=BALIOE_13905 | |
| 5573 c1 Prodigal CDS 2717588 2721625 . + 0 ID=BALIOE_13905;Name=hypothetical protein;locus_tag=BALIOE_13905;product=hypothetical protein;Parent=BALIOE_13905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5574 c1 Prodigal gene 2721887 2722939 . - . ID=BALIOE_13910_gene;locus_tag=BALIOE_13910 | |
| 5575 c1 Prodigal CDS 2721887 2722939 . - 0 ID=BALIOE_13910;Name=hypothetical protein;locus_tag=BALIOE_13910;product=hypothetical protein;Parent=BALIOE_13910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5576 c1 Prodigal gene 2723253 2724569 . + . ID=BALIOE_13915_gene;locus_tag=BALIOE_13915 | |
| 5577 c1 Prodigal CDS 2723253 2724569 . + 0 ID=BALIOE_13915;Name=hypothetical protein;locus_tag=BALIOE_13915;product=hypothetical protein;Parent=BALIOE_13915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5578 c1 Prodigal gene 2724671 2726125 . + . ID=BALIOE_13920_gene;locus_tag=BALIOE_13920 | |
| 5579 c1 Prodigal CDS 2724671 2726125 . + 0 ID=BALIOE_13920;Name=hypothetical protein;locus_tag=BALIOE_13920;product=hypothetical protein;Parent=BALIOE_13920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5580 c1 Prodigal gene 2726468 2727184 . + . ID=BALIOE_13925_gene;locus_tag=BALIOE_13925 | |
| 5581 c1 Prodigal CDS 2726468 2727184 . + 0 ID=BALIOE_13925;Name=hypothetical protein;locus_tag=BALIOE_13925;product=hypothetical protein;Parent=BALIOE_13925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5582 c1 tRNAscan-SE gene 2727634 2727709 . - . ID=BALIOE_13930_gene;locus_tag=BALIOE_13930;gene=Asn_trna | |
| 5583 c1 tRNAscan-SE tRNA 2727634 2727709 . - . ID=BALIOE_13930;Name=tRNA-Asn;locus_tag=BALIOE_13930;product=tRNA-Asn;gene=Asn_trna;Parent=BALIOE_13930_gene;inference=profile:tRNAscan:2.0;Note=SO:0000257 | |
| 5584 c1 Prodigal gene 2728158 2729264 . - . ID=BALIOE_13935_gene;locus_tag=BALIOE_13935 | |
| 5585 c1 Prodigal CDS 2728158 2729264 . - 0 ID=BALIOE_13935;Name=hypothetical protein;locus_tag=BALIOE_13935;product=hypothetical protein;Parent=BALIOE_13935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5586 c1 tRNAscan-SE gene 2729458 2729533 . + . ID=BALIOE_13940_gene;locus_tag=BALIOE_13940;gene=Asn_trna | |
| 5587 c1 tRNAscan-SE tRNA 2729458 2729533 . + . ID=BALIOE_13940;Name=tRNA-Asn;locus_tag=BALIOE_13940;product=tRNA-Asn;gene=Asn_trna;Parent=BALIOE_13940_gene;inference=profile:tRNAscan:2.0;Note=SO:0000257 | |
| 5588 c1 Prodigal gene 2729571 2730521 . - . ID=BALIOE_13945_gene;locus_tag=BALIOE_13945 | |
| 5589 c1 Prodigal CDS 2729571 2730521 . - 0 ID=BALIOE_13945;Name=hypothetical protein;locus_tag=BALIOE_13945;product=hypothetical protein;Parent=BALIOE_13945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5590 c1 Prodigal gene 2730623 2731540 . - . ID=BALIOE_13950_gene;locus_tag=BALIOE_13950 | |
| 5591 c1 Prodigal CDS 2730623 2731540 . - 0 ID=BALIOE_13950;Name=hypothetical protein;locus_tag=BALIOE_13950;product=hypothetical protein;Parent=BALIOE_13950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5592 c1 tRNAscan-SE gene 2731866 2731941 . + . ID=BALIOE_13955_gene;locus_tag=BALIOE_13955;gene=Asn_trna | |
| 5593 c1 tRNAscan-SE tRNA 2731866 2731941 . + . ID=BALIOE_13955;Name=tRNA-Asn;locus_tag=BALIOE_13955;product=tRNA-Asn;gene=Asn_trna;Parent=BALIOE_13955_gene;inference=profile:tRNAscan:2.0;Note=SO:0000257 | |
| 5594 c1 Prodigal gene 2731997 2732932 . - . ID=BALIOE_13960_gene;locus_tag=BALIOE_13960 | |
| 5595 c1 Prodigal CDS 2731997 2732932 . - 0 ID=BALIOE_13960;Name=hypothetical protein;locus_tag=BALIOE_13960;product=hypothetical protein;Parent=BALIOE_13960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5596 c1 Prodigal gene 2732994 2734073 . - . ID=BALIOE_13965_gene;locus_tag=BALIOE_13965 | |
| 5597 c1 Prodigal CDS 2732994 2734073 . - 0 ID=BALIOE_13965;Name=hypothetical protein;locus_tag=BALIOE_13965;product=hypothetical protein;Parent=BALIOE_13965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5598 c1 Prodigal gene 2734085 2734828 . - . ID=BALIOE_13970_gene;locus_tag=BALIOE_13970 | |
| 5599 c1 Prodigal CDS 2734085 2734828 . - 0 ID=BALIOE_13970;Name=hypothetical protein;locus_tag=BALIOE_13970;product=hypothetical protein;Parent=BALIOE_13970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5600 c1 Prodigal gene 2734825 2735367 . - . ID=BALIOE_13975_gene;locus_tag=BALIOE_13975 | |
| 5601 c1 Prodigal CDS 2734825 2735367 . - 0 ID=BALIOE_13975;Name=hypothetical protein;locus_tag=BALIOE_13975;product=hypothetical protein;Parent=BALIOE_13975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5602 c1 Prodigal gene 2735732 2736112 . + . ID=BALIOE_13980_gene;locus_tag=BALIOE_13980 | |
| 5603 c1 Prodigal CDS 2735732 2736112 . + 0 ID=BALIOE_13980;Name=hypothetical protein;locus_tag=BALIOE_13980;product=hypothetical protein;Parent=BALIOE_13980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5604 c1 Prodigal gene 2736109 2736456 . + . ID=BALIOE_13985_gene;locus_tag=BALIOE_13985 | |
| 5605 c1 Prodigal CDS 2736109 2736456 . + 0 ID=BALIOE_13985;Name=hypothetical protein;locus_tag=BALIOE_13985;product=hypothetical protein;Parent=BALIOE_13985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5606 c1 Prodigal gene 2736506 2738044 . + . ID=BALIOE_13990_gene;locus_tag=BALIOE_13990 | |
| 5607 c1 Prodigal CDS 2736506 2738044 . + 0 ID=BALIOE_13990;Name=hypothetical protein;locus_tag=BALIOE_13990;product=hypothetical protein;Parent=BALIOE_13990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5608 c1 Prodigal gene 2739492 2741639 . + . ID=BALIOE_13995_gene;locus_tag=BALIOE_13995 | |
| 5609 c1 Prodigal CDS 2739492 2741639 . + 0 ID=BALIOE_13995;Name=hypothetical protein;locus_tag=BALIOE_13995;product=hypothetical protein;Parent=BALIOE_13995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5610 c1 Prodigal gene 2741627 2741755 . + . ID=BALIOE_14000_gene;locus_tag=BALIOE_14000 | |
| 5611 c1 Prodigal CDS 2741627 2741755 . + 0 ID=BALIOE_14000;Name=hypothetical protein;locus_tag=BALIOE_14000;product=hypothetical protein;Parent=BALIOE_14000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5612 c1 Prodigal gene 2742011 2742337 . + . ID=BALIOE_14005_gene;locus_tag=BALIOE_14005 | |
| 5613 c1 Prodigal CDS 2742011 2742337 . + 0 ID=BALIOE_14005;Name=hypothetical protein;locus_tag=BALIOE_14005;product=hypothetical protein;Parent=BALIOE_14005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5614 c1 Prodigal gene 2742337 2743224 . + . ID=BALIOE_14010_gene;locus_tag=BALIOE_14010 | |
| 5615 c1 Prodigal CDS 2742337 2743224 . + 0 ID=BALIOE_14010;Name=hypothetical protein;locus_tag=BALIOE_14010;product=hypothetical protein;Parent=BALIOE_14010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5616 c1 Prodigal gene 2743190 2744089 . + . ID=BALIOE_14015_gene;locus_tag=BALIOE_14015 | |
| 5617 c1 Prodigal CDS 2743190 2744089 . + 0 ID=BALIOE_14015;Name=hypothetical protein;locus_tag=BALIOE_14015;product=hypothetical protein;Parent=BALIOE_14015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5618 c1 Prodigal gene 2744086 2744991 . + . ID=BALIOE_14020_gene;locus_tag=BALIOE_14020 | |
| 5619 c1 Prodigal CDS 2744086 2744991 . + 0 ID=BALIOE_14020;Name=hypothetical protein;locus_tag=BALIOE_14020;product=hypothetical protein;Parent=BALIOE_14020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5620 c1 Prodigal gene 2744988 2746058 . + . ID=BALIOE_14025_gene;locus_tag=BALIOE_14025 | |
| 5621 c1 Prodigal CDS 2744988 2746058 . + 0 ID=BALIOE_14025;Name=hypothetical protein;locus_tag=BALIOE_14025;product=hypothetical protein;Parent=BALIOE_14025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5622 c1 Prodigal gene 2746194 2746877 . + . ID=BALIOE_14030_gene;locus_tag=BALIOE_14030 | |
| 5623 c1 Prodigal CDS 2746194 2746877 . + 0 ID=BALIOE_14030;Name=hypothetical protein;locus_tag=BALIOE_14030;product=hypothetical protein;Parent=BALIOE_14030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5624 c1 Prodigal gene 2746893 2747303 . + . ID=BALIOE_14035_gene;locus_tag=BALIOE_14035 | |
| 5625 c1 Prodigal CDS 2746893 2747303 . + 0 ID=BALIOE_14035;Name=hypothetical protein;locus_tag=BALIOE_14035;product=hypothetical protein;Parent=BALIOE_14035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5626 c1 Prodigal gene 2747524 2748345 . + . ID=BALIOE_14040_gene;locus_tag=BALIOE_14040 | |
| 5627 c1 Prodigal CDS 2747524 2748345 . + 0 ID=BALIOE_14040;Name=hypothetical protein;locus_tag=BALIOE_14040;product=hypothetical protein;Parent=BALIOE_14040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5628 c1 Prodigal gene 2748427 2748906 . + . ID=BALIOE_14045_gene;locus_tag=BALIOE_14045 | |
| 5629 c1 Prodigal CDS 2748427 2748906 . + 0 ID=BALIOE_14045;Name=hypothetical protein;locus_tag=BALIOE_14045;product=hypothetical protein;Parent=BALIOE_14045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5630 c1 Prodigal gene 2748921 2749397 . + . ID=BALIOE_14050_gene;locus_tag=BALIOE_14050 | |
| 5631 c1 Prodigal CDS 2748921 2749397 . + 0 ID=BALIOE_14050;Name=hypothetical protein;locus_tag=BALIOE_14050;product=hypothetical protein;Parent=BALIOE_14050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5632 c1 Prodigal gene 2749460 2749681 . + . ID=BALIOE_14055_gene;locus_tag=BALIOE_14055 | |
| 5633 c1 Prodigal CDS 2749460 2749681 . + 0 ID=BALIOE_14055;Name=hypothetical protein;locus_tag=BALIOE_14055;product=hypothetical protein;Parent=BALIOE_14055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5634 c1 Prodigal gene 2749755 2750123 . + . ID=BALIOE_14060_gene;locus_tag=BALIOE_14060 | |
| 5635 c1 Prodigal CDS 2749755 2750123 . + 0 ID=BALIOE_14060;Name=hypothetical protein;locus_tag=BALIOE_14060;product=hypothetical protein;Parent=BALIOE_14060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5636 c1 Prodigal gene 2750212 2750475 . + . ID=BALIOE_14065_gene;locus_tag=BALIOE_14065 | |
| 5637 c1 Prodigal CDS 2750212 2750475 . + 0 ID=BALIOE_14065;Name=hypothetical protein;locus_tag=BALIOE_14065;product=hypothetical protein;Parent=BALIOE_14065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5638 c1 Prodigal gene 2750582 2750776 . + . ID=BALIOE_14070_gene;locus_tag=BALIOE_14070 | |
| 5639 c1 Prodigal CDS 2750582 2750776 . + 0 ID=BALIOE_14070;Name=hypothetical protein;locus_tag=BALIOE_14070;product=hypothetical protein;Parent=BALIOE_14070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5640 c1 Prodigal gene 2751674 2752003 . - . ID=BALIOE_14075_gene;locus_tag=BALIOE_14075 | |
| 5641 c1 Prodigal CDS 2751674 2752003 . - 0 ID=BALIOE_14075;Name=hypothetical protein;locus_tag=BALIOE_14075;product=hypothetical protein;Parent=BALIOE_14075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5642 c1 Prodigal gene 2752175 2753233 . - . ID=BALIOE_14080_gene;locus_tag=BALIOE_14080 | |
| 5643 c1 Prodigal CDS 2752175 2753233 . - 0 ID=BALIOE_14080;Name=hypothetical protein;locus_tag=BALIOE_14080;product=hypothetical protein;Parent=BALIOE_14080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5644 c1 Prodigal gene 2753432 2753905 . - . ID=BALIOE_14085_gene;locus_tag=BALIOE_14085 | |
| 5645 c1 Prodigal CDS 2753432 2753905 . - 0 ID=BALIOE_14085;Name=hypothetical protein;locus_tag=BALIOE_14085;product=hypothetical protein;Parent=BALIOE_14085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5646 c1 Prodigal gene 2754024 2755190 . - . ID=BALIOE_14090_gene;locus_tag=BALIOE_14090 | |
| 5647 c1 Prodigal CDS 2754024 2755190 . - 0 ID=BALIOE_14090;Name=hypothetical protein;locus_tag=BALIOE_14090;product=hypothetical protein;Parent=BALIOE_14090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5648 c1 Prodigal gene 2755399 2756826 . + . ID=BALIOE_14095_gene;locus_tag=BALIOE_14095 | |
| 5649 c1 Prodigal CDS 2755399 2756826 . + 0 ID=BALIOE_14095;Name=hypothetical protein;locus_tag=BALIOE_14095;product=hypothetical protein;Parent=BALIOE_14095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5650 c1 Prodigal gene 2756869 2757096 . - . ID=BALIOE_14100_gene;locus_tag=BALIOE_14100 | |
| 5651 c1 Prodigal CDS 2756869 2757096 . - 0 ID=BALIOE_14100;Name=hypothetical protein;locus_tag=BALIOE_14100;product=hypothetical protein;Parent=BALIOE_14100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5652 c1 Prodigal gene 2757110 2758114 . - . ID=BALIOE_14105_gene;locus_tag=BALIOE_14105 | |
| 5653 c1 Prodigal CDS 2757110 2758114 . - 0 ID=BALIOE_14105;Name=hypothetical protein;locus_tag=BALIOE_14105;product=hypothetical protein;Parent=BALIOE_14105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5654 c1 Prodigal gene 2758347 2759705 . - . ID=BALIOE_14110_gene;locus_tag=BALIOE_14110 | |
| 5655 c1 Prodigal CDS 2758347 2759705 . - 0 ID=BALIOE_14110;Name=hypothetical protein;locus_tag=BALIOE_14110;product=hypothetical protein;Parent=BALIOE_14110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5656 c1 Prodigal gene 2759972 2760922 . - . ID=BALIOE_14115_gene;locus_tag=BALIOE_14115 | |
| 5657 c1 Prodigal CDS 2759972 2760922 . - 0 ID=BALIOE_14115;Name=hypothetical protein;locus_tag=BALIOE_14115;product=hypothetical protein;Parent=BALIOE_14115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5658 c1 Prodigal gene 2760947 2761771 . - . ID=BALIOE_14120_gene;locus_tag=BALIOE_14120 | |
| 5659 c1 Prodigal CDS 2760947 2761771 . - 0 ID=BALIOE_14120;Name=hypothetical protein;locus_tag=BALIOE_14120;product=hypothetical protein;Parent=BALIOE_14120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5660 c1 Prodigal gene 2762393 2763292 . + . ID=BALIOE_14125_gene;locus_tag=BALIOE_14125 | |
| 5661 c1 Prodigal CDS 2762393 2763292 . + 0 ID=BALIOE_14125;Name=hypothetical protein;locus_tag=BALIOE_14125;product=hypothetical protein;Parent=BALIOE_14125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5662 c1 Prodigal gene 2763298 2764602 . + . ID=BALIOE_14130_gene;locus_tag=BALIOE_14130 | |
| 5663 c1 Prodigal CDS 2763298 2764602 . + 0 ID=BALIOE_14130;Name=hypothetical protein;locus_tag=BALIOE_14130;product=hypothetical protein;Parent=BALIOE_14130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5664 c1 Prodigal gene 2764599 2765669 . + . ID=BALIOE_14135_gene;locus_tag=BALIOE_14135 | |
| 5665 c1 Prodigal CDS 2764599 2765669 . + 0 ID=BALIOE_14135;Name=hypothetical protein;locus_tag=BALIOE_14135;product=hypothetical protein;Parent=BALIOE_14135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5666 c1 Prodigal gene 2765669 2766736 . + . ID=BALIOE_14140_gene;locus_tag=BALIOE_14140 | |
| 5667 c1 Prodigal CDS 2765669 2766736 . + 0 ID=BALIOE_14140;Name=hypothetical protein;locus_tag=BALIOE_14140;product=hypothetical protein;Parent=BALIOE_14140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5668 c1 Prodigal gene 2766736 2767326 . + . ID=BALIOE_14145_gene;locus_tag=BALIOE_14145 | |
| 5669 c1 Prodigal CDS 2766736 2767326 . + 0 ID=BALIOE_14145;Name=hypothetical protein;locus_tag=BALIOE_14145;product=hypothetical protein;Parent=BALIOE_14145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5670 c1 Prodigal gene 2767326 2768063 . + . ID=BALIOE_14150_gene;locus_tag=BALIOE_14150 | |
| 5671 c1 Prodigal CDS 2767326 2768063 . + 0 ID=BALIOE_14150;Name=hypothetical protein;locus_tag=BALIOE_14150;product=hypothetical protein;Parent=BALIOE_14150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5672 c1 Prodigal gene 2768045 2768821 . + . ID=BALIOE_14155_gene;locus_tag=BALIOE_14155 | |
| 5673 c1 Prodigal CDS 2768045 2768821 . + 0 ID=BALIOE_14155;Name=hypothetical protein;locus_tag=BALIOE_14155;product=hypothetical protein;Parent=BALIOE_14155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5674 c1 Prodigal gene 2768815 2769426 . + . ID=BALIOE_14160_gene;locus_tag=BALIOE_14160 | |
| 5675 c1 Prodigal CDS 2768815 2769426 . + 0 ID=BALIOE_14160;Name=hypothetical protein;locus_tag=BALIOE_14160;product=hypothetical protein;Parent=BALIOE_14160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5676 c1 Prodigal gene 2769523 2770500 . - . ID=BALIOE_14165_gene;locus_tag=BALIOE_14165 | |
| 5677 c1 Prodigal CDS 2769523 2770500 . - 0 ID=BALIOE_14165;Name=hypothetical protein;locus_tag=BALIOE_14165;product=hypothetical protein;Parent=BALIOE_14165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5678 c1 Prodigal gene 2770646 2771812 . - . ID=BALIOE_14170_gene;locus_tag=BALIOE_14170 | |
| 5679 c1 Prodigal CDS 2770646 2771812 . - 0 ID=BALIOE_14170;Name=hypothetical protein;locus_tag=BALIOE_14170;product=hypothetical protein;Parent=BALIOE_14170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5680 c1 Prodigal gene 2772061 2773467 . - . ID=BALIOE_14175_gene;locus_tag=BALIOE_14175 | |
| 5681 c1 Prodigal CDS 2772061 2773467 . - 0 ID=BALIOE_14175;Name=hypothetical protein;locus_tag=BALIOE_14175;product=hypothetical protein;Parent=BALIOE_14175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5682 c1 Prodigal gene 2773668 2774333 . - . ID=BALIOE_14180_gene;locus_tag=BALIOE_14180 | |
| 5683 c1 Prodigal CDS 2773668 2774333 . - 0 ID=BALIOE_14180;Name=hypothetical protein;locus_tag=BALIOE_14180;product=hypothetical protein;Parent=BALIOE_14180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5684 c1 Prodigal gene 2775596 2776966 . - . ID=BALIOE_14185_gene;locus_tag=BALIOE_14185 | |
| 5685 c1 Prodigal CDS 2775596 2776966 . - 0 ID=BALIOE_14185;Name=hypothetical protein;locus_tag=BALIOE_14185;product=hypothetical protein;Parent=BALIOE_14185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5686 c1 Prodigal gene 2776970 2778418 . - . ID=BALIOE_14190_gene;locus_tag=BALIOE_14190 | |
| 5687 c1 Prodigal CDS 2776970 2778418 . - 0 ID=BALIOE_14190;Name=hypothetical protein;locus_tag=BALIOE_14190;product=hypothetical protein;Parent=BALIOE_14190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5688 c1 Prodigal gene 2778400 2778909 . - . ID=BALIOE_14195_gene;locus_tag=BALIOE_14195 | |
| 5689 c1 Prodigal CDS 2778400 2778909 . - 0 ID=BALIOE_14195;Name=hypothetical protein;locus_tag=BALIOE_14195;product=hypothetical protein;Parent=BALIOE_14195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5690 c1 Prodigal gene 2778912 2779877 . - . ID=BALIOE_14200_gene;locus_tag=BALIOE_14200 | |
| 5691 c1 Prodigal CDS 2778912 2779877 . - 0 ID=BALIOE_14200;Name=hypothetical protein;locus_tag=BALIOE_14200;product=hypothetical protein;Parent=BALIOE_14200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5692 c1 Prodigal gene 2779880 2780998 . - . ID=BALIOE_14205_gene;locus_tag=BALIOE_14205 | |
| 5693 c1 Prodigal CDS 2779880 2780998 . - 0 ID=BALIOE_14205;Name=hypothetical protein;locus_tag=BALIOE_14205;product=hypothetical protein;Parent=BALIOE_14205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5694 c1 Prodigal gene 2781018 2782232 . - . ID=BALIOE_14210_gene;locus_tag=BALIOE_14210 | |
| 5695 c1 Prodigal CDS 2781018 2782232 . - 0 ID=BALIOE_14210;Name=hypothetical protein;locus_tag=BALIOE_14210;product=hypothetical protein;Parent=BALIOE_14210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5696 c1 Prodigal gene 2782257 2783351 . - . ID=BALIOE_14215_gene;locus_tag=BALIOE_14215 | |
| 5697 c1 Prodigal CDS 2782257 2783351 . - 0 ID=BALIOE_14215;Name=hypothetical protein;locus_tag=BALIOE_14215;product=hypothetical protein;Parent=BALIOE_14215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5698 c1 Prodigal gene 2783354 2784745 . - . ID=BALIOE_14220_gene;locus_tag=BALIOE_14220 | |
| 5699 c1 Prodigal CDS 2783354 2784745 . - 0 ID=BALIOE_14220;Name=hypothetical protein;locus_tag=BALIOE_14220;product=hypothetical protein;Parent=BALIOE_14220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5700 c1 Prodigal gene 2784732 2785478 . - . ID=BALIOE_14225_gene;locus_tag=BALIOE_14225 | |
| 5701 c1 Prodigal CDS 2784732 2785478 . - 0 ID=BALIOE_14225;Name=hypothetical protein;locus_tag=BALIOE_14225;product=hypothetical protein;Parent=BALIOE_14225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5702 c1 Prodigal gene 2785447 2786631 . - . ID=BALIOE_14230_gene;locus_tag=BALIOE_14230 | |
| 5703 c1 Prodigal CDS 2785447 2786631 . - 0 ID=BALIOE_14230;Name=hypothetical protein;locus_tag=BALIOE_14230;product=hypothetical protein;Parent=BALIOE_14230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5704 c1 Prodigal gene 2786628 2787410 . - . ID=BALIOE_14235_gene;locus_tag=BALIOE_14235 | |
| 5705 c1 Prodigal CDS 2786628 2787410 . - 0 ID=BALIOE_14235;Name=hypothetical protein;locus_tag=BALIOE_14235;product=hypothetical protein;Parent=BALIOE_14235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5706 c1 Prodigal gene 2787729 2788622 . - . ID=BALIOE_14240_gene;locus_tag=BALIOE_14240 | |
| 5707 c1 Prodigal CDS 2787729 2788622 . - 0 ID=BALIOE_14240;Name=hypothetical protein;locus_tag=BALIOE_14240;product=hypothetical protein;Parent=BALIOE_14240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5708 c1 Prodigal gene 2788865 2789860 . - . ID=BALIOE_14245_gene;locus_tag=BALIOE_14245 | |
| 5709 c1 Prodigal CDS 2788865 2789860 . - 0 ID=BALIOE_14245;Name=hypothetical protein;locus_tag=BALIOE_14245;product=hypothetical protein;Parent=BALIOE_14245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5710 c1 Prodigal gene 2790018 2791412 . - . ID=BALIOE_14250_gene;locus_tag=BALIOE_14250 | |
| 5711 c1 Prodigal CDS 2790018 2791412 . - 0 ID=BALIOE_14250;Name=hypothetical protein;locus_tag=BALIOE_14250;product=hypothetical protein;Parent=BALIOE_14250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5712 c1 Prodigal gene 2791423 2792643 . - . ID=BALIOE_14255_gene;locus_tag=BALIOE_14255 | |
| 5713 c1 Prodigal CDS 2791423 2792643 . - 0 ID=BALIOE_14255;Name=hypothetical protein;locus_tag=BALIOE_14255;product=hypothetical protein;Parent=BALIOE_14255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5714 c1 Prodigal gene 2792640 2793920 . - . ID=BALIOE_14260_gene;locus_tag=BALIOE_14260 | |
| 5715 c1 Prodigal CDS 2792640 2793920 . - 0 ID=BALIOE_14260;Name=hypothetical protein;locus_tag=BALIOE_14260;product=hypothetical protein;Parent=BALIOE_14260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5716 c1 Prodigal gene 2794100 2795578 . - . ID=BALIOE_14265_gene;locus_tag=BALIOE_14265 | |
| 5717 c1 Prodigal CDS 2794100 2795578 . - 0 ID=BALIOE_14265;Name=hypothetical protein;locus_tag=BALIOE_14265;product=hypothetical protein;Parent=BALIOE_14265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5718 c1 Prodigal gene 2795580 2796974 . - . ID=BALIOE_14270_gene;locus_tag=BALIOE_14270 | |
| 5719 c1 Prodigal CDS 2795580 2796974 . - 0 ID=BALIOE_14270;Name=hypothetical protein;locus_tag=BALIOE_14270;product=hypothetical protein;Parent=BALIOE_14270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5720 c1 Prodigal gene 2797029 2798399 . - . ID=BALIOE_14275_gene;locus_tag=BALIOE_14275 | |
| 5721 c1 Prodigal CDS 2797029 2798399 . - 0 ID=BALIOE_14275;Name=hypothetical protein;locus_tag=BALIOE_14275;product=hypothetical protein;Parent=BALIOE_14275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5722 c1 Prodigal gene 2798592 2800028 . - . ID=BALIOE_14280_gene;locus_tag=BALIOE_14280 | |
| 5723 c1 Prodigal CDS 2798592 2800028 . - 0 ID=BALIOE_14280;Name=hypothetical protein;locus_tag=BALIOE_14280;product=hypothetical protein;Parent=BALIOE_14280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5724 c1 Prodigal gene 2800031 2801254 . - . ID=BALIOE_14285_gene;locus_tag=BALIOE_14285 | |
| 5725 c1 Prodigal CDS 2800031 2801254 . - 0 ID=BALIOE_14285;Name=hypothetical protein;locus_tag=BALIOE_14285;product=hypothetical protein;Parent=BALIOE_14285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5726 c1 Prodigal gene 2801251 2801733 . - . ID=BALIOE_14290_gene;locus_tag=BALIOE_14290 | |
| 5727 c1 Prodigal CDS 2801251 2801733 . - 0 ID=BALIOE_14290;Name=hypothetical protein;locus_tag=BALIOE_14290;product=hypothetical protein;Parent=BALIOE_14290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5728 c1 Prodigal gene 2801733 2802698 . - . ID=BALIOE_14295_gene;locus_tag=BALIOE_14295 | |
| 5729 c1 Prodigal CDS 2801733 2802698 . - 0 ID=BALIOE_14295;Name=hypothetical protein;locus_tag=BALIOE_14295;product=hypothetical protein;Parent=BALIOE_14295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5730 c1 Prodigal gene 2802701 2803822 . - . ID=BALIOE_14300_gene;locus_tag=BALIOE_14300 | |
| 5731 c1 Prodigal CDS 2802701 2803822 . - 0 ID=BALIOE_14300;Name=hypothetical protein;locus_tag=BALIOE_14300;product=hypothetical protein;Parent=BALIOE_14300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5732 c1 Prodigal gene 2803851 2804399 . - . ID=BALIOE_14305_gene;locus_tag=BALIOE_14305 | |
| 5733 c1 Prodigal CDS 2803851 2804399 . - 0 ID=BALIOE_14305;Name=hypothetical protein;locus_tag=BALIOE_14305;product=hypothetical protein;Parent=BALIOE_14305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5734 c1 Prodigal gene 2804415 2805161 . - . ID=BALIOE_14310_gene;locus_tag=BALIOE_14310 | |
| 5735 c1 Prodigal CDS 2804415 2805161 . - 0 ID=BALIOE_14310;Name=hypothetical protein;locus_tag=BALIOE_14310;product=hypothetical protein;Parent=BALIOE_14310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5736 c1 Prodigal gene 2805172 2806389 . - . ID=BALIOE_14315_gene;locus_tag=BALIOE_14315 | |
| 5737 c1 Prodigal CDS 2805172 2806389 . - 0 ID=BALIOE_14315;Name=hypothetical protein;locus_tag=BALIOE_14315;product=hypothetical protein;Parent=BALIOE_14315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5738 c1 Prodigal gene 2806364 2807581 . - . ID=BALIOE_14320_gene;locus_tag=BALIOE_14320 | |
| 5739 c1 Prodigal CDS 2806364 2807581 . - 0 ID=BALIOE_14320;Name=hypothetical protein;locus_tag=BALIOE_14320;product=hypothetical protein;Parent=BALIOE_14320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5740 c1 Prodigal gene 2807578 2808066 . - . ID=BALIOE_14325_gene;locus_tag=BALIOE_14325 | |
| 5741 c1 Prodigal CDS 2807578 2808066 . - 0 ID=BALIOE_14325;Name=hypothetical protein;locus_tag=BALIOE_14325;product=hypothetical protein;Parent=BALIOE_14325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5742 c1 Prodigal gene 2808069 2808908 . - . ID=BALIOE_14330_gene;locus_tag=BALIOE_14330 | |
| 5743 c1 Prodigal CDS 2808069 2808908 . - 0 ID=BALIOE_14330;Name=hypothetical protein;locus_tag=BALIOE_14330;product=hypothetical protein;Parent=BALIOE_14330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5744 c1 Prodigal gene 2809001 2811163 . - . ID=BALIOE_14335_gene;locus_tag=BALIOE_14335 | |
| 5745 c1 Prodigal CDS 2809001 2811163 . - 0 ID=BALIOE_14335;Name=hypothetical protein;locus_tag=BALIOE_14335;product=hypothetical protein;Parent=BALIOE_14335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5746 c1 Prodigal gene 2811166 2811609 . - . ID=BALIOE_14340_gene;locus_tag=BALIOE_14340 | |
| 5747 c1 Prodigal CDS 2811166 2811609 . - 0 ID=BALIOE_14340;Name=hypothetical protein;locus_tag=BALIOE_14340;product=hypothetical protein;Parent=BALIOE_14340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5748 c1 Prodigal gene 2811615 2812754 . - . ID=BALIOE_14345_gene;locus_tag=BALIOE_14345 | |
| 5749 c1 Prodigal CDS 2811615 2812754 . - 0 ID=BALIOE_14345;Name=hypothetical protein;locus_tag=BALIOE_14345;product=hypothetical protein;Parent=BALIOE_14345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5750 c1 Prodigal gene 2813413 2814996 . + . ID=BALIOE_14350_gene;locus_tag=BALIOE_14350 | |
| 5751 c1 Prodigal CDS 2813413 2814996 . + 0 ID=BALIOE_14350;Name=hypothetical protein;locus_tag=BALIOE_14350;product=hypothetical protein;Parent=BALIOE_14350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5752 c1 Prodigal gene 2815071 2815409 . + . ID=BALIOE_14355_gene;locus_tag=BALIOE_14355 | |
| 5753 c1 Prodigal CDS 2815071 2815409 . + 0 ID=BALIOE_14355;Name=hypothetical protein;locus_tag=BALIOE_14355;product=hypothetical protein;Parent=BALIOE_14355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5754 c1 Prodigal gene 2815399 2815689 . + . ID=BALIOE_14360_gene;locus_tag=BALIOE_14360 | |
| 5755 c1 Prodigal CDS 2815399 2815689 . + 0 ID=BALIOE_14360;Name=hypothetical protein;locus_tag=BALIOE_14360;product=hypothetical protein;Parent=BALIOE_14360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5756 c1 Prodigal gene 2815742 2817595 . - . ID=BALIOE_14365_gene;locus_tag=BALIOE_14365 | |
| 5757 c1 Prodigal CDS 2815742 2817595 . - 0 ID=BALIOE_14365;Name=hypothetical protein;locus_tag=BALIOE_14365;product=hypothetical protein;Parent=BALIOE_14365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5758 c1 Prodigal gene 2817617 2818198 . - . ID=BALIOE_14370_gene;locus_tag=BALIOE_14370 | |
| 5759 c1 Prodigal CDS 2817617 2818198 . - 0 ID=BALIOE_14370;Name=hypothetical protein;locus_tag=BALIOE_14370;product=hypothetical protein;Parent=BALIOE_14370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5760 c1 Prodigal gene 2818290 2818931 . - . ID=BALIOE_14375_gene;locus_tag=BALIOE_14375 | |
| 5761 c1 Prodigal CDS 2818290 2818931 . - 0 ID=BALIOE_14375;Name=hypothetical protein;locus_tag=BALIOE_14375;product=hypothetical protein;Parent=BALIOE_14375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5762 c1 Prodigal gene 2819249 2819782 . + . ID=BALIOE_14380_gene;locus_tag=BALIOE_14380 | |
| 5763 c1 Prodigal CDS 2819249 2819782 . + 0 ID=BALIOE_14380;Name=hypothetical protein;locus_tag=BALIOE_14380;product=hypothetical protein;Parent=BALIOE_14380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5764 c1 Prodigal gene 2819760 2822567 . + . ID=BALIOE_14385_gene;locus_tag=BALIOE_14385 | |
| 5765 c1 Prodigal CDS 2819760 2822567 . + 0 ID=BALIOE_14385;Name=hypothetical protein;locus_tag=BALIOE_14385;product=hypothetical protein;Parent=BALIOE_14385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5766 c1 Prodigal gene 2822668 2823516 . - . ID=BALIOE_14390_gene;locus_tag=BALIOE_14390 | |
| 5767 c1 Prodigal CDS 2822668 2823516 . - 0 ID=BALIOE_14390;Name=hypothetical protein;locus_tag=BALIOE_14390;product=hypothetical protein;Parent=BALIOE_14390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5768 c1 Prodigal gene 2823698 2825002 . + . ID=BALIOE_14395_gene;locus_tag=BALIOE_14395 | |
| 5769 c1 Prodigal CDS 2823698 2825002 . + 0 ID=BALIOE_14395;Name=hypothetical protein;locus_tag=BALIOE_14395;product=hypothetical protein;Parent=BALIOE_14395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5770 c1 Prodigal gene 2825015 2826955 . - . ID=BALIOE_14400_gene;locus_tag=BALIOE_14400 | |
| 5771 c1 Prodigal CDS 2825015 2826955 . - 0 ID=BALIOE_14400;Name=hypothetical protein;locus_tag=BALIOE_14400;product=hypothetical protein;Parent=BALIOE_14400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5772 c1 Prodigal gene 2826952 2827632 . - . ID=BALIOE_14405_gene;locus_tag=BALIOE_14405 | |
| 5773 c1 Prodigal CDS 2826952 2827632 . - 0 ID=BALIOE_14405;Name=hypothetical protein;locus_tag=BALIOE_14405;product=hypothetical protein;Parent=BALIOE_14405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5774 c1 Prodigal gene 2827710 2828369 . - . ID=BALIOE_14410_gene;locus_tag=BALIOE_14410 | |
| 5775 c1 Prodigal CDS 2827710 2828369 . - 0 ID=BALIOE_14410;Name=hypothetical protein;locus_tag=BALIOE_14410;product=hypothetical protein;Parent=BALIOE_14410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5776 c1 Prodigal gene 2829585 2830832 . + . ID=BALIOE_14415_gene;locus_tag=BALIOE_14415 | |
| 5777 c1 Prodigal CDS 2829585 2830832 . + 0 ID=BALIOE_14415;Name=hypothetical protein;locus_tag=BALIOE_14415;product=hypothetical protein;Parent=BALIOE_14415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5778 c1 Prodigal gene 2830832 2833954 . + . ID=BALIOE_14420_gene;locus_tag=BALIOE_14420 | |
| 5779 c1 Prodigal CDS 2830832 2833954 . + 0 ID=BALIOE_14420;Name=hypothetical protein;locus_tag=BALIOE_14420;product=hypothetical protein;Parent=BALIOE_14420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5780 c1 Prodigal gene 2833955 2837032 . + . ID=BALIOE_14425_gene;locus_tag=BALIOE_14425 | |
| 5781 c1 Prodigal CDS 2833955 2837032 . + 0 ID=BALIOE_14425;Name=hypothetical protein;locus_tag=BALIOE_14425;product=hypothetical protein;Parent=BALIOE_14425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5782 c1 Prodigal gene 2837033 2838448 . + . ID=BALIOE_14430_gene;locus_tag=BALIOE_14430 | |
| 5783 c1 Prodigal CDS 2837033 2838448 . + 0 ID=BALIOE_14430;Name=hypothetical protein;locus_tag=BALIOE_14430;product=hypothetical protein;Parent=BALIOE_14430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5784 c1 Prodigal gene 2838445 2839848 . + . ID=BALIOE_14435_gene;locus_tag=BALIOE_14435 | |
| 5785 c1 Prodigal CDS 2838445 2839848 . + 0 ID=BALIOE_14435;Name=hypothetical protein;locus_tag=BALIOE_14435;product=hypothetical protein;Parent=BALIOE_14435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5786 c1 Prodigal gene 2839845 2840567 . + . ID=BALIOE_14440_gene;locus_tag=BALIOE_14440 | |
| 5787 c1 Prodigal CDS 2839845 2840567 . + 0 ID=BALIOE_14440;Name=hypothetical protein;locus_tag=BALIOE_14440;product=hypothetical protein;Parent=BALIOE_14440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5788 c1 Prodigal gene 2840758 2841090 . + . ID=BALIOE_14445_gene;locus_tag=BALIOE_14445 | |
| 5789 c1 Prodigal CDS 2840758 2841090 . + 0 ID=BALIOE_14445;Name=hypothetical protein;locus_tag=BALIOE_14445;product=hypothetical protein;Parent=BALIOE_14445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5790 c1 Prodigal gene 2841238 2842599 . + . ID=BALIOE_14450_gene;locus_tag=BALIOE_14450 | |
| 5791 c1 Prodigal CDS 2841238 2842599 . + 0 ID=BALIOE_14450;Name=hypothetical protein;locus_tag=BALIOE_14450;product=hypothetical protein;Parent=BALIOE_14450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5792 c1 Prodigal gene 2842929 2843246 . - . ID=BALIOE_14455_gene;locus_tag=BALIOE_14455 | |
| 5793 c1 Prodigal CDS 2842929 2843246 . - 0 ID=BALIOE_14455;Name=hypothetical protein;locus_tag=BALIOE_14455;product=hypothetical protein;Parent=BALIOE_14455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5794 c1 Prodigal gene 2843652 2844551 . + . ID=BALIOE_14460_gene;locus_tag=BALIOE_14460 | |
| 5795 c1 Prodigal CDS 2843652 2844551 . + 0 ID=BALIOE_14460;Name=hypothetical protein;locus_tag=BALIOE_14460;product=hypothetical protein;Parent=BALIOE_14460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5796 c1 Prodigal gene 2844633 2845412 . - . ID=BALIOE_14465_gene;locus_tag=BALIOE_14465 | |
| 5797 c1 Prodigal CDS 2844633 2845412 . - 0 ID=BALIOE_14465;Name=hypothetical protein;locus_tag=BALIOE_14465;product=hypothetical protein;Parent=BALIOE_14465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5798 c1 Prodigal gene 2845512 2846552 . - . ID=BALIOE_14470_gene;locus_tag=BALIOE_14470 | |
| 5799 c1 Prodigal CDS 2845512 2846552 . - 0 ID=BALIOE_14470;Name=hypothetical protein;locus_tag=BALIOE_14470;product=hypothetical protein;Parent=BALIOE_14470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5800 c1 Prodigal gene 2846600 2847955 . - . ID=BALIOE_14475_gene;locus_tag=BALIOE_14475 | |
| 5801 c1 Prodigal CDS 2846600 2847955 . - 0 ID=BALIOE_14475;Name=hypothetical protein;locus_tag=BALIOE_14475;product=hypothetical protein;Parent=BALIOE_14475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5802 c1 Prodigal gene 2847959 2848243 . - . ID=BALIOE_14480_gene;locus_tag=BALIOE_14480 | |
| 5803 c1 Prodigal CDS 2847959 2848243 . - 0 ID=BALIOE_14480;Name=hypothetical protein;locus_tag=BALIOE_14480;product=hypothetical protein;Parent=BALIOE_14480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5804 c1 Prodigal gene 2848274 2848726 . - . ID=BALIOE_14485_gene;locus_tag=BALIOE_14485 | |
| 5805 c1 Prodigal CDS 2848274 2848726 . - 0 ID=BALIOE_14485;Name=hypothetical protein;locus_tag=BALIOE_14485;product=hypothetical protein;Parent=BALIOE_14485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5806 c1 Prodigal gene 2848736 2849998 . - . ID=BALIOE_14490_gene;locus_tag=BALIOE_14490 | |
| 5807 c1 Prodigal CDS 2848736 2849998 . - 0 ID=BALIOE_14490;Name=hypothetical protein;locus_tag=BALIOE_14490;product=hypothetical protein;Parent=BALIOE_14490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5808 c1 Prodigal gene 2850027 2850881 . - . ID=BALIOE_14495_gene;locus_tag=BALIOE_14495 | |
| 5809 c1 Prodigal CDS 2850027 2850881 . - 0 ID=BALIOE_14495;Name=hypothetical protein;locus_tag=BALIOE_14495;product=hypothetical protein;Parent=BALIOE_14495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5810 c1 Infernal gene 2851088 2851158 . - . ID=BALIOE_14500_gene;locus_tag=BALIOE_14500;gene=naRNA4 | |
| 5811 c1 Infernal ncRNA 2851088 2851158 1e-09 - . ID=BALIOE_14500;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_14500;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_14500_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 5812 c1 Prodigal gene 2851180 2852232 . - . ID=BALIOE_14505_gene;locus_tag=BALIOE_14505 | |
| 5813 c1 Prodigal CDS 2851180 2852232 . - 0 ID=BALIOE_14505;Name=hypothetical protein;locus_tag=BALIOE_14505;product=hypothetical protein;Parent=BALIOE_14505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5814 c1 Prodigal gene 2852489 2853766 . + . ID=BALIOE_14510_gene;locus_tag=BALIOE_14510 | |
| 5815 c1 Prodigal CDS 2852489 2853766 . + 0 ID=BALIOE_14510;Name=hypothetical protein;locus_tag=BALIOE_14510;product=hypothetical protein;Parent=BALIOE_14510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5816 c1 Prodigal gene 2853763 2854767 . + . ID=BALIOE_14515_gene;locus_tag=BALIOE_14515 | |
| 5817 c1 Prodigal CDS 2853763 2854767 . + 0 ID=BALIOE_14515;Name=hypothetical protein;locus_tag=BALIOE_14515;product=hypothetical protein;Parent=BALIOE_14515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5818 c1 Prodigal gene 2854764 2855729 . + . ID=BALIOE_14520_gene;locus_tag=BALIOE_14520 | |
| 5819 c1 Prodigal CDS 2854764 2855729 . + 0 ID=BALIOE_14520;Name=hypothetical protein;locus_tag=BALIOE_14520;product=hypothetical protein;Parent=BALIOE_14520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5820 c1 Prodigal gene 2855703 2856449 . - . ID=BALIOE_14525_gene;locus_tag=BALIOE_14525 | |
| 5821 c1 Prodigal CDS 2855703 2856449 . - 0 ID=BALIOE_14525;Name=hypothetical protein;locus_tag=BALIOE_14525;product=hypothetical protein;Parent=BALIOE_14525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5822 c1 Prodigal gene 2856501 2857319 . - . ID=BALIOE_14530_gene;locus_tag=BALIOE_14530 | |
| 5823 c1 Prodigal CDS 2856501 2857319 . - 0 ID=BALIOE_14530;Name=hypothetical protein;locus_tag=BALIOE_14530;product=hypothetical protein;Parent=BALIOE_14530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5824 c1 Prodigal gene 2857384 2858184 . - . ID=BALIOE_14535_gene;locus_tag=BALIOE_14535 | |
| 5825 c1 Prodigal CDS 2857384 2858184 . - 0 ID=BALIOE_14535;Name=hypothetical protein;locus_tag=BALIOE_14535;product=hypothetical protein;Parent=BALIOE_14535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5826 c1 Prodigal gene 2858181 2858969 . - . ID=BALIOE_14540_gene;locus_tag=BALIOE_14540 | |
| 5827 c1 Prodigal CDS 2858181 2858969 . - 0 ID=BALIOE_14540;Name=hypothetical protein;locus_tag=BALIOE_14540;product=hypothetical protein;Parent=BALIOE_14540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5828 c1 Prodigal gene 2859303 2859542 . + . ID=BALIOE_14545_gene;locus_tag=BALIOE_14545 | |
| 5829 c1 Prodigal CDS 2859303 2859542 . + 0 ID=BALIOE_14545;Name=hypothetical protein;locus_tag=BALIOE_14545;product=hypothetical protein;Parent=BALIOE_14545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5830 c1 Prodigal gene 2860593 2860940 . + . ID=BALIOE_14550_gene;locus_tag=BALIOE_14550 | |
| 5831 c1 Prodigal CDS 2860593 2860940 . + 0 ID=BALIOE_14550;Name=hypothetical protein;locus_tag=BALIOE_14550;product=hypothetical protein;Parent=BALIOE_14550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5832 c1 Prodigal gene 2860950 2861264 . + . ID=BALIOE_14555_gene;locus_tag=BALIOE_14555 | |
| 5833 c1 Prodigal CDS 2860950 2861264 . + 0 ID=BALIOE_14555;Name=hypothetical protein;locus_tag=BALIOE_14555;product=hypothetical protein;Parent=BALIOE_14555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5834 c1 Prodigal gene 2861374 2861646 . - . ID=BALIOE_14560_gene;locus_tag=BALIOE_14560 | |
| 5835 c1 Prodigal CDS 2861374 2861646 . - 0 ID=BALIOE_14560;Name=hypothetical protein;locus_tag=BALIOE_14560;product=hypothetical protein;Parent=BALIOE_14560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5836 c1 Prodigal gene 2861767 2862606 . + . ID=BALIOE_14565_gene;locus_tag=BALIOE_14565 | |
| 5837 c1 Prodigal CDS 2861767 2862606 . + 0 ID=BALIOE_14565;Name=hypothetical protein;locus_tag=BALIOE_14565;product=hypothetical protein;Parent=BALIOE_14565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5838 c1 Prodigal gene 2862824 2863162 . + . ID=BALIOE_14570_gene;locus_tag=BALIOE_14570 | |
| 5839 c1 Prodigal CDS 2862824 2863162 . + 0 ID=BALIOE_14570;Name=hypothetical protein;locus_tag=BALIOE_14570;product=hypothetical protein;Parent=BALIOE_14570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5840 c1 Prodigal gene 2863244 2864278 . - . ID=BALIOE_14575_gene;locus_tag=BALIOE_14575 | |
| 5841 c1 Prodigal CDS 2863244 2864278 . - 0 ID=BALIOE_14575;Name=hypothetical protein;locus_tag=BALIOE_14575;product=hypothetical protein;Parent=BALIOE_14575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5842 c1 Prodigal gene 2864289 2866769 . - . ID=BALIOE_14580_gene;locus_tag=BALIOE_14580 | |
| 5843 c1 Prodigal CDS 2864289 2866769 . - 0 ID=BALIOE_14580;Name=hypothetical protein;locus_tag=BALIOE_14580;product=hypothetical protein;Parent=BALIOE_14580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5844 c1 Prodigal gene 2866785 2867459 . - . ID=BALIOE_14585_gene;locus_tag=BALIOE_14585 | |
| 5845 c1 Prodigal CDS 2866785 2867459 . - 0 ID=BALIOE_14585;Name=hypothetical protein;locus_tag=BALIOE_14585;product=hypothetical protein;Parent=BALIOE_14585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5846 c1 Prodigal gene 2867547 2868089 . - . ID=BALIOE_14590_gene;locus_tag=BALIOE_14590 | |
| 5847 c1 Prodigal CDS 2867547 2868089 . - 0 ID=BALIOE_14590;Name=hypothetical protein;locus_tag=BALIOE_14590;product=hypothetical protein;Parent=BALIOE_14590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5848 c1 Prodigal gene 2868381 2868662 . - . ID=BALIOE_14595_gene;locus_tag=BALIOE_14595 | |
| 5849 c1 Prodigal CDS 2868381 2868662 . - 0 ID=BALIOE_14595;Name=hypothetical protein;locus_tag=BALIOE_14595;product=hypothetical protein;Parent=BALIOE_14595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5850 c1 Prodigal gene 2868924 2870033 . - . ID=BALIOE_14600_gene;locus_tag=BALIOE_14600 | |
| 5851 c1 Prodigal CDS 2868924 2870033 . - 0 ID=BALIOE_14600;Name=hypothetical protein;locus_tag=BALIOE_14600;product=hypothetical protein;Parent=BALIOE_14600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5852 c1 Prodigal gene 2870165 2872198 . + . ID=BALIOE_14605_gene;locus_tag=BALIOE_14605 | |
| 5853 c1 Prodigal CDS 2870165 2872198 . + 0 ID=BALIOE_14605;Name=hypothetical protein;locus_tag=BALIOE_14605;product=hypothetical protein;Parent=BALIOE_14605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5854 c1 Prodigal gene 2872339 2873067 . + . ID=BALIOE_14610_gene;locus_tag=BALIOE_14610 | |
| 5855 c1 Prodigal CDS 2872339 2873067 . + 0 ID=BALIOE_14610;Name=hypothetical protein;locus_tag=BALIOE_14610;product=hypothetical protein;Parent=BALIOE_14610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5856 c1 Prodigal gene 2873257 2876148 . + . ID=BALIOE_14615_gene;locus_tag=BALIOE_14615 | |
| 5857 c1 Prodigal CDS 2873257 2876148 . + 0 ID=BALIOE_14615;Name=hypothetical protein;locus_tag=BALIOE_14615;product=hypothetical protein;Parent=BALIOE_14615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5858 c1 Prodigal gene 2876161 2877441 . + . ID=BALIOE_14620_gene;locus_tag=BALIOE_14620 | |
| 5859 c1 Prodigal CDS 2876161 2877441 . + 0 ID=BALIOE_14620;Name=hypothetical protein;locus_tag=BALIOE_14620;product=hypothetical protein;Parent=BALIOE_14620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5860 c1 Prodigal gene 2877407 2879146 . + . ID=BALIOE_14625_gene;locus_tag=BALIOE_14625 | |
| 5861 c1 Prodigal CDS 2877407 2879146 . + 0 ID=BALIOE_14625;Name=hypothetical protein;locus_tag=BALIOE_14625;product=hypothetical protein;Parent=BALIOE_14625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5862 c1 Prodigal gene 2879156 2882785 . + . ID=BALIOE_14630_gene;locus_tag=BALIOE_14630 | |
| 5863 c1 Prodigal CDS 2879156 2882785 . + 0 ID=BALIOE_14630;Name=hypothetical protein;locus_tag=BALIOE_14630;product=hypothetical protein;Parent=BALIOE_14630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5864 c1 Prodigal gene 2882847 2883164 . + . ID=BALIOE_14635_gene;locus_tag=BALIOE_14635 | |
| 5865 c1 Prodigal CDS 2882847 2883164 . + 0 ID=BALIOE_14635;Name=hypothetical protein;locus_tag=BALIOE_14635;product=hypothetical protein;Parent=BALIOE_14635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5866 c1 Prodigal gene 2883274 2883363 . - . ID=BALIOE_14640_gene;locus_tag=BALIOE_14640 | |
| 5867 c1 Prodigal CDS 2883274 2883363 . - 0 ID=BALIOE_14640;Name=hypothetical protein;locus_tag=BALIOE_14640;product=hypothetical protein;Parent=BALIOE_14640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5868 c1 Prodigal gene 2884405 2885493 . + . ID=BALIOE_14645_gene;locus_tag=BALIOE_14645 | |
| 5869 c1 Prodigal CDS 2884405 2885493 . + 0 ID=BALIOE_14645;Name=hypothetical protein;locus_tag=BALIOE_14645;product=hypothetical protein;Parent=BALIOE_14645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5870 c1 Prodigal gene 2885504 2887033 . + . ID=BALIOE_14650_gene;locus_tag=BALIOE_14650 | |
| 5871 c1 Prodigal CDS 2885504 2887033 . + 0 ID=BALIOE_14650;Name=hypothetical protein;locus_tag=BALIOE_14650;product=hypothetical protein;Parent=BALIOE_14650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5872 c1 Prodigal gene 2887052 2887783 . + . ID=BALIOE_14655_gene;locus_tag=BALIOE_14655 | |
| 5873 c1 Prodigal CDS 2887052 2887783 . + 0 ID=BALIOE_14655;Name=hypothetical protein;locus_tag=BALIOE_14655;product=hypothetical protein;Parent=BALIOE_14655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5874 c1 Prodigal gene 2887776 2888912 . + . ID=BALIOE_14660_gene;locus_tag=BALIOE_14660 | |
| 5875 c1 Prodigal CDS 2887776 2888912 . + 0 ID=BALIOE_14660;Name=hypothetical protein;locus_tag=BALIOE_14660;product=hypothetical protein;Parent=BALIOE_14660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5876 c1 Prodigal gene 2888909 2891146 . + . ID=BALIOE_14665_gene;locus_tag=BALIOE_14665 | |
| 5877 c1 Prodigal CDS 2888909 2891146 . + 0 ID=BALIOE_14665;Name=hypothetical protein;locus_tag=BALIOE_14665;product=hypothetical protein;Parent=BALIOE_14665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5878 c1 Prodigal gene 2890953 2891840 . - . ID=BALIOE_14670_gene;locus_tag=BALIOE_14670 | |
| 5879 c1 Prodigal CDS 2890953 2891840 . - 0 ID=BALIOE_14670;Name=hypothetical protein;locus_tag=BALIOE_14670;product=hypothetical protein;Parent=BALIOE_14670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5880 c1 Prodigal gene 2891840 2892166 . - . ID=BALIOE_14675_gene;locus_tag=BALIOE_14675 | |
| 5881 c1 Prodigal CDS 2891840 2892166 . - 0 ID=BALIOE_14675;Name=hypothetical protein;locus_tag=BALIOE_14675;product=hypothetical protein;Parent=BALIOE_14675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5882 c1 Prodigal gene 2892350 2892811 . + . ID=BALIOE_14680_gene;locus_tag=BALIOE_14680 | |
| 5883 c1 Prodigal CDS 2892350 2892811 . + 0 ID=BALIOE_14680;Name=hypothetical protein;locus_tag=BALIOE_14680;product=hypothetical protein;Parent=BALIOE_14680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5884 c1 Prodigal gene 2892853 2893323 . - . ID=BALIOE_14685_gene;locus_tag=BALIOE_14685 | |
| 5885 c1 Prodigal CDS 2892853 2893323 . - 0 ID=BALIOE_14685;Name=hypothetical protein;locus_tag=BALIOE_14685;product=hypothetical protein;Parent=BALIOE_14685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5886 c1 Prodigal gene 2893370 2894089 . - . ID=BALIOE_14690_gene;locus_tag=BALIOE_14690 | |
| 5887 c1 Prodigal CDS 2893370 2894089 . - 0 ID=BALIOE_14690;Name=hypothetical protein;locus_tag=BALIOE_14690;product=hypothetical protein;Parent=BALIOE_14690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5888 c1 Prodigal gene 2894086 2895771 . - . ID=BALIOE_14695_gene;locus_tag=BALIOE_14695 | |
| 5889 c1 Prodigal CDS 2894086 2895771 . - 0 ID=BALIOE_14695;Name=hypothetical protein;locus_tag=BALIOE_14695;product=hypothetical protein;Parent=BALIOE_14695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5890 c1 Prodigal gene 2896286 2896534 . + . ID=BALIOE_14700_gene;locus_tag=BALIOE_14700 | |
| 5891 c1 Prodigal CDS 2896286 2896534 . + 0 ID=BALIOE_14700;Name=hypothetical protein;locus_tag=BALIOE_14700;product=hypothetical protein;Parent=BALIOE_14700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5892 c1 Prodigal gene 2896902 2897171 . - . ID=BALIOE_14705_gene;locus_tag=BALIOE_14705 | |
| 5893 c1 Prodigal CDS 2896902 2897171 . - 0 ID=BALIOE_14705;Name=hypothetical protein;locus_tag=BALIOE_14705;product=hypothetical protein;Parent=BALIOE_14705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5894 c1 Prodigal gene 2897173 2898486 . - . ID=BALIOE_14710_gene;locus_tag=BALIOE_14710 | |
| 5895 c1 Prodigal CDS 2897173 2898486 . - 0 ID=BALIOE_14710;Name=hypothetical protein;locus_tag=BALIOE_14710;product=hypothetical protein;Parent=BALIOE_14710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5896 c1 Prodigal gene 2898551 2899150 . - . ID=BALIOE_14715_gene;locus_tag=BALIOE_14715 | |
| 5897 c1 Prodigal CDS 2898551 2899150 . - 0 ID=BALIOE_14715;Name=hypothetical protein;locus_tag=BALIOE_14715;product=hypothetical protein;Parent=BALIOE_14715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5898 c1 Prodigal gene 2899218 2901563 . - . ID=BALIOE_14720_gene;locus_tag=BALIOE_14720 | |
| 5899 c1 Prodigal CDS 2899218 2901563 . - 0 ID=BALIOE_14720;Name=hypothetical protein;locus_tag=BALIOE_14720;product=hypothetical protein;Parent=BALIOE_14720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5900 c1 Prodigal gene 2901515 2902690 . - . ID=BALIOE_14725_gene;locus_tag=BALIOE_14725 | |
| 5901 c1 Prodigal CDS 2901515 2902690 . - 0 ID=BALIOE_14725;Name=hypothetical protein;locus_tag=BALIOE_14725;product=hypothetical protein;Parent=BALIOE_14725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5902 c1 Prodigal gene 2902931 2903509 . - . ID=BALIOE_14730_gene;locus_tag=BALIOE_14730 | |
| 5903 c1 Prodigal CDS 2902931 2903509 . - 0 ID=BALIOE_14730;Name=hypothetical protein;locus_tag=BALIOE_14730;product=hypothetical protein;Parent=BALIOE_14730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5904 c1 Prodigal gene 2903506 2904249 . - . ID=BALIOE_14735_gene;locus_tag=BALIOE_14735 | |
| 5905 c1 Prodigal CDS 2903506 2904249 . - 0 ID=BALIOE_14735;Name=hypothetical protein;locus_tag=BALIOE_14735;product=hypothetical protein;Parent=BALIOE_14735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5906 c1 Prodigal gene 2904260 2904958 . - . ID=BALIOE_14740_gene;locus_tag=BALIOE_14740 | |
| 5907 c1 Prodigal CDS 2904260 2904958 . - 0 ID=BALIOE_14740;Name=hypothetical protein;locus_tag=BALIOE_14740;product=hypothetical protein;Parent=BALIOE_14740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5908 c1 Prodigal gene 2904958 2905287 . - . ID=BALIOE_14745_gene;locus_tag=BALIOE_14745 | |
| 5909 c1 Prodigal CDS 2904958 2905287 . - 0 ID=BALIOE_14745;Name=hypothetical protein;locus_tag=BALIOE_14745;product=hypothetical protein;Parent=BALIOE_14745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5910 c1 Prodigal gene 2905284 2907929 . - . ID=BALIOE_14750_gene;locus_tag=BALIOE_14750 | |
| 5911 c1 Prodigal CDS 2905284 2907929 . - 0 ID=BALIOE_14750;Name=hypothetical protein;locus_tag=BALIOE_14750;product=hypothetical protein;Parent=BALIOE_14750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5912 c1 Prodigal gene 2907973 2908281 . - . ID=BALIOE_14755_gene;locus_tag=BALIOE_14755 | |
| 5913 c1 Prodigal CDS 2907973 2908281 . - 0 ID=BALIOE_14755;Name=hypothetical protein;locus_tag=BALIOE_14755;product=hypothetical protein;Parent=BALIOE_14755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5914 c1 Prodigal gene 2908308 2908730 . - . ID=BALIOE_14760_gene;locus_tag=BALIOE_14760 | |
| 5915 c1 Prodigal CDS 2908308 2908730 . - 0 ID=BALIOE_14760;Name=hypothetical protein;locus_tag=BALIOE_14760;product=hypothetical protein;Parent=BALIOE_14760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5916 c1 Prodigal gene 2908744 2909496 . - . ID=BALIOE_14765_gene;locus_tag=BALIOE_14765 | |
| 5917 c1 Prodigal CDS 2908744 2909496 . - 0 ID=BALIOE_14765;Name=hypothetical protein;locus_tag=BALIOE_14765;product=hypothetical protein;Parent=BALIOE_14765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5918 c1 Prodigal gene 2909504 2909902 . - . ID=BALIOE_14770_gene;locus_tag=BALIOE_14770 | |
| 5919 c1 Prodigal CDS 2909504 2909902 . - 0 ID=BALIOE_14770;Name=hypothetical protein;locus_tag=BALIOE_14770;product=hypothetical protein;Parent=BALIOE_14770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5920 c1 Prodigal gene 2909915 2910538 . - . ID=BALIOE_14775_gene;locus_tag=BALIOE_14775 | |
| 5921 c1 Prodigal CDS 2909915 2910538 . - 0 ID=BALIOE_14775;Name=hypothetical protein;locus_tag=BALIOE_14775;product=hypothetical protein;Parent=BALIOE_14775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5922 c1 Prodigal gene 2910541 2910822 . - . ID=BALIOE_14780_gene;locus_tag=BALIOE_14780 | |
| 5923 c1 Prodigal CDS 2910541 2910822 . - 0 ID=BALIOE_14780;Name=hypothetical protein;locus_tag=BALIOE_14780;product=hypothetical protein;Parent=BALIOE_14780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5924 c1 Prodigal gene 2910815 2911141 . - . ID=BALIOE_14785_gene;locus_tag=BALIOE_14785 | |
| 5925 c1 Prodigal CDS 2910815 2911141 . - 0 ID=BALIOE_14785;Name=hypothetical protein;locus_tag=BALIOE_14785;product=hypothetical protein;Parent=BALIOE_14785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5926 c1 Prodigal gene 2911229 2912269 . - . ID=BALIOE_14790_gene;locus_tag=BALIOE_14790 | |
| 5927 c1 Prodigal CDS 2911229 2912269 . - 0 ID=BALIOE_14790;Name=hypothetical protein;locus_tag=BALIOE_14790;product=hypothetical protein;Parent=BALIOE_14790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5928 c1 Prodigal gene 2912391 2912717 . + . ID=BALIOE_14795_gene;locus_tag=BALIOE_14795 | |
| 5929 c1 Prodigal CDS 2912391 2912717 . + 0 ID=BALIOE_14795;Name=hypothetical protein;locus_tag=BALIOE_14795;product=hypothetical protein;Parent=BALIOE_14795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5930 c1 Prodigal gene 2912717 2913604 . + . ID=BALIOE_14800_gene;locus_tag=BALIOE_14800 | |
| 5931 c1 Prodigal CDS 2912717 2913604 . + 0 ID=BALIOE_14800;Name=hypothetical protein;locus_tag=BALIOE_14800;product=hypothetical protein;Parent=BALIOE_14800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5932 c1 Prodigal gene 2913607 2914566 . - . ID=BALIOE_14805_gene;locus_tag=BALIOE_14805 | |
| 5933 c1 Prodigal CDS 2913607 2914566 . - 0 ID=BALIOE_14805;Name=hypothetical protein;locus_tag=BALIOE_14805;product=hypothetical protein;Parent=BALIOE_14805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5934 c1 Prodigal gene 2914511 2916013 . - . ID=BALIOE_14810_gene;locus_tag=BALIOE_14810 | |
| 5935 c1 Prodigal CDS 2914511 2916013 . - 0 ID=BALIOE_14810;Name=hypothetical protein;locus_tag=BALIOE_14810;product=hypothetical protein;Parent=BALIOE_14810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5936 c1 Prodigal gene 2916013 2916225 . - . ID=BALIOE_14815_gene;locus_tag=BALIOE_14815 | |
| 5937 c1 Prodigal CDS 2916013 2916225 . - 0 ID=BALIOE_14815;Name=hypothetical protein;locus_tag=BALIOE_14815;product=hypothetical protein;Parent=BALIOE_14815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5938 c1 Prodigal gene 2916222 2918345 . - . ID=BALIOE_14820_gene;locus_tag=BALIOE_14820 | |
| 5939 c1 Prodigal CDS 2916222 2918345 . - 0 ID=BALIOE_14820;Name=hypothetical protein;locus_tag=BALIOE_14820;product=hypothetical protein;Parent=BALIOE_14820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5940 c1 Prodigal gene 2918342 2918818 . - . ID=BALIOE_14825_gene;locus_tag=BALIOE_14825 | |
| 5941 c1 Prodigal CDS 2918342 2918818 . - 0 ID=BALIOE_14825;Name=hypothetical protein;locus_tag=BALIOE_14825;product=hypothetical protein;Parent=BALIOE_14825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5942 c1 Prodigal gene 2919273 2919740 . - . ID=BALIOE_14830_gene;locus_tag=BALIOE_14830 | |
| 5943 c1 Prodigal CDS 2919273 2919740 . - 0 ID=BALIOE_14830;Name=hypothetical protein;locus_tag=BALIOE_14830;product=hypothetical protein;Parent=BALIOE_14830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5944 c1 Prodigal gene 2919748 2919894 . - . ID=BALIOE_14835_gene;locus_tag=BALIOE_14835 | |
| 5945 c1 Prodigal CDS 2919748 2919894 . - 0 ID=BALIOE_14835;Name=hypothetical protein;locus_tag=BALIOE_14835;product=hypothetical protein;Parent=BALIOE_14835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5946 c1 Prodigal gene 2919894 2920463 . - . ID=BALIOE_14840_gene;locus_tag=BALIOE_14840 | |
| 5947 c1 Prodigal CDS 2919894 2920463 . - 0 ID=BALIOE_14840;Name=hypothetical protein;locus_tag=BALIOE_14840;product=hypothetical protein;Parent=BALIOE_14840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5948 c1 Prodigal gene 2920734 2921267 . - . ID=BALIOE_14845_gene;locus_tag=BALIOE_14845 | |
| 5949 c1 Prodigal CDS 2920734 2921267 . - 0 ID=BALIOE_14845;Name=hypothetical protein;locus_tag=BALIOE_14845;product=hypothetical protein;Parent=BALIOE_14845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5950 c1 Prodigal gene 2921272 2921487 . - . ID=BALIOE_14850_gene;locus_tag=BALIOE_14850 | |
| 5951 c1 Prodigal CDS 2921272 2921487 . - 0 ID=BALIOE_14850;Name=hypothetical protein;locus_tag=BALIOE_14850;product=hypothetical protein;Parent=BALIOE_14850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5952 c1 Prodigal gene 2921565 2921810 . - . ID=BALIOE_14855_gene;locus_tag=BALIOE_14855 | |
| 5953 c1 Prodigal CDS 2921565 2921810 . - 0 ID=BALIOE_14855;Name=hypothetical protein;locus_tag=BALIOE_14855;product=hypothetical protein;Parent=BALIOE_14855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5954 c1 Prodigal gene 2921851 2922030 . - . ID=BALIOE_14860_gene;locus_tag=BALIOE_14860 | |
| 5955 c1 Prodigal CDS 2921851 2922030 . - 0 ID=BALIOE_14860;Name=hypothetical protein;locus_tag=BALIOE_14860;product=hypothetical protein;Parent=BALIOE_14860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5956 c1 Prodigal gene 2922168 2924114 . - . ID=BALIOE_14865_gene;locus_tag=BALIOE_14865 | |
| 5957 c1 Prodigal CDS 2922168 2924114 . - 0 ID=BALIOE_14865;Name=hypothetical protein;locus_tag=BALIOE_14865;product=hypothetical protein;Parent=BALIOE_14865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5958 c1 Prodigal gene 2924625 2924894 . - . ID=BALIOE_14870_gene;locus_tag=BALIOE_14870 | |
| 5959 c1 Prodigal CDS 2924625 2924894 . - 0 ID=BALIOE_14870;Name=hypothetical protein;locus_tag=BALIOE_14870;product=hypothetical protein;Parent=BALIOE_14870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5960 c1 Prodigal gene 2924904 2925851 . - . ID=BALIOE_14875_gene;locus_tag=BALIOE_14875 | |
| 5961 c1 Prodigal CDS 2924904 2925851 . - 0 ID=BALIOE_14875;Name=hypothetical protein;locus_tag=BALIOE_14875;product=hypothetical protein;Parent=BALIOE_14875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5962 c1 Prodigal gene 2926358 2926840 . - . ID=BALIOE_14880_gene;locus_tag=BALIOE_14880 | |
| 5963 c1 Prodigal CDS 2926358 2926840 . - 0 ID=BALIOE_14880;Name=hypothetical protein;locus_tag=BALIOE_14880;product=hypothetical protein;Parent=BALIOE_14880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5964 c1 Prodigal gene 2926785 2926979 . - . ID=BALIOE_14885_gene;locus_tag=BALIOE_14885 | |
| 5965 c1 Prodigal CDS 2926785 2926979 . - 0 ID=BALIOE_14885;Name=hypothetical protein;locus_tag=BALIOE_14885;product=hypothetical protein;Parent=BALIOE_14885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5966 c1 Prodigal gene 2926976 2927581 . - . ID=BALIOE_14890_gene;locus_tag=BALIOE_14890 | |
| 5967 c1 Prodigal CDS 2926976 2927581 . - 0 ID=BALIOE_14890;Name=hypothetical protein;locus_tag=BALIOE_14890;product=hypothetical protein;Parent=BALIOE_14890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5968 c1 Prodigal gene 2927574 2927783 . - . ID=BALIOE_14895_gene;locus_tag=BALIOE_14895 | |
| 5969 c1 Prodigal CDS 2927574 2927783 . - 0 ID=BALIOE_14895;Name=hypothetical protein;locus_tag=BALIOE_14895;product=hypothetical protein;Parent=BALIOE_14895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5970 c1 Prodigal gene 2927743 2928144 . - . ID=BALIOE_14900_gene;locus_tag=BALIOE_14900 | |
| 5971 c1 Prodigal CDS 2927743 2928144 . - 0 ID=BALIOE_14900;Name=hypothetical protein;locus_tag=BALIOE_14900;product=hypothetical protein;Parent=BALIOE_14900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5972 c1 Prodigal gene 2928320 2928847 . - . ID=BALIOE_14905_gene;locus_tag=BALIOE_14905 | |
| 5973 c1 Prodigal CDS 2928320 2928847 . - 0 ID=BALIOE_14905;Name=hypothetical protein;locus_tag=BALIOE_14905;product=hypothetical protein;Parent=BALIOE_14905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5974 c1 Prodigal gene 2928844 2929290 . - . ID=BALIOE_14910_gene;locus_tag=BALIOE_14910 | |
| 5975 c1 Prodigal CDS 2928844 2929290 . - 0 ID=BALIOE_14910;Name=hypothetical protein;locus_tag=BALIOE_14910;product=hypothetical protein;Parent=BALIOE_14910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5976 c1 Prodigal gene 2929247 2929483 . - . ID=BALIOE_14915_gene;locus_tag=BALIOE_14915 | |
| 5977 c1 Prodigal CDS 2929247 2929483 . - 0 ID=BALIOE_14915;Name=hypothetical protein;locus_tag=BALIOE_14915;product=hypothetical protein;Parent=BALIOE_14915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5978 c1 Prodigal gene 2929494 2929709 . - . ID=BALIOE_14920_gene;locus_tag=BALIOE_14920 | |
| 5979 c1 Prodigal CDS 2929494 2929709 . - 0 ID=BALIOE_14920;Name=hypothetical protein;locus_tag=BALIOE_14920;product=hypothetical protein;Parent=BALIOE_14920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5980 c1 Prodigal gene 2929842 2930120 . - . ID=BALIOE_14925_gene;locus_tag=BALIOE_14925 | |
| 5981 c1 Prodigal CDS 2929842 2930120 . - 0 ID=BALIOE_14925;Name=hypothetical protein;locus_tag=BALIOE_14925;product=hypothetical protein;Parent=BALIOE_14925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5982 c1 Prodigal gene 2930191 2930481 . - . ID=BALIOE_14930_gene;locus_tag=BALIOE_14930 | |
| 5983 c1 Prodigal CDS 2930191 2930481 . - 0 ID=BALIOE_14930;Name=hypothetical protein;locus_tag=BALIOE_14930;product=hypothetical protein;Parent=BALIOE_14930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5984 c1 Prodigal gene 2930478 2931179 . - . ID=BALIOE_14935_gene;locus_tag=BALIOE_14935 | |
| 5985 c1 Prodigal CDS 2930478 2931179 . - 0 ID=BALIOE_14935;Name=hypothetical protein;locus_tag=BALIOE_14935;product=hypothetical protein;Parent=BALIOE_14935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5986 c1 Prodigal gene 2931176 2932114 . - . ID=BALIOE_14940_gene;locus_tag=BALIOE_14940 | |
| 5987 c1 Prodigal CDS 2931176 2932114 . - 0 ID=BALIOE_14940;Name=hypothetical protein;locus_tag=BALIOE_14940;product=hypothetical protein;Parent=BALIOE_14940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5988 c1 Prodigal gene 2932147 2932443 . - . ID=BALIOE_14945_gene;locus_tag=BALIOE_14945 | |
| 5989 c1 Prodigal CDS 2932147 2932443 . - 0 ID=BALIOE_14945;Name=hypothetical protein;locus_tag=BALIOE_14945;product=hypothetical protein;Parent=BALIOE_14945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5990 c1 Prodigal gene 2932558 2932776 . - . ID=BALIOE_14950_gene;locus_tag=BALIOE_14950 | |
| 5991 c1 Prodigal CDS 2932558 2932776 . - 0 ID=BALIOE_14950;Name=hypothetical protein;locus_tag=BALIOE_14950;product=hypothetical protein;Parent=BALIOE_14950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5992 c1 Prodigal gene 2932894 2933532 . + . ID=BALIOE_14955_gene;locus_tag=BALIOE_14955 | |
| 5993 c1 Prodigal CDS 2932894 2933532 . + 0 ID=BALIOE_14955;Name=hypothetical protein;locus_tag=BALIOE_14955;product=hypothetical protein;Parent=BALIOE_14955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5994 c1 Prodigal gene 2933655 2933936 . + . ID=BALIOE_14960_gene;locus_tag=BALIOE_14960 | |
| 5995 c1 Prodigal CDS 2933655 2933936 . + 0 ID=BALIOE_14960;Name=hypothetical protein;locus_tag=BALIOE_14960;product=hypothetical protein;Parent=BALIOE_14960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5996 c1 Prodigal gene 2933943 2934494 . + . ID=BALIOE_14965_gene;locus_tag=BALIOE_14965 | |
| 5997 c1 Prodigal CDS 2933943 2934494 . + 0 ID=BALIOE_14965;Name=hypothetical protein;locus_tag=BALIOE_14965;product=hypothetical protein;Parent=BALIOE_14965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 5998 c1 Prodigal gene 2935007 2935279 . + . ID=BALIOE_14970_gene;locus_tag=BALIOE_14970 | |
| 5999 c1 Prodigal CDS 2935007 2935279 . + 0 ID=BALIOE_14970;Name=hypothetical protein;locus_tag=BALIOE_14970;product=hypothetical protein;Parent=BALIOE_14970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6000 c1 Prodigal gene 2935296 2935877 . - . ID=BALIOE_14975_gene;locus_tag=BALIOE_14975 | |
| 6001 c1 Prodigal CDS 2935296 2935877 . - 0 ID=BALIOE_14975;Name=hypothetical protein;locus_tag=BALIOE_14975;product=hypothetical protein;Parent=BALIOE_14975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6002 c1 Prodigal gene 2936138 2936506 . + . ID=BALIOE_14980_gene;locus_tag=BALIOE_14980 | |
| 6003 c1 Prodigal CDS 2936138 2936506 . + 0 ID=BALIOE_14980;Name=hypothetical protein;locus_tag=BALIOE_14980;product=hypothetical protein;Parent=BALIOE_14980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6004 c1 Prodigal gene 2936579 2936743 . + . ID=BALIOE_14985_gene;locus_tag=BALIOE_14985 | |
| 6005 c1 Prodigal CDS 2936579 2936743 . + 0 ID=BALIOE_14985;Name=hypothetical protein;locus_tag=BALIOE_14985;product=hypothetical protein;Parent=BALIOE_14985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6006 c1 Prodigal gene 2936712 2936855 . + . ID=BALIOE_14990_gene;locus_tag=BALIOE_14990 | |
| 6007 c1 Prodigal CDS 2936712 2936855 . + 0 ID=BALIOE_14990;Name=hypothetical protein;locus_tag=BALIOE_14990;product=hypothetical protein;Parent=BALIOE_14990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6008 c1 Prodigal gene 2936931 2937227 . + . ID=BALIOE_14995_gene;locus_tag=BALIOE_14995 | |
| 6009 c1 Prodigal CDS 2936931 2937227 . + 0 ID=BALIOE_14995;Name=hypothetical protein;locus_tag=BALIOE_14995;product=hypothetical protein;Parent=BALIOE_14995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6010 c1 Prodigal gene 2937233 2938018 . + . ID=BALIOE_15000_gene;locus_tag=BALIOE_15000 | |
| 6011 c1 Prodigal CDS 2937233 2938018 . + 0 ID=BALIOE_15000;Name=hypothetical protein;locus_tag=BALIOE_15000;product=hypothetical protein;Parent=BALIOE_15000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6012 c1 Prodigal gene 2938015 2938692 . + . ID=BALIOE_15005_gene;locus_tag=BALIOE_15005 | |
| 6013 c1 Prodigal CDS 2938015 2938692 . + 0 ID=BALIOE_15005;Name=hypothetical protein;locus_tag=BALIOE_15005;product=hypothetical protein;Parent=BALIOE_15005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6014 c1 Prodigal gene 2938692 2938874 . + . ID=BALIOE_15010_gene;locus_tag=BALIOE_15010 | |
| 6015 c1 Prodigal CDS 2938692 2938874 . + 0 ID=BALIOE_15010;Name=hypothetical protein;locus_tag=BALIOE_15010;product=hypothetical protein;Parent=BALIOE_15010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6016 c1 Prodigal gene 2938847 2939038 . + . ID=BALIOE_15015_gene;locus_tag=BALIOE_15015 | |
| 6017 c1 Prodigal CDS 2938847 2939038 . + 0 ID=BALIOE_15015;Name=hypothetical protein;locus_tag=BALIOE_15015;product=hypothetical protein;Parent=BALIOE_15015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6018 c1 Prodigal gene 2939115 2939330 . + . ID=BALIOE_15020_gene;locus_tag=BALIOE_15020 | |
| 6019 c1 Prodigal CDS 2939115 2939330 . + 0 ID=BALIOE_15020;Name=hypothetical protein;locus_tag=BALIOE_15020;product=hypothetical protein;Parent=BALIOE_15020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6020 c1 Prodigal gene 2939429 2939650 . + . ID=BALIOE_15025_gene;locus_tag=BALIOE_15025 | |
| 6021 c1 Prodigal CDS 2939429 2939650 . + 0 ID=BALIOE_15025;Name=hypothetical protein;locus_tag=BALIOE_15025;product=hypothetical protein;Parent=BALIOE_15025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6022 c1 Prodigal gene 2939647 2940594 . + . ID=BALIOE_15030_gene;locus_tag=BALIOE_15030 | |
| 6023 c1 Prodigal CDS 2939647 2940594 . + 0 ID=BALIOE_15030;Name=hypothetical protein;locus_tag=BALIOE_15030;product=hypothetical protein;Parent=BALIOE_15030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6024 c1 Prodigal gene 2940596 2940772 . + . ID=BALIOE_15035_gene;locus_tag=BALIOE_15035 | |
| 6025 c1 Prodigal CDS 2940596 2940772 . + 0 ID=BALIOE_15035;Name=hypothetical protein;locus_tag=BALIOE_15035;product=hypothetical protein;Parent=BALIOE_15035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6026 c1 Prodigal gene 2941106 2941462 . + . ID=BALIOE_15040_gene;locus_tag=BALIOE_15040 | |
| 6027 c1 Prodigal CDS 2941106 2941462 . + 0 ID=BALIOE_15040;Name=hypothetical protein;locus_tag=BALIOE_15040;product=hypothetical protein;Parent=BALIOE_15040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6028 c1 Prodigal gene 2941459 2941821 . + . ID=BALIOE_15045_gene;locus_tag=BALIOE_15045 | |
| 6029 c1 Prodigal CDS 2941459 2941821 . + 0 ID=BALIOE_15045;Name=hypothetical protein;locus_tag=BALIOE_15045;product=hypothetical protein;Parent=BALIOE_15045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6030 c1 Prodigal gene 2941909 2942151 . + . ID=BALIOE_15050_gene;locus_tag=BALIOE_15050 | |
| 6031 c1 Prodigal CDS 2941909 2942151 . + 0 ID=BALIOE_15050;Name=hypothetical protein;locus_tag=BALIOE_15050;product=hypothetical protein;Parent=BALIOE_15050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6032 c1 Prodigal gene 2942155 2942289 . + . ID=BALIOE_15055_gene;locus_tag=BALIOE_15055 | |
| 6033 c1 Prodigal CDS 2942155 2942289 . + 0 ID=BALIOE_15055;Name=hypothetical protein;locus_tag=BALIOE_15055;product=hypothetical protein;Parent=BALIOE_15055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6034 c1 Prodigal gene 2942308 2942562 . + . ID=BALIOE_15060_gene;locus_tag=BALIOE_15060 | |
| 6035 c1 Prodigal CDS 2942308 2942562 . + 0 ID=BALIOE_15060;Name=hypothetical protein;locus_tag=BALIOE_15060;product=hypothetical protein;Parent=BALIOE_15060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6036 c1 Prodigal gene 2942596 2943882 . + . ID=BALIOE_15065_gene;locus_tag=BALIOE_15065 | |
| 6037 c1 Prodigal CDS 2942596 2943882 . + 0 ID=BALIOE_15065;Name=hypothetical protein;locus_tag=BALIOE_15065;product=hypothetical protein;Parent=BALIOE_15065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6038 c1 Prodigal gene 2943957 2944604 . + . ID=BALIOE_15070_gene;locus_tag=BALIOE_15070 | |
| 6039 c1 Prodigal CDS 2943957 2944604 . + 0 ID=BALIOE_15070;Name=hypothetical protein;locus_tag=BALIOE_15070;product=hypothetical protein;Parent=BALIOE_15070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6040 c1 Prodigal gene 2944664 2944771 . + . ID=BALIOE_15075_gene;locus_tag=BALIOE_15075 | |
| 6041 c1 Prodigal CDS 2944664 2944771 . + 0 ID=BALIOE_15075;Name=hypothetical protein;locus_tag=BALIOE_15075;product=hypothetical protein;Parent=BALIOE_15075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6042 c1 Prodigal gene 2944752 2945483 . - . ID=BALIOE_15080_gene;locus_tag=BALIOE_15080 | |
| 6043 c1 Prodigal CDS 2944752 2945483 . - 0 ID=BALIOE_15080;Name=hypothetical protein;locus_tag=BALIOE_15080;product=hypothetical protein;Parent=BALIOE_15080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6044 c1 Prodigal gene 2945488 2946414 . - . ID=BALIOE_15085_gene;locus_tag=BALIOE_15085 | |
| 6045 c1 Prodigal CDS 2945488 2946414 . - 0 ID=BALIOE_15085;Name=hypothetical protein;locus_tag=BALIOE_15085;product=hypothetical protein;Parent=BALIOE_15085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6046 c1 Prodigal gene 2946407 2947564 . - . ID=BALIOE_15090_gene;locus_tag=BALIOE_15090 | |
| 6047 c1 Prodigal CDS 2946407 2947564 . - 0 ID=BALIOE_15090;Name=hypothetical protein;locus_tag=BALIOE_15090;product=hypothetical protein;Parent=BALIOE_15090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6048 c1 Prodigal gene 2947571 2948488 . - . ID=BALIOE_15095_gene;locus_tag=BALIOE_15095 | |
| 6049 c1 Prodigal CDS 2947571 2948488 . - 0 ID=BALIOE_15095;Name=hypothetical protein;locus_tag=BALIOE_15095;product=hypothetical protein;Parent=BALIOE_15095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6050 c1 Prodigal gene 2948740 2951007 . - . ID=BALIOE_15100_gene;locus_tag=BALIOE_15100 | |
| 6051 c1 Prodigal CDS 2948740 2951007 . - 0 ID=BALIOE_15100;Name=hypothetical protein;locus_tag=BALIOE_15100;product=hypothetical protein;Parent=BALIOE_15100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6052 c1 Prodigal gene 2951233 2952948 . + . ID=BALIOE_15105_gene;locus_tag=BALIOE_15105 | |
| 6053 c1 Prodigal CDS 2951233 2952948 . + 0 ID=BALIOE_15105;Name=hypothetical protein;locus_tag=BALIOE_15105;product=hypothetical protein;Parent=BALIOE_15105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6054 c1 Prodigal gene 2952986 2953918 . - . ID=BALIOE_15110_gene;locus_tag=BALIOE_15110 | |
| 6055 c1 Prodigal CDS 2952986 2953918 . - 0 ID=BALIOE_15110;Name=hypothetical protein;locus_tag=BALIOE_15110;product=hypothetical protein;Parent=BALIOE_15110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6056 c1 Prodigal gene 2954092 2954679 . - . ID=BALIOE_15115_gene;locus_tag=BALIOE_15115 | |
| 6057 c1 Prodigal CDS 2954092 2954679 . - 0 ID=BALIOE_15115;Name=hypothetical protein;locus_tag=BALIOE_15115;product=hypothetical protein;Parent=BALIOE_15115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6058 c1 Prodigal gene 2954849 2955427 . + . ID=BALIOE_15120_gene;locus_tag=BALIOE_15120 | |
| 6059 c1 Prodigal CDS 2954849 2955427 . + 0 ID=BALIOE_15120;Name=hypothetical protein;locus_tag=BALIOE_15120;product=hypothetical protein;Parent=BALIOE_15120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6060 c1 Prodigal gene 2955557 2956318 . - . ID=BALIOE_15125_gene;locus_tag=BALIOE_15125 | |
| 6061 c1 Prodigal CDS 2955557 2956318 . - 0 ID=BALIOE_15125;Name=hypothetical protein;locus_tag=BALIOE_15125;product=hypothetical protein;Parent=BALIOE_15125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6062 c1 Prodigal gene 2956371 2957897 . - . ID=BALIOE_15130_gene;locus_tag=BALIOE_15130 | |
| 6063 c1 Prodigal CDS 2956371 2957897 . - 0 ID=BALIOE_15130;Name=hypothetical protein;locus_tag=BALIOE_15130;product=hypothetical protein;Parent=BALIOE_15130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6064 c1 Prodigal gene 2958502 2959452 . - . ID=BALIOE_15135_gene;locus_tag=BALIOE_15135 | |
| 6065 c1 Prodigal CDS 2958502 2959452 . - 0 ID=BALIOE_15135;Name=hypothetical protein;locus_tag=BALIOE_15135;product=hypothetical protein;Parent=BALIOE_15135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6066 c1 Prodigal gene 2959612 2960805 . - . ID=BALIOE_15140_gene;locus_tag=BALIOE_15140 | |
| 6067 c1 Prodigal CDS 2959612 2960805 . - 0 ID=BALIOE_15140;Name=hypothetical protein;locus_tag=BALIOE_15140;product=hypothetical protein;Parent=BALIOE_15140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6068 c1 Prodigal gene 2960820 2961464 . - . ID=BALIOE_15145_gene;locus_tag=BALIOE_15145 | |
| 6069 c1 Prodigal CDS 2960820 2961464 . - 0 ID=BALIOE_15145;Name=hypothetical protein;locus_tag=BALIOE_15145;product=hypothetical protein;Parent=BALIOE_15145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6070 c1 Prodigal gene 2961473 2962174 . - . ID=BALIOE_15150_gene;locus_tag=BALIOE_15150 | |
| 6071 c1 Prodigal CDS 2961473 2962174 . - 0 ID=BALIOE_15150;Name=hypothetical protein;locus_tag=BALIOE_15150;product=hypothetical protein;Parent=BALIOE_15150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6072 c1 Prodigal gene 2962189 2963217 . - . ID=BALIOE_15155_gene;locus_tag=BALIOE_15155 | |
| 6073 c1 Prodigal CDS 2962189 2963217 . - 0 ID=BALIOE_15155;Name=hypothetical protein;locus_tag=BALIOE_15155;product=hypothetical protein;Parent=BALIOE_15155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6074 c1 Prodigal gene 2963229 2964587 . - . ID=BALIOE_15160_gene;locus_tag=BALIOE_15160 | |
| 6075 c1 Prodigal CDS 2963229 2964587 . - 0 ID=BALIOE_15160;Name=hypothetical protein;locus_tag=BALIOE_15160;product=hypothetical protein;Parent=BALIOE_15160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6076 c1 Prodigal gene 2964714 2965622 . + . ID=BALIOE_15165_gene;locus_tag=BALIOE_15165 | |
| 6077 c1 Prodigal CDS 2964714 2965622 . + 0 ID=BALIOE_15165;Name=hypothetical protein;locus_tag=BALIOE_15165;product=hypothetical protein;Parent=BALIOE_15165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6078 c1 Prodigal gene 2965753 2966151 . + . ID=BALIOE_15170_gene;locus_tag=BALIOE_15170 | |
| 6079 c1 Prodigal CDS 2965753 2966151 . + 0 ID=BALIOE_15170;Name=hypothetical protein;locus_tag=BALIOE_15170;product=hypothetical protein;Parent=BALIOE_15170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6080 c1 Prodigal gene 2966148 2966843 . + . ID=BALIOE_15175_gene;locus_tag=BALIOE_15175 | |
| 6081 c1 Prodigal CDS 2966148 2966843 . + 0 ID=BALIOE_15175;Name=hypothetical protein;locus_tag=BALIOE_15175;product=hypothetical protein;Parent=BALIOE_15175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6082 c1 Prodigal gene 2966973 2967857 . + . ID=BALIOE_15180_gene;locus_tag=BALIOE_15180 | |
| 6083 c1 Prodigal CDS 2966973 2967857 . + 0 ID=BALIOE_15180;Name=hypothetical protein;locus_tag=BALIOE_15180;product=hypothetical protein;Parent=BALIOE_15180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6084 c1 Prodigal gene 2968007 2968726 . + . ID=BALIOE_15185_gene;locus_tag=BALIOE_15185 | |
| 6085 c1 Prodigal CDS 2968007 2968726 . + 0 ID=BALIOE_15185;Name=hypothetical protein;locus_tag=BALIOE_15185;product=hypothetical protein;Parent=BALIOE_15185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6086 c1 Prodigal gene 2968729 2968968 . + . ID=BALIOE_15190_gene;locus_tag=BALIOE_15190 | |
| 6087 c1 Prodigal CDS 2968729 2968968 . + 0 ID=BALIOE_15190;Name=hypothetical protein;locus_tag=BALIOE_15190;product=hypothetical protein;Parent=BALIOE_15190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6088 c1 Prodigal gene 2969162 2970400 . + . ID=BALIOE_15195_gene;locus_tag=BALIOE_15195 | |
| 6089 c1 Prodigal CDS 2969162 2970400 . + 0 ID=BALIOE_15195;Name=hypothetical protein;locus_tag=BALIOE_15195;product=hypothetical protein;Parent=BALIOE_15195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6090 c1 Prodigal gene 2970394 2971629 . + . ID=BALIOE_15200_gene;locus_tag=BALIOE_15200 | |
| 6091 c1 Prodigal CDS 2970394 2971629 . + 0 ID=BALIOE_15200;Name=hypothetical protein;locus_tag=BALIOE_15200;product=hypothetical protein;Parent=BALIOE_15200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6092 c1 Infernal gene 2971732 2971809 . - . ID=BALIOE_15205_gene;locus_tag=BALIOE_15205;gene=naRNA4 | |
| 6093 c1 Infernal ncRNA 2971732 2971809 6.4e-13 - . ID=BALIOE_15205;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_15205;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_15205_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 6094 c1 Prodigal gene 2971872 2972882 . - . ID=BALIOE_15210_gene;locus_tag=BALIOE_15210 | |
| 6095 c1 Prodigal CDS 2971872 2972882 . - 0 ID=BALIOE_15210;Name=hypothetical protein;locus_tag=BALIOE_15210;product=hypothetical protein;Parent=BALIOE_15210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6096 c1 Prodigal gene 2972898 2974418 . - . ID=BALIOE_15215_gene;locus_tag=BALIOE_15215 | |
| 6097 c1 Prodigal CDS 2972898 2974418 . - 0 ID=BALIOE_15215;Name=hypothetical protein;locus_tag=BALIOE_15215;product=hypothetical protein;Parent=BALIOE_15215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6098 c1 Prodigal gene 2974479 2975477 . - . ID=BALIOE_15220_gene;locus_tag=BALIOE_15220 | |
| 6099 c1 Prodigal CDS 2974479 2975477 . - 0 ID=BALIOE_15220;Name=hypothetical protein;locus_tag=BALIOE_15220;product=hypothetical protein;Parent=BALIOE_15220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6100 c1 Prodigal gene 2975756 2976796 . - . ID=BALIOE_15225_gene;locus_tag=BALIOE_15225 | |
| 6101 c1 Prodigal CDS 2975756 2976796 . - 0 ID=BALIOE_15225;Name=hypothetical protein;locus_tag=BALIOE_15225;product=hypothetical protein;Parent=BALIOE_15225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6102 c1 Prodigal gene 2976938 2978095 . - . ID=BALIOE_15230_gene;locus_tag=BALIOE_15230 | |
| 6103 c1 Prodigal CDS 2976938 2978095 . - 0 ID=BALIOE_15230;Name=hypothetical protein;locus_tag=BALIOE_15230;product=hypothetical protein;Parent=BALIOE_15230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6104 c1 Prodigal gene 2978112 2978780 . - . ID=BALIOE_15235_gene;locus_tag=BALIOE_15235 | |
| 6105 c1 Prodigal CDS 2978112 2978780 . - 0 ID=BALIOE_15235;Name=hypothetical protein;locus_tag=BALIOE_15235;product=hypothetical protein;Parent=BALIOE_15235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6106 c1 Prodigal gene 2979038 2979874 . + . ID=BALIOE_15240_gene;locus_tag=BALIOE_15240 | |
| 6107 c1 Prodigal CDS 2979038 2979874 . + 0 ID=BALIOE_15240;Name=hypothetical protein;locus_tag=BALIOE_15240;product=hypothetical protein;Parent=BALIOE_15240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6108 c1 Prodigal gene 2979906 2981885 . - . ID=BALIOE_15245_gene;locus_tag=BALIOE_15245 | |
| 6109 c1 Prodigal CDS 2979906 2981885 . - 0 ID=BALIOE_15245;Name=hypothetical protein;locus_tag=BALIOE_15245;product=hypothetical protein;Parent=BALIOE_15245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6110 c1 Prodigal gene 2982177 2983646 . - . ID=BALIOE_15250_gene;locus_tag=BALIOE_15250 | |
| 6111 c1 Prodigal CDS 2982177 2983646 . - 0 ID=BALIOE_15250;Name=hypothetical protein;locus_tag=BALIOE_15250;product=hypothetical protein;Parent=BALIOE_15250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6112 c1 Prodigal gene 2983851 2984732 . - . ID=BALIOE_15255_gene;locus_tag=BALIOE_15255 | |
| 6113 c1 Prodigal CDS 2983851 2984732 . - 0 ID=BALIOE_15255;Name=hypothetical protein;locus_tag=BALIOE_15255;product=hypothetical protein;Parent=BALIOE_15255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6114 c1 Prodigal gene 2984831 2985880 . + . ID=BALIOE_15260_gene;locus_tag=BALIOE_15260 | |
| 6115 c1 Prodigal CDS 2984831 2985880 . + 0 ID=BALIOE_15260;Name=hypothetical protein;locus_tag=BALIOE_15260;product=hypothetical protein;Parent=BALIOE_15260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6116 c1 Prodigal gene 2985954 2986811 . + . ID=BALIOE_15265_gene;locus_tag=BALIOE_15265 | |
| 6117 c1 Prodigal CDS 2985954 2986811 . + 0 ID=BALIOE_15265;Name=hypothetical protein;locus_tag=BALIOE_15265;product=hypothetical protein;Parent=BALIOE_15265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6118 c1 Prodigal gene 2986814 2987902 . + . ID=BALIOE_15270_gene;locus_tag=BALIOE_15270 | |
| 6119 c1 Prodigal CDS 2986814 2987902 . + 0 ID=BALIOE_15270;Name=hypothetical protein;locus_tag=BALIOE_15270;product=hypothetical protein;Parent=BALIOE_15270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6120 c1 Prodigal gene 2987958 2989208 . - . ID=BALIOE_15275_gene;locus_tag=BALIOE_15275 | |
| 6121 c1 Prodigal CDS 2987958 2989208 . - 0 ID=BALIOE_15275;Name=hypothetical protein;locus_tag=BALIOE_15275;product=hypothetical protein;Parent=BALIOE_15275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6122 c1 Prodigal gene 2989308 2990249 . - . ID=BALIOE_15280_gene;locus_tag=BALIOE_15280 | |
| 6123 c1 Prodigal CDS 2989308 2990249 . - 0 ID=BALIOE_15280;Name=hypothetical protein;locus_tag=BALIOE_15280;product=hypothetical protein;Parent=BALIOE_15280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6124 c1 Prodigal gene 2990379 2991077 . + . ID=BALIOE_15285_gene;locus_tag=BALIOE_15285 | |
| 6125 c1 Prodigal CDS 2990379 2991077 . + 0 ID=BALIOE_15285;Name=hypothetical protein;locus_tag=BALIOE_15285;product=hypothetical protein;Parent=BALIOE_15285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6126 c1 Prodigal gene 2991148 2992398 . - . ID=BALIOE_15290_gene;locus_tag=BALIOE_15290 | |
| 6127 c1 Prodigal CDS 2991148 2992398 . - 0 ID=BALIOE_15290;Name=hypothetical protein;locus_tag=BALIOE_15290;product=hypothetical protein;Parent=BALIOE_15290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6128 c1 Prodigal gene 2992492 2993430 . - . ID=BALIOE_15295_gene;locus_tag=BALIOE_15295 | |
| 6129 c1 Prodigal CDS 2992492 2993430 . - 0 ID=BALIOE_15295;Name=hypothetical protein;locus_tag=BALIOE_15295;product=hypothetical protein;Parent=BALIOE_15295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6130 c1 Prodigal gene 2993418 2994359 . - . ID=BALIOE_15300_gene;locus_tag=BALIOE_15300 | |
| 6131 c1 Prodigal CDS 2993418 2994359 . - 0 ID=BALIOE_15300;Name=hypothetical protein;locus_tag=BALIOE_15300;product=hypothetical protein;Parent=BALIOE_15300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6132 c1 Prodigal gene 2994783 2996474 . - . ID=BALIOE_15305_gene;locus_tag=BALIOE_15305 | |
| 6133 c1 Prodigal CDS 2994783 2996474 . - 0 ID=BALIOE_15305;Name=hypothetical protein;locus_tag=BALIOE_15305;product=hypothetical protein;Parent=BALIOE_15305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6134 c1 Prodigal gene 2996491 2997429 . - . ID=BALIOE_15310_gene;locus_tag=BALIOE_15310 | |
| 6135 c1 Prodigal CDS 2996491 2997429 . - 0 ID=BALIOE_15310;Name=hypothetical protein;locus_tag=BALIOE_15310;product=hypothetical protein;Parent=BALIOE_15310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6136 c1 Prodigal gene 2997429 2998559 . - . ID=BALIOE_15315_gene;locus_tag=BALIOE_15315 | |
| 6137 c1 Prodigal CDS 2997429 2998559 . - 0 ID=BALIOE_15315;Name=hypothetical protein;locus_tag=BALIOE_15315;product=hypothetical protein;Parent=BALIOE_15315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6138 c1 Prodigal gene 2998927 3000108 . + . ID=BALIOE_15320_gene;locus_tag=BALIOE_15320 | |
| 6139 c1 Prodigal CDS 2998927 3000108 . + 0 ID=BALIOE_15320;Name=hypothetical protein;locus_tag=BALIOE_15320;product=hypothetical protein;Parent=BALIOE_15320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6140 c1 Prodigal gene 3000105 3000359 . - . ID=BALIOE_15325_gene;locus_tag=BALIOE_15325 | |
| 6141 c1 Prodigal CDS 3000105 3000359 . - 0 ID=BALIOE_15325;Name=hypothetical protein;locus_tag=BALIOE_15325;product=hypothetical protein;Parent=BALIOE_15325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6142 c1 Prodigal gene 3000514 3001086 . + . ID=BALIOE_15330_gene;locus_tag=BALIOE_15330 | |
| 6143 c1 Prodigal CDS 3000514 3001086 . + 0 ID=BALIOE_15330;Name=hypothetical protein;locus_tag=BALIOE_15330;product=hypothetical protein;Parent=BALIOE_15330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6144 c1 Prodigal gene 3001300 3002775 . + . ID=BALIOE_15335_gene;locus_tag=BALIOE_15335 | |
| 6145 c1 Prodigal CDS 3001300 3002775 . + 0 ID=BALIOE_15335;Name=hypothetical protein;locus_tag=BALIOE_15335;product=hypothetical protein;Parent=BALIOE_15335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6146 c1 Prodigal gene 3002893 3003879 . + . ID=BALIOE_15340_gene;locus_tag=BALIOE_15340 | |
| 6147 c1 Prodigal CDS 3002893 3003879 . + 0 ID=BALIOE_15340;Name=hypothetical protein;locus_tag=BALIOE_15340;product=hypothetical protein;Parent=BALIOE_15340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6148 c1 Prodigal gene 3003918 3004631 . + . ID=BALIOE_15345_gene;locus_tag=BALIOE_15345 | |
| 6149 c1 Prodigal CDS 3003918 3004631 . + 0 ID=BALIOE_15345;Name=hypothetical protein;locus_tag=BALIOE_15345;product=hypothetical protein;Parent=BALIOE_15345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6150 c1 Prodigal gene 3005044 3005610 . + . ID=BALIOE_15350_gene;locus_tag=BALIOE_15350 | |
| 6151 c1 Prodigal CDS 3005044 3005610 . + 0 ID=BALIOE_15350;Name=hypothetical protein;locus_tag=BALIOE_15350;product=hypothetical protein;Parent=BALIOE_15350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6152 c1 Prodigal gene 3005791 3007347 . + . ID=BALIOE_15355_gene;locus_tag=BALIOE_15355 | |
| 6153 c1 Prodigal CDS 3005791 3007347 . + 0 ID=BALIOE_15355;Name=hypothetical protein;locus_tag=BALIOE_15355;product=hypothetical protein;Parent=BALIOE_15355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6154 c1 Prodigal gene 3007429 3009243 . + . ID=BALIOE_15360_gene;locus_tag=BALIOE_15360 | |
| 6155 c1 Prodigal CDS 3007429 3009243 . + 0 ID=BALIOE_15360;Name=hypothetical protein;locus_tag=BALIOE_15360;product=hypothetical protein;Parent=BALIOE_15360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6156 c1 Prodigal gene 3009244 3010338 . + . ID=BALIOE_15365_gene;locus_tag=BALIOE_15365 | |
| 6157 c1 Prodigal CDS 3009244 3010338 . + 0 ID=BALIOE_15365;Name=hypothetical protein;locus_tag=BALIOE_15365;product=hypothetical protein;Parent=BALIOE_15365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6158 c1 Prodigal gene 3010338 3011363 . + . ID=BALIOE_15370_gene;locus_tag=BALIOE_15370 | |
| 6159 c1 Prodigal CDS 3010338 3011363 . + 0 ID=BALIOE_15370;Name=hypothetical protein;locus_tag=BALIOE_15370;product=hypothetical protein;Parent=BALIOE_15370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6160 c1 Prodigal gene 3011365 3012954 . + . ID=BALIOE_15375_gene;locus_tag=BALIOE_15375 | |
| 6161 c1 Prodigal CDS 3011365 3012954 . + 0 ID=BALIOE_15375;Name=hypothetical protein;locus_tag=BALIOE_15375;product=hypothetical protein;Parent=BALIOE_15375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6162 c1 Prodigal gene 3012958 3013302 . - . ID=BALIOE_15380_gene;locus_tag=BALIOE_15380 | |
| 6163 c1 Prodigal CDS 3012958 3013302 . - 0 ID=BALIOE_15380;Name=hypothetical protein;locus_tag=BALIOE_15380;product=hypothetical protein;Parent=BALIOE_15380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6164 c1 Prodigal gene 3013635 3014825 . - . ID=BALIOE_15385_gene;locus_tag=BALIOE_15385 | |
| 6165 c1 Prodigal CDS 3013635 3014825 . - 0 ID=BALIOE_15385;Name=hypothetical protein;locus_tag=BALIOE_15385;product=hypothetical protein;Parent=BALIOE_15385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6166 c1 Prodigal gene 3014853 3015548 . - . ID=BALIOE_15390_gene;locus_tag=BALIOE_15390 | |
| 6167 c1 Prodigal CDS 3014853 3015548 . - 0 ID=BALIOE_15390;Name=hypothetical protein;locus_tag=BALIOE_15390;product=hypothetical protein;Parent=BALIOE_15390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6168 c1 Prodigal gene 3015697 3017457 . + . ID=BALIOE_15395_gene;locus_tag=BALIOE_15395 | |
| 6169 c1 Prodigal CDS 3015697 3017457 . + 0 ID=BALIOE_15395;Name=hypothetical protein;locus_tag=BALIOE_15395;product=hypothetical protein;Parent=BALIOE_15395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6170 c1 Prodigal gene 3017582 3017866 . + . ID=BALIOE_15400_gene;locus_tag=BALIOE_15400 | |
| 6171 c1 Prodigal CDS 3017582 3017866 . + 0 ID=BALIOE_15400;Name=hypothetical protein;locus_tag=BALIOE_15400;product=hypothetical protein;Parent=BALIOE_15400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6172 c1 Prodigal gene 3018005 3019012 . - . ID=BALIOE_15405_gene;locus_tag=BALIOE_15405 | |
| 6173 c1 Prodigal CDS 3018005 3019012 . - 0 ID=BALIOE_15405;Name=hypothetical protein;locus_tag=BALIOE_15405;product=hypothetical protein;Parent=BALIOE_15405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6174 c1 Prodigal gene 3019194 3019421 . + . ID=BALIOE_15410_gene;locus_tag=BALIOE_15410 | |
| 6175 c1 Prodigal CDS 3019194 3019421 . + 0 ID=BALIOE_15410;Name=hypothetical protein;locus_tag=BALIOE_15410;product=hypothetical protein;Parent=BALIOE_15410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6176 c1 Prodigal gene 3019441 3021201 . + . ID=BALIOE_15415_gene;locus_tag=BALIOE_15415 | |
| 6177 c1 Prodigal CDS 3019441 3021201 . + 0 ID=BALIOE_15415;Name=hypothetical protein;locus_tag=BALIOE_15415;product=hypothetical protein;Parent=BALIOE_15415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6178 c1 tRNAscan-SE gene 3021276 3021352 . + . ID=BALIOE_15420_gene;locus_tag=BALIOE_15420;gene=Pro_trna | |
| 6179 c1 tRNAscan-SE tRNA 3021276 3021352 . + . ID=BALIOE_15420;Name=tRNA-Pro;locus_tag=BALIOE_15420;product=tRNA-Pro;gene=Pro_trna;Parent=BALIOE_15420_gene;inference=profile:tRNAscan:2.0;Note=SO:0000268 | |
| 6180 c1 Prodigal gene 3021453 3024044 . - . ID=BALIOE_15425_gene;locus_tag=BALIOE_15425 | |
| 6181 c1 Prodigal CDS 3021453 3024044 . - 0 ID=BALIOE_15425;Name=hypothetical protein;locus_tag=BALIOE_15425;product=hypothetical protein;Parent=BALIOE_15425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6182 c1 Prodigal gene 3024364 3025011 . + . ID=BALIOE_15430_gene;locus_tag=BALIOE_15430 | |
| 6183 c1 Prodigal CDS 3024364 3025011 . + 0 ID=BALIOE_15430;Name=hypothetical protein;locus_tag=BALIOE_15430;product=hypothetical protein;Parent=BALIOE_15430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6184 c1 Prodigal gene 3025046 3026098 . - . ID=BALIOE_15435_gene;locus_tag=BALIOE_15435 | |
| 6185 c1 Prodigal CDS 3025046 3026098 . - 0 ID=BALIOE_15435;Name=hypothetical protein;locus_tag=BALIOE_15435;product=hypothetical protein;Parent=BALIOE_15435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6186 c1 Prodigal gene 3026095 3026652 . - . ID=BALIOE_15440_gene;locus_tag=BALIOE_15440 | |
| 6187 c1 Prodigal CDS 3026095 3026652 . - 0 ID=BALIOE_15440;Name=hypothetical protein;locus_tag=BALIOE_15440;product=hypothetical protein;Parent=BALIOE_15440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6188 c1 Prodigal gene 3026649 3028592 . - . ID=BALIOE_15445_gene;locus_tag=BALIOE_15445 | |
| 6189 c1 Prodigal CDS 3026649 3028592 . - 0 ID=BALIOE_15445;Name=hypothetical protein;locus_tag=BALIOE_15445;product=hypothetical protein;Parent=BALIOE_15445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6190 c1 Prodigal gene 3028589 3029068 . - . ID=BALIOE_15450_gene;locus_tag=BALIOE_15450 | |
| 6191 c1 Prodigal CDS 3028589 3029068 . - 0 ID=BALIOE_15450;Name=hypothetical protein;locus_tag=BALIOE_15450;product=hypothetical protein;Parent=BALIOE_15450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6192 c1 Prodigal gene 3029065 3029274 . - . ID=BALIOE_15455_gene;locus_tag=BALIOE_15455 | |
| 6193 c1 Prodigal CDS 3029065 3029274 . - 0 ID=BALIOE_15455;Name=hypothetical protein;locus_tag=BALIOE_15455;product=hypothetical protein;Parent=BALIOE_15455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6194 c1 Prodigal gene 3029271 3030008 . - . ID=BALIOE_15460_gene;locus_tag=BALIOE_15460 | |
| 6195 c1 Prodigal CDS 3029271 3030008 . - 0 ID=BALIOE_15460;Name=hypothetical protein;locus_tag=BALIOE_15460;product=hypothetical protein;Parent=BALIOE_15460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6196 c1 Prodigal gene 3030050 3030712 . - . ID=BALIOE_15465_gene;locus_tag=BALIOE_15465 | |
| 6197 c1 Prodigal CDS 3030050 3030712 . - 0 ID=BALIOE_15465;Name=hypothetical protein;locus_tag=BALIOE_15465;product=hypothetical protein;Parent=BALIOE_15465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6198 c1 Prodigal gene 3030709 3031326 . - . ID=BALIOE_15470_gene;locus_tag=BALIOE_15470 | |
| 6199 c1 Prodigal CDS 3030709 3031326 . - 0 ID=BALIOE_15470;Name=hypothetical protein;locus_tag=BALIOE_15470;product=hypothetical protein;Parent=BALIOE_15470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6200 c1 Prodigal gene 3031345 3031947 . - . ID=BALIOE_15475_gene;locus_tag=BALIOE_15475 | |
| 6201 c1 Prodigal CDS 3031345 3031947 . - 0 ID=BALIOE_15475;Name=hypothetical protein;locus_tag=BALIOE_15475;product=hypothetical protein;Parent=BALIOE_15475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6202 c1 Prodigal gene 3031957 3032406 . - . ID=BALIOE_15480_gene;locus_tag=BALIOE_15480 | |
| 6203 c1 Prodigal CDS 3031957 3032406 . - 0 ID=BALIOE_15480;Name=hypothetical protein;locus_tag=BALIOE_15480;product=hypothetical protein;Parent=BALIOE_15480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6204 c1 Prodigal gene 3032403 3033266 . - . ID=BALIOE_15485_gene;locus_tag=BALIOE_15485 | |
| 6205 c1 Prodigal CDS 3032403 3033266 . - 0 ID=BALIOE_15485;Name=hypothetical protein;locus_tag=BALIOE_15485;product=hypothetical protein;Parent=BALIOE_15485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6206 c1 Prodigal gene 3033253 3033948 . - . ID=BALIOE_15490_gene;locus_tag=BALIOE_15490 | |
| 6207 c1 Prodigal CDS 3033253 3033948 . - 0 ID=BALIOE_15490;Name=hypothetical protein;locus_tag=BALIOE_15490;product=hypothetical protein;Parent=BALIOE_15490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6208 c1 Prodigal gene 3033955 3036441 . - . ID=BALIOE_15495_gene;locus_tag=BALIOE_15495 | |
| 6209 c1 Prodigal CDS 3033955 3036441 . - 0 ID=BALIOE_15495;Name=hypothetical protein;locus_tag=BALIOE_15495;product=hypothetical protein;Parent=BALIOE_15495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6210 c1 Prodigal gene 3036438 3036701 . - . ID=BALIOE_15500_gene;locus_tag=BALIOE_15500 | |
| 6211 c1 Prodigal CDS 3036438 3036701 . - 0 ID=BALIOE_15500;Name=hypothetical protein;locus_tag=BALIOE_15500;product=hypothetical protein;Parent=BALIOE_15500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6212 c1 Prodigal gene 3036691 3037185 . - . ID=BALIOE_15505_gene;locus_tag=BALIOE_15505 | |
| 6213 c1 Prodigal CDS 3036691 3037185 . - 0 ID=BALIOE_15505;Name=hypothetical protein;locus_tag=BALIOE_15505;product=hypothetical protein;Parent=BALIOE_15505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6214 c1 Prodigal gene 3037294 3037458 . + . ID=BALIOE_15510_gene;locus_tag=BALIOE_15510 | |
| 6215 c1 Prodigal CDS 3037294 3037458 . + 0 ID=BALIOE_15510;Name=hypothetical protein;locus_tag=BALIOE_15510;product=hypothetical protein;Parent=BALIOE_15510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6216 c1 Prodigal gene 3037592 3038080 . + . ID=BALIOE_15515_gene;locus_tag=BALIOE_15515 | |
| 6217 c1 Prodigal CDS 3037592 3038080 . + 0 ID=BALIOE_15515;Name=hypothetical protein;locus_tag=BALIOE_15515;product=hypothetical protein;Parent=BALIOE_15515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6218 c1 Prodigal gene 3038230 3039876 . - . ID=BALIOE_15520_gene;locus_tag=BALIOE_15520 | |
| 6219 c1 Prodigal CDS 3038230 3039876 . - 0 ID=BALIOE_15520;Name=hypothetical protein;locus_tag=BALIOE_15520;product=hypothetical protein;Parent=BALIOE_15520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6220 c1 Prodigal gene 3040094 3041737 . - . ID=BALIOE_15525_gene;locus_tag=BALIOE_15525 | |
| 6221 c1 Prodigal CDS 3040094 3041737 . - 0 ID=BALIOE_15525;Name=hypothetical protein;locus_tag=BALIOE_15525;product=hypothetical protein;Parent=BALIOE_15525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6222 c1 Prodigal gene 3041813 3042463 . - . ID=BALIOE_15530_gene;locus_tag=BALIOE_15530 | |
| 6223 c1 Prodigal CDS 3041813 3042463 . - 0 ID=BALIOE_15530;Name=hypothetical protein;locus_tag=BALIOE_15530;product=hypothetical protein;Parent=BALIOE_15530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6224 c1 Prodigal gene 3042463 3043527 . - . ID=BALIOE_15535_gene;locus_tag=BALIOE_15535 | |
| 6225 c1 Prodigal CDS 3042463 3043527 . - 0 ID=BALIOE_15535;Name=hypothetical protein;locus_tag=BALIOE_15535;product=hypothetical protein;Parent=BALIOE_15535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6226 c1 Prodigal gene 3043601 3044656 . - . ID=BALIOE_15540_gene;locus_tag=BALIOE_15540 | |
| 6227 c1 Prodigal CDS 3043601 3044656 . - 0 ID=BALIOE_15540;Name=hypothetical protein;locus_tag=BALIOE_15540;product=hypothetical protein;Parent=BALIOE_15540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6228 c1 Prodigal gene 3044768 3045871 . - . ID=BALIOE_15545_gene;locus_tag=BALIOE_15545 | |
| 6229 c1 Prodigal CDS 3044768 3045871 . - 0 ID=BALIOE_15545;Name=hypothetical protein;locus_tag=BALIOE_15545;product=hypothetical protein;Parent=BALIOE_15545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6230 c1 Prodigal gene 3046610 3049282 . + . ID=BALIOE_15550_gene;locus_tag=BALIOE_15550 | |
| 6231 c1 Prodigal CDS 3046610 3049282 . + 0 ID=BALIOE_15550;Name=hypothetical protein;locus_tag=BALIOE_15550;product=hypothetical protein;Parent=BALIOE_15550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6232 c1 Prodigal gene 3049299 3049949 . + . ID=BALIOE_15555_gene;locus_tag=BALIOE_15555 | |
| 6233 c1 Prodigal CDS 3049299 3049949 . + 0 ID=BALIOE_15555;Name=hypothetical protein;locus_tag=BALIOE_15555;product=hypothetical protein;Parent=BALIOE_15555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6234 c1 Infernal gene 3049959 3050035 . - . ID=BALIOE_15560_gene;locus_tag=BALIOE_15560;gene=naRNA4 | |
| 6235 c1 Infernal ncRNA 3049959 3050035 1e-10 - . ID=BALIOE_15560;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_15560;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_15560_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 6236 c1 Infernal gene 3050073 3050149 . - . ID=BALIOE_15565_gene;locus_tag=BALIOE_15565;gene=naRNA4 | |
| 6237 c1 Infernal ncRNA 3050073 3050149 9.8e-11 - . ID=BALIOE_15565;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_15565;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_15565_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 6238 c1 Prodigal gene 3050149 3052998 . - . ID=BALIOE_15570_gene;locus_tag=BALIOE_15570 | |
| 6239 c1 Prodigal CDS 3050149 3052998 . - 0 ID=BALIOE_15570;Name=hypothetical protein;locus_tag=BALIOE_15570;product=hypothetical protein;Parent=BALIOE_15570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6240 c1 Prodigal gene 3053273 3054049 . - . ID=BALIOE_15575_gene;locus_tag=BALIOE_15575 | |
| 6241 c1 Prodigal CDS 3053273 3054049 . - 0 ID=BALIOE_15575;Name=hypothetical protein;locus_tag=BALIOE_15575;product=hypothetical protein;Parent=BALIOE_15575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6242 c1 Prodigal gene 3054054 3054836 . - . ID=BALIOE_15580_gene;locus_tag=BALIOE_15580 | |
| 6243 c1 Prodigal CDS 3054054 3054836 . - 0 ID=BALIOE_15580;Name=hypothetical protein;locus_tag=BALIOE_15580;product=hypothetical protein;Parent=BALIOE_15580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6244 c1 Prodigal gene 3054909 3055703 . - . ID=BALIOE_15585_gene;locus_tag=BALIOE_15585 | |
| 6245 c1 Prodigal CDS 3054909 3055703 . - 0 ID=BALIOE_15585;Name=hypothetical protein;locus_tag=BALIOE_15585;product=hypothetical protein;Parent=BALIOE_15585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6246 c1 Prodigal gene 3055704 3060098 . - . ID=BALIOE_15590_gene;locus_tag=BALIOE_15590 | |
| 6247 c1 Prodigal CDS 3055704 3060098 . - 0 ID=BALIOE_15590;Name=hypothetical protein;locus_tag=BALIOE_15590;product=hypothetical protein;Parent=BALIOE_15590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6248 c1 Prodigal gene 3060242 3060865 . - . ID=BALIOE_15595_gene;locus_tag=BALIOE_15595 | |
| 6249 c1 Prodigal CDS 3060242 3060865 . - 0 ID=BALIOE_15595;Name=hypothetical protein;locus_tag=BALIOE_15595;product=hypothetical protein;Parent=BALIOE_15595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6250 c1 Prodigal gene 3060862 3062415 . - . ID=BALIOE_15600_gene;locus_tag=BALIOE_15600 | |
| 6251 c1 Prodigal CDS 3060862 3062415 . - 0 ID=BALIOE_15600;Name=hypothetical protein;locus_tag=BALIOE_15600;product=hypothetical protein;Parent=BALIOE_15600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6252 c1 Prodigal gene 3062698 3065325 . - . ID=BALIOE_15605_gene;locus_tag=BALIOE_15605 | |
| 6253 c1 Prodigal CDS 3062698 3065325 . - 0 ID=BALIOE_15605;Name=hypothetical protein;locus_tag=BALIOE_15605;product=hypothetical protein;Parent=BALIOE_15605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6254 c1 Prodigal gene 3065472 3066194 . + . ID=BALIOE_15610_gene;locus_tag=BALIOE_15610 | |
| 6255 c1 Prodigal CDS 3065472 3066194 . + 0 ID=BALIOE_15610;Name=hypothetical protein;locus_tag=BALIOE_15610;product=hypothetical protein;Parent=BALIOE_15610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6256 c1 Prodigal gene 3066335 3070087 . - . ID=BALIOE_15615_gene;locus_tag=BALIOE_15615 | |
| 6257 c1 Prodigal CDS 3066335 3070087 . - 0 ID=BALIOE_15615;Name=hypothetical protein;locus_tag=BALIOE_15615;product=hypothetical protein;Parent=BALIOE_15615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6258 c1 Prodigal gene 3070783 3073068 . + . ID=BALIOE_15620_gene;locus_tag=BALIOE_15620 | |
| 6259 c1 Prodigal CDS 3070783 3073068 . + 0 ID=BALIOE_15620;Name=hypothetical protein;locus_tag=BALIOE_15620;product=hypothetical protein;Parent=BALIOE_15620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6260 c1 Infernal gene 3073125 3073188 . - . ID=BALIOE_15625_gene;locus_tag=BALIOE_15625;gene=naRNA4 | |
| 6261 c1 Infernal ncRNA 3073125 3073188 7.8e-09 - . ID=BALIOE_15625;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_15625;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_15625_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 6262 c1 Prodigal gene 3073295 3074425 . + . ID=BALIOE_15630_gene;locus_tag=BALIOE_15630 | |
| 6263 c1 Prodigal CDS 3073295 3074425 . + 0 ID=BALIOE_15630;Name=hypothetical protein;locus_tag=BALIOE_15630;product=hypothetical protein;Parent=BALIOE_15630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6264 c1 Prodigal gene 3074425 3074679 . + . ID=BALIOE_15635_gene;locus_tag=BALIOE_15635 | |
| 6265 c1 Prodigal CDS 3074425 3074679 . + 0 ID=BALIOE_15635;Name=hypothetical protein;locus_tag=BALIOE_15635;product=hypothetical protein;Parent=BALIOE_15635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6266 c1 Prodigal gene 3074733 3075383 . - . ID=BALIOE_15640_gene;locus_tag=BALIOE_15640 | |
| 6267 c1 Prodigal CDS 3074733 3075383 . - 0 ID=BALIOE_15640;Name=hypothetical protein;locus_tag=BALIOE_15640;product=hypothetical protein;Parent=BALIOE_15640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6268 c1 Prodigal gene 3075464 3076654 . - . ID=BALIOE_15645_gene;locus_tag=BALIOE_15645 | |
| 6269 c1 Prodigal CDS 3075464 3076654 . - 0 ID=BALIOE_15645;Name=hypothetical protein;locus_tag=BALIOE_15645;product=hypothetical protein;Parent=BALIOE_15645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6270 c1 Prodigal gene 3076806 3077684 . + . ID=BALIOE_15650_gene;locus_tag=BALIOE_15650 | |
| 6271 c1 Prodigal CDS 3076806 3077684 . + 0 ID=BALIOE_15650;Name=hypothetical protein;locus_tag=BALIOE_15650;product=hypothetical protein;Parent=BALIOE_15650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6272 c1 Prodigal gene 3077838 3077969 . + . ID=BALIOE_15655_gene;locus_tag=BALIOE_15655 | |
| 6273 c1 Prodigal CDS 3077838 3077969 . + 0 ID=BALIOE_15655;Name=hypothetical protein;locus_tag=BALIOE_15655;product=hypothetical protein;Parent=BALIOE_15655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6274 c1 Prodigal gene 3078148 3079218 . + . ID=BALIOE_15660_gene;locus_tag=BALIOE_15660 | |
| 6275 c1 Prodigal CDS 3078148 3079218 . + 0 ID=BALIOE_15660;Name=hypothetical protein;locus_tag=BALIOE_15660;product=hypothetical protein;Parent=BALIOE_15660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6276 c1 Prodigal gene 3079442 3080518 . - . ID=BALIOE_15665_gene;locus_tag=BALIOE_15665 | |
| 6277 c1 Prodigal CDS 3079442 3080518 . - 0 ID=BALIOE_15665;Name=hypothetical protein;locus_tag=BALIOE_15665;product=hypothetical protein;Parent=BALIOE_15665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6278 c1 Prodigal gene 3080523 3081881 . - . ID=BALIOE_15670_gene;locus_tag=BALIOE_15670 | |
| 6279 c1 Prodigal CDS 3080523 3081881 . - 0 ID=BALIOE_15670;Name=hypothetical protein;locus_tag=BALIOE_15670;product=hypothetical protein;Parent=BALIOE_15670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6280 c1 Prodigal gene 3082154 3083782 . + . ID=BALIOE_15675_gene;locus_tag=BALIOE_15675 | |
| 6281 c1 Prodigal CDS 3082154 3083782 . + 0 ID=BALIOE_15675;Name=hypothetical protein;locus_tag=BALIOE_15675;product=hypothetical protein;Parent=BALIOE_15675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6282 c1 Prodigal gene 3083772 3085031 . + . ID=BALIOE_15680_gene;locus_tag=BALIOE_15680 | |
| 6283 c1 Prodigal CDS 3083772 3085031 . + 0 ID=BALIOE_15680;Name=hypothetical protein;locus_tag=BALIOE_15680;product=hypothetical protein;Parent=BALIOE_15680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6284 c1 Prodigal gene 3085028 3086218 . + . ID=BALIOE_15685_gene;locus_tag=BALIOE_15685 | |
| 6285 c1 Prodigal CDS 3085028 3086218 . + 0 ID=BALIOE_15685;Name=hypothetical protein;locus_tag=BALIOE_15685;product=hypothetical protein;Parent=BALIOE_15685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6286 c1 Prodigal gene 3086411 3087337 . + . ID=BALIOE_15690_gene;locus_tag=BALIOE_15690 | |
| 6287 c1 Prodigal CDS 3086411 3087337 . + 0 ID=BALIOE_15690;Name=hypothetical protein;locus_tag=BALIOE_15690;product=hypothetical protein;Parent=BALIOE_15690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6288 c1 Prodigal gene 3087378 3088130 . - . ID=BALIOE_15695_gene;locus_tag=BALIOE_15695 | |
| 6289 c1 Prodigal CDS 3087378 3088130 . - 0 ID=BALIOE_15695;Name=hypothetical protein;locus_tag=BALIOE_15695;product=hypothetical protein;Parent=BALIOE_15695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6290 c1 Prodigal gene 3088198 3088950 . - . ID=BALIOE_15700_gene;locus_tag=BALIOE_15700 | |
| 6291 c1 Prodigal CDS 3088198 3088950 . - 0 ID=BALIOE_15700;Name=hypothetical protein;locus_tag=BALIOE_15700;product=hypothetical protein;Parent=BALIOE_15700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6292 c1 Prodigal gene 3089027 3089353 . + . ID=BALIOE_15705_gene;locus_tag=BALIOE_15705 | |
| 6293 c1 Prodigal CDS 3089027 3089353 . + 0 ID=BALIOE_15705;Name=hypothetical protein;locus_tag=BALIOE_15705;product=hypothetical protein;Parent=BALIOE_15705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6294 c1 Prodigal gene 3089353 3090240 . + . ID=BALIOE_15710_gene;locus_tag=BALIOE_15710 | |
| 6295 c1 Prodigal CDS 3089353 3090240 . + 0 ID=BALIOE_15710;Name=hypothetical protein;locus_tag=BALIOE_15710;product=hypothetical protein;Parent=BALIOE_15710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6296 c1 Prodigal gene 3090243 3090800 . - . ID=BALIOE_15715_gene;locus_tag=BALIOE_15715 | |
| 6297 c1 Prodigal CDS 3090243 3090800 . - 0 ID=BALIOE_15715;Name=hypothetical protein;locus_tag=BALIOE_15715;product=hypothetical protein;Parent=BALIOE_15715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6298 c1 Prodigal gene 3090857 3092062 . - . ID=BALIOE_15720_gene;locus_tag=BALIOE_15720 | |
| 6299 c1 Prodigal CDS 3090857 3092062 . - 0 ID=BALIOE_15720;Name=hypothetical protein;locus_tag=BALIOE_15720;product=hypothetical protein;Parent=BALIOE_15720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6300 c1 Prodigal gene 3092077 3092859 . - . ID=BALIOE_15725_gene;locus_tag=BALIOE_15725 | |
| 6301 c1 Prodigal CDS 3092077 3092859 . - 0 ID=BALIOE_15725;Name=hypothetical protein;locus_tag=BALIOE_15725;product=hypothetical protein;Parent=BALIOE_15725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6302 c1 Prodigal gene 3093079 3094281 . - . ID=BALIOE_15730_gene;locus_tag=BALIOE_15730 | |
| 6303 c1 Prodigal CDS 3093079 3094281 . - 0 ID=BALIOE_15730;Name=hypothetical protein;locus_tag=BALIOE_15730;product=hypothetical protein;Parent=BALIOE_15730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6304 c1 Prodigal gene 3094381 3094923 . - . ID=BALIOE_15735_gene;locus_tag=BALIOE_15735 | |
| 6305 c1 Prodigal CDS 3094381 3094923 . - 0 ID=BALIOE_15735;Name=hypothetical protein;locus_tag=BALIOE_15735;product=hypothetical protein;Parent=BALIOE_15735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6306 c1 Prodigal gene 3095202 3095627 . + . ID=BALIOE_15740_gene;locus_tag=BALIOE_15740 | |
| 6307 c1 Prodigal CDS 3095202 3095627 . + 0 ID=BALIOE_15740;Name=hypothetical protein;locus_tag=BALIOE_15740;product=hypothetical protein;Parent=BALIOE_15740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6308 c1 Prodigal gene 3095666 3096268 . - . ID=BALIOE_15745_gene;locus_tag=BALIOE_15745 | |
| 6309 c1 Prodigal CDS 3095666 3096268 . - 0 ID=BALIOE_15745;Name=hypothetical protein;locus_tag=BALIOE_15745;product=hypothetical protein;Parent=BALIOE_15745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6310 c1 Prodigal gene 3096558 3097715 . + . ID=BALIOE_15750_gene;locus_tag=BALIOE_15750 | |
| 6311 c1 Prodigal CDS 3096558 3097715 . + 0 ID=BALIOE_15750;Name=hypothetical protein;locus_tag=BALIOE_15750;product=hypothetical protein;Parent=BALIOE_15750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6312 c1 Prodigal gene 3097719 3098687 . + . ID=BALIOE_15755_gene;locus_tag=BALIOE_15755 | |
| 6313 c1 Prodigal CDS 3097719 3098687 . + 0 ID=BALIOE_15755;Name=hypothetical protein;locus_tag=BALIOE_15755;product=hypothetical protein;Parent=BALIOE_15755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6314 c1 Prodigal gene 3098687 3100669 . + . ID=BALIOE_15760_gene;locus_tag=BALIOE_15760 | |
| 6315 c1 Prodigal CDS 3098687 3100669 . + 0 ID=BALIOE_15760;Name=hypothetical protein;locus_tag=BALIOE_15760;product=hypothetical protein;Parent=BALIOE_15760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6316 c1 Prodigal gene 3100666 3101556 . + . ID=BALIOE_15765_gene;locus_tag=BALIOE_15765 | |
| 6317 c1 Prodigal CDS 3100666 3101556 . + 0 ID=BALIOE_15765;Name=hypothetical protein;locus_tag=BALIOE_15765;product=hypothetical protein;Parent=BALIOE_15765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6318 c1 Prodigal gene 3101556 3103208 . + . ID=BALIOE_15770_gene;locus_tag=BALIOE_15770 | |
| 6319 c1 Prodigal CDS 3101556 3103208 . + 0 ID=BALIOE_15770;Name=hypothetical protein;locus_tag=BALIOE_15770;product=hypothetical protein;Parent=BALIOE_15770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6320 c1 Prodigal gene 3103205 3103540 . + . ID=BALIOE_15775_gene;locus_tag=BALIOE_15775 | |
| 6321 c1 Prodigal CDS 3103205 3103540 . + 0 ID=BALIOE_15775;Name=hypothetical protein;locus_tag=BALIOE_15775;product=hypothetical protein;Parent=BALIOE_15775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6322 c1 Prodigal gene 3103540 3103926 . + . ID=BALIOE_15780_gene;locus_tag=BALIOE_15780 | |
| 6323 c1 Prodigal CDS 3103540 3103926 . + 0 ID=BALIOE_15780;Name=hypothetical protein;locus_tag=BALIOE_15780;product=hypothetical protein;Parent=BALIOE_15780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6324 c1 Prodigal gene 3103920 3104186 . - . ID=BALIOE_15785_gene;locus_tag=BALIOE_15785 | |
| 6325 c1 Prodigal CDS 3103920 3104186 . - 0 ID=BALIOE_15785;Name=hypothetical protein;locus_tag=BALIOE_15785;product=hypothetical protein;Parent=BALIOE_15785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6326 c1 Prodigal gene 3104296 3105651 . - . ID=BALIOE_15790_gene;locus_tag=BALIOE_15790 | |
| 6327 c1 Prodigal CDS 3104296 3105651 . - 0 ID=BALIOE_15790;Name=hypothetical protein;locus_tag=BALIOE_15790;product=hypothetical protein;Parent=BALIOE_15790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6328 c1 Prodigal gene 3105648 3106610 . - . ID=BALIOE_15795_gene;locus_tag=BALIOE_15795 | |
| 6329 c1 Prodigal CDS 3105648 3106610 . - 0 ID=BALIOE_15795;Name=hypothetical protein;locus_tag=BALIOE_15795;product=hypothetical protein;Parent=BALIOE_15795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6330 c1 Prodigal gene 3106610 3107467 . - . ID=BALIOE_15800_gene;locus_tag=BALIOE_15800 | |
| 6331 c1 Prodigal CDS 3106610 3107467 . - 0 ID=BALIOE_15800;Name=hypothetical protein;locus_tag=BALIOE_15800;product=hypothetical protein;Parent=BALIOE_15800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6332 c1 Prodigal gene 3107482 3108240 . - . ID=BALIOE_15805_gene;locus_tag=BALIOE_15805 | |
| 6333 c1 Prodigal CDS 3107482 3108240 . - 0 ID=BALIOE_15805;Name=hypothetical protein;locus_tag=BALIOE_15805;product=hypothetical protein;Parent=BALIOE_15805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6334 c1 Prodigal gene 3108237 3109907 . - . ID=BALIOE_15810_gene;locus_tag=BALIOE_15810 | |
| 6335 c1 Prodigal CDS 3108237 3109907 . - 0 ID=BALIOE_15810;Name=hypothetical protein;locus_tag=BALIOE_15810;product=hypothetical protein;Parent=BALIOE_15810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6336 c1 Prodigal gene 3109996 3111291 . - . ID=BALIOE_15815_gene;locus_tag=BALIOE_15815 | |
| 6337 c1 Prodigal CDS 3109996 3111291 . - 0 ID=BALIOE_15815;Name=hypothetical protein;locus_tag=BALIOE_15815;product=hypothetical protein;Parent=BALIOE_15815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6338 c1 Prodigal gene 3111370 3111675 . - . ID=BALIOE_15820_gene;locus_tag=BALIOE_15820 | |
| 6339 c1 Prodigal CDS 3111370 3111675 . - 0 ID=BALIOE_15820;Name=hypothetical protein;locus_tag=BALIOE_15820;product=hypothetical protein;Parent=BALIOE_15820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6340 c1 Prodigal gene 3111730 3112191 . - . ID=BALIOE_15825_gene;locus_tag=BALIOE_15825 | |
| 6341 c1 Prodigal CDS 3111730 3112191 . - 0 ID=BALIOE_15825;Name=hypothetical protein;locus_tag=BALIOE_15825;product=hypothetical protein;Parent=BALIOE_15825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6342 c1 Prodigal gene 3112256 3113173 . + . ID=BALIOE_15830_gene;locus_tag=BALIOE_15830 | |
| 6343 c1 Prodigal CDS 3112256 3113173 . + 0 ID=BALIOE_15830;Name=hypothetical protein;locus_tag=BALIOE_15830;product=hypothetical protein;Parent=BALIOE_15830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6344 c1 Prodigal gene 3113364 3114584 . + . ID=BALIOE_15835_gene;locus_tag=BALIOE_15835 | |
| 6345 c1 Prodigal CDS 3113364 3114584 . + 0 ID=BALIOE_15835;Name=hypothetical protein;locus_tag=BALIOE_15835;product=hypothetical protein;Parent=BALIOE_15835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6346 c1 Prodigal gene 3115716 3116219 . + . ID=BALIOE_15840_gene;locus_tag=BALIOE_15840 | |
| 6347 c1 Prodigal CDS 3115716 3116219 . + 0 ID=BALIOE_15840;Name=hypothetical protein;locus_tag=BALIOE_15840;product=hypothetical protein;Parent=BALIOE_15840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6348 c1 Prodigal gene 3116286 3117743 . - . ID=BALIOE_15845_gene;locus_tag=BALIOE_15845 | |
| 6349 c1 Prodigal CDS 3116286 3117743 . - 0 ID=BALIOE_15845;Name=hypothetical protein;locus_tag=BALIOE_15845;product=hypothetical protein;Parent=BALIOE_15845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6350 c1 Prodigal gene 3117750 3119279 . - . ID=BALIOE_15850_gene;locus_tag=BALIOE_15850 | |
| 6351 c1 Prodigal CDS 3117750 3119279 . - 0 ID=BALIOE_15850;Name=hypothetical protein;locus_tag=BALIOE_15850;product=hypothetical protein;Parent=BALIOE_15850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6352 c1 Prodigal gene 3119510 3121351 . - . ID=BALIOE_15855_gene;locus_tag=BALIOE_15855 | |
| 6353 c1 Prodigal CDS 3119510 3121351 . - 0 ID=BALIOE_15855;Name=hypothetical protein;locus_tag=BALIOE_15855;product=hypothetical protein;Parent=BALIOE_15855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6354 c1 Prodigal gene 3121348 3121650 . - . ID=BALIOE_15860_gene;locus_tag=BALIOE_15860 | |
| 6355 c1 Prodigal CDS 3121348 3121650 . - 0 ID=BALIOE_15860;Name=hypothetical protein;locus_tag=BALIOE_15860;product=hypothetical protein;Parent=BALIOE_15860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6356 c1 Prodigal gene 3121647 3122201 . - . ID=BALIOE_15865_gene;locus_tag=BALIOE_15865 | |
| 6357 c1 Prodigal CDS 3121647 3122201 . - 0 ID=BALIOE_15865;Name=hypothetical protein;locus_tag=BALIOE_15865;product=hypothetical protein;Parent=BALIOE_15865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6358 c1 Prodigal gene 3122213 3122755 . - . ID=BALIOE_15870_gene;locus_tag=BALIOE_15870 | |
| 6359 c1 Prodigal CDS 3122213 3122755 . - 0 ID=BALIOE_15870;Name=hypothetical protein;locus_tag=BALIOE_15870;product=hypothetical protein;Parent=BALIOE_15870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6360 c1 Prodigal gene 3122770 3123747 . - . ID=BALIOE_15875_gene;locus_tag=BALIOE_15875 | |
| 6361 c1 Prodigal CDS 3122770 3123747 . - 0 ID=BALIOE_15875;Name=hypothetical protein;locus_tag=BALIOE_15875;product=hypothetical protein;Parent=BALIOE_15875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6362 c1 Prodigal gene 3123744 3126470 . - . ID=BALIOE_15880_gene;locus_tag=BALIOE_15880 | |
| 6363 c1 Prodigal CDS 3123744 3126470 . - 0 ID=BALIOE_15880;Name=hypothetical protein;locus_tag=BALIOE_15880;product=hypothetical protein;Parent=BALIOE_15880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6364 c1 Prodigal gene 3126523 3127860 . - . ID=BALIOE_15885_gene;locus_tag=BALIOE_15885 | |
| 6365 c1 Prodigal CDS 3126523 3127860 . - 0 ID=BALIOE_15885;Name=hypothetical protein;locus_tag=BALIOE_15885;product=hypothetical protein;Parent=BALIOE_15885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6366 c1 Prodigal gene 3127857 3128357 . - . ID=BALIOE_15890_gene;locus_tag=BALIOE_15890 | |
| 6367 c1 Prodigal CDS 3127857 3128357 . - 0 ID=BALIOE_15890;Name=hypothetical protein;locus_tag=BALIOE_15890;product=hypothetical protein;Parent=BALIOE_15890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6368 c1 Prodigal gene 3128360 3130162 . - . ID=BALIOE_15895_gene;locus_tag=BALIOE_15895 | |
| 6369 c1 Prodigal CDS 3128360 3130162 . - 0 ID=BALIOE_15895;Name=hypothetical protein;locus_tag=BALIOE_15895;product=hypothetical protein;Parent=BALIOE_15895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6370 c1 Prodigal gene 3130256 3130918 . - . ID=BALIOE_15900_gene;locus_tag=BALIOE_15900 | |
| 6371 c1 Prodigal CDS 3130256 3130918 . - 0 ID=BALIOE_15900;Name=hypothetical protein;locus_tag=BALIOE_15900;product=hypothetical protein;Parent=BALIOE_15900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6372 c1 Prodigal gene 3130934 3131377 . - . ID=BALIOE_15905_gene;locus_tag=BALIOE_15905 | |
| 6373 c1 Prodigal CDS 3130934 3131377 . - 0 ID=BALIOE_15905;Name=hypothetical protein;locus_tag=BALIOE_15905;product=hypothetical protein;Parent=BALIOE_15905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6374 c1 Prodigal gene 3131640 3131804 . + . ID=BALIOE_15910_gene;locus_tag=BALIOE_15910 | |
| 6375 c1 Prodigal CDS 3131640 3131804 . + 0 ID=BALIOE_15910;Name=hypothetical protein;locus_tag=BALIOE_15910;product=hypothetical protein;Parent=BALIOE_15910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6376 c1 Prodigal gene 3132008 3132946 . - . ID=BALIOE_15915_gene;locus_tag=BALIOE_15915 | |
| 6377 c1 Prodigal CDS 3132008 3132946 . - 0 ID=BALIOE_15915;Name=hypothetical protein;locus_tag=BALIOE_15915;product=hypothetical protein;Parent=BALIOE_15915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6378 c1 Prodigal gene 3133866 3135083 . + . ID=BALIOE_15920_gene;locus_tag=BALIOE_15920 | |
| 6379 c1 Prodigal CDS 3133866 3135083 . + 0 ID=BALIOE_15920;Name=hypothetical protein;locus_tag=BALIOE_15920;product=hypothetical protein;Parent=BALIOE_15920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6380 c1 Prodigal gene 3135167 3135766 . + . ID=BALIOE_15925_gene;locus_tag=BALIOE_15925 | |
| 6381 c1 Prodigal CDS 3135167 3135766 . + 0 ID=BALIOE_15925;Name=hypothetical protein;locus_tag=BALIOE_15925;product=hypothetical protein;Parent=BALIOE_15925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6382 c1 Prodigal gene 3135825 3137657 . - . ID=BALIOE_15930_gene;locus_tag=BALIOE_15930 | |
| 6383 c1 Prodigal CDS 3135825 3137657 . - 0 ID=BALIOE_15930;Name=hypothetical protein;locus_tag=BALIOE_15930;product=hypothetical protein;Parent=BALIOE_15930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6384 c1 Prodigal gene 3137744 3138394 . - . ID=BALIOE_15935_gene;locus_tag=BALIOE_15935 | |
| 6385 c1 Prodigal CDS 3137744 3138394 . - 0 ID=BALIOE_15935;Name=hypothetical protein;locus_tag=BALIOE_15935;product=hypothetical protein;Parent=BALIOE_15935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6386 c1 Prodigal gene 3138405 3138899 . - . ID=BALIOE_15940_gene;locus_tag=BALIOE_15940 | |
| 6387 c1 Prodigal CDS 3138405 3138899 . - 0 ID=BALIOE_15940;Name=hypothetical protein;locus_tag=BALIOE_15940;product=hypothetical protein;Parent=BALIOE_15940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6388 c1 Prodigal gene 3138982 3139437 . - . ID=BALIOE_15945_gene;locus_tag=BALIOE_15945 | |
| 6389 c1 Prodigal CDS 3138982 3139437 . - 0 ID=BALIOE_15945;Name=hypothetical protein;locus_tag=BALIOE_15945;product=hypothetical protein;Parent=BALIOE_15945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6390 c1 Prodigal gene 3139775 3140977 . + . ID=BALIOE_15950_gene;locus_tag=BALIOE_15950 | |
| 6391 c1 Prodigal CDS 3139775 3140977 . + 0 ID=BALIOE_15950;Name=hypothetical protein;locus_tag=BALIOE_15950;product=hypothetical protein;Parent=BALIOE_15950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6392 c1 Prodigal gene 3141052 3143196 . + . ID=BALIOE_15955_gene;locus_tag=BALIOE_15955 | |
| 6393 c1 Prodigal CDS 3141052 3143196 . + 0 ID=BALIOE_15955;Name=hypothetical protein;locus_tag=BALIOE_15955;product=hypothetical protein;Parent=BALIOE_15955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6394 c1 Prodigal gene 3143428 3144906 . + . ID=BALIOE_15960_gene;locus_tag=BALIOE_15960 | |
| 6395 c1 Prodigal CDS 3143428 3144906 . + 0 ID=BALIOE_15960;Name=hypothetical protein;locus_tag=BALIOE_15960;product=hypothetical protein;Parent=BALIOE_15960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6396 c1 Prodigal gene 3144939 3145481 . - . ID=BALIOE_15965_gene;locus_tag=BALIOE_15965 | |
| 6397 c1 Prodigal CDS 3144939 3145481 . - 0 ID=BALIOE_15965;Name=hypothetical protein;locus_tag=BALIOE_15965;product=hypothetical protein;Parent=BALIOE_15965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6398 c1 Prodigal gene 3145539 3146090 . - . ID=BALIOE_15970_gene;locus_tag=BALIOE_15970 | |
| 6399 c1 Prodigal CDS 3145539 3146090 . - 0 ID=BALIOE_15970;Name=hypothetical protein;locus_tag=BALIOE_15970;product=hypothetical protein;Parent=BALIOE_15970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6400 c1 Prodigal gene 3146146 3146790 . - . ID=BALIOE_15975_gene;locus_tag=BALIOE_15975 | |
| 6401 c1 Prodigal CDS 3146146 3146790 . - 0 ID=BALIOE_15975;Name=hypothetical protein;locus_tag=BALIOE_15975;product=hypothetical protein;Parent=BALIOE_15975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6402 c1 Prodigal gene 3146926 3147573 . + . ID=BALIOE_15980_gene;locus_tag=BALIOE_15980 | |
| 6403 c1 Prodigal CDS 3146926 3147573 . + 0 ID=BALIOE_15980;Name=hypothetical protein;locus_tag=BALIOE_15980;product=hypothetical protein;Parent=BALIOE_15980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6404 c1 Prodigal gene 3147630 3147992 . + . ID=BALIOE_15985_gene;locus_tag=BALIOE_15985 | |
| 6405 c1 Prodigal CDS 3147630 3147992 . + 0 ID=BALIOE_15985;Name=hypothetical protein;locus_tag=BALIOE_15985;product=hypothetical protein;Parent=BALIOE_15985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6406 c1 Prodigal gene 3148013 3148906 . + . ID=BALIOE_15990_gene;locus_tag=BALIOE_15990 | |
| 6407 c1 Prodigal CDS 3148013 3148906 . + 0 ID=BALIOE_15990;Name=hypothetical protein;locus_tag=BALIOE_15990;product=hypothetical protein;Parent=BALIOE_15990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6408 c1 Prodigal gene 3148954 3149844 . - . ID=BALIOE_15995_gene;locus_tag=BALIOE_15995 | |
| 6409 c1 Prodigal CDS 3148954 3149844 . - 0 ID=BALIOE_15995;Name=hypothetical protein;locus_tag=BALIOE_15995;product=hypothetical protein;Parent=BALIOE_15995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6410 c1 Prodigal gene 3150041 3150814 . - . ID=BALIOE_16000_gene;locus_tag=BALIOE_16000 | |
| 6411 c1 Prodigal CDS 3150041 3150814 . - 0 ID=BALIOE_16000;Name=hypothetical protein;locus_tag=BALIOE_16000;product=hypothetical protein;Parent=BALIOE_16000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6412 c1 Prodigal gene 3150822 3151538 . - . ID=BALIOE_16005_gene;locus_tag=BALIOE_16005 | |
| 6413 c1 Prodigal CDS 3150822 3151538 . - 0 ID=BALIOE_16005;Name=hypothetical protein;locus_tag=BALIOE_16005;product=hypothetical protein;Parent=BALIOE_16005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6414 c1 Prodigal gene 3151535 3152221 . - . ID=BALIOE_16010_gene;locus_tag=BALIOE_16010 | |
| 6415 c1 Prodigal CDS 3151535 3152221 . - 0 ID=BALIOE_16010;Name=hypothetical protein;locus_tag=BALIOE_16010;product=hypothetical protein;Parent=BALIOE_16010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6416 c1 Prodigal gene 3152311 3153093 . - . ID=BALIOE_16015_gene;locus_tag=BALIOE_16015 | |
| 6417 c1 Prodigal CDS 3152311 3153093 . - 0 ID=BALIOE_16015;Name=hypothetical protein;locus_tag=BALIOE_16015;product=hypothetical protein;Parent=BALIOE_16015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6418 c1 Prodigal gene 3153314 3154096 . - . ID=BALIOE_16020_gene;locus_tag=BALIOE_16020 | |
| 6419 c1 Prodigal CDS 3153314 3154096 . - 0 ID=BALIOE_16020;Name=hypothetical protein;locus_tag=BALIOE_16020;product=hypothetical protein;Parent=BALIOE_16020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6420 c1 Prodigal gene 3154362 3154931 . - . ID=BALIOE_16025_gene;locus_tag=BALIOE_16025 | |
| 6421 c1 Prodigal CDS 3154362 3154931 . - 0 ID=BALIOE_16025;Name=hypothetical protein;locus_tag=BALIOE_16025;product=hypothetical protein;Parent=BALIOE_16025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6422 c1 Prodigal gene 3155026 3156543 . - . ID=BALIOE_16030_gene;locus_tag=BALIOE_16030 | |
| 6423 c1 Prodigal CDS 3155026 3156543 . - 0 ID=BALIOE_16030;Name=hypothetical protein;locus_tag=BALIOE_16030;product=hypothetical protein;Parent=BALIOE_16030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6424 c1 Prodigal gene 3156580 3157068 . - . ID=BALIOE_16035_gene;locus_tag=BALIOE_16035 | |
| 6425 c1 Prodigal CDS 3156580 3157068 . - 0 ID=BALIOE_16035;Name=hypothetical protein;locus_tag=BALIOE_16035;product=hypothetical protein;Parent=BALIOE_16035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6426 c1 Infernal gene 3157285 3157355 . - . ID=BALIOE_16040_gene;locus_tag=BALIOE_16040;gene=naRNA4 | |
| 6427 c1 Infernal ncRNA 3157285 3157355 2.1e-10 - . ID=BALIOE_16040;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_16040;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_16040_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 6428 c1 Infernal gene 3157376 3157446 . - . ID=BALIOE_16045_gene;locus_tag=BALIOE_16045;gene=naRNA4 | |
| 6429 c1 Infernal ncRNA 3157376 3157446 1.8e-12 - . ID=BALIOE_16045;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_16045;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_16045_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 6430 c1 Prodigal gene 3157509 3158171 . - . ID=BALIOE_16050_gene;locus_tag=BALIOE_16050 | |
| 6431 c1 Prodigal CDS 3157509 3158171 . - 0 ID=BALIOE_16050;Name=hypothetical protein;locus_tag=BALIOE_16050;product=hypothetical protein;Parent=BALIOE_16050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6432 c1 Prodigal gene 3158161 3159429 . - . ID=BALIOE_16055_gene;locus_tag=BALIOE_16055 | |
| 6433 c1 Prodigal CDS 3158161 3159429 . - 0 ID=BALIOE_16055;Name=hypothetical protein;locus_tag=BALIOE_16055;product=hypothetical protein;Parent=BALIOE_16055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6434 c1 Prodigal gene 3159499 3160413 . - . ID=BALIOE_16060_gene;locus_tag=BALIOE_16060 | |
| 6435 c1 Prodigal CDS 3159499 3160413 . - 0 ID=BALIOE_16060;Name=hypothetical protein;locus_tag=BALIOE_16060;product=hypothetical protein;Parent=BALIOE_16060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6436 c1 Prodigal gene 3160569 3161228 . - . ID=BALIOE_16065_gene;locus_tag=BALIOE_16065 | |
| 6437 c1 Prodigal CDS 3160569 3161228 . - 0 ID=BALIOE_16065;Name=hypothetical protein;locus_tag=BALIOE_16065;product=hypothetical protein;Parent=BALIOE_16065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6438 c1 Prodigal gene 3161311 3162123 . - . ID=BALIOE_16070_gene;locus_tag=BALIOE_16070 | |
| 6439 c1 Prodigal CDS 3161311 3162123 . - 0 ID=BALIOE_16070;Name=hypothetical protein;locus_tag=BALIOE_16070;product=hypothetical protein;Parent=BALIOE_16070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6440 c1 Prodigal gene 3162123 3163136 . - . ID=BALIOE_16075_gene;locus_tag=BALIOE_16075 | |
| 6441 c1 Prodigal CDS 3162123 3163136 . - 0 ID=BALIOE_16075;Name=hypothetical protein;locus_tag=BALIOE_16075;product=hypothetical protein;Parent=BALIOE_16075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6442 c1 Prodigal gene 3163202 3164338 . - . ID=BALIOE_16080_gene;locus_tag=BALIOE_16080 | |
| 6443 c1 Prodigal CDS 3163202 3164338 . - 0 ID=BALIOE_16080;Name=hypothetical protein;locus_tag=BALIOE_16080;product=hypothetical protein;Parent=BALIOE_16080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6444 c1 Prodigal gene 3164437 3165432 . + . ID=BALIOE_16085_gene;locus_tag=BALIOE_16085 | |
| 6445 c1 Prodigal CDS 3164437 3165432 . + 0 ID=BALIOE_16085;Name=hypothetical protein;locus_tag=BALIOE_16085;product=hypothetical protein;Parent=BALIOE_16085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6446 c1 Prodigal gene 3165429 3166607 . - . ID=BALIOE_16090_gene;locus_tag=BALIOE_16090 | |
| 6447 c1 Prodigal CDS 3165429 3166607 . - 0 ID=BALIOE_16090;Name=hypothetical protein;locus_tag=BALIOE_16090;product=hypothetical protein;Parent=BALIOE_16090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6448 c1 Prodigal gene 3166882 3168102 . - . ID=BALIOE_16095_gene;locus_tag=BALIOE_16095 | |
| 6449 c1 Prodigal CDS 3166882 3168102 . - 0 ID=BALIOE_16095;Name=hypothetical protein;locus_tag=BALIOE_16095;product=hypothetical protein;Parent=BALIOE_16095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6450 c1 Prodigal gene 3168261 3170267 . + . ID=BALIOE_16100_gene;locus_tag=BALIOE_16100 | |
| 6451 c1 Prodigal CDS 3168261 3170267 . + 0 ID=BALIOE_16100;Name=hypothetical protein;locus_tag=BALIOE_16100;product=hypothetical protein;Parent=BALIOE_16100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6452 c1 Prodigal gene 3170388 3170666 . - . ID=BALIOE_16105_gene;locus_tag=BALIOE_16105 | |
| 6453 c1 Prodigal CDS 3170388 3170666 . - 0 ID=BALIOE_16105;Name=hypothetical protein;locus_tag=BALIOE_16105;product=hypothetical protein;Parent=BALIOE_16105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6454 c1 Prodigal gene 3170700 3171248 . - . ID=BALIOE_16110_gene;locus_tag=BALIOE_16110 | |
| 6455 c1 Prodigal CDS 3170700 3171248 . - 0 ID=BALIOE_16110;Name=hypothetical protein;locus_tag=BALIOE_16110;product=hypothetical protein;Parent=BALIOE_16110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6456 c1 Prodigal gene 3171248 3172057 . - . ID=BALIOE_16115_gene;locus_tag=BALIOE_16115 | |
| 6457 c1 Prodigal CDS 3171248 3172057 . - 0 ID=BALIOE_16115;Name=hypothetical protein;locus_tag=BALIOE_16115;product=hypothetical protein;Parent=BALIOE_16115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6458 c1 Prodigal gene 3172057 3172881 . - . ID=BALIOE_16120_gene;locus_tag=BALIOE_16120 | |
| 6459 c1 Prodigal CDS 3172057 3172881 . - 0 ID=BALIOE_16120;Name=hypothetical protein;locus_tag=BALIOE_16120;product=hypothetical protein;Parent=BALIOE_16120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6460 c1 Prodigal gene 3172885 3173970 . - . ID=BALIOE_16125_gene;locus_tag=BALIOE_16125 | |
| 6461 c1 Prodigal CDS 3172885 3173970 . - 0 ID=BALIOE_16125;Name=hypothetical protein;locus_tag=BALIOE_16125;product=hypothetical protein;Parent=BALIOE_16125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6462 c1 Prodigal gene 3174005 3174937 . - . ID=BALIOE_16130_gene;locus_tag=BALIOE_16130 | |
| 6463 c1 Prodigal CDS 3174005 3174937 . - 0 ID=BALIOE_16130;Name=hypothetical protein;locus_tag=BALIOE_16130;product=hypothetical protein;Parent=BALIOE_16130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6464 c1 Prodigal gene 3175103 3175654 . + . ID=BALIOE_16135_gene;locus_tag=BALIOE_16135 | |
| 6465 c1 Prodigal CDS 3175103 3175654 . + 0 ID=BALIOE_16135;Name=hypothetical protein;locus_tag=BALIOE_16135;product=hypothetical protein;Parent=BALIOE_16135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6466 c1 Prodigal gene 3175825 3176667 . - . ID=BALIOE_16140_gene;locus_tag=BALIOE_16140 | |
| 6467 c1 Prodigal CDS 3175825 3176667 . - 0 ID=BALIOE_16140;Name=hypothetical protein;locus_tag=BALIOE_16140;product=hypothetical protein;Parent=BALIOE_16140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6468 c1 Prodigal gene 3176669 3177190 . - . ID=BALIOE_16145_gene;locus_tag=BALIOE_16145 | |
| 6469 c1 Prodigal CDS 3176669 3177190 . - 0 ID=BALIOE_16145;Name=hypothetical protein;locus_tag=BALIOE_16145;product=hypothetical protein;Parent=BALIOE_16145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6470 c1 Prodigal gene 3177187 3177615 . - . ID=BALIOE_16150_gene;locus_tag=BALIOE_16150 | |
| 6471 c1 Prodigal CDS 3177187 3177615 . - 0 ID=BALIOE_16150;Name=hypothetical protein;locus_tag=BALIOE_16150;product=hypothetical protein;Parent=BALIOE_16150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6472 c1 Prodigal gene 3177654 3178154 . - . ID=BALIOE_16155_gene;locus_tag=BALIOE_16155 | |
| 6473 c1 Prodigal CDS 3177654 3178154 . - 0 ID=BALIOE_16155;Name=hypothetical protein;locus_tag=BALIOE_16155;product=hypothetical protein;Parent=BALIOE_16155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6474 c1 Prodigal gene 3178165 3178923 . - . ID=BALIOE_16160_gene;locus_tag=BALIOE_16160 | |
| 6475 c1 Prodigal CDS 3178165 3178923 . - 0 ID=BALIOE_16160;Name=hypothetical protein;locus_tag=BALIOE_16160;product=hypothetical protein;Parent=BALIOE_16160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6476 c1 Prodigal gene 3178946 3181585 . - . ID=BALIOE_16165_gene;locus_tag=BALIOE_16165 | |
| 6477 c1 Prodigal CDS 3178946 3181585 . - 0 ID=BALIOE_16165;Name=hypothetical protein;locus_tag=BALIOE_16165;product=hypothetical protein;Parent=BALIOE_16165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6478 c1 Prodigal gene 3181667 3182230 . - . ID=BALIOE_16170_gene;locus_tag=BALIOE_16170 | |
| 6479 c1 Prodigal CDS 3181667 3182230 . - 0 ID=BALIOE_16170;Name=hypothetical protein;locus_tag=BALIOE_16170;product=hypothetical protein;Parent=BALIOE_16170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6480 c1 Prodigal gene 3182876 3183361 . - . ID=BALIOE_16175_gene;locus_tag=BALIOE_16175 | |
| 6481 c1 Prodigal CDS 3182876 3183361 . - 0 ID=BALIOE_16175;Name=hypothetical protein;locus_tag=BALIOE_16175;product=hypothetical protein;Parent=BALIOE_16175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6482 c1 Prodigal gene 3183564 3185708 . - . ID=BALIOE_16180_gene;locus_tag=BALIOE_16180 | |
| 6483 c1 Prodigal CDS 3183564 3185708 . - 0 ID=BALIOE_16180;Name=hypothetical protein;locus_tag=BALIOE_16180;product=hypothetical protein;Parent=BALIOE_16180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6484 c1 Prodigal gene 3185708 3187018 . - . ID=BALIOE_16185_gene;locus_tag=BALIOE_16185 | |
| 6485 c1 Prodigal CDS 3185708 3187018 . - 0 ID=BALIOE_16185;Name=hypothetical protein;locus_tag=BALIOE_16185;product=hypothetical protein;Parent=BALIOE_16185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6486 c1 Prodigal gene 3187198 3187482 . - . ID=BALIOE_16190_gene;locus_tag=BALIOE_16190 | |
| 6487 c1 Prodigal CDS 3187198 3187482 . - 0 ID=BALIOE_16190;Name=hypothetical protein;locus_tag=BALIOE_16190;product=hypothetical protein;Parent=BALIOE_16190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6488 c1 Prodigal gene 3187854 3189194 . + . ID=BALIOE_16195_gene;locus_tag=BALIOE_16195 | |
| 6489 c1 Prodigal CDS 3187854 3189194 . + 0 ID=BALIOE_16195;Name=hypothetical protein;locus_tag=BALIOE_16195;product=hypothetical protein;Parent=BALIOE_16195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6490 c1 Prodigal gene 3189559 3190590 . + . ID=BALIOE_16200_gene;locus_tag=BALIOE_16200 | |
| 6491 c1 Prodigal CDS 3189559 3190590 . + 0 ID=BALIOE_16200;Name=hypothetical protein;locus_tag=BALIOE_16200;product=hypothetical protein;Parent=BALIOE_16200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6492 c1 Prodigal gene 3190985 3191740 . - . ID=BALIOE_16205_gene;locus_tag=BALIOE_16205 | |
| 6493 c1 Prodigal CDS 3190985 3191740 . - 0 ID=BALIOE_16205;Name=hypothetical protein;locus_tag=BALIOE_16205;product=hypothetical protein;Parent=BALIOE_16205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6494 c1 Prodigal gene 3192034 3192966 . + . ID=BALIOE_16210_gene;locus_tag=BALIOE_16210 | |
| 6495 c1 Prodigal CDS 3192034 3192966 . + 0 ID=BALIOE_16210;Name=hypothetical protein;locus_tag=BALIOE_16210;product=hypothetical protein;Parent=BALIOE_16210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6496 c1 tRNAscan-SE gene 3193042 3193116 . + . ID=BALIOE_16215_gene;locus_tag=BALIOE_16215;gene=Arg_trna | |
| 6497 c1 tRNAscan-SE tRNA 3193042 3193116 . + . ID=BALIOE_16215;Name=tRNA-Arg;locus_tag=BALIOE_16215;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_16215_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 6498 c1 Prodigal gene 3193278 3194435 . + . ID=BALIOE_16220_gene;locus_tag=BALIOE_16220 | |
| 6499 c1 Prodigal CDS 3193278 3194435 . + 0 ID=BALIOE_16220;Name=hypothetical protein;locus_tag=BALIOE_16220;product=hypothetical protein;Parent=BALIOE_16220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6500 c1 Prodigal gene 3194610 3195746 . - . ID=BALIOE_16225_gene;locus_tag=BALIOE_16225 | |
| 6501 c1 Prodigal CDS 3194610 3195746 . - 0 ID=BALIOE_16225;Name=hypothetical protein;locus_tag=BALIOE_16225;product=hypothetical protein;Parent=BALIOE_16225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6502 c1 Prodigal gene 3195756 3196436 . - . ID=BALIOE_16230_gene;locus_tag=BALIOE_16230 | |
| 6503 c1 Prodigal CDS 3195756 3196436 . - 0 ID=BALIOE_16230;Name=hypothetical protein;locus_tag=BALIOE_16230;product=hypothetical protein;Parent=BALIOE_16230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6504 c1 Prodigal gene 3196423 3196890 . - . ID=BALIOE_16235_gene;locus_tag=BALIOE_16235 | |
| 6505 c1 Prodigal CDS 3196423 3196890 . - 0 ID=BALIOE_16235;Name=hypothetical protein;locus_tag=BALIOE_16235;product=hypothetical protein;Parent=BALIOE_16235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6506 c1 Prodigal gene 3196890 3197459 . - . ID=BALIOE_16240_gene;locus_tag=BALIOE_16240 | |
| 6507 c1 Prodigal CDS 3196890 3197459 . - 0 ID=BALIOE_16240;Name=hypothetical protein;locus_tag=BALIOE_16240;product=hypothetical protein;Parent=BALIOE_16240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6508 c1 Prodigal gene 3197490 3198137 . + . ID=BALIOE_16245_gene;locus_tag=BALIOE_16245 | |
| 6509 c1 Prodigal CDS 3197490 3198137 . + 0 ID=BALIOE_16245;Name=hypothetical protein;locus_tag=BALIOE_16245;product=hypothetical protein;Parent=BALIOE_16245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6510 c1 Prodigal gene 3198807 3200219 . - . ID=BALIOE_16250_gene;locus_tag=BALIOE_16250 | |
| 6511 c1 Prodigal CDS 3198807 3200219 . - 0 ID=BALIOE_16250;Name=hypothetical protein;locus_tag=BALIOE_16250;product=hypothetical protein;Parent=BALIOE_16250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6512 c1 Prodigal gene 3200406 3200582 . - . ID=BALIOE_16255_gene;locus_tag=BALIOE_16255 | |
| 6513 c1 Prodigal CDS 3200406 3200582 . - 0 ID=BALIOE_16255;Name=hypothetical protein;locus_tag=BALIOE_16255;product=hypothetical protein;Parent=BALIOE_16255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6514 c1 Prodigal gene 3200885 3201511 . + . ID=BALIOE_16260_gene;locus_tag=BALIOE_16260 | |
| 6515 c1 Prodigal CDS 3200885 3201511 . + 0 ID=BALIOE_16260;Name=hypothetical protein;locus_tag=BALIOE_16260;product=hypothetical protein;Parent=BALIOE_16260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6516 c1 Prodigal gene 3202109 3203356 . - . ID=BALIOE_16265_gene;locus_tag=BALIOE_16265 | |
| 6517 c1 Prodigal CDS 3202109 3203356 . - 0 ID=BALIOE_16265;Name=hypothetical protein;locus_tag=BALIOE_16265;product=hypothetical protein;Parent=BALIOE_16265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6518 c1 Prodigal gene 3203428 3204342 . - . ID=BALIOE_16270_gene;locus_tag=BALIOE_16270 | |
| 6519 c1 Prodigal CDS 3203428 3204342 . - 0 ID=BALIOE_16270;Name=hypothetical protein;locus_tag=BALIOE_16270;product=hypothetical protein;Parent=BALIOE_16270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6520 c1 Prodigal gene 3204558 3205991 . + . ID=BALIOE_16275_gene;locus_tag=BALIOE_16275 | |
| 6521 c1 Prodigal CDS 3204558 3205991 . + 0 ID=BALIOE_16275;Name=hypothetical protein;locus_tag=BALIOE_16275;product=hypothetical protein;Parent=BALIOE_16275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6522 c1 Prodigal gene 3205999 3206952 . - . ID=BALIOE_16280_gene;locus_tag=BALIOE_16280 | |
| 6523 c1 Prodigal CDS 3205999 3206952 . - 0 ID=BALIOE_16280;Name=hypothetical protein;locus_tag=BALIOE_16280;product=hypothetical protein;Parent=BALIOE_16280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6524 c1 Prodigal gene 3207237 3207455 . + . ID=BALIOE_16285_gene;locus_tag=BALIOE_16285 | |
| 6525 c1 Prodigal CDS 3207237 3207455 . + 0 ID=BALIOE_16285;Name=hypothetical protein;locus_tag=BALIOE_16285;product=hypothetical protein;Parent=BALIOE_16285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6526 c1 Prodigal gene 3207473 3208801 . + . ID=BALIOE_16290_gene;locus_tag=BALIOE_16290 | |
| 6527 c1 Prodigal CDS 3207473 3208801 . + 0 ID=BALIOE_16290;Name=hypothetical protein;locus_tag=BALIOE_16290;product=hypothetical protein;Parent=BALIOE_16290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6528 c1 Prodigal gene 3208909 3210447 . - . ID=BALIOE_16295_gene;locus_tag=BALIOE_16295 | |
| 6529 c1 Prodigal CDS 3208909 3210447 . - 0 ID=BALIOE_16295;Name=hypothetical protein;locus_tag=BALIOE_16295;product=hypothetical protein;Parent=BALIOE_16295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6530 c1 Prodigal gene 3210447 3211610 . - . ID=BALIOE_16300_gene;locus_tag=BALIOE_16300 | |
| 6531 c1 Prodigal CDS 3210447 3211610 . - 0 ID=BALIOE_16300;Name=hypothetical protein;locus_tag=BALIOE_16300;product=hypothetical protein;Parent=BALIOE_16300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6532 c1 Prodigal gene 3212026 3212640 . + . ID=BALIOE_16305_gene;locus_tag=BALIOE_16305 | |
| 6533 c1 Prodigal CDS 3212026 3212640 . + 0 ID=BALIOE_16305;Name=hypothetical protein;locus_tag=BALIOE_16305;product=hypothetical protein;Parent=BALIOE_16305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6534 c1 Prodigal gene 3212645 3216238 . + . ID=BALIOE_16310_gene;locus_tag=BALIOE_16310 | |
| 6535 c1 Prodigal CDS 3212645 3216238 . + 0 ID=BALIOE_16310;Name=hypothetical protein;locus_tag=BALIOE_16310;product=hypothetical protein;Parent=BALIOE_16310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6536 c1 Prodigal gene 3216294 3217172 . - . ID=BALIOE_16315_gene;locus_tag=BALIOE_16315 | |
| 6537 c1 Prodigal CDS 3216294 3217172 . - 0 ID=BALIOE_16315;Name=hypothetical protein;locus_tag=BALIOE_16315;product=hypothetical protein;Parent=BALIOE_16315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6538 c1 Prodigal gene 3217205 3217435 . - . ID=BALIOE_16320_gene;locus_tag=BALIOE_16320 | |
| 6539 c1 Prodigal CDS 3217205 3217435 . - 0 ID=BALIOE_16320;Name=hypothetical protein;locus_tag=BALIOE_16320;product=hypothetical protein;Parent=BALIOE_16320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6540 c1 Prodigal gene 3217509 3218453 . - . ID=BALIOE_16325_gene;locus_tag=BALIOE_16325 | |
| 6541 c1 Prodigal CDS 3217509 3218453 . - 0 ID=BALIOE_16325;Name=hypothetical protein;locus_tag=BALIOE_16325;product=hypothetical protein;Parent=BALIOE_16325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6542 c1 Prodigal gene 3218523 3220217 . - . ID=BALIOE_16330_gene;locus_tag=BALIOE_16330 | |
| 6543 c1 Prodigal CDS 3218523 3220217 . - 0 ID=BALIOE_16330;Name=hypothetical protein;locus_tag=BALIOE_16330;product=hypothetical protein;Parent=BALIOE_16330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6544 c1 Prodigal gene 3220271 3221521 . - . ID=BALIOE_16335_gene;locus_tag=BALIOE_16335 | |
| 6545 c1 Prodigal CDS 3220271 3221521 . - 0 ID=BALIOE_16335;Name=hypothetical protein;locus_tag=BALIOE_16335;product=hypothetical protein;Parent=BALIOE_16335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6546 c1 Prodigal gene 3222034 3222669 . - . ID=BALIOE_16340_gene;locus_tag=BALIOE_16340 | |
| 6547 c1 Prodigal CDS 3222034 3222669 . - 0 ID=BALIOE_16340;Name=hypothetical protein;locus_tag=BALIOE_16340;product=hypothetical protein;Parent=BALIOE_16340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6548 c1 Prodigal gene 3222965 3223240 . + . ID=BALIOE_16345_gene;locus_tag=BALIOE_16345 | |
| 6549 c1 Prodigal CDS 3222965 3223240 . + 0 ID=BALIOE_16345;Name=hypothetical protein;locus_tag=BALIOE_16345;product=hypothetical protein;Parent=BALIOE_16345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6550 c1 Prodigal gene 3223317 3223559 . - . ID=BALIOE_16350_gene;locus_tag=BALIOE_16350 | |
| 6551 c1 Prodigal CDS 3223317 3223559 . - 0 ID=BALIOE_16350;Name=hypothetical protein;locus_tag=BALIOE_16350;product=hypothetical protein;Parent=BALIOE_16350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6552 c1 Prodigal gene 3223912 3224832 . + . ID=BALIOE_16355_gene;locus_tag=BALIOE_16355 | |
| 6553 c1 Prodigal CDS 3223912 3224832 . + 0 ID=BALIOE_16355;Name=hypothetical protein;locus_tag=BALIOE_16355;product=hypothetical protein;Parent=BALIOE_16355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6554 c1 Prodigal gene 3225324 3226562 . - . ID=BALIOE_16360_gene;locus_tag=BALIOE_16360 | |
| 6555 c1 Prodigal CDS 3225324 3226562 . - 0 ID=BALIOE_16360;Name=hypothetical protein;locus_tag=BALIOE_16360;product=hypothetical protein;Parent=BALIOE_16360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6556 c1 Prodigal gene 3226939 3228636 . + . ID=BALIOE_16365_gene;locus_tag=BALIOE_16365 | |
| 6557 c1 Prodigal CDS 3226939 3228636 . + 0 ID=BALIOE_16365;Name=hypothetical protein;locus_tag=BALIOE_16365;product=hypothetical protein;Parent=BALIOE_16365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6558 c1 Prodigal gene 3228651 3229385 . + . ID=BALIOE_16370_gene;locus_tag=BALIOE_16370 | |
| 6559 c1 Prodigal CDS 3228651 3229385 . + 0 ID=BALIOE_16370;Name=hypothetical protein;locus_tag=BALIOE_16370;product=hypothetical protein;Parent=BALIOE_16370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6560 c1 Prodigal gene 3229398 3230255 . + . ID=BALIOE_16375_gene;locus_tag=BALIOE_16375 | |
| 6561 c1 Prodigal CDS 3229398 3230255 . + 0 ID=BALIOE_16375;Name=hypothetical protein;locus_tag=BALIOE_16375;product=hypothetical protein;Parent=BALIOE_16375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6562 c1 Prodigal gene 3230258 3232753 . - . ID=BALIOE_16380_gene;locus_tag=BALIOE_16380 | |
| 6563 c1 Prodigal CDS 3230258 3232753 . - 0 ID=BALIOE_16380;Name=hypothetical protein;locus_tag=BALIOE_16380;product=hypothetical protein;Parent=BALIOE_16380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6564 c1 Prodigal gene 3232778 3233815 . - . ID=BALIOE_16385_gene;locus_tag=BALIOE_16385 | |
| 6565 c1 Prodigal CDS 3232778 3233815 . - 0 ID=BALIOE_16385;Name=hypothetical protein;locus_tag=BALIOE_16385;product=hypothetical protein;Parent=BALIOE_16385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6566 c1 Prodigal gene 3233815 3234900 . - . ID=BALIOE_16390_gene;locus_tag=BALIOE_16390 | |
| 6567 c1 Prodigal CDS 3233815 3234900 . - 0 ID=BALIOE_16390;Name=hypothetical protein;locus_tag=BALIOE_16390;product=hypothetical protein;Parent=BALIOE_16390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6568 c1 Prodigal gene 3234915 3236162 . - . ID=BALIOE_16395_gene;locus_tag=BALIOE_16395 | |
| 6569 c1 Prodigal CDS 3234915 3236162 . - 0 ID=BALIOE_16395;Name=hypothetical protein;locus_tag=BALIOE_16395;product=hypothetical protein;Parent=BALIOE_16395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6570 c1 Prodigal gene 3236184 3236510 . - . ID=BALIOE_16400_gene;locus_tag=BALIOE_16400 | |
| 6571 c1 Prodigal CDS 3236184 3236510 . - 0 ID=BALIOE_16400;Name=hypothetical protein;locus_tag=BALIOE_16400;product=hypothetical protein;Parent=BALIOE_16400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6572 c1 Prodigal gene 3236729 3237694 . - . ID=BALIOE_16405_gene;locus_tag=BALIOE_16405 | |
| 6573 c1 Prodigal CDS 3236729 3237694 . - 0 ID=BALIOE_16405;Name=hypothetical protein;locus_tag=BALIOE_16405;product=hypothetical protein;Parent=BALIOE_16405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6574 c1 Prodigal gene 3237898 3239154 . + . ID=BALIOE_16410_gene;locus_tag=BALIOE_16410 | |
| 6575 c1 Prodigal CDS 3237898 3239154 . + 0 ID=BALIOE_16410;Name=hypothetical protein;locus_tag=BALIOE_16410;product=hypothetical protein;Parent=BALIOE_16410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6576 c1 Prodigal gene 3239269 3239595 . + . ID=BALIOE_16415_gene;locus_tag=BALIOE_16415 | |
| 6577 c1 Prodigal CDS 3239269 3239595 . + 0 ID=BALIOE_16415;Name=hypothetical protein;locus_tag=BALIOE_16415;product=hypothetical protein;Parent=BALIOE_16415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6578 c1 Prodigal gene 3239735 3240973 . - . ID=BALIOE_16420_gene;locus_tag=BALIOE_16420 | |
| 6579 c1 Prodigal CDS 3239735 3240973 . - 0 ID=BALIOE_16420;Name=hypothetical protein;locus_tag=BALIOE_16420;product=hypothetical protein;Parent=BALIOE_16420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6580 c1 Prodigal gene 3241309 3242511 . + . ID=BALIOE_16425_gene;locus_tag=BALIOE_16425 | |
| 6581 c1 Prodigal CDS 3241309 3242511 . + 0 ID=BALIOE_16425;Name=hypothetical protein;locus_tag=BALIOE_16425;product=hypothetical protein;Parent=BALIOE_16425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6582 c1 Prodigal gene 3242561 3244750 . - . ID=BALIOE_16430_gene;locus_tag=BALIOE_16430 | |
| 6583 c1 Prodigal CDS 3242561 3244750 . - 0 ID=BALIOE_16430;Name=hypothetical protein;locus_tag=BALIOE_16430;product=hypothetical protein;Parent=BALIOE_16430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6584 c1 tRNAscan-SE gene 3244958 3245033 . - . ID=BALIOE_16435_gene;locus_tag=BALIOE_16435;gene=Ala_trna | |
| 6585 c1 tRNAscan-SE tRNA 3244958 3245033 . - . ID=BALIOE_16435;Name=tRNA-Ala;locus_tag=BALIOE_16435;product=tRNA-Ala;gene=Ala_trna;Parent=BALIOE_16435_gene;inference=profile:tRNAscan:2.0;Note=SO:0000254 | |
| 6586 c1 tRNAscan-SE gene 3245073 3245148 . - . ID=BALIOE_16440_gene;locus_tag=BALIOE_16440;gene=Ala_trna | |
| 6587 c1 tRNAscan-SE tRNA 3245073 3245148 . - . ID=BALIOE_16440;Name=tRNA-Ala;locus_tag=BALIOE_16440;product=tRNA-Ala;gene=Ala_trna;Parent=BALIOE_16440_gene;inference=profile:tRNAscan:2.0;Note=SO:0000254 | |
| 6588 c1 Prodigal gene 3245369 3245728 . + . ID=BALIOE_16445_gene;locus_tag=BALIOE_16445 | |
| 6589 c1 Prodigal CDS 3245369 3245728 . + 0 ID=BALIOE_16445;Name=hypothetical protein;locus_tag=BALIOE_16445;product=hypothetical protein;Parent=BALIOE_16445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6590 c1 Prodigal gene 3245751 3246122 . + . ID=BALIOE_16450_gene;locus_tag=BALIOE_16450 | |
| 6591 c1 Prodigal CDS 3245751 3246122 . + 0 ID=BALIOE_16450;Name=hypothetical protein;locus_tag=BALIOE_16450;product=hypothetical protein;Parent=BALIOE_16450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6592 c1 Prodigal gene 3246162 3247310 . - . ID=BALIOE_16455_gene;locus_tag=BALIOE_16455 | |
| 6593 c1 Prodigal CDS 3246162 3247310 . - 0 ID=BALIOE_16455;Name=hypothetical protein;locus_tag=BALIOE_16455;product=hypothetical protein;Parent=BALIOE_16455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6594 c1 Prodigal gene 3247378 3247920 . + . ID=BALIOE_16460_gene;locus_tag=BALIOE_16460 | |
| 6595 c1 Prodigal CDS 3247378 3247920 . + 0 ID=BALIOE_16460;Name=hypothetical protein;locus_tag=BALIOE_16460;product=hypothetical protein;Parent=BALIOE_16460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6596 c1 Prodigal gene 3247921 3249336 . - . ID=BALIOE_16465_gene;locus_tag=BALIOE_16465 | |
| 6597 c1 Prodigal CDS 3247921 3249336 . - 0 ID=BALIOE_16465;Name=hypothetical protein;locus_tag=BALIOE_16465;product=hypothetical protein;Parent=BALIOE_16465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6598 c1 tRNAscan-SE gene 3249595 3249670 . + . ID=BALIOE_16470_gene;locus_tag=BALIOE_16470;gene=Val_trna | |
| 6599 c1 tRNAscan-SE tRNA 3249595 3249670 . + . ID=BALIOE_16470;Name=tRNA-Val;locus_tag=BALIOE_16470;product=tRNA-Val;gene=Val_trna;Parent=BALIOE_16470_gene;inference=profile:tRNAscan:2.0;Note=SO:0000273 | |
| 6600 c1 tRNAscan-SE gene 3249715 3249790 . + . ID=BALIOE_16475_gene;locus_tag=BALIOE_16475;gene=Val_trna | |
| 6601 c1 tRNAscan-SE tRNA 3249715 3249790 . + . ID=BALIOE_16475;Name=tRNA-Val;locus_tag=BALIOE_16475;product=tRNA-Val;gene=Val_trna;Parent=BALIOE_16475_gene;inference=profile:tRNAscan:2.0;Note=SO:0000273 | |
| 6602 c1 tRNAscan-SE gene 3249837 3249912 . + . ID=BALIOE_16480_gene;locus_tag=BALIOE_16480;gene=Val_trna | |
| 6603 c1 tRNAscan-SE tRNA 3249837 3249912 . + . ID=BALIOE_16480;Name=tRNA-Val;locus_tag=BALIOE_16480;product=tRNA-Val;gene=Val_trna;Parent=BALIOE_16480_gene;inference=profile:tRNAscan:2.0;Note=SO:0000273 | |
| 6604 c1 tRNAscan-SE gene 3249917 3249992 . + . ID=BALIOE_16485_gene;locus_tag=BALIOE_16485;gene=Lys_trna | |
| 6605 c1 tRNAscan-SE tRNA 3249917 3249992 . + . ID=BALIOE_16485;Name=tRNA-Lys;locus_tag=BALIOE_16485;product=tRNA-Lys;gene=Lys_trna;Parent=BALIOE_16485_gene;inference=profile:tRNAscan:2.0;Note=SO:0000265 | |
| 6606 c1 Prodigal gene 3250112 3250453 . + . ID=BALIOE_16490_gene;locus_tag=BALIOE_16490 | |
| 6607 c1 Prodigal CDS 3250112 3250453 . + 0 ID=BALIOE_16490;Name=hypothetical protein;locus_tag=BALIOE_16490;product=hypothetical protein;Parent=BALIOE_16490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6608 c1 Prodigal gene 3250444 3250791 . - . ID=BALIOE_16495_gene;locus_tag=BALIOE_16495 | |
| 6609 c1 Prodigal CDS 3250444 3250791 . - 0 ID=BALIOE_16495;Name=hypothetical protein;locus_tag=BALIOE_16495;product=hypothetical protein;Parent=BALIOE_16495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6610 c1 Prodigal gene 3250816 3251370 . - . ID=BALIOE_16500_gene;locus_tag=BALIOE_16500 | |
| 6611 c1 Prodigal CDS 3250816 3251370 . - 0 ID=BALIOE_16500;Name=hypothetical protein;locus_tag=BALIOE_16500;product=hypothetical protein;Parent=BALIOE_16500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6612 c1 Prodigal gene 3251460 3252458 . + . ID=BALIOE_16505_gene;locus_tag=BALIOE_16505 | |
| 6613 c1 Prodigal CDS 3251460 3252458 . + 0 ID=BALIOE_16505;Name=hypothetical protein;locus_tag=BALIOE_16505;product=hypothetical protein;Parent=BALIOE_16505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6614 c1 Prodigal gene 3252455 3252673 . - . ID=BALIOE_16510_gene;locus_tag=BALIOE_16510 | |
| 6615 c1 Prodigal CDS 3252455 3252673 . - 0 ID=BALIOE_16510;Name=hypothetical protein;locus_tag=BALIOE_16510;product=hypothetical protein;Parent=BALIOE_16510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6616 c1 Prodigal gene 3252675 3254690 . - . ID=BALIOE_16515_gene;locus_tag=BALIOE_16515 | |
| 6617 c1 Prodigal CDS 3252675 3254690 . - 0 ID=BALIOE_16515;Name=hypothetical protein;locus_tag=BALIOE_16515;product=hypothetical protein;Parent=BALIOE_16515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6618 c1 Prodigal gene 3254761 3255759 . - . ID=BALIOE_16520_gene;locus_tag=BALIOE_16520 | |
| 6619 c1 Prodigal CDS 3254761 3255759 . - 0 ID=BALIOE_16520;Name=hypothetical protein;locus_tag=BALIOE_16520;product=hypothetical protein;Parent=BALIOE_16520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6620 c1 Prodigal gene 3255989 3256750 . + . ID=BALIOE_16525_gene;locus_tag=BALIOE_16525 | |
| 6621 c1 Prodigal CDS 3255989 3256750 . + 0 ID=BALIOE_16525;Name=hypothetical protein;locus_tag=BALIOE_16525;product=hypothetical protein;Parent=BALIOE_16525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6622 c1 Prodigal gene 3256935 3257906 . + . ID=BALIOE_16530_gene;locus_tag=BALIOE_16530 | |
| 6623 c1 Prodigal CDS 3256935 3257906 . + 0 ID=BALIOE_16530;Name=hypothetical protein;locus_tag=BALIOE_16530;product=hypothetical protein;Parent=BALIOE_16530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6624 c1 Prodigal gene 3258290 3258547 . + . ID=BALIOE_16535_gene;locus_tag=BALIOE_16535 | |
| 6625 c1 Prodigal CDS 3258290 3258547 . + 0 ID=BALIOE_16535;Name=hypothetical protein;locus_tag=BALIOE_16535;product=hypothetical protein;Parent=BALIOE_16535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6626 c1 Prodigal gene 3258592 3260319 . + . ID=BALIOE_16540_gene;locus_tag=BALIOE_16540 | |
| 6627 c1 Prodigal CDS 3258592 3260319 . + 0 ID=BALIOE_16540;Name=hypothetical protein;locus_tag=BALIOE_16540;product=hypothetical protein;Parent=BALIOE_16540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6628 c1 Prodigal gene 3260360 3260869 . + . ID=BALIOE_16545_gene;locus_tag=BALIOE_16545 | |
| 6629 c1 Prodigal CDS 3260360 3260869 . + 0 ID=BALIOE_16545;Name=hypothetical protein;locus_tag=BALIOE_16545;product=hypothetical protein;Parent=BALIOE_16545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6630 c1 Prodigal gene 3260912 3261763 . - . ID=BALIOE_16550_gene;locus_tag=BALIOE_16550 | |
| 6631 c1 Prodigal CDS 3260912 3261763 . - 0 ID=BALIOE_16550;Name=hypothetical protein;locus_tag=BALIOE_16550;product=hypothetical protein;Parent=BALIOE_16550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6632 c1 Prodigal gene 3261868 3262200 . + . ID=BALIOE_16555_gene;locus_tag=BALIOE_16555 | |
| 6633 c1 Prodigal CDS 3261868 3262200 . + 0 ID=BALIOE_16555;Name=hypothetical protein;locus_tag=BALIOE_16555;product=hypothetical protein;Parent=BALIOE_16555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6634 c1 Prodigal gene 3262238 3263149 . - . ID=BALIOE_16560_gene;locus_tag=BALIOE_16560 | |
| 6635 c1 Prodigal CDS 3262238 3263149 . - 0 ID=BALIOE_16560;Name=hypothetical protein;locus_tag=BALIOE_16560;product=hypothetical protein;Parent=BALIOE_16560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6636 c1 Prodigal gene 3263283 3264380 . - . ID=BALIOE_16565_gene;locus_tag=BALIOE_16565 | |
| 6637 c1 Prodigal CDS 3263283 3264380 . - 0 ID=BALIOE_16565;Name=hypothetical protein;locus_tag=BALIOE_16565;product=hypothetical protein;Parent=BALIOE_16565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6638 c1 Prodigal gene 3264370 3265245 . - . ID=BALIOE_16570_gene;locus_tag=BALIOE_16570 | |
| 6639 c1 Prodigal CDS 3264370 3265245 . - 0 ID=BALIOE_16570;Name=hypothetical protein;locus_tag=BALIOE_16570;product=hypothetical protein;Parent=BALIOE_16570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6640 c1 Prodigal gene 3265245 3266078 . - . ID=BALIOE_16575_gene;locus_tag=BALIOE_16575 | |
| 6641 c1 Prodigal CDS 3265245 3266078 . - 0 ID=BALIOE_16575;Name=hypothetical protein;locus_tag=BALIOE_16575;product=hypothetical protein;Parent=BALIOE_16575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6642 c1 Prodigal gene 3266078 3267094 . - . ID=BALIOE_16580_gene;locus_tag=BALIOE_16580 | |
| 6643 c1 Prodigal CDS 3266078 3267094 . - 0 ID=BALIOE_16580;Name=hypothetical protein;locus_tag=BALIOE_16580;product=hypothetical protein;Parent=BALIOE_16580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6644 c1 Prodigal gene 3267252 3268043 . - . ID=BALIOE_16585_gene;locus_tag=BALIOE_16585 | |
| 6645 c1 Prodigal CDS 3267252 3268043 . - 0 ID=BALIOE_16585;Name=hypothetical protein;locus_tag=BALIOE_16585;product=hypothetical protein;Parent=BALIOE_16585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6646 c1 Prodigal gene 3268172 3269029 . - . ID=BALIOE_16590_gene;locus_tag=BALIOE_16590 | |
| 6647 c1 Prodigal CDS 3268172 3269029 . - 0 ID=BALIOE_16590;Name=hypothetical protein;locus_tag=BALIOE_16590;product=hypothetical protein;Parent=BALIOE_16590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6648 c1 Prodigal gene 3269193 3270089 . + . ID=BALIOE_16595_gene;locus_tag=BALIOE_16595 | |
| 6649 c1 Prodigal CDS 3269193 3270089 . + 0 ID=BALIOE_16595;Name=hypothetical protein;locus_tag=BALIOE_16595;product=hypothetical protein;Parent=BALIOE_16595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6650 c1 Prodigal gene 3270093 3271517 . + . ID=BALIOE_16600_gene;locus_tag=BALIOE_16600 | |
| 6651 c1 Prodigal CDS 3270093 3271517 . + 0 ID=BALIOE_16600;Name=hypothetical protein;locus_tag=BALIOE_16600;product=hypothetical protein;Parent=BALIOE_16600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6652 c1 Prodigal gene 3271522 3272826 . + . ID=BALIOE_16605_gene;locus_tag=BALIOE_16605 | |
| 6653 c1 Prodigal CDS 3271522 3272826 . + 0 ID=BALIOE_16605;Name=hypothetical protein;locus_tag=BALIOE_16605;product=hypothetical protein;Parent=BALIOE_16605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6654 c1 Prodigal gene 3272884 3273783 . - . ID=BALIOE_16610_gene;locus_tag=BALIOE_16610 | |
| 6655 c1 Prodigal CDS 3272884 3273783 . - 0 ID=BALIOE_16610;Name=hypothetical protein;locus_tag=BALIOE_16610;product=hypothetical protein;Parent=BALIOE_16610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6656 c1 Prodigal gene 3273879 3274454 . - . ID=BALIOE_16615_gene;locus_tag=BALIOE_16615 | |
| 6657 c1 Prodigal CDS 3273879 3274454 . - 0 ID=BALIOE_16615;Name=hypothetical protein;locus_tag=BALIOE_16615;product=hypothetical protein;Parent=BALIOE_16615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6658 c1 Prodigal gene 3274515 3274964 . - . ID=BALIOE_16620_gene;locus_tag=BALIOE_16620 | |
| 6659 c1 Prodigal CDS 3274515 3274964 . - 0 ID=BALIOE_16620;Name=hypothetical protein;locus_tag=BALIOE_16620;product=hypothetical protein;Parent=BALIOE_16620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6660 c1 Prodigal gene 3274951 3275376 . - . ID=BALIOE_16625_gene;locus_tag=BALIOE_16625 | |
| 6661 c1 Prodigal CDS 3274951 3275376 . - 0 ID=BALIOE_16625;Name=hypothetical protein;locus_tag=BALIOE_16625;product=hypothetical protein;Parent=BALIOE_16625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6662 c1 Prodigal gene 3275590 3276459 . + . ID=BALIOE_16630_gene;locus_tag=BALIOE_16630 | |
| 6663 c1 Prodigal CDS 3275590 3276459 . + 0 ID=BALIOE_16630;Name=hypothetical protein;locus_tag=BALIOE_16630;product=hypothetical protein;Parent=BALIOE_16630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6664 c1 Prodigal gene 3276463 3277362 . + . ID=BALIOE_16635_gene;locus_tag=BALIOE_16635 | |
| 6665 c1 Prodigal CDS 3276463 3277362 . + 0 ID=BALIOE_16635;Name=hypothetical protein;locus_tag=BALIOE_16635;product=hypothetical protein;Parent=BALIOE_16635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6666 c1 Prodigal gene 3277368 3278420 . - . ID=BALIOE_16640_gene;locus_tag=BALIOE_16640 | |
| 6667 c1 Prodigal CDS 3277368 3278420 . - 0 ID=BALIOE_16640;Name=hypothetical protein;locus_tag=BALIOE_16640;product=hypothetical protein;Parent=BALIOE_16640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6668 c1 Prodigal gene 3278466 3278966 . - . ID=BALIOE_16645_gene;locus_tag=BALIOE_16645 | |
| 6669 c1 Prodigal CDS 3278466 3278966 . - 0 ID=BALIOE_16645;Name=hypothetical protein;locus_tag=BALIOE_16645;product=hypothetical protein;Parent=BALIOE_16645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6670 c1 Prodigal gene 3278979 3279638 . - . ID=BALIOE_16650_gene;locus_tag=BALIOE_16650 | |
| 6671 c1 Prodigal CDS 3278979 3279638 . - 0 ID=BALIOE_16650;Name=hypothetical protein;locus_tag=BALIOE_16650;product=hypothetical protein;Parent=BALIOE_16650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6672 c1 Prodigal gene 3279648 3280535 . - . ID=BALIOE_16655_gene;locus_tag=BALIOE_16655 | |
| 6673 c1 Prodigal CDS 3279648 3280535 . - 0 ID=BALIOE_16655;Name=hypothetical protein;locus_tag=BALIOE_16655;product=hypothetical protein;Parent=BALIOE_16655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6674 c1 Prodigal gene 3280556 3281917 . - . ID=BALIOE_16660_gene;locus_tag=BALIOE_16660 | |
| 6675 c1 Prodigal CDS 3280556 3281917 . - 0 ID=BALIOE_16660;Name=hypothetical protein;locus_tag=BALIOE_16660;product=hypothetical protein;Parent=BALIOE_16660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6676 c1 Prodigal gene 3281929 3283332 . - . ID=BALIOE_16665_gene;locus_tag=BALIOE_16665 | |
| 6677 c1 Prodigal CDS 3281929 3283332 . - 0 ID=BALIOE_16665;Name=hypothetical protein;locus_tag=BALIOE_16665;product=hypothetical protein;Parent=BALIOE_16665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6678 c1 Prodigal gene 3283329 3284555 . - . ID=BALIOE_16670_gene;locus_tag=BALIOE_16670 | |
| 6679 c1 Prodigal CDS 3283329 3284555 . - 0 ID=BALIOE_16670;Name=hypothetical protein;locus_tag=BALIOE_16670;product=hypothetical protein;Parent=BALIOE_16670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6680 c1 Prodigal gene 3284655 3285842 . - . ID=BALIOE_16675_gene;locus_tag=BALIOE_16675 | |
| 6681 c1 Prodigal CDS 3284655 3285842 . - 0 ID=BALIOE_16675;Name=hypothetical protein;locus_tag=BALIOE_16675;product=hypothetical protein;Parent=BALIOE_16675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6682 c1 Prodigal gene 3285832 3286668 . - . ID=BALIOE_16680_gene;locus_tag=BALIOE_16680 | |
| 6683 c1 Prodigal CDS 3285832 3286668 . - 0 ID=BALIOE_16680;Name=hypothetical protein;locus_tag=BALIOE_16680;product=hypothetical protein;Parent=BALIOE_16680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6684 c1 Prodigal gene 3286679 3288082 . - . ID=BALIOE_16685_gene;locus_tag=BALIOE_16685 | |
| 6685 c1 Prodigal CDS 3286679 3288082 . - 0 ID=BALIOE_16685;Name=hypothetical protein;locus_tag=BALIOE_16685;product=hypothetical protein;Parent=BALIOE_16685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6686 c1 Prodigal gene 3288094 3288381 . - . ID=BALIOE_16690_gene;locus_tag=BALIOE_16690 | |
| 6687 c1 Prodigal CDS 3288094 3288381 . - 0 ID=BALIOE_16690;Name=hypothetical protein;locus_tag=BALIOE_16690;product=hypothetical protein;Parent=BALIOE_16690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6688 c1 Prodigal gene 3288488 3288823 . - . ID=BALIOE_16695_gene;locus_tag=BALIOE_16695 | |
| 6689 c1 Prodigal CDS 3288488 3288823 . - 0 ID=BALIOE_16695;Name=hypothetical protein;locus_tag=BALIOE_16695;product=hypothetical protein;Parent=BALIOE_16695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6690 c1 Prodigal gene 3288820 3289836 . - . ID=BALIOE_16700_gene;locus_tag=BALIOE_16700 | |
| 6691 c1 Prodigal CDS 3288820 3289836 . - 0 ID=BALIOE_16700;Name=hypothetical protein;locus_tag=BALIOE_16700;product=hypothetical protein;Parent=BALIOE_16700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6692 c1 Prodigal gene 3289833 3290564 . - . ID=BALIOE_16705_gene;locus_tag=BALIOE_16705 | |
| 6693 c1 Prodigal CDS 3289833 3290564 . - 0 ID=BALIOE_16705;Name=hypothetical protein;locus_tag=BALIOE_16705;product=hypothetical protein;Parent=BALIOE_16705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6694 c1 Prodigal gene 3290561 3291262 . - . ID=BALIOE_16710_gene;locus_tag=BALIOE_16710 | |
| 6695 c1 Prodigal CDS 3290561 3291262 . - 0 ID=BALIOE_16710;Name=hypothetical protein;locus_tag=BALIOE_16710;product=hypothetical protein;Parent=BALIOE_16710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6696 c1 Prodigal gene 3291237 3291716 . - . ID=BALIOE_16715_gene;locus_tag=BALIOE_16715 | |
| 6697 c1 Prodigal CDS 3291237 3291716 . - 0 ID=BALIOE_16715;Name=hypothetical protein;locus_tag=BALIOE_16715;product=hypothetical protein;Parent=BALIOE_16715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6698 c1 Prodigal gene 3291729 3292064 . - . ID=BALIOE_16720_gene;locus_tag=BALIOE_16720 | |
| 6699 c1 Prodigal CDS 3291729 3292064 . - 0 ID=BALIOE_16720;Name=hypothetical protein;locus_tag=BALIOE_16720;product=hypothetical protein;Parent=BALIOE_16720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6700 c1 Prodigal gene 3292357 3294636 . - . ID=BALIOE_16725_gene;locus_tag=BALIOE_16725 | |
| 6701 c1 Prodigal CDS 3292357 3294636 . - 0 ID=BALIOE_16725;Name=hypothetical protein;locus_tag=BALIOE_16725;product=hypothetical protein;Parent=BALIOE_16725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6702 c1 Prodigal gene 3294925 3295875 . + . ID=BALIOE_16730_gene;locus_tag=BALIOE_16730 | |
| 6703 c1 Prodigal CDS 3294925 3295875 . + 0 ID=BALIOE_16730;Name=hypothetical protein;locus_tag=BALIOE_16730;product=hypothetical protein;Parent=BALIOE_16730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6704 c1 Prodigal gene 3295895 3297898 . + . ID=BALIOE_16735_gene;locus_tag=BALIOE_16735 | |
| 6705 c1 Prodigal CDS 3295895 3297898 . + 0 ID=BALIOE_16735;Name=hypothetical protein;locus_tag=BALIOE_16735;product=hypothetical protein;Parent=BALIOE_16735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6706 c1 Prodigal gene 3297993 3299036 . - . ID=BALIOE_16740_gene;locus_tag=BALIOE_16740 | |
| 6707 c1 Prodigal CDS 3297993 3299036 . - 0 ID=BALIOE_16740;Name=hypothetical protein;locus_tag=BALIOE_16740;product=hypothetical protein;Parent=BALIOE_16740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6708 c1 Prodigal gene 3299162 3299737 . - . ID=BALIOE_16745_gene;locus_tag=BALIOE_16745 | |
| 6709 c1 Prodigal CDS 3299162 3299737 . - 0 ID=BALIOE_16745;Name=hypothetical protein;locus_tag=BALIOE_16745;product=hypothetical protein;Parent=BALIOE_16745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6710 c1 Prodigal gene 3299805 3301784 . - . ID=BALIOE_16750_gene;locus_tag=BALIOE_16750 | |
| 6711 c1 Prodigal CDS 3299805 3301784 . - 0 ID=BALIOE_16750;Name=hypothetical protein;locus_tag=BALIOE_16750;product=hypothetical protein;Parent=BALIOE_16750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6712 c1 Prodigal gene 3301990 3303690 . + . ID=BALIOE_16755_gene;locus_tag=BALIOE_16755 | |
| 6713 c1 Prodigal CDS 3301990 3303690 . + 0 ID=BALIOE_16755;Name=hypothetical protein;locus_tag=BALIOE_16755;product=hypothetical protein;Parent=BALIOE_16755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6714 c1 Prodigal gene 3303854 3306967 . + . ID=BALIOE_16760_gene;locus_tag=BALIOE_16760 | |
| 6715 c1 Prodigal CDS 3303854 3306967 . + 0 ID=BALIOE_16760;Name=hypothetical protein;locus_tag=BALIOE_16760;product=hypothetical protein;Parent=BALIOE_16760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6716 c1 Prodigal gene 3307506 3307862 . + . ID=BALIOE_16765_gene;locus_tag=BALIOE_16765 | |
| 6717 c1 Prodigal CDS 3307506 3307862 . + 0 ID=BALIOE_16765;Name=hypothetical protein;locus_tag=BALIOE_16765;product=hypothetical protein;Parent=BALIOE_16765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6718 c1 Prodigal gene 3307866 3308993 . + . ID=BALIOE_16770_gene;locus_tag=BALIOE_16770 | |
| 6719 c1 Prodigal CDS 3307866 3308993 . + 0 ID=BALIOE_16770;Name=hypothetical protein;locus_tag=BALIOE_16770;product=hypothetical protein;Parent=BALIOE_16770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6720 c1 Prodigal gene 3309021 3309221 . + . ID=BALIOE_16775_gene;locus_tag=BALIOE_16775 | |
| 6721 c1 Prodigal CDS 3309021 3309221 . + 0 ID=BALIOE_16775;Name=hypothetical protein;locus_tag=BALIOE_16775;product=hypothetical protein;Parent=BALIOE_16775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6722 c1 Prodigal gene 3309302 3310000 . - . ID=BALIOE_16780_gene;locus_tag=BALIOE_16780 | |
| 6723 c1 Prodigal CDS 3309302 3310000 . - 0 ID=BALIOE_16780;Name=hypothetical protein;locus_tag=BALIOE_16780;product=hypothetical protein;Parent=BALIOE_16780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6724 c1 Prodigal gene 3310074 3312089 . - . ID=BALIOE_16785_gene;locus_tag=BALIOE_16785 | |
| 6725 c1 Prodigal CDS 3310074 3312089 . - 0 ID=BALIOE_16785;Name=hypothetical protein;locus_tag=BALIOE_16785;product=hypothetical protein;Parent=BALIOE_16785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6726 c1 Prodigal gene 3312104 3312967 . - . ID=BALIOE_16790_gene;locus_tag=BALIOE_16790 | |
| 6727 c1 Prodigal CDS 3312104 3312967 . - 0 ID=BALIOE_16790;Name=hypothetical protein;locus_tag=BALIOE_16790;product=hypothetical protein;Parent=BALIOE_16790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6728 c1 Prodigal gene 3313135 3313848 . - . ID=BALIOE_16795_gene;locus_tag=BALIOE_16795 | |
| 6729 c1 Prodigal CDS 3313135 3313848 . - 0 ID=BALIOE_16795;Name=hypothetical protein;locus_tag=BALIOE_16795;product=hypothetical protein;Parent=BALIOE_16795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6730 c1 Prodigal gene 3313920 3314150 . + . ID=BALIOE_16800_gene;locus_tag=BALIOE_16800 | |
| 6731 c1 Prodigal CDS 3313920 3314150 . + 0 ID=BALIOE_16800;Name=hypothetical protein;locus_tag=BALIOE_16800;product=hypothetical protein;Parent=BALIOE_16800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6732 c1 Prodigal gene 3314061 3315095 . - . ID=BALIOE_16805_gene;locus_tag=BALIOE_16805 | |
| 6733 c1 Prodigal CDS 3314061 3315095 . - 0 ID=BALIOE_16805;Name=hypothetical protein;locus_tag=BALIOE_16805;product=hypothetical protein;Parent=BALIOE_16805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6734 c1 Prodigal gene 3315112 3315990 . - . ID=BALIOE_16810_gene;locus_tag=BALIOE_16810 | |
| 6735 c1 Prodigal CDS 3315112 3315990 . - 0 ID=BALIOE_16810;Name=hypothetical protein;locus_tag=BALIOE_16810;product=hypothetical protein;Parent=BALIOE_16810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6736 c1 Prodigal gene 3316136 3316708 . + . ID=BALIOE_16815_gene;locus_tag=BALIOE_16815 | |
| 6737 c1 Prodigal CDS 3316136 3316708 . + 0 ID=BALIOE_16815;Name=hypothetical protein;locus_tag=BALIOE_16815;product=hypothetical protein;Parent=BALIOE_16815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6738 c1 Prodigal gene 3316708 3317178 . + . ID=BALIOE_16820_gene;locus_tag=BALIOE_16820 | |
| 6739 c1 Prodigal CDS 3316708 3317178 . + 0 ID=BALIOE_16820;Name=hypothetical protein;locus_tag=BALIOE_16820;product=hypothetical protein;Parent=BALIOE_16820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6740 c1 Prodigal gene 3317431 3318048 . + . ID=BALIOE_16825_gene;locus_tag=BALIOE_16825 | |
| 6741 c1 Prodigal CDS 3317431 3318048 . + 0 ID=BALIOE_16825;Name=hypothetical protein;locus_tag=BALIOE_16825;product=hypothetical protein;Parent=BALIOE_16825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6742 c1 Prodigal gene 3318048 3320066 . + . ID=BALIOE_16830_gene;locus_tag=BALIOE_16830 | |
| 6743 c1 Prodigal CDS 3318048 3320066 . + 0 ID=BALIOE_16830;Name=hypothetical protein;locus_tag=BALIOE_16830;product=hypothetical protein;Parent=BALIOE_16830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6744 c1 Prodigal gene 3320077 3321024 . + . ID=BALIOE_16835_gene;locus_tag=BALIOE_16835 | |
| 6745 c1 Prodigal CDS 3320077 3321024 . + 0 ID=BALIOE_16835;Name=hypothetical protein;locus_tag=BALIOE_16835;product=hypothetical protein;Parent=BALIOE_16835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6746 c1 Prodigal gene 3321041 3322480 . + . ID=BALIOE_16840_gene;locus_tag=BALIOE_16840 | |
| 6747 c1 Prodigal CDS 3321041 3322480 . + 0 ID=BALIOE_16840;Name=hypothetical protein;locus_tag=BALIOE_16840;product=hypothetical protein;Parent=BALIOE_16840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6748 c1 Prodigal gene 3322492 3323142 . + . ID=BALIOE_16845_gene;locus_tag=BALIOE_16845 | |
| 6749 c1 Prodigal CDS 3322492 3323142 . + 0 ID=BALIOE_16845;Name=hypothetical protein;locus_tag=BALIOE_16845;product=hypothetical protein;Parent=BALIOE_16845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6750 c1 Prodigal gene 3323162 3324727 . + . ID=BALIOE_16850_gene;locus_tag=BALIOE_16850 | |
| 6751 c1 Prodigal CDS 3323162 3324727 . + 0 ID=BALIOE_16850;Name=hypothetical protein;locus_tag=BALIOE_16850;product=hypothetical protein;Parent=BALIOE_16850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6752 c1 Prodigal gene 3324717 3326432 . + . ID=BALIOE_16855_gene;locus_tag=BALIOE_16855 | |
| 6753 c1 Prodigal CDS 3324717 3326432 . + 0 ID=BALIOE_16855;Name=hypothetical protein;locus_tag=BALIOE_16855;product=hypothetical protein;Parent=BALIOE_16855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6754 c1 Prodigal gene 3326442 3326987 . + . ID=BALIOE_16860_gene;locus_tag=BALIOE_16860 | |
| 6755 c1 Prodigal CDS 3326442 3326987 . + 0 ID=BALIOE_16860;Name=hypothetical protein;locus_tag=BALIOE_16860;product=hypothetical protein;Parent=BALIOE_16860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6756 c1 Prodigal gene 3326984 3327742 . + . ID=BALIOE_16865_gene;locus_tag=BALIOE_16865 | |
| 6757 c1 Prodigal CDS 3326984 3327742 . + 0 ID=BALIOE_16865;Name=hypothetical protein;locus_tag=BALIOE_16865;product=hypothetical protein;Parent=BALIOE_16865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6758 c1 Prodigal gene 3327735 3328148 . + . ID=BALIOE_16870_gene;locus_tag=BALIOE_16870 | |
| 6759 c1 Prodigal CDS 3327735 3328148 . + 0 ID=BALIOE_16870;Name=hypothetical protein;locus_tag=BALIOE_16870;product=hypothetical protein;Parent=BALIOE_16870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6760 c1 Prodigal gene 3328178 3330190 . + . ID=BALIOE_16875_gene;locus_tag=BALIOE_16875 | |
| 6761 c1 Prodigal CDS 3328178 3330190 . + 0 ID=BALIOE_16875;Name=hypothetical protein;locus_tag=BALIOE_16875;product=hypothetical protein;Parent=BALIOE_16875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6762 c1 Prodigal gene 3330212 3331060 . + . ID=BALIOE_16880_gene;locus_tag=BALIOE_16880 | |
| 6763 c1 Prodigal CDS 3330212 3331060 . + 0 ID=BALIOE_16880;Name=hypothetical protein;locus_tag=BALIOE_16880;product=hypothetical protein;Parent=BALIOE_16880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6764 c1 Prodigal gene 3331098 3332159 . - . ID=BALIOE_16885_gene;locus_tag=BALIOE_16885 | |
| 6765 c1 Prodigal CDS 3331098 3332159 . - 0 ID=BALIOE_16885;Name=hypothetical protein;locus_tag=BALIOE_16885;product=hypothetical protein;Parent=BALIOE_16885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6766 c1 Prodigal gene 3332372 3333835 . + . ID=BALIOE_16890_gene;locus_tag=BALIOE_16890 | |
| 6767 c1 Prodigal CDS 3332372 3333835 . + 0 ID=BALIOE_16890;Name=hypothetical protein;locus_tag=BALIOE_16890;product=hypothetical protein;Parent=BALIOE_16890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6768 c1 Prodigal gene 3333856 3334215 . + . ID=BALIOE_16895_gene;locus_tag=BALIOE_16895 | |
| 6769 c1 Prodigal CDS 3333856 3334215 . + 0 ID=BALIOE_16895;Name=hypothetical protein;locus_tag=BALIOE_16895;product=hypothetical protein;Parent=BALIOE_16895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6770 c1 Prodigal gene 3334353 3335099 . - . ID=BALIOE_16900_gene;locus_tag=BALIOE_16900 | |
| 6771 c1 Prodigal CDS 3334353 3335099 . - 0 ID=BALIOE_16900;Name=hypothetical protein;locus_tag=BALIOE_16900;product=hypothetical protein;Parent=BALIOE_16900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6772 c1 Prodigal gene 3335149 3336438 . - . ID=BALIOE_16905_gene;locus_tag=BALIOE_16905 | |
| 6773 c1 Prodigal CDS 3335149 3336438 . - 0 ID=BALIOE_16905;Name=hypothetical protein;locus_tag=BALIOE_16905;product=hypothetical protein;Parent=BALIOE_16905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6774 c1 Prodigal gene 3336524 3337150 . - . ID=BALIOE_16910_gene;locus_tag=BALIOE_16910 | |
| 6775 c1 Prodigal CDS 3336524 3337150 . - 0 ID=BALIOE_16910;Name=hypothetical protein;locus_tag=BALIOE_16910;product=hypothetical protein;Parent=BALIOE_16910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6776 c1 Prodigal gene 3337475 3338512 . + . ID=BALIOE_16915_gene;locus_tag=BALIOE_16915 | |
| 6777 c1 Prodigal CDS 3337475 3338512 . + 0 ID=BALIOE_16915;Name=hypothetical protein;locus_tag=BALIOE_16915;product=hypothetical protein;Parent=BALIOE_16915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6778 c1 Prodigal gene 3338512 3339150 . + . ID=BALIOE_16920_gene;locus_tag=BALIOE_16920 | |
| 6779 c1 Prodigal CDS 3338512 3339150 . + 0 ID=BALIOE_16920;Name=hypothetical protein;locus_tag=BALIOE_16920;product=hypothetical protein;Parent=BALIOE_16920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6780 c1 Prodigal gene 3339321 3341387 . + . ID=BALIOE_16925_gene;locus_tag=BALIOE_16925 | |
| 6781 c1 Prodigal CDS 3339321 3341387 . + 0 ID=BALIOE_16925;Name=hypothetical protein;locus_tag=BALIOE_16925;product=hypothetical protein;Parent=BALIOE_16925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6782 c1 Prodigal gene 3341392 3342933 . + . ID=BALIOE_16930_gene;locus_tag=BALIOE_16930 | |
| 6783 c1 Prodigal CDS 3341392 3342933 . + 0 ID=BALIOE_16930;Name=hypothetical protein;locus_tag=BALIOE_16930;product=hypothetical protein;Parent=BALIOE_16930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6784 c1 Prodigal gene 3342972 3345215 . - . ID=BALIOE_16935_gene;locus_tag=BALIOE_16935 | |
| 6785 c1 Prodigal CDS 3342972 3345215 . - 0 ID=BALIOE_16935;Name=hypothetical protein;locus_tag=BALIOE_16935;product=hypothetical protein;Parent=BALIOE_16935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6786 c1 Prodigal gene 3345397 3345549 . - . ID=BALIOE_16940_gene;locus_tag=BALIOE_16940 | |
| 6787 c1 Prodigal CDS 3345397 3345549 . - 0 ID=BALIOE_16940;Name=hypothetical protein;locus_tag=BALIOE_16940;product=hypothetical protein;Parent=BALIOE_16940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6788 c1 Prodigal gene 3345585 3345758 . + . ID=BALIOE_16945_gene;locus_tag=BALIOE_16945 | |
| 6789 c1 Prodigal CDS 3345585 3345758 . + 0 ID=BALIOE_16945;Name=hypothetical protein;locus_tag=BALIOE_16945;product=hypothetical protein;Parent=BALIOE_16945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6790 c1 Prodigal gene 3346072 3346587 . + . ID=BALIOE_16950_gene;locus_tag=BALIOE_16950 | |
| 6791 c1 Prodigal CDS 3346072 3346587 . + 0 ID=BALIOE_16950;Name=hypothetical protein;locus_tag=BALIOE_16950;product=hypothetical protein;Parent=BALIOE_16950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6792 c1 Prodigal gene 3346603 3347142 . + . ID=BALIOE_16955_gene;locus_tag=BALIOE_16955 | |
| 6793 c1 Prodigal CDS 3346603 3347142 . + 0 ID=BALIOE_16955;Name=hypothetical protein;locus_tag=BALIOE_16955;product=hypothetical protein;Parent=BALIOE_16955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6794 c1 Prodigal gene 3347235 3348812 . - . ID=BALIOE_16960_gene;locus_tag=BALIOE_16960 | |
| 6795 c1 Prodigal CDS 3347235 3348812 . - 0 ID=BALIOE_16960;Name=hypothetical protein;locus_tag=BALIOE_16960;product=hypothetical protein;Parent=BALIOE_16960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6796 c1 Prodigal gene 3348881 3350347 . - . ID=BALIOE_16965_gene;locus_tag=BALIOE_16965 | |
| 6797 c1 Prodigal CDS 3348881 3350347 . - 0 ID=BALIOE_16965;Name=hypothetical protein;locus_tag=BALIOE_16965;product=hypothetical protein;Parent=BALIOE_16965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6798 c1 Prodigal gene 3350509 3351879 . + . ID=BALIOE_16970_gene;locus_tag=BALIOE_16970 | |
| 6799 c1 Prodigal CDS 3350509 3351879 . + 0 ID=BALIOE_16970;Name=hypothetical protein;locus_tag=BALIOE_16970;product=hypothetical protein;Parent=BALIOE_16970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6800 c1 Prodigal gene 3351876 3352091 . - . ID=BALIOE_16975_gene;locus_tag=BALIOE_16975 | |
| 6801 c1 Prodigal CDS 3351876 3352091 . - 0 ID=BALIOE_16975;Name=hypothetical protein;locus_tag=BALIOE_16975;product=hypothetical protein;Parent=BALIOE_16975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6802 c1 Prodigal gene 3352160 3353632 . - . ID=BALIOE_16980_gene;locus_tag=BALIOE_16980 | |
| 6803 c1 Prodigal CDS 3352160 3353632 . - 0 ID=BALIOE_16980;Name=hypothetical protein;locus_tag=BALIOE_16980;product=hypothetical protein;Parent=BALIOE_16980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6804 c1 Prodigal gene 3353750 3354928 . - . ID=BALIOE_16985_gene;locus_tag=BALIOE_16985 | |
| 6805 c1 Prodigal CDS 3353750 3354928 . - 0 ID=BALIOE_16985;Name=hypothetical protein;locus_tag=BALIOE_16985;product=hypothetical protein;Parent=BALIOE_16985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6806 c1 Prodigal gene 3354939 3355559 . - . ID=BALIOE_16990_gene;locus_tag=BALIOE_16990 | |
| 6807 c1 Prodigal CDS 3354939 3355559 . - 0 ID=BALIOE_16990;Name=hypothetical protein;locus_tag=BALIOE_16990;product=hypothetical protein;Parent=BALIOE_16990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6808 c1 Prodigal gene 3355577 3356851 . - . ID=BALIOE_16995_gene;locus_tag=BALIOE_16995 | |
| 6809 c1 Prodigal CDS 3355577 3356851 . - 0 ID=BALIOE_16995;Name=hypothetical protein;locus_tag=BALIOE_16995;product=hypothetical protein;Parent=BALIOE_16995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6810 c1 Prodigal gene 3356962 3358080 . - . ID=BALIOE_17000_gene;locus_tag=BALIOE_17000 | |
| 6811 c1 Prodigal CDS 3356962 3358080 . - 0 ID=BALIOE_17000;Name=hypothetical protein;locus_tag=BALIOE_17000;product=hypothetical protein;Parent=BALIOE_17000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6812 c1 Prodigal gene 3358107 3359120 . - . ID=BALIOE_17005_gene;locus_tag=BALIOE_17005 | |
| 6813 c1 Prodigal CDS 3358107 3359120 . - 0 ID=BALIOE_17005;Name=hypothetical protein;locus_tag=BALIOE_17005;product=hypothetical protein;Parent=BALIOE_17005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6814 c1 Prodigal gene 3359405 3360559 . - . ID=BALIOE_17010_gene;locus_tag=BALIOE_17010 | |
| 6815 c1 Prodigal CDS 3359405 3360559 . - 0 ID=BALIOE_17010;Name=hypothetical protein;locus_tag=BALIOE_17010;product=hypothetical protein;Parent=BALIOE_17010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6816 c1 Prodigal gene 3360709 3361140 . - . ID=BALIOE_17015_gene;locus_tag=BALIOE_17015 | |
| 6817 c1 Prodigal CDS 3360709 3361140 . - 0 ID=BALIOE_17015;Name=hypothetical protein;locus_tag=BALIOE_17015;product=hypothetical protein;Parent=BALIOE_17015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6818 c1 Prodigal gene 3361281 3362135 . - . ID=BALIOE_17020_gene;locus_tag=BALIOE_17020 | |
| 6819 c1 Prodigal CDS 3361281 3362135 . - 0 ID=BALIOE_17020;Name=hypothetical protein;locus_tag=BALIOE_17020;product=hypothetical protein;Parent=BALIOE_17020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6820 c1 Prodigal gene 3362135 3362956 . - . ID=BALIOE_17025_gene;locus_tag=BALIOE_17025 | |
| 6821 c1 Prodigal CDS 3362135 3362956 . - 0 ID=BALIOE_17025;Name=hypothetical protein;locus_tag=BALIOE_17025;product=hypothetical protein;Parent=BALIOE_17025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6822 c1 Prodigal gene 3362949 3363578 . - . ID=BALIOE_17030_gene;locus_tag=BALIOE_17030 | |
| 6823 c1 Prodigal CDS 3362949 3363578 . - 0 ID=BALIOE_17030;Name=hypothetical protein;locus_tag=BALIOE_17030;product=hypothetical protein;Parent=BALIOE_17030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6824 c1 Prodigal gene 3363575 3365956 . - . ID=BALIOE_17035_gene;locus_tag=BALIOE_17035 | |
| 6825 c1 Prodigal CDS 3363575 3365956 . - 0 ID=BALIOE_17035;Name=hypothetical protein;locus_tag=BALIOE_17035;product=hypothetical protein;Parent=BALIOE_17035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6826 c1 Prodigal gene 3366120 3368432 . - . ID=BALIOE_17040_gene;locus_tag=BALIOE_17040 | |
| 6827 c1 Prodigal CDS 3366120 3368432 . - 0 ID=BALIOE_17040;Name=hypothetical protein;locus_tag=BALIOE_17040;product=hypothetical protein;Parent=BALIOE_17040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6828 c1 Prodigal gene 3368433 3373394 . - . ID=BALIOE_17045_gene;locus_tag=BALIOE_17045 | |
| 6829 c1 Prodigal CDS 3368433 3373394 . - 0 ID=BALIOE_17045;Name=hypothetical protein;locus_tag=BALIOE_17045;product=hypothetical protein;Parent=BALIOE_17045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6830 c1 Prodigal gene 3373601 3374446 . + . ID=BALIOE_17050_gene;locus_tag=BALIOE_17050 | |
| 6831 c1 Prodigal CDS 3373601 3374446 . + 0 ID=BALIOE_17050;Name=hypothetical protein;locus_tag=BALIOE_17050;product=hypothetical protein;Parent=BALIOE_17050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6832 c1 Prodigal gene 3374946 3375722 . - . ID=BALIOE_17055_gene;locus_tag=BALIOE_17055 | |
| 6833 c1 Prodigal CDS 3374946 3375722 . - 0 ID=BALIOE_17055;Name=hypothetical protein;locus_tag=BALIOE_17055;product=hypothetical protein;Parent=BALIOE_17055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6834 c1 Prodigal gene 3375865 3377148 . - . ID=BALIOE_17060_gene;locus_tag=BALIOE_17060 | |
| 6835 c1 Prodigal CDS 3375865 3377148 . - 0 ID=BALIOE_17060;Name=hypothetical protein;locus_tag=BALIOE_17060;product=hypothetical protein;Parent=BALIOE_17060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6836 c1 Prodigal gene 3377326 3377526 . - . ID=BALIOE_17065_gene;locus_tag=BALIOE_17065 | |
| 6837 c1 Prodigal CDS 3377326 3377526 . - 0 ID=BALIOE_17065;Name=hypothetical protein;locus_tag=BALIOE_17065;product=hypothetical protein;Parent=BALIOE_17065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6838 c1 Prodigal gene 3377538 3377873 . - . ID=BALIOE_17070_gene;locus_tag=BALIOE_17070 | |
| 6839 c1 Prodigal CDS 3377538 3377873 . - 0 ID=BALIOE_17070;Name=hypothetical protein;locus_tag=BALIOE_17070;product=hypothetical protein;Parent=BALIOE_17070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6840 c1 Prodigal gene 3377875 3379725 . - . ID=BALIOE_17075_gene;locus_tag=BALIOE_17075 | |
| 6841 c1 Prodigal CDS 3377875 3379725 . - 0 ID=BALIOE_17075;Name=hypothetical protein;locus_tag=BALIOE_17075;product=hypothetical protein;Parent=BALIOE_17075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6842 c1 Prodigal gene 3379742 3380257 . - . ID=BALIOE_17080_gene;locus_tag=BALIOE_17080 | |
| 6843 c1 Prodigal CDS 3379742 3380257 . - 0 ID=BALIOE_17080;Name=hypothetical protein;locus_tag=BALIOE_17080;product=hypothetical protein;Parent=BALIOE_17080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6844 c1 Prodigal gene 3380353 3380676 . - . ID=BALIOE_17085_gene;locus_tag=BALIOE_17085 | |
| 6845 c1 Prodigal CDS 3380353 3380676 . - 0 ID=BALIOE_17085;Name=hypothetical protein;locus_tag=BALIOE_17085;product=hypothetical protein;Parent=BALIOE_17085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6846 c1 Prodigal gene 3380693 3381079 . - . ID=BALIOE_17090_gene;locus_tag=BALIOE_17090 | |
| 6847 c1 Prodigal CDS 3380693 3381079 . - 0 ID=BALIOE_17090;Name=hypothetical protein;locus_tag=BALIOE_17090;product=hypothetical protein;Parent=BALIOE_17090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6848 c1 Prodigal gene 3381107 3382321 . - . ID=BALIOE_17095_gene;locus_tag=BALIOE_17095 | |
| 6849 c1 Prodigal CDS 3381107 3382321 . - 0 ID=BALIOE_17095;Name=hypothetical protein;locus_tag=BALIOE_17095;product=hypothetical protein;Parent=BALIOE_17095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6850 c1 Prodigal gene 3382433 3382921 . - . ID=BALIOE_17100_gene;locus_tag=BALIOE_17100 | |
| 6851 c1 Prodigal CDS 3382433 3382921 . - 0 ID=BALIOE_17100;Name=hypothetical protein;locus_tag=BALIOE_17100;product=hypothetical protein;Parent=BALIOE_17100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6852 c1 Prodigal gene 3383222 3383959 . - . ID=BALIOE_17105_gene;locus_tag=BALIOE_17105 | |
| 6853 c1 Prodigal CDS 3383222 3383959 . - 0 ID=BALIOE_17105;Name=hypothetical protein;locus_tag=BALIOE_17105;product=hypothetical protein;Parent=BALIOE_17105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6854 c1 Prodigal gene 3384078 3384881 . + . ID=BALIOE_17110_gene;locus_tag=BALIOE_17110 | |
| 6855 c1 Prodigal CDS 3384078 3384881 . + 0 ID=BALIOE_17110;Name=hypothetical protein;locus_tag=BALIOE_17110;product=hypothetical protein;Parent=BALIOE_17110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6856 c1 Prodigal gene 3385026 3385880 . + . ID=BALIOE_17115_gene;locus_tag=BALIOE_17115 | |
| 6857 c1 Prodigal CDS 3385026 3385880 . + 0 ID=BALIOE_17115;Name=hypothetical protein;locus_tag=BALIOE_17115;product=hypothetical protein;Parent=BALIOE_17115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6858 c1 Prodigal gene 3386071 3387351 . + . ID=BALIOE_17120_gene;locus_tag=BALIOE_17120 | |
| 6859 c1 Prodigal CDS 3386071 3387351 . + 0 ID=BALIOE_17120;Name=hypothetical protein;locus_tag=BALIOE_17120;product=hypothetical protein;Parent=BALIOE_17120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6860 c1 Prodigal gene 3387343 3388482 . - . ID=BALIOE_17125_gene;locus_tag=BALIOE_17125 | |
| 6861 c1 Prodigal CDS 3387343 3388482 . - 0 ID=BALIOE_17125;Name=hypothetical protein;locus_tag=BALIOE_17125;product=hypothetical protein;Parent=BALIOE_17125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6862 c1 Prodigal gene 3388642 3389532 . - . ID=BALIOE_17130_gene;locus_tag=BALIOE_17130 | |
| 6863 c1 Prodigal CDS 3388642 3389532 . - 0 ID=BALIOE_17130;Name=hypothetical protein;locus_tag=BALIOE_17130;product=hypothetical protein;Parent=BALIOE_17130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6864 c1 Prodigal gene 3389668 3391029 . + . ID=BALIOE_17135_gene;locus_tag=BALIOE_17135 | |
| 6865 c1 Prodigal CDS 3389668 3391029 . + 0 ID=BALIOE_17135;Name=hypothetical protein;locus_tag=BALIOE_17135;product=hypothetical protein;Parent=BALIOE_17135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6866 c1 Prodigal gene 3391026 3391544 . + . ID=BALIOE_17140_gene;locus_tag=BALIOE_17140 | |
| 6867 c1 Prodigal CDS 3391026 3391544 . + 0 ID=BALIOE_17140;Name=hypothetical protein;locus_tag=BALIOE_17140;product=hypothetical protein;Parent=BALIOE_17140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6868 c1 Prodigal gene 3391544 3391864 . + . ID=BALIOE_17145_gene;locus_tag=BALIOE_17145 | |
| 6869 c1 Prodigal CDS 3391544 3391864 . + 0 ID=BALIOE_17145;Name=hypothetical protein;locus_tag=BALIOE_17145;product=hypothetical protein;Parent=BALIOE_17145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6870 c1 Prodigal gene 3391861 3392673 . + . ID=BALIOE_17150_gene;locus_tag=BALIOE_17150 | |
| 6871 c1 Prodigal CDS 3391861 3392673 . + 0 ID=BALIOE_17150;Name=hypothetical protein;locus_tag=BALIOE_17150;product=hypothetical protein;Parent=BALIOE_17150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6872 c1 Prodigal gene 3392683 3393885 . + . ID=BALIOE_17155_gene;locus_tag=BALIOE_17155 | |
| 6873 c1 Prodigal CDS 3392683 3393885 . + 0 ID=BALIOE_17155;Name=hypothetical protein;locus_tag=BALIOE_17155;product=hypothetical protein;Parent=BALIOE_17155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6874 c1 Prodigal gene 3393982 3394404 . + . ID=BALIOE_17160_gene;locus_tag=BALIOE_17160 | |
| 6875 c1 Prodigal CDS 3393982 3394404 . + 0 ID=BALIOE_17160;Name=hypothetical protein;locus_tag=BALIOE_17160;product=hypothetical protein;Parent=BALIOE_17160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6876 c1 Prodigal gene 3394452 3395324 . - . ID=BALIOE_17165_gene;locus_tag=BALIOE_17165 | |
| 6877 c1 Prodigal CDS 3394452 3395324 . - 0 ID=BALIOE_17165;Name=hypothetical protein;locus_tag=BALIOE_17165;product=hypothetical protein;Parent=BALIOE_17165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6878 c1 Prodigal gene 3395336 3396163 . - . ID=BALIOE_17170_gene;locus_tag=BALIOE_17170 | |
| 6879 c1 Prodigal CDS 3395336 3396163 . - 0 ID=BALIOE_17170;Name=hypothetical protein;locus_tag=BALIOE_17170;product=hypothetical protein;Parent=BALIOE_17170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6880 c1 Prodigal gene 3396206 3396397 . - . ID=BALIOE_17175_gene;locus_tag=BALIOE_17175 | |
| 6881 c1 Prodigal CDS 3396206 3396397 . - 0 ID=BALIOE_17175;Name=hypothetical protein;locus_tag=BALIOE_17175;product=hypothetical protein;Parent=BALIOE_17175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6882 c1 Prodigal gene 3396463 3397461 . - . ID=BALIOE_17180_gene;locus_tag=BALIOE_17180 | |
| 6883 c1 Prodigal CDS 3396463 3397461 . - 0 ID=BALIOE_17180;Name=hypothetical protein;locus_tag=BALIOE_17180;product=hypothetical protein;Parent=BALIOE_17180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6884 c1 Prodigal gene 3397486 3398997 . - . ID=BALIOE_17185_gene;locus_tag=BALIOE_17185 | |
| 6885 c1 Prodigal CDS 3397486 3398997 . - 0 ID=BALIOE_17185;Name=hypothetical protein;locus_tag=BALIOE_17185;product=hypothetical protein;Parent=BALIOE_17185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6886 c1 Prodigal gene 3399020 3400003 . - . ID=BALIOE_17190_gene;locus_tag=BALIOE_17190 | |
| 6887 c1 Prodigal CDS 3399020 3400003 . - 0 ID=BALIOE_17190;Name=hypothetical protein;locus_tag=BALIOE_17190;product=hypothetical protein;Parent=BALIOE_17190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6888 c1 Prodigal gene 3400100 3403381 . - . ID=BALIOE_17195_gene;locus_tag=BALIOE_17195 | |
| 6889 c1 Prodigal CDS 3400100 3403381 . - 0 ID=BALIOE_17195;Name=hypothetical protein;locus_tag=BALIOE_17195;product=hypothetical protein;Parent=BALIOE_17195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6890 c1 Prodigal gene 3403499 3404692 . + . ID=BALIOE_17200_gene;locus_tag=BALIOE_17200 | |
| 6891 c1 Prodigal CDS 3403499 3404692 . + 0 ID=BALIOE_17200;Name=hypothetical protein;locus_tag=BALIOE_17200;product=hypothetical protein;Parent=BALIOE_17200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6892 c1 Prodigal gene 3404755 3406008 . - . ID=BALIOE_17205_gene;locus_tag=BALIOE_17205 | |
| 6893 c1 Prodigal CDS 3404755 3406008 . - 0 ID=BALIOE_17205;Name=hypothetical protein;locus_tag=BALIOE_17205;product=hypothetical protein;Parent=BALIOE_17205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6894 c1 Prodigal gene 3406336 3407526 . + . ID=BALIOE_17210_gene;locus_tag=BALIOE_17210 | |
| 6895 c1 Prodigal CDS 3406336 3407526 . + 0 ID=BALIOE_17210;Name=hypothetical protein;locus_tag=BALIOE_17210;product=hypothetical protein;Parent=BALIOE_17210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6896 c1 Prodigal gene 3407571 3407909 . - . ID=BALIOE_17215_gene;locus_tag=BALIOE_17215 | |
| 6897 c1 Prodigal CDS 3407571 3407909 . - 0 ID=BALIOE_17215;Name=hypothetical protein;locus_tag=BALIOE_17215;product=hypothetical protein;Parent=BALIOE_17215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6898 c1 Prodigal gene 3407970 3409304 . - . ID=BALIOE_17220_gene;locus_tag=BALIOE_17220 | |
| 6899 c1 Prodigal CDS 3407970 3409304 . - 0 ID=BALIOE_17220;Name=hypothetical protein;locus_tag=BALIOE_17220;product=hypothetical protein;Parent=BALIOE_17220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6900 c1 Prodigal gene 3409294 3410007 . - . ID=BALIOE_17225_gene;locus_tag=BALIOE_17225 | |
| 6901 c1 Prodigal CDS 3409294 3410007 . - 0 ID=BALIOE_17225;Name=hypothetical protein;locus_tag=BALIOE_17225;product=hypothetical protein;Parent=BALIOE_17225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6902 c1 Prodigal gene 3410172 3411554 . - . ID=BALIOE_17230_gene;locus_tag=BALIOE_17230 | |
| 6903 c1 Prodigal CDS 3410172 3411554 . - 0 ID=BALIOE_17230;Name=hypothetical protein;locus_tag=BALIOE_17230;product=hypothetical protein;Parent=BALIOE_17230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6904 c1 Prodigal gene 3412175 3416062 . - . ID=BALIOE_17235_gene;locus_tag=BALIOE_17235 | |
| 6905 c1 Prodigal CDS 3412175 3416062 . - 0 ID=BALIOE_17235;Name=hypothetical protein;locus_tag=BALIOE_17235;product=hypothetical protein;Parent=BALIOE_17235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6906 c1 Prodigal gene 3416319 3417875 . + . ID=BALIOE_17240_gene;locus_tag=BALIOE_17240 | |
| 6907 c1 Prodigal CDS 3416319 3417875 . + 0 ID=BALIOE_17240;Name=hypothetical protein;locus_tag=BALIOE_17240;product=hypothetical protein;Parent=BALIOE_17240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6908 c1 Prodigal gene 3417872 3418375 . - . ID=BALIOE_17245_gene;locus_tag=BALIOE_17245 | |
| 6909 c1 Prodigal CDS 3417872 3418375 . - 0 ID=BALIOE_17245;Name=hypothetical protein;locus_tag=BALIOE_17245;product=hypothetical protein;Parent=BALIOE_17245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6910 c1 Prodigal gene 3418433 3419068 . - . ID=BALIOE_17250_gene;locus_tag=BALIOE_17250 | |
| 6911 c1 Prodigal CDS 3418433 3419068 . - 0 ID=BALIOE_17250;Name=hypothetical protein;locus_tag=BALIOE_17250;product=hypothetical protein;Parent=BALIOE_17250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6912 c1 Prodigal gene 3419277 3420125 . + . ID=BALIOE_17255_gene;locus_tag=BALIOE_17255 | |
| 6913 c1 Prodigal CDS 3419277 3420125 . + 0 ID=BALIOE_17255;Name=hypothetical protein;locus_tag=BALIOE_17255;product=hypothetical protein;Parent=BALIOE_17255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6914 c1 Prodigal gene 3420181 3420441 . + . ID=BALIOE_17260_gene;locus_tag=BALIOE_17260 | |
| 6915 c1 Prodigal CDS 3420181 3420441 . + 0 ID=BALIOE_17260;Name=hypothetical protein;locus_tag=BALIOE_17260;product=hypothetical protein;Parent=BALIOE_17260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6916 c1 Prodigal gene 3421137 3421517 . - . ID=BALIOE_17265_gene;locus_tag=BALIOE_17265 | |
| 6917 c1 Prodigal CDS 3421137 3421517 . - 0 ID=BALIOE_17265;Name=hypothetical protein;locus_tag=BALIOE_17265;product=hypothetical protein;Parent=BALIOE_17265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6918 c1 Prodigal gene 3421517 3422248 . - . ID=BALIOE_17270_gene;locus_tag=BALIOE_17270 | |
| 6919 c1 Prodigal CDS 3421517 3422248 . - 0 ID=BALIOE_17270;Name=hypothetical protein;locus_tag=BALIOE_17270;product=hypothetical protein;Parent=BALIOE_17270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6920 c1 Prodigal gene 3422260 3422988 . - . ID=BALIOE_17275_gene;locus_tag=BALIOE_17275 | |
| 6921 c1 Prodigal CDS 3422260 3422988 . - 0 ID=BALIOE_17275;Name=hypothetical protein;locus_tag=BALIOE_17275;product=hypothetical protein;Parent=BALIOE_17275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6922 c1 Prodigal gene 3423000 3423905 . - . ID=BALIOE_17280_gene;locus_tag=BALIOE_17280 | |
| 6923 c1 Prodigal CDS 3423000 3423905 . - 0 ID=BALIOE_17280;Name=hypothetical protein;locus_tag=BALIOE_17280;product=hypothetical protein;Parent=BALIOE_17280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6924 c1 Prodigal gene 3423902 3424582 . - . ID=BALIOE_17285_gene;locus_tag=BALIOE_17285 | |
| 6925 c1 Prodigal CDS 3423902 3424582 . - 0 ID=BALIOE_17285;Name=hypothetical protein;locus_tag=BALIOE_17285;product=hypothetical protein;Parent=BALIOE_17285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6926 c1 Prodigal gene 3424855 3425829 . - . ID=BALIOE_17290_gene;locus_tag=BALIOE_17290 | |
| 6927 c1 Prodigal CDS 3424855 3425829 . - 0 ID=BALIOE_17290;Name=hypothetical protein;locus_tag=BALIOE_17290;product=hypothetical protein;Parent=BALIOE_17290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6928 c1 Prodigal gene 3425845 3427644 . - . ID=BALIOE_17295_gene;locus_tag=BALIOE_17295 | |
| 6929 c1 Prodigal CDS 3425845 3427644 . - 0 ID=BALIOE_17295;Name=hypothetical protein;locus_tag=BALIOE_17295;product=hypothetical protein;Parent=BALIOE_17295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6930 c1 Prodigal gene 3427842 3428321 . - . ID=BALIOE_17300_gene;locus_tag=BALIOE_17300 | |
| 6931 c1 Prodigal CDS 3427842 3428321 . - 0 ID=BALIOE_17300;Name=hypothetical protein;locus_tag=BALIOE_17300;product=hypothetical protein;Parent=BALIOE_17300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6932 c1 Prodigal gene 3428318 3429274 . - . ID=BALIOE_17305_gene;locus_tag=BALIOE_17305 | |
| 6933 c1 Prodigal CDS 3428318 3429274 . - 0 ID=BALIOE_17305;Name=hypothetical protein;locus_tag=BALIOE_17305;product=hypothetical protein;Parent=BALIOE_17305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6934 c1 Prodigal gene 3429274 3429912 . - . ID=BALIOE_17310_gene;locus_tag=BALIOE_17310 | |
| 6935 c1 Prodigal CDS 3429274 3429912 . - 0 ID=BALIOE_17310;Name=hypothetical protein;locus_tag=BALIOE_17310;product=hypothetical protein;Parent=BALIOE_17310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6936 c1 Prodigal gene 3429945 3430520 . - . ID=BALIOE_17315_gene;locus_tag=BALIOE_17315 | |
| 6937 c1 Prodigal CDS 3429945 3430520 . - 0 ID=BALIOE_17315;Name=hypothetical protein;locus_tag=BALIOE_17315;product=hypothetical protein;Parent=BALIOE_17315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6938 c1 Prodigal gene 3430928 3432550 . + . ID=BALIOE_17320_gene;locus_tag=BALIOE_17320 | |
| 6939 c1 Prodigal CDS 3430928 3432550 . + 0 ID=BALIOE_17320;Name=hypothetical protein;locus_tag=BALIOE_17320;product=hypothetical protein;Parent=BALIOE_17320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6940 c1 Prodigal gene 3432535 3433272 . - . ID=BALIOE_17325_gene;locus_tag=BALIOE_17325 | |
| 6941 c1 Prodigal CDS 3432535 3433272 . - 0 ID=BALIOE_17325;Name=hypothetical protein;locus_tag=BALIOE_17325;product=hypothetical protein;Parent=BALIOE_17325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6942 c1 Prodigal gene 3433404 3434738 . + . ID=BALIOE_17330_gene;locus_tag=BALIOE_17330 | |
| 6943 c1 Prodigal CDS 3433404 3434738 . + 0 ID=BALIOE_17330;Name=hypothetical protein;locus_tag=BALIOE_17330;product=hypothetical protein;Parent=BALIOE_17330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6944 c1 Prodigal gene 3434771 3435652 . - . ID=BALIOE_17335_gene;locus_tag=BALIOE_17335 | |
| 6945 c1 Prodigal CDS 3434771 3435652 . - 0 ID=BALIOE_17335;Name=hypothetical protein;locus_tag=BALIOE_17335;product=hypothetical protein;Parent=BALIOE_17335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6946 c1 Prodigal gene 3435755 3436342 . + . ID=BALIOE_17340_gene;locus_tag=BALIOE_17340 | |
| 6947 c1 Prodigal CDS 3435755 3436342 . + 0 ID=BALIOE_17340;Name=hypothetical protein;locus_tag=BALIOE_17340;product=hypothetical protein;Parent=BALIOE_17340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6948 c1 Prodigal gene 3436398 3436781 . - . ID=BALIOE_17345_gene;locus_tag=BALIOE_17345 | |
| 6949 c1 Prodigal CDS 3436398 3436781 . - 0 ID=BALIOE_17345;Name=hypothetical protein;locus_tag=BALIOE_17345;product=hypothetical protein;Parent=BALIOE_17345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6950 c1 Prodigal gene 3437086 3437775 . + . ID=BALIOE_17350_gene;locus_tag=BALIOE_17350 | |
| 6951 c1 Prodigal CDS 3437086 3437775 . + 0 ID=BALIOE_17350;Name=hypothetical protein;locus_tag=BALIOE_17350;product=hypothetical protein;Parent=BALIOE_17350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6952 c1 Prodigal gene 3437823 3438860 . - . ID=BALIOE_17355_gene;locus_tag=BALIOE_17355 | |
| 6953 c1 Prodigal CDS 3437823 3438860 . - 0 ID=BALIOE_17355;Name=hypothetical protein;locus_tag=BALIOE_17355;product=hypothetical protein;Parent=BALIOE_17355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6954 c1 Prodigal gene 3439067 3439486 . + . ID=BALIOE_17360_gene;locus_tag=BALIOE_17360 | |
| 6955 c1 Prodigal CDS 3439067 3439486 . + 0 ID=BALIOE_17360;Name=hypothetical protein;locus_tag=BALIOE_17360;product=hypothetical protein;Parent=BALIOE_17360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6956 c1 Prodigal gene 3439555 3440253 . + . ID=BALIOE_17365_gene;locus_tag=BALIOE_17365 | |
| 6957 c1 Prodigal CDS 3439555 3440253 . + 0 ID=BALIOE_17365;Name=hypothetical protein;locus_tag=BALIOE_17365;product=hypothetical protein;Parent=BALIOE_17365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6958 c1 Prodigal gene 3440285 3442945 . + . ID=BALIOE_17370_gene;locus_tag=BALIOE_17370 | |
| 6959 c1 Prodigal CDS 3440285 3442945 . + 0 ID=BALIOE_17370;Name=hypothetical protein;locus_tag=BALIOE_17370;product=hypothetical protein;Parent=BALIOE_17370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6960 c1 Prodigal gene 3443059 3444414 . + . ID=BALIOE_17375_gene;locus_tag=BALIOE_17375 | |
| 6961 c1 Prodigal CDS 3443059 3444414 . + 0 ID=BALIOE_17375;Name=hypothetical protein;locus_tag=BALIOE_17375;product=hypothetical protein;Parent=BALIOE_17375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6962 c1 Prodigal gene 3444511 3444783 . + . ID=BALIOE_17380_gene;locus_tag=BALIOE_17380 | |
| 6963 c1 Prodigal CDS 3444511 3444783 . + 0 ID=BALIOE_17380;Name=hypothetical protein;locus_tag=BALIOE_17380;product=hypothetical protein;Parent=BALIOE_17380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6964 c1 Prodigal gene 3444780 3446078 . - . ID=BALIOE_17385_gene;locus_tag=BALIOE_17385 | |
| 6965 c1 Prodigal CDS 3444780 3446078 . - 0 ID=BALIOE_17385;Name=hypothetical protein;locus_tag=BALIOE_17385;product=hypothetical protein;Parent=BALIOE_17385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6966 c1 tRNAscan-SE gene 3449707 3449782 . - . ID=BALIOE_17390_gene;locus_tag=BALIOE_17390;gene=Glu_trna | |
| 6967 c1 tRNAscan-SE tRNA 3449707 3449782 . - . ID=BALIOE_17390;Name=tRNA-Glu;locus_tag=BALIOE_17390;product=tRNA-Glu;gene=Glu_trna;Parent=BALIOE_17390_gene;inference=profile:tRNAscan:2.0;Note=SO:0000259 | |
| 6968 c1 Infernal gene 3449868 3451409 . - . ID=BALIOE_17395_gene;locus_tag=BALIOE_17395;gene=16S_rrna | |
| 6969 c1 Infernal rRNA 3449868 3451409 8.4e-49 - . ID=BALIOE_17395;Name=16S ribosomal RNA;locus_tag=BALIOE_17395;gene=16S_rrna;product=16S ribosomal RNA;Dbxref=GO:0005840,GO:0003735,RFAM:RF00177;Parent=BALIOE_17395_gene;inference=profile:Rfam:RF00177;Note=SO:0001000 | |
| 6970 c1 Prodigal gene 3451852 3454425 . - . ID=BALIOE_17400_gene;locus_tag=BALIOE_17400 | |
| 6971 c1 Prodigal CDS 3451852 3454425 . - 0 ID=BALIOE_17400;Name=hypothetical protein;locus_tag=BALIOE_17400;product=hypothetical protein;Parent=BALIOE_17400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6972 c1 Prodigal gene 3454555 3455286 . - . ID=BALIOE_17405_gene;locus_tag=BALIOE_17405 | |
| 6973 c1 Prodigal CDS 3454555 3455286 . - 0 ID=BALIOE_17405;Name=hypothetical protein;locus_tag=BALIOE_17405;product=hypothetical protein;Parent=BALIOE_17405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6974 c1 Prodigal gene 3455283 3456263 . - . ID=BALIOE_17410_gene;locus_tag=BALIOE_17410 | |
| 6975 c1 Prodigal CDS 3455283 3456263 . - 0 ID=BALIOE_17410;Name=hypothetical protein;locus_tag=BALIOE_17410;product=hypothetical protein;Parent=BALIOE_17410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6976 c1 Prodigal gene 3456398 3457135 . + . ID=BALIOE_17415_gene;locus_tag=BALIOE_17415 | |
| 6977 c1 Prodigal CDS 3456398 3457135 . + 0 ID=BALIOE_17415;Name=hypothetical protein;locus_tag=BALIOE_17415;product=hypothetical protein;Parent=BALIOE_17415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6978 c1 Prodigal gene 3457406 3457747 . + . ID=BALIOE_17420_gene;locus_tag=BALIOE_17420 | |
| 6979 c1 Prodigal CDS 3457406 3457747 . + 0 ID=BALIOE_17420;Name=hypothetical protein;locus_tag=BALIOE_17420;product=hypothetical protein;Parent=BALIOE_17420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6980 c1 Prodigal gene 3457997 3459157 . + . ID=BALIOE_17425_gene;locus_tag=BALIOE_17425 | |
| 6981 c1 Prodigal CDS 3457997 3459157 . + 0 ID=BALIOE_17425;Name=hypothetical protein;locus_tag=BALIOE_17425;product=hypothetical protein;Parent=BALIOE_17425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6982 c1 Prodigal gene 3459200 3460321 . - . ID=BALIOE_17430_gene;locus_tag=BALIOE_17430 | |
| 6983 c1 Prodigal CDS 3459200 3460321 . - 0 ID=BALIOE_17430;Name=hypothetical protein;locus_tag=BALIOE_17430;product=hypothetical protein;Parent=BALIOE_17430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6984 c1 Prodigal gene 3460332 3461402 . - . ID=BALIOE_17435_gene;locus_tag=BALIOE_17435 | |
| 6985 c1 Prodigal CDS 3460332 3461402 . - 0 ID=BALIOE_17435;Name=hypothetical protein;locus_tag=BALIOE_17435;product=hypothetical protein;Parent=BALIOE_17435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6986 c1 Prodigal gene 3461615 3461977 . + . ID=BALIOE_17440_gene;locus_tag=BALIOE_17440 | |
| 6987 c1 Prodigal CDS 3461615 3461977 . + 0 ID=BALIOE_17440;Name=hypothetical protein;locus_tag=BALIOE_17440;product=hypothetical protein;Parent=BALIOE_17440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6988 c1 Prodigal gene 3462127 3462645 . + . ID=BALIOE_17445_gene;locus_tag=BALIOE_17445 | |
| 6989 c1 Prodigal CDS 3462127 3462645 . + 0 ID=BALIOE_17445;Name=hypothetical protein;locus_tag=BALIOE_17445;product=hypothetical protein;Parent=BALIOE_17445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6990 c1 Prodigal gene 3462635 3463861 . + . ID=BALIOE_17450_gene;locus_tag=BALIOE_17450 | |
| 6991 c1 Prodigal CDS 3462635 3463861 . + 0 ID=BALIOE_17450;Name=hypothetical protein;locus_tag=BALIOE_17450;product=hypothetical protein;Parent=BALIOE_17450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6992 c1 Prodigal gene 3463877 3464359 . + . ID=BALIOE_17455_gene;locus_tag=BALIOE_17455 | |
| 6993 c1 Prodigal CDS 3463877 3464359 . + 0 ID=BALIOE_17455;Name=hypothetical protein;locus_tag=BALIOE_17455;product=hypothetical protein;Parent=BALIOE_17455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6994 c1 Prodigal gene 3464436 3464783 . - . ID=BALIOE_17460_gene;locus_tag=BALIOE_17460 | |
| 6995 c1 Prodigal CDS 3464436 3464783 . - 0 ID=BALIOE_17460;Name=hypothetical protein;locus_tag=BALIOE_17460;product=hypothetical protein;Parent=BALIOE_17460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6996 c1 Prodigal gene 3464825 3465592 . - . ID=BALIOE_17465_gene;locus_tag=BALIOE_17465 | |
| 6997 c1 Prodigal CDS 3464825 3465592 . - 0 ID=BALIOE_17465;Name=hypothetical protein;locus_tag=BALIOE_17465;product=hypothetical protein;Parent=BALIOE_17465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 6998 c1 Prodigal gene 3465623 3466171 . - . ID=BALIOE_17470_gene;locus_tag=BALIOE_17470 | |
| 6999 c1 Prodigal CDS 3465623 3466171 . - 0 ID=BALIOE_17470;Name=hypothetical protein;locus_tag=BALIOE_17470;product=hypothetical protein;Parent=BALIOE_17470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7000 c1 Prodigal gene 3466190 3466438 . - . ID=BALIOE_17475_gene;locus_tag=BALIOE_17475 | |
| 7001 c1 Prodigal CDS 3466190 3466438 . - 0 ID=BALIOE_17475;Name=hypothetical protein;locus_tag=BALIOE_17475;product=hypothetical protein;Parent=BALIOE_17475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7002 c1 Prodigal gene 3466575 3467936 . - . ID=BALIOE_17480_gene;locus_tag=BALIOE_17480 | |
| 7003 c1 Prodigal CDS 3466575 3467936 . - 0 ID=BALIOE_17480;Name=hypothetical protein;locus_tag=BALIOE_17480;product=hypothetical protein;Parent=BALIOE_17480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7004 c1 Prodigal gene 3468028 3468894 . + . ID=BALIOE_17485_gene;locus_tag=BALIOE_17485 | |
| 7005 c1 Prodigal CDS 3468028 3468894 . + 0 ID=BALIOE_17485;Name=hypothetical protein;locus_tag=BALIOE_17485;product=hypothetical protein;Parent=BALIOE_17485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7006 c1 Prodigal gene 3468961 3470202 . + . ID=BALIOE_17490_gene;locus_tag=BALIOE_17490 | |
| 7007 c1 Prodigal CDS 3468961 3470202 . + 0 ID=BALIOE_17490;Name=hypothetical protein;locus_tag=BALIOE_17490;product=hypothetical protein;Parent=BALIOE_17490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7008 c1 Prodigal gene 3470257 3470850 . - . ID=BALIOE_17495_gene;locus_tag=BALIOE_17495 | |
| 7009 c1 Prodigal CDS 3470257 3470850 . - 0 ID=BALIOE_17495;Name=hypothetical protein;locus_tag=BALIOE_17495;product=hypothetical protein;Parent=BALIOE_17495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7010 c1 Prodigal gene 3470973 3471851 . + . ID=BALIOE_17500_gene;locus_tag=BALIOE_17500 | |
| 7011 c1 Prodigal CDS 3470973 3471851 . + 0 ID=BALIOE_17500;Name=hypothetical protein;locus_tag=BALIOE_17500;product=hypothetical protein;Parent=BALIOE_17500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7012 c1 Prodigal gene 3471937 3473598 . + . ID=BALIOE_17505_gene;locus_tag=BALIOE_17505 | |
| 7013 c1 Prodigal CDS 3471937 3473598 . + 0 ID=BALIOE_17505;Name=hypothetical protein;locus_tag=BALIOE_17505;product=hypothetical protein;Parent=BALIOE_17505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7014 c1 Prodigal gene 3473747 3474088 . + . ID=BALIOE_17510_gene;locus_tag=BALIOE_17510 | |
| 7015 c1 Prodigal CDS 3473747 3474088 . + 0 ID=BALIOE_17510;Name=hypothetical protein;locus_tag=BALIOE_17510;product=hypothetical protein;Parent=BALIOE_17510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7016 c1 Prodigal gene 3474150 3474440 . - . ID=BALIOE_17515_gene;locus_tag=BALIOE_17515 | |
| 7017 c1 Prodigal CDS 3474150 3474440 . - 0 ID=BALIOE_17515;Name=hypothetical protein;locus_tag=BALIOE_17515;product=hypothetical protein;Parent=BALIOE_17515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7018 c1 Prodigal gene 3474430 3474879 . - . ID=BALIOE_17520_gene;locus_tag=BALIOE_17520 | |
| 7019 c1 Prodigal CDS 3474430 3474879 . - 0 ID=BALIOE_17520;Name=hypothetical protein;locus_tag=BALIOE_17520;product=hypothetical protein;Parent=BALIOE_17520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7020 c1 Prodigal gene 3475038 3475520 . + . ID=BALIOE_17525_gene;locus_tag=BALIOE_17525 | |
| 7021 c1 Prodigal CDS 3475038 3475520 . + 0 ID=BALIOE_17525;Name=hypothetical protein;locus_tag=BALIOE_17525;product=hypothetical protein;Parent=BALIOE_17525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7022 c1 Aragorn gene 3475735 3476097 . + . ID=BALIOE_17530_gene;locus_tag=BALIOE_17530;gene=ssrA | |
| 7023 c1 Aragorn tmRNA 3475735 3476097 . + . ID=BALIOE_17530;Name=transfer-messenger RNA%2C SsrA;locus_tag=BALIOE_17530;gene=ssrA;product=transfer-messenger RNA%2C SsrA;Parent=BALIOE_17530_gene;inference=profile:aragorn:1.2;Note=SO:0000584 | |
| 7024 c1 Prodigal gene 3476366 3476614 . + . ID=BALIOE_17535_gene;locus_tag=BALIOE_17535 | |
| 7025 c1 Prodigal CDS 3476366 3476614 . + 0 ID=BALIOE_17535;Name=hypothetical protein;locus_tag=BALIOE_17535;product=hypothetical protein;Parent=BALIOE_17535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7026 c1 Prodigal gene 3477116 3477706 . - . ID=BALIOE_17540_gene;locus_tag=BALIOE_17540 | |
| 7027 c1 Prodigal CDS 3477116 3477706 . - 0 ID=BALIOE_17540;Name=hypothetical protein;locus_tag=BALIOE_17540;product=hypothetical protein;Parent=BALIOE_17540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7028 c1 Prodigal gene 3477889 3478539 . + . ID=BALIOE_17545_gene;locus_tag=BALIOE_17545 | |
| 7029 c1 Prodigal CDS 3477889 3478539 . + 0 ID=BALIOE_17545;Name=hypothetical protein;locus_tag=BALIOE_17545;product=hypothetical protein;Parent=BALIOE_17545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7030 c1 Prodigal gene 3478618 3479676 . + . ID=BALIOE_17550_gene;locus_tag=BALIOE_17550 | |
| 7031 c1 Prodigal CDS 3478618 3479676 . + 0 ID=BALIOE_17550;Name=hypothetical protein;locus_tag=BALIOE_17550;product=hypothetical protein;Parent=BALIOE_17550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7032 c1 Prodigal gene 3479806 3480213 . - . ID=BALIOE_17555_gene;locus_tag=BALIOE_17555 | |
| 7033 c1 Prodigal CDS 3479806 3480213 . - 0 ID=BALIOE_17555;Name=hypothetical protein;locus_tag=BALIOE_17555;product=hypothetical protein;Parent=BALIOE_17555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7034 c1 Prodigal gene 3480389 3480658 . - . ID=BALIOE_17560_gene;locus_tag=BALIOE_17560 | |
| 7035 c1 Prodigal CDS 3480389 3480658 . - 0 ID=BALIOE_17560;Name=hypothetical protein;locus_tag=BALIOE_17560;product=hypothetical protein;Parent=BALIOE_17560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7036 c1 Prodigal gene 3480876 3481202 . + . ID=BALIOE_17565_gene;locus_tag=BALIOE_17565 | |
| 7037 c1 Prodigal CDS 3480876 3481202 . + 0 ID=BALIOE_17565;Name=hypothetical protein;locus_tag=BALIOE_17565;product=hypothetical protein;Parent=BALIOE_17565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7038 c1 Prodigal gene 3481202 3482089 . + . ID=BALIOE_17570_gene;locus_tag=BALIOE_17570 | |
| 7039 c1 Prodigal CDS 3481202 3482089 . + 0 ID=BALIOE_17570;Name=hypothetical protein;locus_tag=BALIOE_17570;product=hypothetical protein;Parent=BALIOE_17570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7040 c1 Prodigal gene 3481896 3482540 . - . ID=BALIOE_17575_gene;locus_tag=BALIOE_17575 | |
| 7041 c1 Prodigal CDS 3481896 3482540 . - 0 ID=BALIOE_17575;Name=hypothetical protein;locus_tag=BALIOE_17575;product=hypothetical protein;Parent=BALIOE_17575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7042 c1 Prodigal gene 3482590 3482937 . - . ID=BALIOE_17580_gene;locus_tag=BALIOE_17580 | |
| 7043 c1 Prodigal CDS 3482590 3482937 . - 0 ID=BALIOE_17580;Name=hypothetical protein;locus_tag=BALIOE_17580;product=hypothetical protein;Parent=BALIOE_17580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7044 c1 Prodigal gene 3482934 3483314 . - . ID=BALIOE_17585_gene;locus_tag=BALIOE_17585 | |
| 7045 c1 Prodigal CDS 3482934 3483314 . - 0 ID=BALIOE_17585;Name=hypothetical protein;locus_tag=BALIOE_17585;product=hypothetical protein;Parent=BALIOE_17585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7046 c1 Prodigal gene 3483390 3483620 . - . ID=BALIOE_17590_gene;locus_tag=BALIOE_17590 | |
| 7047 c1 Prodigal CDS 3483390 3483620 . - 0 ID=BALIOE_17590;Name=hypothetical protein;locus_tag=BALIOE_17590;product=hypothetical protein;Parent=BALIOE_17590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7048 c1 Prodigal gene 3483671 3484015 . - . ID=BALIOE_17595_gene;locus_tag=BALIOE_17595 | |
| 7049 c1 Prodigal CDS 3483671 3484015 . - 0 ID=BALIOE_17595;Name=hypothetical protein;locus_tag=BALIOE_17595;product=hypothetical protein;Parent=BALIOE_17595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7050 c1 Prodigal gene 3484020 3484235 . - . ID=BALIOE_17600_gene;locus_tag=BALIOE_17600 | |
| 7051 c1 Prodigal CDS 3484020 3484235 . - 0 ID=BALIOE_17600;Name=hypothetical protein;locus_tag=BALIOE_17600;product=hypothetical protein;Parent=BALIOE_17600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7052 c1 Prodigal gene 3484385 3486238 . - . ID=BALIOE_17605_gene;locus_tag=BALIOE_17605 | |
| 7053 c1 Prodigal CDS 3484385 3486238 . - 0 ID=BALIOE_17605;Name=hypothetical protein;locus_tag=BALIOE_17605;product=hypothetical protein;Parent=BALIOE_17605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7054 c1 Prodigal gene 3486479 3486808 . + . ID=BALIOE_17610_gene;locus_tag=BALIOE_17610 | |
| 7055 c1 Prodigal CDS 3486479 3486808 . + 0 ID=BALIOE_17610;Name=hypothetical protein;locus_tag=BALIOE_17610;product=hypothetical protein;Parent=BALIOE_17610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7056 c1 Prodigal gene 3486899 3487642 . - . ID=BALIOE_17615_gene;locus_tag=BALIOE_17615 | |
| 7057 c1 Prodigal CDS 3486899 3487642 . - 0 ID=BALIOE_17615;Name=hypothetical protein;locus_tag=BALIOE_17615;product=hypothetical protein;Parent=BALIOE_17615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7058 c1 Prodigal gene 3487895 3488518 . - . ID=BALIOE_17620_gene;locus_tag=BALIOE_17620 | |
| 7059 c1 Prodigal CDS 3487895 3488518 . - 0 ID=BALIOE_17620;Name=hypothetical protein;locus_tag=BALIOE_17620;product=hypothetical protein;Parent=BALIOE_17620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7060 c1 Prodigal gene 3488515 3489180 . - . ID=BALIOE_17625_gene;locus_tag=BALIOE_17625 | |
| 7061 c1 Prodigal CDS 3488515 3489180 . - 0 ID=BALIOE_17625;Name=hypothetical protein;locus_tag=BALIOE_17625;product=hypothetical protein;Parent=BALIOE_17625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7062 c1 Prodigal gene 3489177 3489788 . - . ID=BALIOE_17630_gene;locus_tag=BALIOE_17630 | |
| 7063 c1 Prodigal CDS 3489177 3489788 . - 0 ID=BALIOE_17630;Name=hypothetical protein;locus_tag=BALIOE_17630;product=hypothetical protein;Parent=BALIOE_17630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7064 c1 Prodigal gene 3489763 3490329 . - . ID=BALIOE_17635_gene;locus_tag=BALIOE_17635 | |
| 7065 c1 Prodigal CDS 3489763 3490329 . - 0 ID=BALIOE_17635;Name=hypothetical protein;locus_tag=BALIOE_17635;product=hypothetical protein;Parent=BALIOE_17635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7066 c1 Prodigal gene 3490322 3490438 . - . ID=BALIOE_17640_gene;locus_tag=BALIOE_17640 | |
| 7067 c1 Prodigal CDS 3490322 3490438 . - 0 ID=BALIOE_17640;Name=hypothetical protein;locus_tag=BALIOE_17640;product=hypothetical protein;Parent=BALIOE_17640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7068 c1 Prodigal gene 3490659 3491414 . + . ID=BALIOE_17645_gene;locus_tag=BALIOE_17645 | |
| 7069 c1 Prodigal CDS 3490659 3491414 . + 0 ID=BALIOE_17645;Name=hypothetical protein;locus_tag=BALIOE_17645;product=hypothetical protein;Parent=BALIOE_17645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7070 c1 Prodigal gene 3491450 3491752 . + . ID=BALIOE_17650_gene;locus_tag=BALIOE_17650 | |
| 7071 c1 Prodigal CDS 3491450 3491752 . + 0 ID=BALIOE_17650;Name=hypothetical protein;locus_tag=BALIOE_17650;product=hypothetical protein;Parent=BALIOE_17650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7072 c1 Prodigal gene 3491828 3493090 . - . ID=BALIOE_17655_gene;locus_tag=BALIOE_17655 | |
| 7073 c1 Prodigal CDS 3491828 3493090 . - 0 ID=BALIOE_17655;Name=hypothetical protein;locus_tag=BALIOE_17655;product=hypothetical protein;Parent=BALIOE_17655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7074 c1 Prodigal gene 3493486 3493899 . - . ID=BALIOE_17660_gene;locus_tag=BALIOE_17660 | |
| 7075 c1 Prodigal CDS 3493486 3493899 . - 0 ID=BALIOE_17660;Name=hypothetical protein;locus_tag=BALIOE_17660;product=hypothetical protein;Parent=BALIOE_17660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7076 c1 Prodigal gene 3493997 3494395 . - . ID=BALIOE_17665_gene;locus_tag=BALIOE_17665 | |
| 7077 c1 Prodigal CDS 3493997 3494395 . - 0 ID=BALIOE_17665;Name=hypothetical protein;locus_tag=BALIOE_17665;product=hypothetical protein;Parent=BALIOE_17665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7078 c1 Prodigal gene 3494396 3496027 . - . ID=BALIOE_17670_gene;locus_tag=BALIOE_17670 | |
| 7079 c1 Prodigal CDS 3494396 3496027 . - 0 ID=BALIOE_17670;Name=hypothetical protein;locus_tag=BALIOE_17670;product=hypothetical protein;Parent=BALIOE_17670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7080 c1 Prodigal gene 3496024 3497337 . - . ID=BALIOE_17675_gene;locus_tag=BALIOE_17675 | |
| 7081 c1 Prodigal CDS 3496024 3497337 . - 0 ID=BALIOE_17675;Name=hypothetical protein;locus_tag=BALIOE_17675;product=hypothetical protein;Parent=BALIOE_17675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7082 c1 Prodigal gene 3497339 3498544 . - . ID=BALIOE_17680_gene;locus_tag=BALIOE_17680 | |
| 7083 c1 Prodigal CDS 3497339 3498544 . - 0 ID=BALIOE_17680;Name=hypothetical protein;locus_tag=BALIOE_17680;product=hypothetical protein;Parent=BALIOE_17680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7084 c1 Prodigal gene 3498867 3499073 . - . ID=BALIOE_17685_gene;locus_tag=BALIOE_17685 | |
| 7085 c1 Prodigal CDS 3498867 3499073 . - 0 ID=BALIOE_17685;Name=hypothetical protein;locus_tag=BALIOE_17685;product=hypothetical protein;Parent=BALIOE_17685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7086 c1 Prodigal gene 3499173 3500024 . - . ID=BALIOE_17690_gene;locus_tag=BALIOE_17690 | |
| 7087 c1 Prodigal CDS 3499173 3500024 . - 0 ID=BALIOE_17690;Name=hypothetical protein;locus_tag=BALIOE_17690;product=hypothetical protein;Parent=BALIOE_17690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7088 c1 Prodigal gene 3500451 3505037 . - . ID=BALIOE_17695_gene;locus_tag=BALIOE_17695 | |
| 7089 c1 Prodigal CDS 3500451 3505037 . - 0 ID=BALIOE_17695;Name=hypothetical protein;locus_tag=BALIOE_17695;product=hypothetical protein;Parent=BALIOE_17695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7090 c1 Prodigal gene 3505973 3507322 . - . ID=BALIOE_17700_gene;locus_tag=BALIOE_17700 | |
| 7091 c1 Prodigal CDS 3505973 3507322 . - 0 ID=BALIOE_17700;Name=hypothetical protein;locus_tag=BALIOE_17700;product=hypothetical protein;Parent=BALIOE_17700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7092 c1 tRNAscan-SE gene 3508074 3508149 . - . ID=BALIOE_17705_gene;locus_tag=BALIOE_17705;gene=Ile2_trna | |
| 7093 c1 tRNAscan-SE tRNA 3508074 3508149 . - . ID=BALIOE_17705;Name=tRNA-Ile2;locus_tag=BALIOE_17705;product=tRNA-Ile2;gene=Ile2_trna;Parent=BALIOE_17705_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 7094 c1 Prodigal gene 3508710 3509948 . + . ID=BALIOE_17710_gene;locus_tag=BALIOE_17710 | |
| 7095 c1 Prodigal CDS 3508710 3509948 . + 0 ID=BALIOE_17710;Name=hypothetical protein;locus_tag=BALIOE_17710;product=hypothetical protein;Parent=BALIOE_17710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7096 c1 Prodigal gene 3509955 3510962 . + . ID=BALIOE_17715_gene;locus_tag=BALIOE_17715 | |
| 7097 c1 Prodigal CDS 3509955 3510962 . + 0 ID=BALIOE_17715;Name=hypothetical protein;locus_tag=BALIOE_17715;product=hypothetical protein;Parent=BALIOE_17715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7098 c1 Prodigal gene 3511299 3512276 . + . ID=BALIOE_17720_gene;locus_tag=BALIOE_17720 | |
| 7099 c1 Prodigal CDS 3511299 3512276 . + 0 ID=BALIOE_17720;Name=hypothetical protein;locus_tag=BALIOE_17720;product=hypothetical protein;Parent=BALIOE_17720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7100 c1 Prodigal gene 3512296 3513564 . + . ID=BALIOE_17725_gene;locus_tag=BALIOE_17725 | |
| 7101 c1 Prodigal CDS 3512296 3513564 . + 0 ID=BALIOE_17725;Name=hypothetical protein;locus_tag=BALIOE_17725;product=hypothetical protein;Parent=BALIOE_17725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7102 c1 Prodigal gene 3513587 3515035 . + . ID=BALIOE_17730_gene;locus_tag=BALIOE_17730 | |
| 7103 c1 Prodigal CDS 3513587 3515035 . + 0 ID=BALIOE_17730;Name=hypothetical protein;locus_tag=BALIOE_17730;product=hypothetical protein;Parent=BALIOE_17730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7104 c1 Prodigal gene 3515049 3516329 . + . ID=BALIOE_17735_gene;locus_tag=BALIOE_17735 | |
| 7105 c1 Prodigal CDS 3515049 3516329 . + 0 ID=BALIOE_17735;Name=hypothetical protein;locus_tag=BALIOE_17735;product=hypothetical protein;Parent=BALIOE_17735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7106 c1 Prodigal gene 3516567 3517967 . + . ID=BALIOE_17740_gene;locus_tag=BALIOE_17740 | |
| 7107 c1 Prodigal CDS 3516567 3517967 . + 0 ID=BALIOE_17740;Name=hypothetical protein;locus_tag=BALIOE_17740;product=hypothetical protein;Parent=BALIOE_17740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7108 c1 Prodigal gene 3517988 3518650 . + . ID=BALIOE_17745_gene;locus_tag=BALIOE_17745 | |
| 7109 c1 Prodigal CDS 3517988 3518650 . + 0 ID=BALIOE_17745;Name=hypothetical protein;locus_tag=BALIOE_17745;product=hypothetical protein;Parent=BALIOE_17745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7110 c1 Prodigal gene 3518651 3519100 . - . ID=BALIOE_17750_gene;locus_tag=BALIOE_17750 | |
| 7111 c1 Prodigal CDS 3518651 3519100 . - 0 ID=BALIOE_17750;Name=hypothetical protein;locus_tag=BALIOE_17750;product=hypothetical protein;Parent=BALIOE_17750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7112 c1 Prodigal gene 3519184 3519342 . - . ID=BALIOE_17755_gene;locus_tag=BALIOE_17755 | |
| 7113 c1 Prodigal CDS 3519184 3519342 . - 0 ID=BALIOE_17755;Name=hypothetical protein;locus_tag=BALIOE_17755;product=hypothetical protein;Parent=BALIOE_17755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7114 c1 Prodigal gene 3519525 3519824 . + . ID=BALIOE_17760_gene;locus_tag=BALIOE_17760 | |
| 7115 c1 Prodigal CDS 3519525 3519824 . + 0 ID=BALIOE_17760;Name=hypothetical protein;locus_tag=BALIOE_17760;product=hypothetical protein;Parent=BALIOE_17760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7116 c1 Prodigal gene 3519834 3520352 . + . ID=BALIOE_17765_gene;locus_tag=BALIOE_17765 | |
| 7117 c1 Prodigal CDS 3519834 3520352 . + 0 ID=BALIOE_17765;Name=hypothetical protein;locus_tag=BALIOE_17765;product=hypothetical protein;Parent=BALIOE_17765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7118 c1 Prodigal gene 3520405 3520809 . - . ID=BALIOE_17770_gene;locus_tag=BALIOE_17770 | |
| 7119 c1 Prodigal CDS 3520405 3520809 . - 0 ID=BALIOE_17770;Name=hypothetical protein;locus_tag=BALIOE_17770;product=hypothetical protein;Parent=BALIOE_17770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7120 c1 Prodigal gene 3521477 3521926 . + . ID=BALIOE_17775_gene;locus_tag=BALIOE_17775 | |
| 7121 c1 Prodigal CDS 3521477 3521926 . + 0 ID=BALIOE_17775;Name=hypothetical protein;locus_tag=BALIOE_17775;product=hypothetical protein;Parent=BALIOE_17775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7122 c1 Prodigal gene 3521963 3522307 . - . ID=BALIOE_17780_gene;locus_tag=BALIOE_17780 | |
| 7123 c1 Prodigal CDS 3521963 3522307 . - 0 ID=BALIOE_17780;Name=hypothetical protein;locus_tag=BALIOE_17780;product=hypothetical protein;Parent=BALIOE_17780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7124 c1 Prodigal gene 3522459 3522788 . + . ID=BALIOE_17785_gene;locus_tag=BALIOE_17785 | |
| 7125 c1 Prodigal CDS 3522459 3522788 . + 0 ID=BALIOE_17785;Name=hypothetical protein;locus_tag=BALIOE_17785;product=hypothetical protein;Parent=BALIOE_17785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7126 c1 Prodigal gene 3522938 3524272 . - . ID=BALIOE_17790_gene;locus_tag=BALIOE_17790 | |
| 7127 c1 Prodigal CDS 3522938 3524272 . - 0 ID=BALIOE_17790;Name=hypothetical protein;locus_tag=BALIOE_17790;product=hypothetical protein;Parent=BALIOE_17790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7128 c1 Prodigal gene 3524360 3524791 . + . ID=BALIOE_17795_gene;locus_tag=BALIOE_17795 | |
| 7129 c1 Prodigal CDS 3524360 3524791 . + 0 ID=BALIOE_17795;Name=hypothetical protein;locus_tag=BALIOE_17795;product=hypothetical protein;Parent=BALIOE_17795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7130 c1 Prodigal gene 3525000 3525245 . + . ID=BALIOE_17800_gene;locus_tag=BALIOE_17800 | |
| 7131 c1 Prodigal CDS 3525000 3525245 . + 0 ID=BALIOE_17800;Name=hypothetical protein;locus_tag=BALIOE_17800;product=hypothetical protein;Parent=BALIOE_17800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7132 c1 Prodigal gene 3525242 3525652 . + . ID=BALIOE_17805_gene;locus_tag=BALIOE_17805 | |
| 7133 c1 Prodigal CDS 3525242 3525652 . + 0 ID=BALIOE_17805;Name=hypothetical protein;locus_tag=BALIOE_17805;product=hypothetical protein;Parent=BALIOE_17805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7134 c1 Prodigal gene 3525625 3527769 . + . ID=BALIOE_17810_gene;locus_tag=BALIOE_17810 | |
| 7135 c1 Prodigal CDS 3525625 3527769 . + 0 ID=BALIOE_17810;Name=hypothetical protein;locus_tag=BALIOE_17810;product=hypothetical protein;Parent=BALIOE_17810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7136 c1 Prodigal gene 3527779 3528738 . + . ID=BALIOE_17815_gene;locus_tag=BALIOE_17815 | |
| 7137 c1 Prodigal CDS 3527779 3528738 . + 0 ID=BALIOE_17815;Name=hypothetical protein;locus_tag=BALIOE_17815;product=hypothetical protein;Parent=BALIOE_17815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7138 c1 Prodigal gene 3529094 3530296 . + . ID=BALIOE_17820_gene;locus_tag=BALIOE_17820 | |
| 7139 c1 Prodigal CDS 3529094 3530296 . + 0 ID=BALIOE_17820;Name=hypothetical protein;locus_tag=BALIOE_17820;product=hypothetical protein;Parent=BALIOE_17820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7140 c1 Prodigal gene 3530289 3531353 . + . ID=BALIOE_17825_gene;locus_tag=BALIOE_17825 | |
| 7141 c1 Prodigal CDS 3530289 3531353 . + 0 ID=BALIOE_17825;Name=hypothetical protein;locus_tag=BALIOE_17825;product=hypothetical protein;Parent=BALIOE_17825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7142 c1 Prodigal gene 3531410 3532402 . + . ID=BALIOE_17830_gene;locus_tag=BALIOE_17830 | |
| 7143 c1 Prodigal CDS 3531410 3532402 . + 0 ID=BALIOE_17830;Name=hypothetical protein;locus_tag=BALIOE_17830;product=hypothetical protein;Parent=BALIOE_17830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7144 c1 Infernal gene 3532412 3532489 . + . ID=BALIOE_17835_gene;locus_tag=BALIOE_17835;gene=naRNA4 | |
| 7145 c1 Infernal ncRNA 3532412 3532489 3.3e-11 + . ID=BALIOE_17835;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_17835;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_17835_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 7146 c1 Prodigal gene 3532594 3533778 . + . ID=BALIOE_17840_gene;locus_tag=BALIOE_17840 | |
| 7147 c1 Prodigal CDS 3532594 3533778 . + 0 ID=BALIOE_17840;Name=hypothetical protein;locus_tag=BALIOE_17840;product=hypothetical protein;Parent=BALIOE_17840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7148 c1 Prodigal gene 3533902 3534639 . + . ID=BALIOE_17845_gene;locus_tag=BALIOE_17845 | |
| 7149 c1 Prodigal CDS 3533902 3534639 . + 0 ID=BALIOE_17845;Name=hypothetical protein;locus_tag=BALIOE_17845;product=hypothetical protein;Parent=BALIOE_17845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7150 c1 Prodigal gene 3534629 3534964 . + . ID=BALIOE_17850_gene;locus_tag=BALIOE_17850 | |
| 7151 c1 Prodigal CDS 3534629 3534964 . + 0 ID=BALIOE_17850;Name=hypothetical protein;locus_tag=BALIOE_17850;product=hypothetical protein;Parent=BALIOE_17850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7152 c1 Prodigal gene 3535055 3535585 . + . ID=BALIOE_17855_gene;locus_tag=BALIOE_17855 | |
| 7153 c1 Prodigal CDS 3535055 3535585 . + 0 ID=BALIOE_17855;Name=hypothetical protein;locus_tag=BALIOE_17855;product=hypothetical protein;Parent=BALIOE_17855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7154 c1 Prodigal gene 3535712 3536884 . + . ID=BALIOE_17860_gene;locus_tag=BALIOE_17860 | |
| 7155 c1 Prodigal CDS 3535712 3536884 . + 0 ID=BALIOE_17860;Name=hypothetical protein;locus_tag=BALIOE_17860;product=hypothetical protein;Parent=BALIOE_17860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7156 c1 Prodigal gene 3536901 3538439 . + . ID=BALIOE_17865_gene;locus_tag=BALIOE_17865 | |
| 7157 c1 Prodigal CDS 3536901 3538439 . + 0 ID=BALIOE_17865;Name=hypothetical protein;locus_tag=BALIOE_17865;product=hypothetical protein;Parent=BALIOE_17865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7158 c1 Prodigal gene 3538503 3539018 . - . ID=BALIOE_17870_gene;locus_tag=BALIOE_17870 | |
| 7159 c1 Prodigal CDS 3538503 3539018 . - 0 ID=BALIOE_17870;Name=hypothetical protein;locus_tag=BALIOE_17870;product=hypothetical protein;Parent=BALIOE_17870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7160 c1 Prodigal gene 3539168 3540724 . - . ID=BALIOE_17875_gene;locus_tag=BALIOE_17875 | |
| 7161 c1 Prodigal CDS 3539168 3540724 . - 0 ID=BALIOE_17875;Name=hypothetical protein;locus_tag=BALIOE_17875;product=hypothetical protein;Parent=BALIOE_17875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7162 c1 Prodigal gene 3540797 3541225 . - . ID=BALIOE_17880_gene;locus_tag=BALIOE_17880 | |
| 7163 c1 Prodigal CDS 3540797 3541225 . - 0 ID=BALIOE_17880;Name=hypothetical protein;locus_tag=BALIOE_17880;product=hypothetical protein;Parent=BALIOE_17880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7164 c1 Prodigal gene 3541222 3541788 . - . ID=BALIOE_17885_gene;locus_tag=BALIOE_17885 | |
| 7165 c1 Prodigal CDS 3541222 3541788 . - 0 ID=BALIOE_17885;Name=hypothetical protein;locus_tag=BALIOE_17885;product=hypothetical protein;Parent=BALIOE_17885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7166 c1 tRNAscan-SE gene 3542069 3542145 . - . ID=BALIOE_17890_gene;locus_tag=BALIOE_17890;gene=Arg_trna | |
| 7167 c1 tRNAscan-SE tRNA 3542069 3542145 . - . ID=BALIOE_17890;Name=tRNA-Arg;locus_tag=BALIOE_17890;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_17890_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 7168 c1 tRNAscan-SE gene 3542248 3542324 . - . ID=BALIOE_17895_gene;locus_tag=BALIOE_17895;gene=Arg_trna | |
| 7169 c1 tRNAscan-SE tRNA 3542248 3542324 . - . ID=BALIOE_17895;Name=tRNA-Arg;locus_tag=BALIOE_17895;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_17895_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 7170 c1 tRNAscan-SE gene 3542387 3542463 . - . ID=BALIOE_17900_gene;locus_tag=BALIOE_17900;gene=Arg_trna | |
| 7171 c1 tRNAscan-SE tRNA 3542387 3542463 . - . ID=BALIOE_17900;Name=tRNA-Arg;locus_tag=BALIOE_17900;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_17900_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 7172 c1 tRNAscan-SE gene 3542528 3542604 . - . ID=BALIOE_17905_gene;locus_tag=BALIOE_17905;gene=Arg_trna | |
| 7173 c1 tRNAscan-SE tRNA 3542528 3542604 . - . ID=BALIOE_17905;Name=tRNA-Arg;locus_tag=BALIOE_17905;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_17905_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 7174 c1 tRNAscan-SE gene 3542608 3542700 . - . ID=BALIOE_17910_gene;locus_tag=BALIOE_17910;gene=Ser_trna | |
| 7175 c1 tRNAscan-SE tRNA 3542608 3542700 . - . ID=BALIOE_17910;Name=tRNA-Ser;locus_tag=BALIOE_17910;product=tRNA-Ser;gene=Ser_trna;Parent=BALIOE_17910_gene;inference=profile:tRNAscan:2.0;Note=SO:0000269 | |
| 7176 c1 Prodigal gene 3543016 3543201 . - . ID=BALIOE_17915_gene;locus_tag=BALIOE_17915 | |
| 7177 c1 Prodigal CDS 3543016 3543201 . - 0 ID=BALIOE_17915;Name=hypothetical protein;locus_tag=BALIOE_17915;product=hypothetical protein;Parent=BALIOE_17915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7178 c1 Prodigal gene 3543436 3546066 . - . ID=BALIOE_17920_gene;locus_tag=BALIOE_17920 | |
| 7179 c1 Prodigal CDS 3543436 3546066 . - 0 ID=BALIOE_17920;Name=hypothetical protein;locus_tag=BALIOE_17920;product=hypothetical protein;Parent=BALIOE_17920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7180 c1 Prodigal gene 3546194 3546694 . - . ID=BALIOE_17925_gene;locus_tag=BALIOE_17925 | |
| 7181 c1 Prodigal CDS 3546194 3546694 . - 0 ID=BALIOE_17925;Name=hypothetical protein;locus_tag=BALIOE_17925;product=hypothetical protein;Parent=BALIOE_17925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7182 c1 Prodigal gene 3546762 3547823 . - . ID=BALIOE_17930_gene;locus_tag=BALIOE_17930 | |
| 7183 c1 Prodigal CDS 3546762 3547823 . - 0 ID=BALIOE_17930;Name=hypothetical protein;locus_tag=BALIOE_17930;product=hypothetical protein;Parent=BALIOE_17930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7184 c1 Prodigal gene 3547903 3548400 . - . ID=BALIOE_17935_gene;locus_tag=BALIOE_17935 | |
| 7185 c1 Prodigal CDS 3547903 3548400 . - 0 ID=BALIOE_17935;Name=hypothetical protein;locus_tag=BALIOE_17935;product=hypothetical protein;Parent=BALIOE_17935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7186 c1 Prodigal gene 3548545 3549735 . - . ID=BALIOE_17940_gene;locus_tag=BALIOE_17940 | |
| 7187 c1 Prodigal CDS 3548545 3549735 . - 0 ID=BALIOE_17940;Name=hypothetical protein;locus_tag=BALIOE_17940;product=hypothetical protein;Parent=BALIOE_17940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7188 c1 Prodigal gene 3549880 3550275 . + . ID=BALIOE_17945_gene;locus_tag=BALIOE_17945 | |
| 7189 c1 Prodigal CDS 3549880 3550275 . + 0 ID=BALIOE_17945;Name=hypothetical protein;locus_tag=BALIOE_17945;product=hypothetical protein;Parent=BALIOE_17945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7190 c1 Prodigal gene 3550439 3550645 . + . ID=BALIOE_17950_gene;locus_tag=BALIOE_17950 | |
| 7191 c1 Prodigal CDS 3550439 3550645 . + 0 ID=BALIOE_17950;Name=hypothetical protein;locus_tag=BALIOE_17950;product=hypothetical protein;Parent=BALIOE_17950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7192 c1 Prodigal gene 3550750 3551400 . + . ID=BALIOE_17955_gene;locus_tag=BALIOE_17955 | |
| 7193 c1 Prodigal CDS 3550750 3551400 . + 0 ID=BALIOE_17955;Name=hypothetical protein;locus_tag=BALIOE_17955;product=hypothetical protein;Parent=BALIOE_17955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7194 c1 Prodigal gene 3551411 3551782 . + . ID=BALIOE_17960_gene;locus_tag=BALIOE_17960 | |
| 7195 c1 Prodigal CDS 3551411 3551782 . + 0 ID=BALIOE_17960;Name=hypothetical protein;locus_tag=BALIOE_17960;product=hypothetical protein;Parent=BALIOE_17960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7196 c1 Prodigal gene 3551786 3552565 . + . ID=BALIOE_17965_gene;locus_tag=BALIOE_17965 | |
| 7197 c1 Prodigal CDS 3551786 3552565 . + 0 ID=BALIOE_17965;Name=hypothetical protein;locus_tag=BALIOE_17965;product=hypothetical protein;Parent=BALIOE_17965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7198 c1 Prodigal gene 3552671 3553030 . + . ID=BALIOE_17970_gene;locus_tag=BALIOE_17970 | |
| 7199 c1 Prodigal CDS 3552671 3553030 . + 0 ID=BALIOE_17970;Name=hypothetical protein;locus_tag=BALIOE_17970;product=hypothetical protein;Parent=BALIOE_17970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7200 c1 Prodigal gene 3553097 3553870 . + . ID=BALIOE_17975_gene;locus_tag=BALIOE_17975 | |
| 7201 c1 Prodigal CDS 3553097 3553870 . + 0 ID=BALIOE_17975;Name=hypothetical protein;locus_tag=BALIOE_17975;product=hypothetical protein;Parent=BALIOE_17975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7202 c1 Prodigal gene 3553863 3554828 . + . ID=BALIOE_17980_gene;locus_tag=BALIOE_17980 | |
| 7203 c1 Prodigal CDS 3553863 3554828 . + 0 ID=BALIOE_17980;Name=hypothetical protein;locus_tag=BALIOE_17980;product=hypothetical protein;Parent=BALIOE_17980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7204 c1 Prodigal gene 3554825 3556339 . - . ID=BALIOE_17985_gene;locus_tag=BALIOE_17985 | |
| 7205 c1 Prodigal CDS 3554825 3556339 . - 0 ID=BALIOE_17985;Name=hypothetical protein;locus_tag=BALIOE_17985;product=hypothetical protein;Parent=BALIOE_17985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7206 c1 Prodigal gene 3556526 3557761 . + . ID=BALIOE_17990_gene;locus_tag=BALIOE_17990 | |
| 7207 c1 Prodigal CDS 3556526 3557761 . + 0 ID=BALIOE_17990;Name=hypothetical protein;locus_tag=BALIOE_17990;product=hypothetical protein;Parent=BALIOE_17990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7208 c1 Prodigal gene 3557758 3558891 . + . ID=BALIOE_17995_gene;locus_tag=BALIOE_17995 | |
| 7209 c1 Prodigal CDS 3557758 3558891 . + 0 ID=BALIOE_17995;Name=hypothetical protein;locus_tag=BALIOE_17995;product=hypothetical protein;Parent=BALIOE_17995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7210 c1 Prodigal gene 3559019 3561271 . - . ID=BALIOE_18000_gene;locus_tag=BALIOE_18000 | |
| 7211 c1 Prodigal CDS 3559019 3561271 . - 0 ID=BALIOE_18000;Name=hypothetical protein;locus_tag=BALIOE_18000;product=hypothetical protein;Parent=BALIOE_18000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7212 c1 Prodigal gene 3561424 3561951 . - . ID=BALIOE_18005_gene;locus_tag=BALIOE_18005 | |
| 7213 c1 Prodigal CDS 3561424 3561951 . - 0 ID=BALIOE_18005;Name=hypothetical protein;locus_tag=BALIOE_18005;product=hypothetical protein;Parent=BALIOE_18005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7214 c1 Prodigal gene 3562100 3563113 . - . ID=BALIOE_18010_gene;locus_tag=BALIOE_18010 | |
| 7215 c1 Prodigal CDS 3562100 3563113 . - 0 ID=BALIOE_18010;Name=hypothetical protein;locus_tag=BALIOE_18010;product=hypothetical protein;Parent=BALIOE_18010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7216 c1 Prodigal gene 3563370 3564827 . + . ID=BALIOE_18015_gene;locus_tag=BALIOE_18015 | |
| 7217 c1 Prodigal CDS 3563370 3564827 . + 0 ID=BALIOE_18015;Name=hypothetical protein;locus_tag=BALIOE_18015;product=hypothetical protein;Parent=BALIOE_18015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7218 c1 Prodigal gene 3564836 3566260 . + . ID=BALIOE_18020_gene;locus_tag=BALIOE_18020 | |
| 7219 c1 Prodigal CDS 3564836 3566260 . + 0 ID=BALIOE_18020;Name=hypothetical protein;locus_tag=BALIOE_18020;product=hypothetical protein;Parent=BALIOE_18020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7220 c1 Prodigal gene 3566384 3566854 . - . ID=BALIOE_18025_gene;locus_tag=BALIOE_18025 | |
| 7221 c1 Prodigal CDS 3566384 3566854 . - 0 ID=BALIOE_18025;Name=hypothetical protein;locus_tag=BALIOE_18025;product=hypothetical protein;Parent=BALIOE_18025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7222 c1 Prodigal gene 3566847 3567257 . - . ID=BALIOE_18030_gene;locus_tag=BALIOE_18030 | |
| 7223 c1 Prodigal CDS 3566847 3567257 . - 0 ID=BALIOE_18030;Name=hypothetical protein;locus_tag=BALIOE_18030;product=hypothetical protein;Parent=BALIOE_18030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7224 c1 Prodigal gene 3567254 3568021 . - . ID=BALIOE_18035_gene;locus_tag=BALIOE_18035 | |
| 7225 c1 Prodigal CDS 3567254 3568021 . - 0 ID=BALIOE_18035;Name=hypothetical protein;locus_tag=BALIOE_18035;product=hypothetical protein;Parent=BALIOE_18035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7226 c1 Prodigal gene 3568021 3568563 . - . ID=BALIOE_18040_gene;locus_tag=BALIOE_18040 | |
| 7227 c1 Prodigal CDS 3568021 3568563 . - 0 ID=BALIOE_18040;Name=hypothetical protein;locus_tag=BALIOE_18040;product=hypothetical protein;Parent=BALIOE_18040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7228 c1 Prodigal gene 3568573 3570282 . - . ID=BALIOE_18045_gene;locus_tag=BALIOE_18045 | |
| 7229 c1 Prodigal CDS 3568573 3570282 . - 0 ID=BALIOE_18045;Name=hypothetical protein;locus_tag=BALIOE_18045;product=hypothetical protein;Parent=BALIOE_18045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7230 c1 Prodigal gene 3570300 3571223 . - . ID=BALIOE_18050_gene;locus_tag=BALIOE_18050 | |
| 7231 c1 Prodigal CDS 3570300 3571223 . - 0 ID=BALIOE_18050;Name=hypothetical protein;locus_tag=BALIOE_18050;product=hypothetical protein;Parent=BALIOE_18050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7232 c1 Prodigal gene 3571226 3573052 . - . ID=BALIOE_18055_gene;locus_tag=BALIOE_18055 | |
| 7233 c1 Prodigal CDS 3571226 3573052 . - 0 ID=BALIOE_18055;Name=hypothetical protein;locus_tag=BALIOE_18055;product=hypothetical protein;Parent=BALIOE_18055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7234 c1 Prodigal gene 3573049 3573660 . - . ID=BALIOE_18060_gene;locus_tag=BALIOE_18060 | |
| 7235 c1 Prodigal CDS 3573049 3573660 . - 0 ID=BALIOE_18060;Name=hypothetical protein;locus_tag=BALIOE_18060;product=hypothetical protein;Parent=BALIOE_18060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7236 c1 Prodigal gene 3573785 3574246 . - . ID=BALIOE_18065_gene;locus_tag=BALIOE_18065 | |
| 7237 c1 Prodigal CDS 3573785 3574246 . - 0 ID=BALIOE_18065;Name=hypothetical protein;locus_tag=BALIOE_18065;product=hypothetical protein;Parent=BALIOE_18065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7238 c1 Prodigal gene 3574458 3574808 . + . ID=BALIOE_18070_gene;locus_tag=BALIOE_18070 | |
| 7239 c1 Prodigal CDS 3574458 3574808 . + 0 ID=BALIOE_18070;Name=hypothetical protein;locus_tag=BALIOE_18070;product=hypothetical protein;Parent=BALIOE_18070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7240 c1 Prodigal gene 3574812 3575684 . + . ID=BALIOE_18075_gene;locus_tag=BALIOE_18075 | |
| 7241 c1 Prodigal CDS 3574812 3575684 . + 0 ID=BALIOE_18075;Name=hypothetical protein;locus_tag=BALIOE_18075;product=hypothetical protein;Parent=BALIOE_18075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7242 c1 Prodigal gene 3575675 3575947 . + . ID=BALIOE_18080_gene;locus_tag=BALIOE_18080 | |
| 7243 c1 Prodigal CDS 3575675 3575947 . + 0 ID=BALIOE_18080;Name=hypothetical protein;locus_tag=BALIOE_18080;product=hypothetical protein;Parent=BALIOE_18080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7244 c1 Prodigal gene 3575947 3577068 . + . ID=BALIOE_18085_gene;locus_tag=BALIOE_18085 | |
| 7245 c1 Prodigal CDS 3575947 3577068 . + 0 ID=BALIOE_18085;Name=hypothetical protein;locus_tag=BALIOE_18085;product=hypothetical protein;Parent=BALIOE_18085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7246 c1 Prodigal gene 3577065 3578075 . + . ID=BALIOE_18090_gene;locus_tag=BALIOE_18090 | |
| 7247 c1 Prodigal CDS 3577065 3578075 . + 0 ID=BALIOE_18090;Name=hypothetical protein;locus_tag=BALIOE_18090;product=hypothetical protein;Parent=BALIOE_18090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7248 c1 Prodigal gene 3578149 3580227 . + . ID=BALIOE_18095_gene;locus_tag=BALIOE_18095 | |
| 7249 c1 Prodigal CDS 3578149 3580227 . + 0 ID=BALIOE_18095;Name=hypothetical protein;locus_tag=BALIOE_18095;product=hypothetical protein;Parent=BALIOE_18095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7250 c1 Prodigal gene 3580264 3580617 . - . ID=BALIOE_18100_gene;locus_tag=BALIOE_18100 | |
| 7251 c1 Prodigal CDS 3580264 3580617 . - 0 ID=BALIOE_18100;Name=hypothetical protein;locus_tag=BALIOE_18100;product=hypothetical protein;Parent=BALIOE_18100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7252 c1 Prodigal gene 3580694 3580828 . - . ID=BALIOE_18105_gene;locus_tag=BALIOE_18105 | |
| 7253 c1 Prodigal CDS 3580694 3580828 . - 0 ID=BALIOE_18105;Name=hypothetical protein;locus_tag=BALIOE_18105;product=hypothetical protein;Parent=BALIOE_18105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7254 c1 Prodigal gene 3580904 3583465 . + . ID=BALIOE_18110_gene;locus_tag=BALIOE_18110 | |
| 7255 c1 Prodigal CDS 3580904 3583465 . + 0 ID=BALIOE_18110;Name=hypothetical protein;locus_tag=BALIOE_18110;product=hypothetical protein;Parent=BALIOE_18110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7256 c1 Prodigal gene 3583571 3584227 . + . ID=BALIOE_18115_gene;locus_tag=BALIOE_18115 | |
| 7257 c1 Prodigal CDS 3583571 3584227 . + 0 ID=BALIOE_18115;Name=hypothetical protein;locus_tag=BALIOE_18115;product=hypothetical protein;Parent=BALIOE_18115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7258 c1 Prodigal gene 3584268 3584504 . - . ID=BALIOE_18120_gene;locus_tag=BALIOE_18120 | |
| 7259 c1 Prodigal CDS 3584268 3584504 . - 0 ID=BALIOE_18120;Name=hypothetical protein;locus_tag=BALIOE_18120;product=hypothetical protein;Parent=BALIOE_18120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7260 c1 Prodigal gene 3584515 3585942 . - . ID=BALIOE_18125_gene;locus_tag=BALIOE_18125 | |
| 7261 c1 Prodigal CDS 3584515 3585942 . - 0 ID=BALIOE_18125;Name=hypothetical protein;locus_tag=BALIOE_18125;product=hypothetical protein;Parent=BALIOE_18125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7262 c1 Prodigal gene 3585942 3586535 . - . ID=BALIOE_18130_gene;locus_tag=BALIOE_18130 | |
| 7263 c1 Prodigal CDS 3585942 3586535 . - 0 ID=BALIOE_18130;Name=hypothetical protein;locus_tag=BALIOE_18130;product=hypothetical protein;Parent=BALIOE_18130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7264 c1 Prodigal gene 3586682 3587089 . + . ID=BALIOE_18135_gene;locus_tag=BALIOE_18135 | |
| 7265 c1 Prodigal CDS 3586682 3587089 . + 0 ID=BALIOE_18135;Name=hypothetical protein;locus_tag=BALIOE_18135;product=hypothetical protein;Parent=BALIOE_18135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7266 c1 Prodigal gene 3587209 3588201 . - . ID=BALIOE_18140_gene;locus_tag=BALIOE_18140 | |
| 7267 c1 Prodigal CDS 3587209 3588201 . - 0 ID=BALIOE_18140;Name=hypothetical protein;locus_tag=BALIOE_18140;product=hypothetical protein;Parent=BALIOE_18140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7268 c1 Prodigal gene 3588264 3589403 . - . ID=BALIOE_18145_gene;locus_tag=BALIOE_18145 | |
| 7269 c1 Prodigal CDS 3588264 3589403 . - 0 ID=BALIOE_18145;Name=hypothetical protein;locus_tag=BALIOE_18145;product=hypothetical protein;Parent=BALIOE_18145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7270 c1 Prodigal gene 3589543 3590169 . - . ID=BALIOE_18150_gene;locus_tag=BALIOE_18150 | |
| 7271 c1 Prodigal CDS 3589543 3590169 . - 0 ID=BALIOE_18150;Name=hypothetical protein;locus_tag=BALIOE_18150;product=hypothetical protein;Parent=BALIOE_18150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7272 c1 Prodigal gene 3590163 3590924 . - . ID=BALIOE_18155_gene;locus_tag=BALIOE_18155 | |
| 7273 c1 Prodigal CDS 3590163 3590924 . - 0 ID=BALIOE_18155;Name=hypothetical protein;locus_tag=BALIOE_18155;product=hypothetical protein;Parent=BALIOE_18155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7274 c1 Prodigal gene 3590905 3591954 . - . ID=BALIOE_18160_gene;locus_tag=BALIOE_18160 | |
| 7275 c1 Prodigal CDS 3590905 3591954 . - 0 ID=BALIOE_18160;Name=hypothetical protein;locus_tag=BALIOE_18160;product=hypothetical protein;Parent=BALIOE_18160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7276 c1 Prodigal gene 3591951 3592430 . - . ID=BALIOE_18165_gene;locus_tag=BALIOE_18165 | |
| 7277 c1 Prodigal CDS 3591951 3592430 . - 0 ID=BALIOE_18165;Name=hypothetical protein;locus_tag=BALIOE_18165;product=hypothetical protein;Parent=BALIOE_18165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7278 c1 Prodigal gene 3592430 3593140 . - . ID=BALIOE_18170_gene;locus_tag=BALIOE_18170 | |
| 7279 c1 Prodigal CDS 3592430 3593140 . - 0 ID=BALIOE_18170;Name=hypothetical protein;locus_tag=BALIOE_18170;product=hypothetical protein;Parent=BALIOE_18170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7280 c1 Prodigal gene 3593159 3593470 . - . ID=BALIOE_18175_gene;locus_tag=BALIOE_18175 | |
| 7281 c1 Prodigal CDS 3593159 3593470 . - 0 ID=BALIOE_18175;Name=hypothetical protein;locus_tag=BALIOE_18175;product=hypothetical protein;Parent=BALIOE_18175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7282 c1 Prodigal gene 3593664 3593987 . - . ID=BALIOE_18180_gene;locus_tag=BALIOE_18180 | |
| 7283 c1 Prodigal CDS 3593664 3593987 . - 0 ID=BALIOE_18180;Name=hypothetical protein;locus_tag=BALIOE_18180;product=hypothetical protein;Parent=BALIOE_18180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7284 c1 Prodigal gene 3594037 3594642 . - . ID=BALIOE_18185_gene;locus_tag=BALIOE_18185 | |
| 7285 c1 Prodigal CDS 3594037 3594642 . - 0 ID=BALIOE_18185;Name=hypothetical protein;locus_tag=BALIOE_18185;product=hypothetical protein;Parent=BALIOE_18185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7286 c1 Prodigal gene 3594642 3596069 . - . ID=BALIOE_18190_gene;locus_tag=BALIOE_18190 | |
| 7287 c1 Prodigal CDS 3594642 3596069 . - 0 ID=BALIOE_18190;Name=hypothetical protein;locus_tag=BALIOE_18190;product=hypothetical protein;Parent=BALIOE_18190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7288 c1 Prodigal gene 3596071 3596979 . - . ID=BALIOE_18195_gene;locus_tag=BALIOE_18195 | |
| 7289 c1 Prodigal CDS 3596071 3596979 . - 0 ID=BALIOE_18195;Name=hypothetical protein;locus_tag=BALIOE_18195;product=hypothetical protein;Parent=BALIOE_18195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7290 c1 Prodigal gene 3597231 3598268 . + . ID=BALIOE_18200_gene;locus_tag=BALIOE_18200 | |
| 7291 c1 Prodigal CDS 3597231 3598268 . + 0 ID=BALIOE_18200;Name=hypothetical protein;locus_tag=BALIOE_18200;product=hypothetical protein;Parent=BALIOE_18200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7292 c1 PILER-CR repeat_region 3598411 3598562 . ? . ID=BALIOELGAO_175;Name=CRISPR array with 3 repeats of length 30%2C consensus sequence CGGTTTATCCCCGCTGGCGCGGGGAACACA and spacer length 31;product=CRISPR array with 3 repeats of length 30%2C consensus sequence CGGTTTATCCCCGCTGGCGCGGGGAACACA and spacer length 31;Note=SO:0001459;rpt_family=CRISPR;rpt_type=direct;rpt_unit_seq=CGGTTTATCCCCGCTGGCGCGGGGAACACA | |
| 7293 c1 Prodigal gene 3598658 3598951 . - . ID=BALIOE_18205_gene;locus_tag=BALIOE_18205 | |
| 7294 c1 Prodigal CDS 3598658 3598951 . - 0 ID=BALIOE_18205;Name=hypothetical protein;locus_tag=BALIOE_18205;product=hypothetical protein;Parent=BALIOE_18205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7295 c1 Prodigal gene 3598948 3599871 . - . ID=BALIOE_18210_gene;locus_tag=BALIOE_18210 | |
| 7296 c1 Prodigal CDS 3598948 3599871 . - 0 ID=BALIOE_18210;Name=hypothetical protein;locus_tag=BALIOE_18210;product=hypothetical protein;Parent=BALIOE_18210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7297 c1 Prodigal gene 3599868 3600518 . - . ID=BALIOE_18215_gene;locus_tag=BALIOE_18215 | |
| 7298 c1 Prodigal CDS 3599868 3600518 . - 0 ID=BALIOE_18215;Name=hypothetical protein;locus_tag=BALIOE_18215;product=hypothetical protein;Parent=BALIOE_18215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7299 c1 Prodigal gene 3600500 3601246 . - . ID=BALIOE_18220_gene;locus_tag=BALIOE_18220 | |
| 7300 c1 Prodigal CDS 3600500 3601246 . - 0 ID=BALIOE_18220;Name=hypothetical protein;locus_tag=BALIOE_18220;product=hypothetical protein;Parent=BALIOE_18220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7301 c1 Prodigal gene 3601257 3602312 . - . ID=BALIOE_18225_gene;locus_tag=BALIOE_18225 | |
| 7302 c1 Prodigal CDS 3601257 3602312 . - 0 ID=BALIOE_18225;Name=hypothetical protein;locus_tag=BALIOE_18225;product=hypothetical protein;Parent=BALIOE_18225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7303 c1 Prodigal gene 3602324 3602860 . - . ID=BALIOE_18230_gene;locus_tag=BALIOE_18230 | |
| 7304 c1 Prodigal CDS 3602324 3602860 . - 0 ID=BALIOE_18230;Name=hypothetical protein;locus_tag=BALIOE_18230;product=hypothetical protein;Parent=BALIOE_18230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7305 c1 Prodigal gene 3602857 3604419 . - . ID=BALIOE_18235_gene;locus_tag=BALIOE_18235 | |
| 7306 c1 Prodigal CDS 3602857 3604419 . - 0 ID=BALIOE_18235;Name=hypothetical protein;locus_tag=BALIOE_18235;product=hypothetical protein;Parent=BALIOE_18235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7307 c1 Prodigal gene 3604517 3607216 . - . ID=BALIOE_18240_gene;locus_tag=BALIOE_18240 | |
| 7308 c1 Prodigal CDS 3604517 3607216 . - 0 ID=BALIOE_18240;Name=hypothetical protein;locus_tag=BALIOE_18240;product=hypothetical protein;Parent=BALIOE_18240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7309 c1 Prodigal gene 3607408 3607560 . - . ID=BALIOE_18245_gene;locus_tag=BALIOE_18245 | |
| 7310 c1 Prodigal CDS 3607408 3607560 . - 0 ID=BALIOE_18245;Name=hypothetical protein;locus_tag=BALIOE_18245;product=hypothetical protein;Parent=BALIOE_18245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7311 c1 Prodigal gene 3607824 3608558 . - . ID=BALIOE_18250_gene;locus_tag=BALIOE_18250 | |
| 7312 c1 Prodigal CDS 3607824 3608558 . - 0 ID=BALIOE_18250;Name=hypothetical protein;locus_tag=BALIOE_18250;product=hypothetical protein;Parent=BALIOE_18250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7313 c1 Prodigal gene 3608632 3610344 . - . ID=BALIOE_18255_gene;locus_tag=BALIOE_18255 | |
| 7314 c1 Prodigal CDS 3608632 3610344 . - 0 ID=BALIOE_18255;Name=hypothetical protein;locus_tag=BALIOE_18255;product=hypothetical protein;Parent=BALIOE_18255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7315 c1 Prodigal gene 3610344 3612143 . - . ID=BALIOE_18260_gene;locus_tag=BALIOE_18260 | |
| 7316 c1 Prodigal CDS 3610344 3612143 . - 0 ID=BALIOE_18260;Name=hypothetical protein;locus_tag=BALIOE_18260;product=hypothetical protein;Parent=BALIOE_18260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7317 c1 Prodigal gene 3612459 3612824 . + . ID=BALIOE_18265_gene;locus_tag=BALIOE_18265 | |
| 7318 c1 Prodigal CDS 3612459 3612824 . + 0 ID=BALIOE_18265;Name=hypothetical protein;locus_tag=BALIOE_18265;product=hypothetical protein;Parent=BALIOE_18265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7319 c1 Prodigal gene 3612902 3614173 . + . ID=BALIOE_18270_gene;locus_tag=BALIOE_18270 | |
| 7320 c1 Prodigal CDS 3612902 3614173 . + 0 ID=BALIOE_18270;Name=hypothetical protein;locus_tag=BALIOE_18270;product=hypothetical protein;Parent=BALIOE_18270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7321 c1 Prodigal gene 3614164 3614424 . + . ID=BALIOE_18275_gene;locus_tag=BALIOE_18275 | |
| 7322 c1 Prodigal CDS 3614164 3614424 . + 0 ID=BALIOE_18275;Name=hypothetical protein;locus_tag=BALIOE_18275;product=hypothetical protein;Parent=BALIOE_18275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7323 c1 Prodigal gene 3614441 3615016 . + . ID=BALIOE_18280_gene;locus_tag=BALIOE_18280 | |
| 7324 c1 Prodigal CDS 3614441 3615016 . + 0 ID=BALIOE_18280;Name=hypothetical protein;locus_tag=BALIOE_18280;product=hypothetical protein;Parent=BALIOE_18280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7325 c1 Prodigal gene 3615164 3615439 . - . ID=BALIOE_18285_gene;locus_tag=BALIOE_18285 | |
| 7326 c1 Prodigal CDS 3615164 3615439 . - 0 ID=BALIOE_18285;Name=hypothetical protein;locus_tag=BALIOE_18285;product=hypothetical protein;Parent=BALIOE_18285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7327 c1 Prodigal gene 3615455 3616024 . - . ID=BALIOE_18290_gene;locus_tag=BALIOE_18290 | |
| 7328 c1 Prodigal CDS 3615455 3616024 . - 0 ID=BALIOE_18290;Name=hypothetical protein;locus_tag=BALIOE_18290;product=hypothetical protein;Parent=BALIOE_18290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7329 c1 Prodigal gene 3616021 3616800 . - . ID=BALIOE_18295_gene;locus_tag=BALIOE_18295 | |
| 7330 c1 Prodigal CDS 3616021 3616800 . - 0 ID=BALIOE_18295;Name=hypothetical protein;locus_tag=BALIOE_18295;product=hypothetical protein;Parent=BALIOE_18295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7331 c1 Prodigal gene 3616778 3616984 . - . ID=BALIOE_18300_gene;locus_tag=BALIOE_18300 | |
| 7332 c1 Prodigal CDS 3616778 3616984 . - 0 ID=BALIOE_18300;Name=hypothetical protein;locus_tag=BALIOE_18300;product=hypothetical protein;Parent=BALIOE_18300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7333 c1 Prodigal gene 3616981 3618186 . - . ID=BALIOE_18305_gene;locus_tag=BALIOE_18305 | |
| 7334 c1 Prodigal CDS 3616981 3618186 . - 0 ID=BALIOE_18305;Name=hypothetical protein;locus_tag=BALIOE_18305;product=hypothetical protein;Parent=BALIOE_18305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7335 c1 Prodigal gene 3618208 3619662 . - . ID=BALIOE_18310_gene;locus_tag=BALIOE_18310 | |
| 7336 c1 Prodigal CDS 3618208 3619662 . - 0 ID=BALIOE_18310;Name=hypothetical protein;locus_tag=BALIOE_18310;product=hypothetical protein;Parent=BALIOE_18310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7337 c1 Prodigal gene 3619732 3620517 . - . ID=BALIOE_18315_gene;locus_tag=BALIOE_18315 | |
| 7338 c1 Prodigal CDS 3619732 3620517 . - 0 ID=BALIOE_18315;Name=hypothetical protein;locus_tag=BALIOE_18315;product=hypothetical protein;Parent=BALIOE_18315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7339 c1 Prodigal gene 3620836 3622113 . + . ID=BALIOE_18320_gene;locus_tag=BALIOE_18320 | |
| 7340 c1 Prodigal CDS 3620836 3622113 . + 0 ID=BALIOE_18320;Name=hypothetical protein;locus_tag=BALIOE_18320;product=hypothetical protein;Parent=BALIOE_18320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7341 c1 Prodigal gene 3622140 3623618 . + . ID=BALIOE_18325_gene;locus_tag=BALIOE_18325 | |
| 7342 c1 Prodigal CDS 3622140 3623618 . + 0 ID=BALIOE_18325;Name=hypothetical protein;locus_tag=BALIOE_18325;product=hypothetical protein;Parent=BALIOE_18325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7343 c1 Prodigal gene 3624682 3625353 . - . ID=BALIOE_18330_gene;locus_tag=BALIOE_18330 | |
| 7344 c1 Prodigal CDS 3624682 3625353 . - 0 ID=BALIOE_18330;Name=hypothetical protein;locus_tag=BALIOE_18330;product=hypothetical protein;Parent=BALIOE_18330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7345 c1 Prodigal gene 3625634 3626128 . + . ID=BALIOE_18335_gene;locus_tag=BALIOE_18335 | |
| 7346 c1 Prodigal CDS 3625634 3626128 . + 0 ID=BALIOE_18335;Name=hypothetical protein;locus_tag=BALIOE_18335;product=hypothetical protein;Parent=BALIOE_18335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7347 c1 Prodigal gene 3626142 3626816 . + . ID=BALIOE_18340_gene;locus_tag=BALIOE_18340 | |
| 7348 c1 Prodigal CDS 3626142 3626816 . + 0 ID=BALIOE_18340;Name=hypothetical protein;locus_tag=BALIOE_18340;product=hypothetical protein;Parent=BALIOE_18340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7349 c1 Prodigal gene 3627050 3628198 . + . ID=BALIOE_18345_gene;locus_tag=BALIOE_18345 | |
| 7350 c1 Prodigal CDS 3627050 3628198 . + 0 ID=BALIOE_18345;Name=hypothetical protein;locus_tag=BALIOE_18345;product=hypothetical protein;Parent=BALIOE_18345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7351 c1 Prodigal gene 3628195 3629109 . + . ID=BALIOE_18350_gene;locus_tag=BALIOE_18350 | |
| 7352 c1 Prodigal CDS 3628195 3629109 . + 0 ID=BALIOE_18350;Name=hypothetical protein;locus_tag=BALIOE_18350;product=hypothetical protein;Parent=BALIOE_18350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7353 c1 Prodigal gene 3629169 3630467 . - . ID=BALIOE_18355_gene;locus_tag=BALIOE_18355 | |
| 7354 c1 Prodigal CDS 3629169 3630467 . - 0 ID=BALIOE_18355;Name=hypothetical protein;locus_tag=BALIOE_18355;product=hypothetical protein;Parent=BALIOE_18355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7355 c1 Prodigal gene 3630555 3632192 . - . ID=BALIOE_18360_gene;locus_tag=BALIOE_18360 | |
| 7356 c1 Prodigal CDS 3630555 3632192 . - 0 ID=BALIOE_18360;Name=hypothetical protein;locus_tag=BALIOE_18360;product=hypothetical protein;Parent=BALIOE_18360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7357 c1 Prodigal gene 3632420 3633211 . - . ID=BALIOE_18365_gene;locus_tag=BALIOE_18365 | |
| 7358 c1 Prodigal CDS 3632420 3633211 . - 0 ID=BALIOE_18365;Name=hypothetical protein;locus_tag=BALIOE_18365;product=hypothetical protein;Parent=BALIOE_18365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7359 c1 Prodigal gene 3633282 3633617 . - . ID=BALIOE_18370_gene;locus_tag=BALIOE_18370 | |
| 7360 c1 Prodigal CDS 3633282 3633617 . - 0 ID=BALIOE_18370;Name=hypothetical protein;locus_tag=BALIOE_18370;product=hypothetical protein;Parent=BALIOE_18370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7361 c1 Prodigal gene 3633617 3633865 . - . ID=BALIOE_18375_gene;locus_tag=BALIOE_18375 | |
| 7362 c1 Prodigal CDS 3633617 3633865 . - 0 ID=BALIOE_18375;Name=hypothetical protein;locus_tag=BALIOE_18375;product=hypothetical protein;Parent=BALIOE_18375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7363 c1 Prodigal gene 3633943 3636177 . - . ID=BALIOE_18380_gene;locus_tag=BALIOE_18380 | |
| 7364 c1 Prodigal CDS 3633943 3636177 . - 0 ID=BALIOE_18380;Name=hypothetical protein;locus_tag=BALIOE_18380;product=hypothetical protein;Parent=BALIOE_18380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7365 c1 Prodigal gene 3636225 3637526 . - . ID=BALIOE_18385_gene;locus_tag=BALIOE_18385 | |
| 7366 c1 Prodigal CDS 3636225 3637526 . - 0 ID=BALIOE_18385;Name=hypothetical protein;locus_tag=BALIOE_18385;product=hypothetical protein;Parent=BALIOE_18385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7367 c1 Prodigal gene 3637583 3640339 . + . ID=BALIOE_18390_gene;locus_tag=BALIOE_18390 | |
| 7368 c1 Prodigal CDS 3637583 3640339 . + 0 ID=BALIOE_18390;Name=hypothetical protein;locus_tag=BALIOE_18390;product=hypothetical protein;Parent=BALIOE_18390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7369 c1 Prodigal gene 3640572 3641912 . - . ID=BALIOE_18395_gene;locus_tag=BALIOE_18395 | |
| 7370 c1 Prodigal CDS 3640572 3641912 . - 0 ID=BALIOE_18395;Name=hypothetical protein;locus_tag=BALIOE_18395;product=hypothetical protein;Parent=BALIOE_18395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7371 c1 Prodigal gene 3641933 3643030 . - . ID=BALIOE_18400_gene;locus_tag=BALIOE_18400 | |
| 7372 c1 Prodigal CDS 3641933 3643030 . - 0 ID=BALIOE_18400;Name=hypothetical protein;locus_tag=BALIOE_18400;product=hypothetical protein;Parent=BALIOE_18400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7373 c1 Prodigal gene 3643052 3643273 . - . ID=BALIOE_18405_gene;locus_tag=BALIOE_18405 | |
| 7374 c1 Prodigal CDS 3643052 3643273 . - 0 ID=BALIOE_18405;Name=hypothetical protein;locus_tag=BALIOE_18405;product=hypothetical protein;Parent=BALIOE_18405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7375 c1 Prodigal gene 3643275 3644627 . - . ID=BALIOE_18410_gene;locus_tag=BALIOE_18410 | |
| 7376 c1 Prodigal CDS 3643275 3644627 . - 0 ID=BALIOE_18410;Name=hypothetical protein;locus_tag=BALIOE_18410;product=hypothetical protein;Parent=BALIOE_18410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7377 c1 Prodigal gene 3645062 3645511 . - . ID=BALIOE_18415_gene;locus_tag=BALIOE_18415 | |
| 7378 c1 Prodigal CDS 3645062 3645511 . - 0 ID=BALIOE_18415;Name=hypothetical protein;locus_tag=BALIOE_18415;product=hypothetical protein;Parent=BALIOE_18415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7379 c1 Prodigal gene 3645529 3646311 . - . ID=BALIOE_18420_gene;locus_tag=BALIOE_18420 | |
| 7380 c1 Prodigal CDS 3645529 3646311 . - 0 ID=BALIOE_18420;Name=hypothetical protein;locus_tag=BALIOE_18420;product=hypothetical protein;Parent=BALIOE_18420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7381 c1 Prodigal gene 3646311 3646640 . - . ID=BALIOE_18425_gene;locus_tag=BALIOE_18425 | |
| 7382 c1 Prodigal CDS 3646311 3646640 . - 0 ID=BALIOE_18425;Name=hypothetical protein;locus_tag=BALIOE_18425;product=hypothetical protein;Parent=BALIOE_18425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7383 c1 Prodigal gene 3647262 3647807 . - . ID=BALIOE_18430_gene;locus_tag=BALIOE_18430 | |
| 7384 c1 Prodigal CDS 3647262 3647807 . - 0 ID=BALIOE_18430;Name=hypothetical protein;locus_tag=BALIOE_18430;product=hypothetical protein;Parent=BALIOE_18430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7385 c1 Prodigal gene 3647875 3648723 . + . ID=BALIOE_18435_gene;locus_tag=BALIOE_18435 | |
| 7386 c1 Prodigal CDS 3647875 3648723 . + 0 ID=BALIOE_18435;Name=hypothetical protein;locus_tag=BALIOE_18435;product=hypothetical protein;Parent=BALIOE_18435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7387 c1 Prodigal gene 3648835 3650199 . + . ID=BALIOE_18440_gene;locus_tag=BALIOE_18440 | |
| 7388 c1 Prodigal CDS 3648835 3650199 . + 0 ID=BALIOE_18440;Name=hypothetical protein;locus_tag=BALIOE_18440;product=hypothetical protein;Parent=BALIOE_18440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7389 c1 Prodigal gene 3650756 3652045 . + . ID=BALIOE_18445_gene;locus_tag=BALIOE_18445 | |
| 7390 c1 Prodigal CDS 3650756 3652045 . + 0 ID=BALIOE_18445;Name=hypothetical protein;locus_tag=BALIOE_18445;product=hypothetical protein;Parent=BALIOE_18445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7391 c1 Prodigal gene 3652103 3653470 . + . ID=BALIOE_18450_gene;locus_tag=BALIOE_18450 | |
| 7392 c1 Prodigal CDS 3652103 3653470 . + 0 ID=BALIOE_18450;Name=hypothetical protein;locus_tag=BALIOE_18450;product=hypothetical protein;Parent=BALIOE_18450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7393 c1 Prodigal gene 3653492 3654337 . + . ID=BALIOE_18455_gene;locus_tag=BALIOE_18455 | |
| 7394 c1 Prodigal CDS 3653492 3654337 . + 0 ID=BALIOE_18455;Name=hypothetical protein;locus_tag=BALIOE_18455;product=hypothetical protein;Parent=BALIOE_18455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7395 c1 Prodigal gene 3654392 3655540 . - . ID=BALIOE_18460_gene;locus_tag=BALIOE_18460 | |
| 7396 c1 Prodigal CDS 3654392 3655540 . - 0 ID=BALIOE_18460;Name=hypothetical protein;locus_tag=BALIOE_18460;product=hypothetical protein;Parent=BALIOE_18460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7397 c1 Prodigal gene 3655568 3656215 . - . ID=BALIOE_18465_gene;locus_tag=BALIOE_18465 | |
| 7398 c1 Prodigal CDS 3655568 3656215 . - 0 ID=BALIOE_18465;Name=hypothetical protein;locus_tag=BALIOE_18465;product=hypothetical protein;Parent=BALIOE_18465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7399 c1 Prodigal gene 3656762 3658078 . + . ID=BALIOE_18470_gene;locus_tag=BALIOE_18470 | |
| 7400 c1 Prodigal CDS 3656762 3658078 . + 0 ID=BALIOE_18470;Name=hypothetical protein;locus_tag=BALIOE_18470;product=hypothetical protein;Parent=BALIOE_18470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7401 c1 Prodigal gene 3658111 3659886 . + . ID=BALIOE_18475_gene;locus_tag=BALIOE_18475 | |
| 7402 c1 Prodigal CDS 3658111 3659886 . + 0 ID=BALIOE_18475;Name=hypothetical protein;locus_tag=BALIOE_18475;product=hypothetical protein;Parent=BALIOE_18475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7403 c1 Prodigal gene 3659995 3661413 . + . ID=BALIOE_18480_gene;locus_tag=BALIOE_18480 | |
| 7404 c1 Prodigal CDS 3659995 3661413 . + 0 ID=BALIOE_18480;Name=hypothetical protein;locus_tag=BALIOE_18480;product=hypothetical protein;Parent=BALIOE_18480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7405 c1 Prodigal gene 3661415 3661837 . + . ID=BALIOE_18485_gene;locus_tag=BALIOE_18485 | |
| 7406 c1 Prodigal CDS 3661415 3661837 . + 0 ID=BALIOE_18485;Name=hypothetical protein;locus_tag=BALIOE_18485;product=hypothetical protein;Parent=BALIOE_18485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7407 c1 Prodigal gene 3661895 3662626 . + . ID=BALIOE_18490_gene;locus_tag=BALIOE_18490 | |
| 7408 c1 Prodigal CDS 3661895 3662626 . + 0 ID=BALIOE_18490;Name=hypothetical protein;locus_tag=BALIOE_18490;product=hypothetical protein;Parent=BALIOE_18490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7409 c1 Prodigal gene 3662670 3663770 . - . ID=BALIOE_18495_gene;locus_tag=BALIOE_18495 | |
| 7410 c1 Prodigal CDS 3662670 3663770 . - 0 ID=BALIOE_18495;Name=hypothetical protein;locus_tag=BALIOE_18495;product=hypothetical protein;Parent=BALIOE_18495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7411 c1 Prodigal gene 3663763 3664158 . - . ID=BALIOE_18500_gene;locus_tag=BALIOE_18500 | |
| 7412 c1 Prodigal CDS 3663763 3664158 . - 0 ID=BALIOE_18500;Name=hypothetical protein;locus_tag=BALIOE_18500;product=hypothetical protein;Parent=BALIOE_18500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7413 c1 Prodigal gene 3664177 3665094 . - . ID=BALIOE_18505_gene;locus_tag=BALIOE_18505 | |
| 7414 c1 Prodigal CDS 3664177 3665094 . - 0 ID=BALIOE_18505;Name=hypothetical protein;locus_tag=BALIOE_18505;product=hypothetical protein;Parent=BALIOE_18505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7415 c1 Prodigal gene 3665445 3665672 . - . ID=BALIOE_18510_gene;locus_tag=BALIOE_18510 | |
| 7416 c1 Prodigal CDS 3665445 3665672 . - 0 ID=BALIOE_18510;Name=hypothetical protein;locus_tag=BALIOE_18510;product=hypothetical protein;Parent=BALIOE_18510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7417 c1 Prodigal gene 3665864 3667069 . + . ID=BALIOE_18515_gene;locus_tag=BALIOE_18515 | |
| 7418 c1 Prodigal CDS 3665864 3667069 . + 0 ID=BALIOE_18515;Name=hypothetical protein;locus_tag=BALIOE_18515;product=hypothetical protein;Parent=BALIOE_18515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7419 c1 Prodigal gene 3667069 3667512 . + . ID=BALIOE_18520_gene;locus_tag=BALIOE_18520 | |
| 7420 c1 Prodigal CDS 3667069 3667512 . + 0 ID=BALIOE_18520;Name=hypothetical protein;locus_tag=BALIOE_18520;product=hypothetical protein;Parent=BALIOE_18520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7421 c1 Prodigal gene 3667563 3668369 . - . ID=BALIOE_18525_gene;locus_tag=BALIOE_18525 | |
| 7422 c1 Prodigal CDS 3667563 3668369 . - 0 ID=BALIOE_18525;Name=hypothetical protein;locus_tag=BALIOE_18525;product=hypothetical protein;Parent=BALIOE_18525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7423 c1 Prodigal gene 3668608 3669705 . - . ID=BALIOE_18530_gene;locus_tag=BALIOE_18530 | |
| 7424 c1 Prodigal CDS 3668608 3669705 . - 0 ID=BALIOE_18530;Name=hypothetical protein;locus_tag=BALIOE_18530;product=hypothetical protein;Parent=BALIOE_18530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7425 c1 tRNAscan-SE gene 3669914 3669990 . + . ID=BALIOE_18535_gene;locus_tag=BALIOE_18535;gene=fMet_trna | |
| 7426 c1 tRNAscan-SE tRNA 3669914 3669990 . + . ID=BALIOE_18535;Name=tRNA-fMet;locus_tag=BALIOE_18535;product=tRNA-fMet;gene=fMet_trna;Parent=BALIOE_18535_gene;inference=profile:tRNAscan:2.0;Note=SO:0000266 | |
| 7427 c1 tRNAscan-SE gene 3670024 3670100 . + . ID=BALIOE_18540_gene;locus_tag=BALIOE_18540;gene=fMet_trna | |
| 7428 c1 tRNAscan-SE tRNA 3670024 3670100 . + . ID=BALIOE_18540;Name=tRNA-fMet;locus_tag=BALIOE_18540;product=tRNA-fMet;gene=fMet_trna;Parent=BALIOE_18540_gene;inference=profile:tRNAscan:2.0;Note=SO:0000266 | |
| 7429 c1 tRNAscan-SE gene 3670134 3670210 . + . ID=BALIOE_18545_gene;locus_tag=BALIOE_18545;gene=fMet_trna | |
| 7430 c1 tRNAscan-SE tRNA 3670134 3670210 . + . ID=BALIOE_18545;Name=tRNA-fMet;locus_tag=BALIOE_18545;product=tRNA-fMet;gene=fMet_trna;Parent=BALIOE_18545_gene;inference=profile:tRNAscan:2.0;Note=SO:0000266 | |
| 7431 c1 Prodigal gene 3670284 3671537 . - . ID=BALIOE_18550_gene;locus_tag=BALIOE_18550 | |
| 7432 c1 Prodigal CDS 3670284 3671537 . - 0 ID=BALIOE_18550;Name=hypothetical protein;locus_tag=BALIOE_18550;product=hypothetical protein;Parent=BALIOE_18550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7433 c1 Prodigal gene 3671769 3673100 . + . ID=BALIOE_18555_gene;locus_tag=BALIOE_18555 | |
| 7434 c1 Prodigal CDS 3671769 3673100 . + 0 ID=BALIOE_18555;Name=hypothetical protein;locus_tag=BALIOE_18555;product=hypothetical protein;Parent=BALIOE_18555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7435 c1 Prodigal gene 3673162 3674988 . - . ID=BALIOE_18560_gene;locus_tag=BALIOE_18560 | |
| 7436 c1 Prodigal CDS 3673162 3674988 . - 0 ID=BALIOE_18560;Name=hypothetical protein;locus_tag=BALIOE_18560;product=hypothetical protein;Parent=BALIOE_18560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7437 c1 Prodigal gene 3674988 3678530 . - . ID=BALIOE_18565_gene;locus_tag=BALIOE_18565 | |
| 7438 c1 Prodigal CDS 3674988 3678530 . - 0 ID=BALIOE_18565;Name=hypothetical protein;locus_tag=BALIOE_18565;product=hypothetical protein;Parent=BALIOE_18565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7439 c1 Prodigal gene 3678523 3681411 . - . ID=BALIOE_18570_gene;locus_tag=BALIOE_18570 | |
| 7440 c1 Prodigal CDS 3678523 3681411 . - 0 ID=BALIOE_18570;Name=hypothetical protein;locus_tag=BALIOE_18570;product=hypothetical protein;Parent=BALIOE_18570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7441 c1 Prodigal gene 3681587 3684955 . - . ID=BALIOE_18575_gene;locus_tag=BALIOE_18575 | |
| 7442 c1 Prodigal CDS 3681587 3684955 . - 0 ID=BALIOE_18575;Name=hypothetical protein;locus_tag=BALIOE_18575;product=hypothetical protein;Parent=BALIOE_18575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7443 c1 Prodigal gene 3684968 3685291 . - . ID=BALIOE_18580_gene;locus_tag=BALIOE_18580 | |
| 7444 c1 Prodigal CDS 3684968 3685291 . - 0 ID=BALIOE_18580;Name=hypothetical protein;locus_tag=BALIOE_18580;product=hypothetical protein;Parent=BALIOE_18580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7445 c1 Prodigal gene 3685276 3685683 . - . ID=BALIOE_18585_gene;locus_tag=BALIOE_18585 | |
| 7446 c1 Prodigal CDS 3685276 3685683 . - 0 ID=BALIOE_18585;Name=hypothetical protein;locus_tag=BALIOE_18585;product=hypothetical protein;Parent=BALIOE_18585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7447 c1 Prodigal gene 3685680 3686243 . - . ID=BALIOE_18590_gene;locus_tag=BALIOE_18590 | |
| 7448 c1 Prodigal CDS 3685680 3686243 . - 0 ID=BALIOE_18590;Name=hypothetical protein;locus_tag=BALIOE_18590;product=hypothetical protein;Parent=BALIOE_18590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7449 c1 Prodigal gene 3686234 3686704 . - . ID=BALIOE_18595_gene;locus_tag=BALIOE_18595 | |
| 7450 c1 Prodigal CDS 3686234 3686704 . - 0 ID=BALIOE_18595;Name=hypothetical protein;locus_tag=BALIOE_18595;product=hypothetical protein;Parent=BALIOE_18595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7451 c1 Prodigal gene 3686888 3687682 . - . ID=BALIOE_18600_gene;locus_tag=BALIOE_18600 | |
| 7452 c1 Prodigal CDS 3686888 3687682 . - 0 ID=BALIOE_18600;Name=hypothetical protein;locus_tag=BALIOE_18600;product=hypothetical protein;Parent=BALIOE_18600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7453 c1 Prodigal gene 3687689 3688564 . - . ID=BALIOE_18605_gene;locus_tag=BALIOE_18605 | |
| 7454 c1 Prodigal CDS 3687689 3688564 . - 0 ID=BALIOE_18605;Name=hypothetical protein;locus_tag=BALIOE_18605;product=hypothetical protein;Parent=BALIOE_18605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7455 c1 Prodigal gene 3688715 3690961 . - . ID=BALIOE_18610_gene;locus_tag=BALIOE_18610 | |
| 7456 c1 Prodigal CDS 3688715 3690961 . - 0 ID=BALIOE_18610;Name=hypothetical protein;locus_tag=BALIOE_18610;product=hypothetical protein;Parent=BALIOE_18610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7457 c1 Prodigal gene 3690974 3691504 . - . ID=BALIOE_18615_gene;locus_tag=BALIOE_18615 | |
| 7458 c1 Prodigal CDS 3690974 3691504 . - 0 ID=BALIOE_18615;Name=hypothetical protein;locus_tag=BALIOE_18615;product=hypothetical protein;Parent=BALIOE_18615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7459 c1 Prodigal gene 3691857 3692003 . - . ID=BALIOE_18620_gene;locus_tag=BALIOE_18620 | |
| 7460 c1 Prodigal CDS 3691857 3692003 . - 0 ID=BALIOE_18620;Name=hypothetical protein;locus_tag=BALIOE_18620;product=hypothetical protein;Parent=BALIOE_18620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7461 c1 Prodigal gene 3692189 3692878 . + . ID=BALIOE_18625_gene;locus_tag=BALIOE_18625 | |
| 7462 c1 Prodigal CDS 3692189 3692878 . + 0 ID=BALIOE_18625;Name=hypothetical protein;locus_tag=BALIOE_18625;product=hypothetical protein;Parent=BALIOE_18625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7463 c1 Prodigal gene 3692947 3693660 . + . ID=BALIOE_18630_gene;locus_tag=BALIOE_18630 | |
| 7464 c1 Prodigal CDS 3692947 3693660 . + 0 ID=BALIOE_18630;Name=hypothetical protein;locus_tag=BALIOE_18630;product=hypothetical protein;Parent=BALIOE_18630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7465 c1 Prodigal gene 3693798 3694016 . + . ID=BALIOE_18635_gene;locus_tag=BALIOE_18635 | |
| 7466 c1 Prodigal CDS 3693798 3694016 . + 0 ID=BALIOE_18635;Name=hypothetical protein;locus_tag=BALIOE_18635;product=hypothetical protein;Parent=BALIOE_18635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7467 c1 Prodigal gene 3694124 3695164 . + . ID=BALIOE_18640_gene;locus_tag=BALIOE_18640 | |
| 7468 c1 Prodigal CDS 3694124 3695164 . + 0 ID=BALIOE_18640;Name=hypothetical protein;locus_tag=BALIOE_18640;product=hypothetical protein;Parent=BALIOE_18640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7469 c1 Prodigal gene 3695196 3696389 . - . ID=BALIOE_18645_gene;locus_tag=BALIOE_18645 | |
| 7470 c1 Prodigal CDS 3695196 3696389 . - 0 ID=BALIOE_18645;Name=hypothetical protein;locus_tag=BALIOE_18645;product=hypothetical protein;Parent=BALIOE_18645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7471 c1 Prodigal gene 3696382 3698541 . - . ID=BALIOE_18650_gene;locus_tag=BALIOE_18650 | |
| 7472 c1 Prodigal CDS 3696382 3698541 . - 0 ID=BALIOE_18650;Name=hypothetical protein;locus_tag=BALIOE_18650;product=hypothetical protein;Parent=BALIOE_18650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7473 c1 Prodigal gene 3699127 3700158 . + . ID=BALIOE_18655_gene;locus_tag=BALIOE_18655 | |
| 7474 c1 Prodigal CDS 3699127 3700158 . + 0 ID=BALIOE_18655;Name=hypothetical protein;locus_tag=BALIOE_18655;product=hypothetical protein;Parent=BALIOE_18655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7475 c1 Prodigal gene 3700165 3701427 . - . ID=BALIOE_18660_gene;locus_tag=BALIOE_18660 | |
| 7476 c1 Prodigal CDS 3700165 3701427 . - 0 ID=BALIOE_18660;Name=hypothetical protein;locus_tag=BALIOE_18660;product=hypothetical protein;Parent=BALIOE_18660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7477 c1 Prodigal gene 3701549 3702484 . + . ID=BALIOE_18665_gene;locus_tag=BALIOE_18665 | |
| 7478 c1 Prodigal CDS 3701549 3702484 . + 0 ID=BALIOE_18665;Name=hypothetical protein;locus_tag=BALIOE_18665;product=hypothetical protein;Parent=BALIOE_18665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7479 c1 Prodigal gene 3702471 3703163 . - . ID=BALIOE_18670_gene;locus_tag=BALIOE_18670 | |
| 7480 c1 Prodigal CDS 3702471 3703163 . - 0 ID=BALIOE_18670;Name=hypothetical protein;locus_tag=BALIOE_18670;product=hypothetical protein;Parent=BALIOE_18670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7481 c1 Prodigal gene 3703292 3704710 . - . ID=BALIOE_18675_gene;locus_tag=BALIOE_18675 | |
| 7482 c1 Prodigal CDS 3703292 3704710 . - 0 ID=BALIOE_18675;Name=hypothetical protein;locus_tag=BALIOE_18675;product=hypothetical protein;Parent=BALIOE_18675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7483 c1 Prodigal gene 3705025 3705786 . - . ID=BALIOE_18680_gene;locus_tag=BALIOE_18680 | |
| 7484 c1 Prodigal CDS 3705025 3705786 . - 0 ID=BALIOE_18680;Name=hypothetical protein;locus_tag=BALIOE_18680;product=hypothetical protein;Parent=BALIOE_18680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7485 c1 Prodigal gene 3705816 3706652 . - . ID=BALIOE_18685_gene;locus_tag=BALIOE_18685 | |
| 7486 c1 Prodigal CDS 3705816 3706652 . - 0 ID=BALIOE_18685;Name=hypothetical protein;locus_tag=BALIOE_18685;product=hypothetical protein;Parent=BALIOE_18685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7487 c1 Prodigal gene 3706939 3708120 . - . ID=BALIOE_18690_gene;locus_tag=BALIOE_18690 | |
| 7488 c1 Prodigal CDS 3706939 3708120 . - 0 ID=BALIOE_18690;Name=hypothetical protein;locus_tag=BALIOE_18690;product=hypothetical protein;Parent=BALIOE_18690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7489 c1 Prodigal gene 3708375 3709604 . + . ID=BALIOE_18695_gene;locus_tag=BALIOE_18695 | |
| 7490 c1 Prodigal CDS 3708375 3709604 . + 0 ID=BALIOE_18695;Name=hypothetical protein;locus_tag=BALIOE_18695;product=hypothetical protein;Parent=BALIOE_18695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7491 c1 Prodigal gene 3710064 3710696 . + . ID=BALIOE_18700_gene;locus_tag=BALIOE_18700 | |
| 7492 c1 Prodigal CDS 3710064 3710696 . + 0 ID=BALIOE_18700;Name=hypothetical protein;locus_tag=BALIOE_18700;product=hypothetical protein;Parent=BALIOE_18700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7493 c1 Prodigal gene 3710778 3710909 . - . ID=BALIOE_18705_gene;locus_tag=BALIOE_18705 | |
| 7494 c1 Prodigal CDS 3710778 3710909 . - 0 ID=BALIOE_18705;Name=hypothetical protein;locus_tag=BALIOE_18705;product=hypothetical protein;Parent=BALIOE_18705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7495 c1 Prodigal gene 3711030 3711839 . + . ID=BALIOE_18710_gene;locus_tag=BALIOE_18710 | |
| 7496 c1 Prodigal CDS 3711030 3711839 . + 0 ID=BALIOE_18710;Name=hypothetical protein;locus_tag=BALIOE_18710;product=hypothetical protein;Parent=BALIOE_18710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7497 c1 Prodigal gene 3711836 3712315 . + . ID=BALIOE_18715_gene;locus_tag=BALIOE_18715 | |
| 7498 c1 Prodigal CDS 3711836 3712315 . + 0 ID=BALIOE_18715;Name=hypothetical protein;locus_tag=BALIOE_18715;product=hypothetical protein;Parent=BALIOE_18715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7499 c1 Prodigal gene 3712348 3712488 . - . ID=BALIOE_18720_gene;locus_tag=BALIOE_18720 | |
| 7500 c1 Prodigal CDS 3712348 3712488 . - 0 ID=BALIOE_18720;Name=hypothetical protein;locus_tag=BALIOE_18720;product=hypothetical protein;Parent=BALIOE_18720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7501 c1 Prodigal gene 3712464 3712889 . - . ID=BALIOE_18725_gene;locus_tag=BALIOE_18725 | |
| 7502 c1 Prodigal CDS 3712464 3712889 . - 0 ID=BALIOE_18725;Name=hypothetical protein;locus_tag=BALIOE_18725;product=hypothetical protein;Parent=BALIOE_18725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7503 c1 Prodigal gene 3713319 3713810 . + . ID=BALIOE_18730_gene;locus_tag=BALIOE_18730 | |
| 7504 c1 Prodigal CDS 3713319 3713810 . + 0 ID=BALIOE_18730;Name=hypothetical protein;locus_tag=BALIOE_18730;product=hypothetical protein;Parent=BALIOE_18730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7505 c1 Prodigal gene 3714036 3714527 . + . ID=BALIOE_18735_gene;locus_tag=BALIOE_18735 | |
| 7506 c1 Prodigal CDS 3714036 3714527 . + 0 ID=BALIOE_18735;Name=hypothetical protein;locus_tag=BALIOE_18735;product=hypothetical protein;Parent=BALIOE_18735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7507 c1 Prodigal gene 3714861 3716237 . + . ID=BALIOE_18740_gene;locus_tag=BALIOE_18740 | |
| 7508 c1 Prodigal CDS 3714861 3716237 . + 0 ID=BALIOE_18740;Name=hypothetical protein;locus_tag=BALIOE_18740;product=hypothetical protein;Parent=BALIOE_18740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7509 c1 Prodigal gene 3716404 3716622 . + . ID=BALIOE_18745_gene;locus_tag=BALIOE_18745 | |
| 7510 c1 Prodigal CDS 3716404 3716622 . + 0 ID=BALIOE_18745;Name=hypothetical protein;locus_tag=BALIOE_18745;product=hypothetical protein;Parent=BALIOE_18745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7511 c1 Prodigal gene 3716809 3717210 . + . ID=BALIOE_18750_gene;locus_tag=BALIOE_18750 | |
| 7512 c1 Prodigal CDS 3716809 3717210 . + 0 ID=BALIOE_18750;Name=hypothetical protein;locus_tag=BALIOE_18750;product=hypothetical protein;Parent=BALIOE_18750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7513 c1 Prodigal gene 3717229 3717861 . - . ID=BALIOE_18755_gene;locus_tag=BALIOE_18755 | |
| 7514 c1 Prodigal CDS 3717229 3717861 . - 0 ID=BALIOE_18755;Name=hypothetical protein;locus_tag=BALIOE_18755;product=hypothetical protein;Parent=BALIOE_18755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7515 c1 Prodigal gene 3718084 3718515 . - . ID=BALIOE_18760_gene;locus_tag=BALIOE_18760 | |
| 7516 c1 Prodigal CDS 3718084 3718515 . - 0 ID=BALIOE_18760;Name=hypothetical protein;locus_tag=BALIOE_18760;product=hypothetical protein;Parent=BALIOE_18760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7517 c1 Prodigal gene 3718532 3718792 . - . ID=BALIOE_18765_gene;locus_tag=BALIOE_18765 | |
| 7518 c1 Prodigal CDS 3718532 3718792 . - 0 ID=BALIOE_18765;Name=hypothetical protein;locus_tag=BALIOE_18765;product=hypothetical protein;Parent=BALIOE_18765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7519 c1 Prodigal gene 3718734 3719315 . - . ID=BALIOE_18770_gene;locus_tag=BALIOE_18770 | |
| 7520 c1 Prodigal CDS 3718734 3719315 . - 0 ID=BALIOE_18770;Name=hypothetical protein;locus_tag=BALIOE_18770;product=hypothetical protein;Parent=BALIOE_18770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7521 c1 Prodigal gene 3719331 3720065 . - . ID=BALIOE_18775_gene;locus_tag=BALIOE_18775 | |
| 7522 c1 Prodigal CDS 3719331 3720065 . - 0 ID=BALIOE_18775;Name=hypothetical protein;locus_tag=BALIOE_18775;product=hypothetical protein;Parent=BALIOE_18775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7523 c1 Prodigal gene 3720062 3720394 . - . ID=BALIOE_18780_gene;locus_tag=BALIOE_18780 | |
| 7524 c1 Prodigal CDS 3720062 3720394 . - 0 ID=BALIOE_18780;Name=hypothetical protein;locus_tag=BALIOE_18780;product=hypothetical protein;Parent=BALIOE_18780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7525 c1 Prodigal gene 3720414 3720653 . - . ID=BALIOE_18785_gene;locus_tag=BALIOE_18785 | |
| 7526 c1 Prodigal CDS 3720414 3720653 . - 0 ID=BALIOE_18785;Name=hypothetical protein;locus_tag=BALIOE_18785;product=hypothetical protein;Parent=BALIOE_18785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7527 c1 Prodigal gene 3720667 3721401 . - . ID=BALIOE_18790_gene;locus_tag=BALIOE_18790 | |
| 7528 c1 Prodigal CDS 3720667 3721401 . - 0 ID=BALIOE_18790;Name=hypothetical protein;locus_tag=BALIOE_18790;product=hypothetical protein;Parent=BALIOE_18790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7529 c1 Prodigal gene 3722105 3722605 . + . ID=BALIOE_18795_gene;locus_tag=BALIOE_18795 | |
| 7530 c1 Prodigal CDS 3722105 3722605 . + 0 ID=BALIOE_18795;Name=hypothetical protein;locus_tag=BALIOE_18795;product=hypothetical protein;Parent=BALIOE_18795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7531 c1 Prodigal gene 3722962 3724083 . - . ID=BALIOE_18800_gene;locus_tag=BALIOE_18800 | |
| 7532 c1 Prodigal CDS 3722962 3724083 . - 0 ID=BALIOE_18800;Name=hypothetical protein;locus_tag=BALIOE_18800;product=hypothetical protein;Parent=BALIOE_18800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7533 c1 Prodigal gene 3724092 3724328 . - . ID=BALIOE_18805_gene;locus_tag=BALIOE_18805 | |
| 7534 c1 Prodigal CDS 3724092 3724328 . - 0 ID=BALIOE_18805;Name=hypothetical protein;locus_tag=BALIOE_18805;product=hypothetical protein;Parent=BALIOE_18805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7535 c1 Prodigal gene 3724407 3724859 . - . ID=BALIOE_18810_gene;locus_tag=BALIOE_18810 | |
| 7536 c1 Prodigal CDS 3724407 3724859 . - 0 ID=BALIOE_18810;Name=hypothetical protein;locus_tag=BALIOE_18810;product=hypothetical protein;Parent=BALIOE_18810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7537 c1 Prodigal gene 3724861 3725121 . - . ID=BALIOE_18815_gene;locus_tag=BALIOE_18815 | |
| 7538 c1 Prodigal CDS 3724861 3725121 . - 0 ID=BALIOE_18815;Name=hypothetical protein;locus_tag=BALIOE_18815;product=hypothetical protein;Parent=BALIOE_18815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7539 c1 Prodigal gene 3725132 3725797 . - . ID=BALIOE_18820_gene;locus_tag=BALIOE_18820 | |
| 7540 c1 Prodigal CDS 3725132 3725797 . - 0 ID=BALIOE_18820;Name=hypothetical protein;locus_tag=BALIOE_18820;product=hypothetical protein;Parent=BALIOE_18820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7541 c1 Prodigal gene 3725787 3726773 . - . ID=BALIOE_18825_gene;locus_tag=BALIOE_18825 | |
| 7542 c1 Prodigal CDS 3725787 3726773 . - 0 ID=BALIOE_18825;Name=hypothetical protein;locus_tag=BALIOE_18825;product=hypothetical protein;Parent=BALIOE_18825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7543 c1 Prodigal gene 3726733 3727302 . - . ID=BALIOE_18830_gene;locus_tag=BALIOE_18830 | |
| 7544 c1 Prodigal CDS 3726733 3727302 . - 0 ID=BALIOE_18830;Name=hypothetical protein;locus_tag=BALIOE_18830;product=hypothetical protein;Parent=BALIOE_18830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7545 c1 Prodigal gene 3727375 3727608 . - . ID=BALIOE_18835_gene;locus_tag=BALIOE_18835 | |
| 7546 c1 Prodigal CDS 3727375 3727608 . - 0 ID=BALIOE_18835;Name=hypothetical protein;locus_tag=BALIOE_18835;product=hypothetical protein;Parent=BALIOE_18835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7547 c1 Prodigal gene 3727586 3728044 . - . ID=BALIOE_18840_gene;locus_tag=BALIOE_18840 | |
| 7548 c1 Prodigal CDS 3727586 3728044 . - 0 ID=BALIOE_18840;Name=hypothetical protein;locus_tag=BALIOE_18840;product=hypothetical protein;Parent=BALIOE_18840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7549 c1 Prodigal gene 3728034 3729326 . - . ID=BALIOE_18845_gene;locus_tag=BALIOE_18845 | |
| 7550 c1 Prodigal CDS 3728034 3729326 . - 0 ID=BALIOE_18845;Name=hypothetical protein;locus_tag=BALIOE_18845;product=hypothetical protein;Parent=BALIOE_18845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7551 c1 Prodigal gene 3729358 3731418 . - . ID=BALIOE_18850_gene;locus_tag=BALIOE_18850 | |
| 7552 c1 Prodigal CDS 3729358 3731418 . - 0 ID=BALIOE_18850;Name=hypothetical protein;locus_tag=BALIOE_18850;product=hypothetical protein;Parent=BALIOE_18850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7553 c1 Prodigal gene 3731411 3732556 . - . ID=BALIOE_18855_gene;locus_tag=BALIOE_18855 | |
| 7554 c1 Prodigal CDS 3731411 3732556 . - 0 ID=BALIOE_18855;Name=hypothetical protein;locus_tag=BALIOE_18855;product=hypothetical protein;Parent=BALIOE_18855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7555 c1 Prodigal gene 3732561 3734264 . - . ID=BALIOE_18860_gene;locus_tag=BALIOE_18860 | |
| 7556 c1 Prodigal CDS 3732561 3734264 . - 0 ID=BALIOE_18860;Name=hypothetical protein;locus_tag=BALIOE_18860;product=hypothetical protein;Parent=BALIOE_18860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7557 c1 Prodigal gene 3734261 3735010 . - . ID=BALIOE_18865_gene;locus_tag=BALIOE_18865 | |
| 7558 c1 Prodigal CDS 3734261 3735010 . - 0 ID=BALIOE_18865;Name=hypothetical protein;locus_tag=BALIOE_18865;product=hypothetical protein;Parent=BALIOE_18865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7559 c1 Prodigal gene 3735356 3735535 . - . ID=BALIOE_18870_gene;locus_tag=BALIOE_18870 | |
| 7560 c1 Prodigal CDS 3735356 3735535 . - 0 ID=BALIOE_18870;Name=hypothetical protein;locus_tag=BALIOE_18870;product=hypothetical protein;Parent=BALIOE_18870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7561 c1 Prodigal gene 3735602 3736660 . - . ID=BALIOE_18875_gene;locus_tag=BALIOE_18875 | |
| 7562 c1 Prodigal CDS 3735602 3736660 . - 0 ID=BALIOE_18875;Name=hypothetical protein;locus_tag=BALIOE_18875;product=hypothetical protein;Parent=BALIOE_18875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7563 c1 Prodigal gene 3736644 3737207 . - . ID=BALIOE_18880_gene;locus_tag=BALIOE_18880 | |
| 7564 c1 Prodigal CDS 3736644 3737207 . - 0 ID=BALIOE_18880;Name=hypothetical protein;locus_tag=BALIOE_18880;product=hypothetical protein;Parent=BALIOE_18880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7565 c1 tRNAscan-SE gene 3737441 3737514 . - . ID=BALIOE_18885_gene;locus_tag=BALIOE_18885;gene=Gly_trna | |
| 7566 c1 tRNAscan-SE tRNA 3737441 3737514 . - . ID=BALIOE_18885;Name=tRNA-Gly;locus_tag=BALIOE_18885;product=tRNA-Gly;gene=Gly_trna;Parent=BALIOE_18885_gene;inference=profile:tRNAscan:2.0;Note=SO:0000260 | |
| 7567 c1 Prodigal gene 3737593 3738348 . - . ID=BALIOE_18890_gene;locus_tag=BALIOE_18890 | |
| 7568 c1 Prodigal CDS 3737593 3738348 . - 0 ID=BALIOE_18890;Name=hypothetical protein;locus_tag=BALIOE_18890;product=hypothetical protein;Parent=BALIOE_18890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7569 c1 Prodigal gene 3738764 3741061 . + . ID=BALIOE_18895_gene;locus_tag=BALIOE_18895 | |
| 7570 c1 Prodigal CDS 3738764 3741061 . + 0 ID=BALIOE_18895;Name=hypothetical protein;locus_tag=BALIOE_18895;product=hypothetical protein;Parent=BALIOE_18895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7571 c1 Prodigal gene 3741072 3741950 . + . ID=BALIOE_18900_gene;locus_tag=BALIOE_18900 | |
| 7572 c1 Prodigal CDS 3741072 3741950 . + 0 ID=BALIOE_18900;Name=hypothetical protein;locus_tag=BALIOE_18900;product=hypothetical protein;Parent=BALIOE_18900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7573 c1 Prodigal gene 3741947 3742426 . + . ID=BALIOE_18905_gene;locus_tag=BALIOE_18905 | |
| 7574 c1 Prodigal CDS 3741947 3742426 . + 0 ID=BALIOE_18905;Name=hypothetical protein;locus_tag=BALIOE_18905;product=hypothetical protein;Parent=BALIOE_18905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7575 c1 Prodigal gene 3742466 3744244 . - . ID=BALIOE_18910_gene;locus_tag=BALIOE_18910 | |
| 7576 c1 Prodigal CDS 3742466 3744244 . - 0 ID=BALIOE_18910;Name=hypothetical protein;locus_tag=BALIOE_18910;product=hypothetical protein;Parent=BALIOE_18910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7577 c1 Prodigal gene 3744723 3745910 . + . ID=BALIOE_18915_gene;locus_tag=BALIOE_18915 | |
| 7578 c1 Prodigal CDS 3744723 3745910 . + 0 ID=BALIOE_18915;Name=hypothetical protein;locus_tag=BALIOE_18915;product=hypothetical protein;Parent=BALIOE_18915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7579 c1 Prodigal gene 3745968 3747164 . + . ID=BALIOE_18920_gene;locus_tag=BALIOE_18920 | |
| 7580 c1 Prodigal CDS 3745968 3747164 . + 0 ID=BALIOE_18920;Name=hypothetical protein;locus_tag=BALIOE_18920;product=hypothetical protein;Parent=BALIOE_18920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7581 c1 Prodigal gene 3747222 3748433 . + . ID=BALIOE_18925_gene;locus_tag=BALIOE_18925 | |
| 7582 c1 Prodigal CDS 3747222 3748433 . + 0 ID=BALIOE_18925;Name=hypothetical protein;locus_tag=BALIOE_18925;product=hypothetical protein;Parent=BALIOE_18925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7583 c1 Prodigal gene 3748486 3749871 . + . ID=BALIOE_18930_gene;locus_tag=BALIOE_18930 | |
| 7584 c1 Prodigal CDS 3748486 3749871 . + 0 ID=BALIOE_18930;Name=hypothetical protein;locus_tag=BALIOE_18930;product=hypothetical protein;Parent=BALIOE_18930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7585 c1 Prodigal gene 3749919 3750851 . + . ID=BALIOE_18935_gene;locus_tag=BALIOE_18935 | |
| 7586 c1 Prodigal CDS 3749919 3750851 . + 0 ID=BALIOE_18935;Name=hypothetical protein;locus_tag=BALIOE_18935;product=hypothetical protein;Parent=BALIOE_18935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7587 c1 Prodigal gene 3750892 3752517 . - . ID=BALIOE_18940_gene;locus_tag=BALIOE_18940 | |
| 7588 c1 Prodigal CDS 3750892 3752517 . - 0 ID=BALIOE_18940;Name=hypothetical protein;locus_tag=BALIOE_18940;product=hypothetical protein;Parent=BALIOE_18940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7589 c1 Prodigal gene 3752565 3753335 . - . ID=BALIOE_18945_gene;locus_tag=BALIOE_18945 | |
| 7590 c1 Prodigal CDS 3752565 3753335 . - 0 ID=BALIOE_18945;Name=hypothetical protein;locus_tag=BALIOE_18945;product=hypothetical protein;Parent=BALIOE_18945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7591 c1 Prodigal gene 3753438 3754016 . + . ID=BALIOE_18950_gene;locus_tag=BALIOE_18950 | |
| 7592 c1 Prodigal CDS 3753438 3754016 . + 0 ID=BALIOE_18950;Name=hypothetical protein;locus_tag=BALIOE_18950;product=hypothetical protein;Parent=BALIOE_18950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7593 c1 Prodigal gene 3754338 3757436 . + . ID=BALIOE_18955_gene;locus_tag=BALIOE_18955 | |
| 7594 c1 Prodigal CDS 3754338 3757436 . + 0 ID=BALIOE_18955;Name=hypothetical protein;locus_tag=BALIOE_18955;product=hypothetical protein;Parent=BALIOE_18955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7595 c1 Prodigal gene 3757439 3758767 . + . ID=BALIOE_18960_gene;locus_tag=BALIOE_18960 | |
| 7596 c1 Prodigal CDS 3757439 3758767 . + 0 ID=BALIOE_18960;Name=hypothetical protein;locus_tag=BALIOE_18960;product=hypothetical protein;Parent=BALIOE_18960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7597 c1 Prodigal gene 3758817 3759596 . + . ID=BALIOE_18965_gene;locus_tag=BALIOE_18965 | |
| 7598 c1 Prodigal CDS 3758817 3759596 . + 0 ID=BALIOE_18965;Name=hypothetical protein;locus_tag=BALIOE_18965;product=hypothetical protein;Parent=BALIOE_18965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7599 c1 Prodigal gene 3759593 3762463 . + . ID=BALIOE_18970_gene;locus_tag=BALIOE_18970 | |
| 7600 c1 Prodigal CDS 3759593 3762463 . + 0 ID=BALIOE_18970;Name=hypothetical protein;locus_tag=BALIOE_18970;product=hypothetical protein;Parent=BALIOE_18970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7601 c1 Prodigal gene 3762628 3764028 . + . ID=BALIOE_18975_gene;locus_tag=BALIOE_18975 | |
| 7602 c1 Prodigal CDS 3762628 3764028 . + 0 ID=BALIOE_18975;Name=hypothetical protein;locus_tag=BALIOE_18975;product=hypothetical protein;Parent=BALIOE_18975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7603 c1 Prodigal gene 3764046 3765362 . + . ID=BALIOE_18980_gene;locus_tag=BALIOE_18980 | |
| 7604 c1 Prodigal CDS 3764046 3765362 . + 0 ID=BALIOE_18980;Name=hypothetical protein;locus_tag=BALIOE_18980;product=hypothetical protein;Parent=BALIOE_18980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7605 c1 Prodigal gene 3765398 3766765 . + . ID=BALIOE_18985_gene;locus_tag=BALIOE_18985 | |
| 7606 c1 Prodigal CDS 3765398 3766765 . + 0 ID=BALIOE_18985;Name=hypothetical protein;locus_tag=BALIOE_18985;product=hypothetical protein;Parent=BALIOE_18985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7607 c1 Prodigal gene 3766801 3767070 . - . ID=BALIOE_18990_gene;locus_tag=BALIOE_18990 | |
| 7608 c1 Prodigal CDS 3766801 3767070 . - 0 ID=BALIOE_18990;Name=hypothetical protein;locus_tag=BALIOE_18990;product=hypothetical protein;Parent=BALIOE_18990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7609 c1 Prodigal gene 3767289 3769208 . - . ID=BALIOE_18995_gene;locus_tag=BALIOE_18995 | |
| 7610 c1 Prodigal CDS 3767289 3769208 . - 0 ID=BALIOE_18995;Name=hypothetical protein;locus_tag=BALIOE_18995;product=hypothetical protein;Parent=BALIOE_18995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7611 c1 Prodigal gene 3769644 3771092 . + . ID=BALIOE_19000_gene;locus_tag=BALIOE_19000 | |
| 7612 c1 Prodigal CDS 3769644 3771092 . + 0 ID=BALIOE_19000;Name=hypothetical protein;locus_tag=BALIOE_19000;product=hypothetical protein;Parent=BALIOE_19000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7613 c1 Prodigal gene 3771094 3771219 . + . ID=BALIOE_19005_gene;locus_tag=BALIOE_19005 | |
| 7614 c1 Prodigal CDS 3771094 3771219 . + 0 ID=BALIOE_19005;Name=hypothetical protein;locus_tag=BALIOE_19005;product=hypothetical protein;Parent=BALIOE_19005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7615 c1 Prodigal gene 3771342 3771890 . + . ID=BALIOE_19010_gene;locus_tag=BALIOE_19010 | |
| 7616 c1 Prodigal CDS 3771342 3771890 . + 0 ID=BALIOE_19010;Name=hypothetical protein;locus_tag=BALIOE_19010;product=hypothetical protein;Parent=BALIOE_19010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7617 c1 Prodigal gene 3771933 3773450 . - . ID=BALIOE_19015_gene;locus_tag=BALIOE_19015 | |
| 7618 c1 Prodigal CDS 3771933 3773450 . - 0 ID=BALIOE_19015;Name=hypothetical protein;locus_tag=BALIOE_19015;product=hypothetical protein;Parent=BALIOE_19015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7619 c1 Prodigal gene 3773460 3774341 . - . ID=BALIOE_19020_gene;locus_tag=BALIOE_19020 | |
| 7620 c1 Prodigal CDS 3773460 3774341 . - 0 ID=BALIOE_19020;Name=hypothetical protein;locus_tag=BALIOE_19020;product=hypothetical protein;Parent=BALIOE_19020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7621 c1 Prodigal gene 3774649 3776382 . - . ID=BALIOE_19025_gene;locus_tag=BALIOE_19025 | |
| 7622 c1 Prodigal CDS 3774649 3776382 . - 0 ID=BALIOE_19025;Name=hypothetical protein;locus_tag=BALIOE_19025;product=hypothetical protein;Parent=BALIOE_19025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7623 c1 Prodigal gene 3776388 3777098 . - . ID=BALIOE_19030_gene;locus_tag=BALIOE_19030 | |
| 7624 c1 Prodigal CDS 3776388 3777098 . - 0 ID=BALIOE_19030;Name=hypothetical protein;locus_tag=BALIOE_19030;product=hypothetical protein;Parent=BALIOE_19030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7625 c1 Prodigal gene 3777123 3778019 . - . ID=BALIOE_19035_gene;locus_tag=BALIOE_19035 | |
| 7626 c1 Prodigal CDS 3777123 3778019 . - 0 ID=BALIOE_19035;Name=hypothetical protein;locus_tag=BALIOE_19035;product=hypothetical protein;Parent=BALIOE_19035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7627 c1 Prodigal gene 3778131 3778652 . + . ID=BALIOE_19040_gene;locus_tag=BALIOE_19040 | |
| 7628 c1 Prodigal CDS 3778131 3778652 . + 0 ID=BALIOE_19040;Name=hypothetical protein;locus_tag=BALIOE_19040;product=hypothetical protein;Parent=BALIOE_19040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7629 c1 Prodigal gene 3778692 3779099 . - . ID=BALIOE_19045_gene;locus_tag=BALIOE_19045 | |
| 7630 c1 Prodigal CDS 3778692 3779099 . - 0 ID=BALIOE_19045;Name=hypothetical protein;locus_tag=BALIOE_19045;product=hypothetical protein;Parent=BALIOE_19045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7631 c1 Prodigal gene 3779080 3779346 . - . ID=BALIOE_19050_gene;locus_tag=BALIOE_19050 | |
| 7632 c1 Prodigal CDS 3779080 3779346 . - 0 ID=BALIOE_19050;Name=hypothetical protein;locus_tag=BALIOE_19050;product=hypothetical protein;Parent=BALIOE_19050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7633 c1 Prodigal gene 3779589 3780569 . + . ID=BALIOE_19055_gene;locus_tag=BALIOE_19055 | |
| 7634 c1 Prodigal CDS 3779589 3780569 . + 0 ID=BALIOE_19055;Name=hypothetical protein;locus_tag=BALIOE_19055;product=hypothetical protein;Parent=BALIOE_19055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7635 c1 Prodigal gene 3780646 3781305 . - . ID=BALIOE_19060_gene;locus_tag=BALIOE_19060 | |
| 7636 c1 Prodigal CDS 3780646 3781305 . - 0 ID=BALIOE_19060;Name=hypothetical protein;locus_tag=BALIOE_19060;product=hypothetical protein;Parent=BALIOE_19060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7637 c1 Prodigal gene 3781469 3781780 . - . ID=BALIOE_19065_gene;locus_tag=BALIOE_19065 | |
| 7638 c1 Prodigal CDS 3781469 3781780 . - 0 ID=BALIOE_19065;Name=hypothetical protein;locus_tag=BALIOE_19065;product=hypothetical protein;Parent=BALIOE_19065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7639 c1 Prodigal gene 3781825 3783258 . + . ID=BALIOE_19070_gene;locus_tag=BALIOE_19070 | |
| 7640 c1 Prodigal CDS 3781825 3783258 . + 0 ID=BALIOE_19070;Name=hypothetical protein;locus_tag=BALIOE_19070;product=hypothetical protein;Parent=BALIOE_19070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7641 c1 Prodigal gene 3783424 3786297 . - . ID=BALIOE_19075_gene;locus_tag=BALIOE_19075 | |
| 7642 c1 Prodigal CDS 3783424 3786297 . - 0 ID=BALIOE_19075;Name=hypothetical protein;locus_tag=BALIOE_19075;product=hypothetical protein;Parent=BALIOE_19075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7643 c1 Prodigal gene 3786415 3786804 . - . ID=BALIOE_19080_gene;locus_tag=BALIOE_19080 | |
| 7644 c1 Prodigal CDS 3786415 3786804 . - 0 ID=BALIOE_19080;Name=hypothetical protein;locus_tag=BALIOE_19080;product=hypothetical protein;Parent=BALIOE_19080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7645 c1 Prodigal gene 3786828 3787922 . - . ID=BALIOE_19085_gene;locus_tag=BALIOE_19085 | |
| 7646 c1 Prodigal CDS 3786828 3787922 . - 0 ID=BALIOE_19085;Name=hypothetical protein;locus_tag=BALIOE_19085;product=hypothetical protein;Parent=BALIOE_19085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7647 c1 Prodigal gene 3788370 3789572 . - . ID=BALIOE_19090_gene;locus_tag=BALIOE_19090 | |
| 7648 c1 Prodigal CDS 3788370 3789572 . - 0 ID=BALIOE_19090;Name=hypothetical protein;locus_tag=BALIOE_19090;product=hypothetical protein;Parent=BALIOE_19090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7649 c1 Prodigal gene 3789596 3790774 . - . ID=BALIOE_19095_gene;locus_tag=BALIOE_19095 | |
| 7650 c1 Prodigal CDS 3789596 3790774 . - 0 ID=BALIOE_19095;Name=hypothetical protein;locus_tag=BALIOE_19095;product=hypothetical protein;Parent=BALIOE_19095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7651 c1 Prodigal gene 3790771 3792096 . - . ID=BALIOE_19100_gene;locus_tag=BALIOE_19100 | |
| 7652 c1 Prodigal CDS 3790771 3792096 . - 0 ID=BALIOE_19100;Name=hypothetical protein;locus_tag=BALIOE_19100;product=hypothetical protein;Parent=BALIOE_19100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7653 c1 Prodigal gene 3792122 3792700 . - . ID=BALIOE_19105_gene;locus_tag=BALIOE_19105 | |
| 7654 c1 Prodigal CDS 3792122 3792700 . - 0 ID=BALIOE_19105;Name=hypothetical protein;locus_tag=BALIOE_19105;product=hypothetical protein;Parent=BALIOE_19105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7655 c1 Prodigal gene 3792868 3793197 . + . ID=BALIOE_19110_gene;locus_tag=BALIOE_19110 | |
| 7656 c1 Prodigal CDS 3792868 3793197 . + 0 ID=BALIOE_19110;Name=hypothetical protein;locus_tag=BALIOE_19110;product=hypothetical protein;Parent=BALIOE_19110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7657 c1 Prodigal gene 3793443 3794045 . + . ID=BALIOE_19115_gene;locus_tag=BALIOE_19115 | |
| 7658 c1 Prodigal CDS 3793443 3794045 . + 0 ID=BALIOE_19115;Name=hypothetical protein;locus_tag=BALIOE_19115;product=hypothetical protein;Parent=BALIOE_19115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7659 c1 Prodigal gene 3794827 3796059 . - . ID=BALIOE_19120_gene;locus_tag=BALIOE_19120 | |
| 7660 c1 Prodigal CDS 3794827 3796059 . - 0 ID=BALIOE_19120;Name=hypothetical protein;locus_tag=BALIOE_19120;product=hypothetical protein;Parent=BALIOE_19120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7661 c1 Prodigal gene 3796314 3796973 . - . ID=BALIOE_19125_gene;locus_tag=BALIOE_19125 | |
| 7662 c1 Prodigal CDS 3796314 3796973 . - 0 ID=BALIOE_19125;Name=hypothetical protein;locus_tag=BALIOE_19125;product=hypothetical protein;Parent=BALIOE_19125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7663 c1 Prodigal gene 3797356 3798249 . + . ID=BALIOE_19130_gene;locus_tag=BALIOE_19130 | |
| 7664 c1 Prodigal CDS 3797356 3798249 . + 0 ID=BALIOE_19130;Name=hypothetical protein;locus_tag=BALIOE_19130;product=hypothetical protein;Parent=BALIOE_19130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7665 c1 Prodigal gene 3798453 3800597 . + . ID=BALIOE_19135_gene;locus_tag=BALIOE_19135 | |
| 7666 c1 Prodigal CDS 3798453 3800597 . + 0 ID=BALIOE_19135;Name=hypothetical protein;locus_tag=BALIOE_19135;product=hypothetical protein;Parent=BALIOE_19135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7667 c1 Prodigal gene 3800590 3801585 . + . ID=BALIOE_19140_gene;locus_tag=BALIOE_19140 | |
| 7668 c1 Prodigal CDS 3800590 3801585 . + 0 ID=BALIOE_19140;Name=hypothetical protein;locus_tag=BALIOE_19140;product=hypothetical protein;Parent=BALIOE_19140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7669 c1 Prodigal gene 3801596 3802381 . + . ID=BALIOE_19145_gene;locus_tag=BALIOE_19145 | |
| 7670 c1 Prodigal CDS 3801596 3802381 . + 0 ID=BALIOE_19145;Name=hypothetical protein;locus_tag=BALIOE_19145;product=hypothetical protein;Parent=BALIOE_19145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7671 c1 Prodigal gene 3802405 3803883 . + . ID=BALIOE_19150_gene;locus_tag=BALIOE_19150 | |
| 7672 c1 Prodigal CDS 3802405 3803883 . + 0 ID=BALIOE_19150;Name=hypothetical protein;locus_tag=BALIOE_19150;product=hypothetical protein;Parent=BALIOE_19150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7673 c1 Prodigal gene 3803880 3804191 . - . ID=BALIOE_19155_gene;locus_tag=BALIOE_19155 | |
| 7674 c1 Prodigal CDS 3803880 3804191 . - 0 ID=BALIOE_19155;Name=hypothetical protein;locus_tag=BALIOE_19155;product=hypothetical protein;Parent=BALIOE_19155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7675 c1 Prodigal gene 3804198 3804776 . - . ID=BALIOE_19160_gene;locus_tag=BALIOE_19160 | |
| 7676 c1 Prodigal CDS 3804198 3804776 . - 0 ID=BALIOE_19160;Name=hypothetical protein;locus_tag=BALIOE_19160;product=hypothetical protein;Parent=BALIOE_19160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7677 c1 Prodigal gene 3804943 3805683 . - . ID=BALIOE_19165_gene;locus_tag=BALIOE_19165 | |
| 7678 c1 Prodigal CDS 3804943 3805683 . - 0 ID=BALIOE_19165;Name=hypothetical protein;locus_tag=BALIOE_19165;product=hypothetical protein;Parent=BALIOE_19165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7679 c1 Prodigal gene 3805776 3806411 . - . ID=BALIOE_19170_gene;locus_tag=BALIOE_19170 | |
| 7680 c1 Prodigal CDS 3805776 3806411 . - 0 ID=BALIOE_19170;Name=hypothetical protein;locus_tag=BALIOE_19170;product=hypothetical protein;Parent=BALIOE_19170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7681 c1 Prodigal gene 3806550 3807410 . - . ID=BALIOE_19175_gene;locus_tag=BALIOE_19175 | |
| 7682 c1 Prodigal CDS 3806550 3807410 . - 0 ID=BALIOE_19175;Name=hypothetical protein;locus_tag=BALIOE_19175;product=hypothetical protein;Parent=BALIOE_19175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7683 c1 Prodigal gene 3807768 3808847 . - . ID=BALIOE_19180_gene;locus_tag=BALIOE_19180 | |
| 7684 c1 Prodigal CDS 3807768 3808847 . - 0 ID=BALIOE_19180;Name=hypothetical protein;locus_tag=BALIOE_19180;product=hypothetical protein;Parent=BALIOE_19180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7685 c1 Prodigal gene 3809062 3810225 . - . ID=BALIOE_19185_gene;locus_tag=BALIOE_19185 | |
| 7686 c1 Prodigal CDS 3809062 3810225 . - 0 ID=BALIOE_19185;Name=hypothetical protein;locus_tag=BALIOE_19185;product=hypothetical protein;Parent=BALIOE_19185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7687 c1 Prodigal gene 3810275 3811294 . - . ID=BALIOE_19190_gene;locus_tag=BALIOE_19190 | |
| 7688 c1 Prodigal CDS 3810275 3811294 . - 0 ID=BALIOE_19190;Name=hypothetical protein;locus_tag=BALIOE_19190;product=hypothetical protein;Parent=BALIOE_19190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7689 c1 Prodigal gene 3811666 3812097 . + . ID=BALIOE_19195_gene;locus_tag=BALIOE_19195 | |
| 7690 c1 Prodigal CDS 3811666 3812097 . + 0 ID=BALIOE_19195;Name=hypothetical protein;locus_tag=BALIOE_19195;product=hypothetical protein;Parent=BALIOE_19195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7691 c1 Prodigal gene 3812120 3812698 . + . ID=BALIOE_19200_gene;locus_tag=BALIOE_19200 | |
| 7692 c1 Prodigal CDS 3812120 3812698 . + 0 ID=BALIOE_19200;Name=hypothetical protein;locus_tag=BALIOE_19200;product=hypothetical protein;Parent=BALIOE_19200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7693 c1 Prodigal gene 3812699 3813406 . + . ID=BALIOE_19205_gene;locus_tag=BALIOE_19205 | |
| 7694 c1 Prodigal CDS 3812699 3813406 . + 0 ID=BALIOE_19205;Name=hypothetical protein;locus_tag=BALIOE_19205;product=hypothetical protein;Parent=BALIOE_19205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7695 c1 Prodigal gene 3813394 3814071 . + . ID=BALIOE_19210_gene;locus_tag=BALIOE_19210 | |
| 7696 c1 Prodigal CDS 3813394 3814071 . + 0 ID=BALIOE_19210;Name=hypothetical protein;locus_tag=BALIOE_19210;product=hypothetical protein;Parent=BALIOE_19210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7697 c1 Prodigal gene 3814065 3814742 . + . ID=BALIOE_19215_gene;locus_tag=BALIOE_19215 | |
| 7698 c1 Prodigal CDS 3814065 3814742 . + 0 ID=BALIOE_19215;Name=hypothetical protein;locus_tag=BALIOE_19215;product=hypothetical protein;Parent=BALIOE_19215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7699 c1 Prodigal gene 3814714 3815427 . - . ID=BALIOE_19220_gene;locus_tag=BALIOE_19220 | |
| 7700 c1 Prodigal CDS 3814714 3815427 . - 0 ID=BALIOE_19220;Name=hypothetical protein;locus_tag=BALIOE_19220;product=hypothetical protein;Parent=BALIOE_19220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7701 c1 Prodigal gene 3815424 3815933 . - . ID=BALIOE_19225_gene;locus_tag=BALIOE_19225 | |
| 7702 c1 Prodigal CDS 3815424 3815933 . - 0 ID=BALIOE_19225;Name=hypothetical protein;locus_tag=BALIOE_19225;product=hypothetical protein;Parent=BALIOE_19225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7703 c1 Prodigal gene 3815955 3816920 . - . ID=BALIOE_19230_gene;locus_tag=BALIOE_19230 | |
| 7704 c1 Prodigal CDS 3815955 3816920 . - 0 ID=BALIOE_19230;Name=hypothetical protein;locus_tag=BALIOE_19230;product=hypothetical protein;Parent=BALIOE_19230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7705 c1 Prodigal gene 3816917 3818194 . - . ID=BALIOE_19235_gene;locus_tag=BALIOE_19235 | |
| 7706 c1 Prodigal CDS 3816917 3818194 . - 0 ID=BALIOE_19235;Name=hypothetical protein;locus_tag=BALIOE_19235;product=hypothetical protein;Parent=BALIOE_19235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7707 c1 Prodigal gene 3818209 3819597 . - . ID=BALIOE_19240_gene;locus_tag=BALIOE_19240 | |
| 7708 c1 Prodigal CDS 3818209 3819597 . - 0 ID=BALIOE_19240;Name=hypothetical protein;locus_tag=BALIOE_19240;product=hypothetical protein;Parent=BALIOE_19240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7709 c1 Prodigal gene 3819625 3820068 . - . ID=BALIOE_19245_gene;locus_tag=BALIOE_19245 | |
| 7710 c1 Prodigal CDS 3819625 3820068 . - 0 ID=BALIOE_19245;Name=hypothetical protein;locus_tag=BALIOE_19245;product=hypothetical protein;Parent=BALIOE_19245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7711 c1 Prodigal gene 3820382 3822373 . - . ID=BALIOE_19250_gene;locus_tag=BALIOE_19250 | |
| 7712 c1 Prodigal CDS 3820382 3822373 . - 0 ID=BALIOE_19250;Name=hypothetical protein;locus_tag=BALIOE_19250;product=hypothetical protein;Parent=BALIOE_19250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7713 c1 Prodigal gene 3822651 3823409 . + . ID=BALIOE_19255_gene;locus_tag=BALIOE_19255 | |
| 7714 c1 Prodigal CDS 3822651 3823409 . + 0 ID=BALIOE_19255;Name=hypothetical protein;locus_tag=BALIOE_19255;product=hypothetical protein;Parent=BALIOE_19255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7715 c1 Prodigal gene 3823615 3824535 . - . ID=BALIOE_19260_gene;locus_tag=BALIOE_19260 | |
| 7716 c1 Prodigal CDS 3823615 3824535 . - 0 ID=BALIOE_19260;Name=hypothetical protein;locus_tag=BALIOE_19260;product=hypothetical protein;Parent=BALIOE_19260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7717 c1 Prodigal gene 3824671 3825402 . - . ID=BALIOE_19265_gene;locus_tag=BALIOE_19265 | |
| 7718 c1 Prodigal CDS 3824671 3825402 . - 0 ID=BALIOE_19265;Name=hypothetical protein;locus_tag=BALIOE_19265;product=hypothetical protein;Parent=BALIOE_19265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7719 c1 Prodigal gene 3825548 3827524 . - . ID=BALIOE_19270_gene;locus_tag=BALIOE_19270 | |
| 7720 c1 Prodigal CDS 3825548 3827524 . - 0 ID=BALIOE_19270;Name=hypothetical protein;locus_tag=BALIOE_19270;product=hypothetical protein;Parent=BALIOE_19270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7721 c1 Prodigal gene 3828012 3828263 . - . ID=BALIOE_19275_gene;locus_tag=BALIOE_19275 | |
| 7722 c1 Prodigal CDS 3828012 3828263 . - 0 ID=BALIOE_19275;Name=hypothetical protein;locus_tag=BALIOE_19275;product=hypothetical protein;Parent=BALIOE_19275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7723 c1 Prodigal gene 3828319 3829473 . + . ID=BALIOE_19280_gene;locus_tag=BALIOE_19280 | |
| 7724 c1 Prodigal CDS 3828319 3829473 . + 0 ID=BALIOE_19280;Name=hypothetical protein;locus_tag=BALIOE_19280;product=hypothetical protein;Parent=BALIOE_19280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7725 c1 Prodigal gene 3829910 3831304 . + . ID=BALIOE_19285_gene;locus_tag=BALIOE_19285 | |
| 7726 c1 Prodigal CDS 3829910 3831304 . + 0 ID=BALIOE_19285;Name=hypothetical protein;locus_tag=BALIOE_19285;product=hypothetical protein;Parent=BALIOE_19285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7727 c1 Prodigal gene 3831423 3831878 . + . ID=BALIOE_19290_gene;locus_tag=BALIOE_19290 | |
| 7728 c1 Prodigal CDS 3831423 3831878 . + 0 ID=BALIOE_19290;Name=hypothetical protein;locus_tag=BALIOE_19290;product=hypothetical protein;Parent=BALIOE_19290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7729 c1 Prodigal gene 3831973 3832680 . + . ID=BALIOE_19295_gene;locus_tag=BALIOE_19295 | |
| 7730 c1 Prodigal CDS 3831973 3832680 . + 0 ID=BALIOE_19295;Name=hypothetical protein;locus_tag=BALIOE_19295;product=hypothetical protein;Parent=BALIOE_19295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7731 c1 Prodigal gene 3832760 3833491 . + . ID=BALIOE_19300_gene;locus_tag=BALIOE_19300 | |
| 7732 c1 Prodigal CDS 3832760 3833491 . + 0 ID=BALIOE_19300;Name=hypothetical protein;locus_tag=BALIOE_19300;product=hypothetical protein;Parent=BALIOE_19300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7733 c1 Prodigal gene 3833504 3834451 . + . ID=BALIOE_19305_gene;locus_tag=BALIOE_19305 | |
| 7734 c1 Prodigal CDS 3833504 3834451 . + 0 ID=BALIOE_19305;Name=hypothetical protein;locus_tag=BALIOE_19305;product=hypothetical protein;Parent=BALIOE_19305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7735 c1 Prodigal gene 3834491 3835126 . + . ID=BALIOE_19310_gene;locus_tag=BALIOE_19310 | |
| 7736 c1 Prodigal CDS 3834491 3835126 . + 0 ID=BALIOE_19310;Name=hypothetical protein;locus_tag=BALIOE_19310;product=hypothetical protein;Parent=BALIOE_19310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7737 c1 Prodigal gene 3835126 3835542 . + . ID=BALIOE_19315_gene;locus_tag=BALIOE_19315 | |
| 7738 c1 Prodigal CDS 3835126 3835542 . + 0 ID=BALIOE_19315;Name=hypothetical protein;locus_tag=BALIOE_19315;product=hypothetical protein;Parent=BALIOE_19315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7739 c1 Prodigal gene 3835733 3836713 . - . ID=BALIOE_19320_gene;locus_tag=BALIOE_19320 | |
| 7740 c1 Prodigal CDS 3835733 3836713 . - 0 ID=BALIOE_19320;Name=hypothetical protein;locus_tag=BALIOE_19320;product=hypothetical protein;Parent=BALIOE_19320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7741 c1 Prodigal gene 3836731 3837435 . + . ID=BALIOE_19325_gene;locus_tag=BALIOE_19325 | |
| 7742 c1 Prodigal CDS 3836731 3837435 . + 0 ID=BALIOE_19325;Name=hypothetical protein;locus_tag=BALIOE_19325;product=hypothetical protein;Parent=BALIOE_19325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7743 c1 Prodigal gene 3837453 3838019 . + . ID=BALIOE_19330_gene;locus_tag=BALIOE_19330 | |
| 7744 c1 Prodigal CDS 3837453 3838019 . + 0 ID=BALIOE_19330;Name=hypothetical protein;locus_tag=BALIOE_19330;product=hypothetical protein;Parent=BALIOE_19330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7745 c1 Prodigal gene 3838016 3838306 . + . ID=BALIOE_19335_gene;locus_tag=BALIOE_19335 | |
| 7746 c1 Prodigal CDS 3838016 3838306 . + 0 ID=BALIOE_19335;Name=hypothetical protein;locus_tag=BALIOE_19335;product=hypothetical protein;Parent=BALIOE_19335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7747 c1 Prodigal gene 3838314 3838907 . + . ID=BALIOE_19340_gene;locus_tag=BALIOE_19340 | |
| 7748 c1 Prodigal CDS 3838314 3838907 . + 0 ID=BALIOE_19340;Name=hypothetical protein;locus_tag=BALIOE_19340;product=hypothetical protein;Parent=BALIOE_19340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7749 c1 Prodigal gene 3838900 3840036 . + . ID=BALIOE_19345_gene;locus_tag=BALIOE_19345 | |
| 7750 c1 Prodigal CDS 3838900 3840036 . + 0 ID=BALIOE_19345;Name=hypothetical protein;locus_tag=BALIOE_19345;product=hypothetical protein;Parent=BALIOE_19345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7751 c1 Infernal gene 3840097 3840167 . - . ID=BALIOE_19350_gene;locus_tag=BALIOE_19350;gene=naRNA4 | |
| 7752 c1 Infernal ncRNA 3840097 3840167 9e-09 - . ID=BALIOE_19350;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_19350;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_19350_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 7753 c1 Prodigal gene 3840279 3841286 . - . ID=BALIOE_19355_gene;locus_tag=BALIOE_19355 | |
| 7754 c1 Prodigal CDS 3840279 3841286 . - 0 ID=BALIOE_19355;Name=hypothetical protein;locus_tag=BALIOE_19355;product=hypothetical protein;Parent=BALIOE_19355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7755 c1 Prodigal gene 3841403 3842449 . - . ID=BALIOE_19360_gene;locus_tag=BALIOE_19360 | |
| 7756 c1 Prodigal CDS 3841403 3842449 . - 0 ID=BALIOE_19360;Name=hypothetical protein;locus_tag=BALIOE_19360;product=hypothetical protein;Parent=BALIOE_19360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7757 c1 Prodigal gene 3842625 3843344 . - . ID=BALIOE_19365_gene;locus_tag=BALIOE_19365 | |
| 7758 c1 Prodigal CDS 3842625 3843344 . - 0 ID=BALIOE_19365;Name=hypothetical protein;locus_tag=BALIOE_19365;product=hypothetical protein;Parent=BALIOE_19365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7759 c1 Prodigal gene 3843528 3843854 . - . ID=BALIOE_19370_gene;locus_tag=BALIOE_19370 | |
| 7760 c1 Prodigal CDS 3843528 3843854 . - 0 ID=BALIOE_19370;Name=hypothetical protein;locus_tag=BALIOE_19370;product=hypothetical protein;Parent=BALIOE_19370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7761 c1 Prodigal gene 3843854 3844573 . - . ID=BALIOE_19375_gene;locus_tag=BALIOE_19375 | |
| 7762 c1 Prodigal CDS 3843854 3844573 . - 0 ID=BALIOE_19375;Name=hypothetical protein;locus_tag=BALIOE_19375;product=hypothetical protein;Parent=BALIOE_19375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7763 c1 Prodigal gene 3844734 3845786 . + . ID=BALIOE_19380_gene;locus_tag=BALIOE_19380 | |
| 7764 c1 Prodigal CDS 3844734 3845786 . + 0 ID=BALIOE_19380;Name=hypothetical protein;locus_tag=BALIOE_19380;product=hypothetical protein;Parent=BALIOE_19380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7765 c1 Prodigal gene 3845814 3846089 . + . ID=BALIOE_19385_gene;locus_tag=BALIOE_19385 | |
| 7766 c1 Prodigal CDS 3845814 3846089 . + 0 ID=BALIOE_19385;Name=hypothetical protein;locus_tag=BALIOE_19385;product=hypothetical protein;Parent=BALIOE_19385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7767 c1 Prodigal gene 3846154 3847233 . + . ID=BALIOE_19390_gene;locus_tag=BALIOE_19390 | |
| 7768 c1 Prodigal CDS 3846154 3847233 . + 0 ID=BALIOE_19390;Name=hypothetical protein;locus_tag=BALIOE_19390;product=hypothetical protein;Parent=BALIOE_19390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7769 c1 Prodigal gene 3847435 3848691 . + . ID=BALIOE_19395_gene;locus_tag=BALIOE_19395 | |
| 7770 c1 Prodigal CDS 3847435 3848691 . + 0 ID=BALIOE_19395;Name=hypothetical protein;locus_tag=BALIOE_19395;product=hypothetical protein;Parent=BALIOE_19395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7771 c1 Prodigal gene 3848741 3850876 . - . ID=BALIOE_19400_gene;locus_tag=BALIOE_19400 | |
| 7772 c1 Prodigal CDS 3848741 3850876 . - 0 ID=BALIOE_19400;Name=hypothetical protein;locus_tag=BALIOE_19400;product=hypothetical protein;Parent=BALIOE_19400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7773 c1 Prodigal gene 3851274 3851981 . + . ID=BALIOE_19405_gene;locus_tag=BALIOE_19405 | |
| 7774 c1 Prodigal CDS 3851274 3851981 . + 0 ID=BALIOE_19405;Name=hypothetical protein;locus_tag=BALIOE_19405;product=hypothetical protein;Parent=BALIOE_19405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7775 c1 tRNAscan-SE gene 3852087 3852162 . + . ID=BALIOE_19410_gene;locus_tag=BALIOE_19410;gene=Phe_trna | |
| 7776 c1 tRNAscan-SE tRNA 3852087 3852162 . + . ID=BALIOE_19410;Name=tRNA-Phe;locus_tag=BALIOE_19410;product=tRNA-Phe;gene=Phe_trna;Parent=BALIOE_19410_gene;inference=profile:tRNAscan:2.0;Note=SO:0000267 | |
| 7777 c1 Prodigal gene 3852360 3853625 . + . ID=BALIOE_19415_gene;locus_tag=BALIOE_19415 | |
| 7778 c1 Prodigal CDS 3852360 3853625 . + 0 ID=BALIOE_19415;Name=hypothetical protein;locus_tag=BALIOE_19415;product=hypothetical protein;Parent=BALIOE_19415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7779 c1 Prodigal gene 3853742 3854527 . - . ID=BALIOE_19420_gene;locus_tag=BALIOE_19420 | |
| 7780 c1 Prodigal CDS 3853742 3854527 . - 0 ID=BALIOE_19420;Name=hypothetical protein;locus_tag=BALIOE_19420;product=hypothetical protein;Parent=BALIOE_19420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7781 c1 Prodigal gene 3854616 3855290 . + . ID=BALIOE_19425_gene;locus_tag=BALIOE_19425 | |
| 7782 c1 Prodigal CDS 3854616 3855290 . + 0 ID=BALIOE_19425;Name=hypothetical protein;locus_tag=BALIOE_19425;product=hypothetical protein;Parent=BALIOE_19425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7783 c1 Prodigal gene 3855287 3855634 . + . ID=BALIOE_19430_gene;locus_tag=BALIOE_19430 | |
| 7784 c1 Prodigal CDS 3855287 3855634 . + 0 ID=BALIOE_19430;Name=hypothetical protein;locus_tag=BALIOE_19430;product=hypothetical protein;Parent=BALIOE_19430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7785 c1 Prodigal gene 3855654 3857102 . + . ID=BALIOE_19435_gene;locus_tag=BALIOE_19435 | |
| 7786 c1 Prodigal CDS 3855654 3857102 . + 0 ID=BALIOE_19435;Name=hypothetical protein;locus_tag=BALIOE_19435;product=hypothetical protein;Parent=BALIOE_19435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7787 c1 Prodigal gene 3857956 3858489 . - . ID=BALIOE_19440_gene;locus_tag=BALIOE_19440 | |
| 7788 c1 Prodigal CDS 3857956 3858489 . - 0 ID=BALIOE_19440;Name=hypothetical protein;locus_tag=BALIOE_19440;product=hypothetical protein;Parent=BALIOE_19440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7789 c1 Prodigal gene 3859806 3860696 . + . ID=BALIOE_19445_gene;locus_tag=BALIOE_19445 | |
| 7790 c1 Prodigal CDS 3859806 3860696 . + 0 ID=BALIOE_19445;Name=hypothetical protein;locus_tag=BALIOE_19445;product=hypothetical protein;Parent=BALIOE_19445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7791 c1 Prodigal gene 3861484 3863133 . + . ID=BALIOE_19450_gene;locus_tag=BALIOE_19450 | |
| 7792 c1 Prodigal CDS 3861484 3863133 . + 0 ID=BALIOE_19450;Name=hypothetical protein;locus_tag=BALIOE_19450;product=hypothetical protein;Parent=BALIOE_19450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7793 c1 Prodigal gene 3863741 3864730 . + . ID=BALIOE_19455_gene;locus_tag=BALIOE_19455 | |
| 7794 c1 Prodigal CDS 3863741 3864730 . + 0 ID=BALIOE_19455;Name=hypothetical protein;locus_tag=BALIOE_19455;product=hypothetical protein;Parent=BALIOE_19455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7795 c1 Prodigal gene 3864779 3865453 . + . ID=BALIOE_19460_gene;locus_tag=BALIOE_19460 | |
| 7796 c1 Prodigal CDS 3864779 3865453 . + 0 ID=BALIOE_19460;Name=hypothetical protein;locus_tag=BALIOE_19460;product=hypothetical protein;Parent=BALIOE_19460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7797 c1 Prodigal gene 3865888 3866676 . + . ID=BALIOE_19465_gene;locus_tag=BALIOE_19465 | |
| 7798 c1 Prodigal CDS 3865888 3866676 . + 0 ID=BALIOE_19465;Name=hypothetical protein;locus_tag=BALIOE_19465;product=hypothetical protein;Parent=BALIOE_19465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7799 c1 Prodigal gene 3867328 3868629 . + . ID=BALIOE_19470_gene;locus_tag=BALIOE_19470 | |
| 7800 c1 Prodigal CDS 3867328 3868629 . + 0 ID=BALIOE_19470;Name=hypothetical protein;locus_tag=BALIOE_19470;product=hypothetical protein;Parent=BALIOE_19470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7801 c1 Prodigal gene 3868635 3869462 . + . ID=BALIOE_19475_gene;locus_tag=BALIOE_19475 | |
| 7802 c1 Prodigal CDS 3868635 3869462 . + 0 ID=BALIOE_19475;Name=hypothetical protein;locus_tag=BALIOE_19475;product=hypothetical protein;Parent=BALIOE_19475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7803 c1 Prodigal gene 3869502 3870389 . - . ID=BALIOE_19480_gene;locus_tag=BALIOE_19480 | |
| 7804 c1 Prodigal CDS 3869502 3870389 . - 0 ID=BALIOE_19480;Name=hypothetical protein;locus_tag=BALIOE_19480;product=hypothetical protein;Parent=BALIOE_19480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7805 c1 Prodigal gene 3870389 3870715 . - . ID=BALIOE_19485_gene;locus_tag=BALIOE_19485 | |
| 7806 c1 Prodigal CDS 3870389 3870715 . - 0 ID=BALIOE_19485;Name=hypothetical protein;locus_tag=BALIOE_19485;product=hypothetical protein;Parent=BALIOE_19485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7807 c1 Prodigal gene 3870906 3871253 . + . ID=BALIOE_19490_gene;locus_tag=BALIOE_19490 | |
| 7808 c1 Prodigal CDS 3870906 3871253 . + 0 ID=BALIOE_19490;Name=hypothetical protein;locus_tag=BALIOE_19490;product=hypothetical protein;Parent=BALIOE_19490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7809 c1 Prodigal gene 3871303 3872841 . + . ID=BALIOE_19495_gene;locus_tag=BALIOE_19495 | |
| 7810 c1 Prodigal CDS 3871303 3872841 . + 0 ID=BALIOE_19495;Name=hypothetical protein;locus_tag=BALIOE_19495;product=hypothetical protein;Parent=BALIOE_19495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7811 c1 Prodigal gene 3873064 3873414 . + . ID=BALIOE_19500_gene;locus_tag=BALIOE_19500 | |
| 7812 c1 Prodigal CDS 3873064 3873414 . + 0 ID=BALIOE_19500;Name=hypothetical protein;locus_tag=BALIOE_19500;product=hypothetical protein;Parent=BALIOE_19500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7813 c1 Prodigal gene 3873627 3875030 . + . ID=BALIOE_19505_gene;locus_tag=BALIOE_19505 | |
| 7814 c1 Prodigal CDS 3873627 3875030 . + 0 ID=BALIOE_19505;Name=hypothetical protein;locus_tag=BALIOE_19505;product=hypothetical protein;Parent=BALIOE_19505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7815 c1 Prodigal gene 3875349 3875693 . + . ID=BALIOE_19510_gene;locus_tag=BALIOE_19510 | |
| 7816 c1 Prodigal CDS 3875349 3875693 . + 0 ID=BALIOE_19510;Name=hypothetical protein;locus_tag=BALIOE_19510;product=hypothetical protein;Parent=BALIOE_19510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7817 c1 Prodigal gene 3875536 3876852 . - . ID=BALIOE_19515_gene;locus_tag=BALIOE_19515 | |
| 7818 c1 Prodigal CDS 3875536 3876852 . - 0 ID=BALIOE_19515;Name=hypothetical protein;locus_tag=BALIOE_19515;product=hypothetical protein;Parent=BALIOE_19515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7819 c1 Prodigal gene 3877144 3879003 . - . ID=BALIOE_19520_gene;locus_tag=BALIOE_19520 | |
| 7820 c1 Prodigal CDS 3877144 3879003 . - 0 ID=BALIOE_19520;Name=hypothetical protein;locus_tag=BALIOE_19520;product=hypothetical protein;Parent=BALIOE_19520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7821 c1 Prodigal gene 3879208 3880074 . + . ID=BALIOE_19525_gene;locus_tag=BALIOE_19525 | |
| 7822 c1 Prodigal CDS 3879208 3880074 . + 0 ID=BALIOE_19525;Name=hypothetical protein;locus_tag=BALIOE_19525;product=hypothetical protein;Parent=BALIOE_19525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7823 c1 Infernal gene 3880105 3880181 . + . ID=BALIOE_19530_gene;locus_tag=BALIOE_19530;gene=naRNA4 | |
| 7824 c1 Infernal ncRNA 3880105 3880181 9.7e-13 + . ID=BALIOE_19530;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_19530;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_19530_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 7825 c1 Prodigal gene 3880197 3880445 . - . ID=BALIOE_19535_gene;locus_tag=BALIOE_19535 | |
| 7826 c1 Prodigal CDS 3880197 3880445 . - 0 ID=BALIOE_19535;Name=hypothetical protein;locus_tag=BALIOE_19535;product=hypothetical protein;Parent=BALIOE_19535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7827 c1 Prodigal gene 3880458 3880799 . - . ID=BALIOE_19540_gene;locus_tag=BALIOE_19540 | |
| 7828 c1 Prodigal CDS 3880458 3880799 . - 0 ID=BALIOE_19540;Name=hypothetical protein;locus_tag=BALIOE_19540;product=hypothetical protein;Parent=BALIOE_19540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7829 c1 Prodigal gene 3880792 3881280 . - . ID=BALIOE_19545_gene;locus_tag=BALIOE_19545 | |
| 7830 c1 Prodigal CDS 3880792 3881280 . - 0 ID=BALIOE_19545;Name=hypothetical protein;locus_tag=BALIOE_19545;product=hypothetical protein;Parent=BALIOE_19545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7831 c1 Prodigal gene 3881273 3881767 . - . ID=BALIOE_19550_gene;locus_tag=BALIOE_19550 | |
| 7832 c1 Prodigal CDS 3881273 3881767 . - 0 ID=BALIOE_19550;Name=hypothetical protein;locus_tag=BALIOE_19550;product=hypothetical protein;Parent=BALIOE_19550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7833 c1 Prodigal gene 3881767 3883470 . - . ID=BALIOE_19555_gene;locus_tag=BALIOE_19555 | |
| 7834 c1 Prodigal CDS 3881767 3883470 . - 0 ID=BALIOE_19555;Name=hypothetical protein;locus_tag=BALIOE_19555;product=hypothetical protein;Parent=BALIOE_19555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7835 c1 Prodigal gene 3883467 3884645 . - . ID=BALIOE_19560_gene;locus_tag=BALIOE_19560 | |
| 7836 c1 Prodigal CDS 3883467 3884645 . - 0 ID=BALIOE_19560;Name=hypothetical protein;locus_tag=BALIOE_19560;product=hypothetical protein;Parent=BALIOE_19560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7837 c1 Prodigal gene 3884635 3885621 . - . ID=BALIOE_19565_gene;locus_tag=BALIOE_19565 | |
| 7838 c1 Prodigal CDS 3884635 3885621 . - 0 ID=BALIOE_19565;Name=hypothetical protein;locus_tag=BALIOE_19565;product=hypothetical protein;Parent=BALIOE_19565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7839 c1 Prodigal gene 3885624 3886742 . - . ID=BALIOE_19570_gene;locus_tag=BALIOE_19570 | |
| 7840 c1 Prodigal CDS 3885624 3886742 . - 0 ID=BALIOE_19570;Name=hypothetical protein;locus_tag=BALIOE_19570;product=hypothetical protein;Parent=BALIOE_19570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7841 c1 Prodigal gene 3886931 3887218 . - . ID=BALIOE_19575_gene;locus_tag=BALIOE_19575 | |
| 7842 c1 Prodigal CDS 3886931 3887218 . - 0 ID=BALIOE_19575;Name=hypothetical protein;locus_tag=BALIOE_19575;product=hypothetical protein;Parent=BALIOE_19575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7843 c1 Prodigal gene 3887337 3888224 . - . ID=BALIOE_19580_gene;locus_tag=BALIOE_19580 | |
| 7844 c1 Prodigal CDS 3887337 3888224 . - 0 ID=BALIOE_19580;Name=hypothetical protein;locus_tag=BALIOE_19580;product=hypothetical protein;Parent=BALIOE_19580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7845 c1 Prodigal gene 3888381 3889421 . + . ID=BALIOE_19585_gene;locus_tag=BALIOE_19585 | |
| 7846 c1 Prodigal CDS 3888381 3889421 . + 0 ID=BALIOE_19585;Name=hypothetical protein;locus_tag=BALIOE_19585;product=hypothetical protein;Parent=BALIOE_19585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7847 c1 Prodigal gene 3889461 3889955 . - . ID=BALIOE_19590_gene;locus_tag=BALIOE_19590 | |
| 7848 c1 Prodigal CDS 3889461 3889955 . - 0 ID=BALIOE_19590;Name=hypothetical protein;locus_tag=BALIOE_19590;product=hypothetical protein;Parent=BALIOE_19590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7849 c1 Prodigal gene 3890146 3891030 . + . ID=BALIOE_19595_gene;locus_tag=BALIOE_19595 | |
| 7850 c1 Prodigal CDS 3890146 3891030 . + 0 ID=BALIOE_19595;Name=hypothetical protein;locus_tag=BALIOE_19595;product=hypothetical protein;Parent=BALIOE_19595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7851 c1 Infernal gene 3891154 3891224 . - . ID=BALIOE_19600_gene;locus_tag=BALIOE_19600;gene=naRNA4 | |
| 7852 c1 Infernal ncRNA 3891154 3891224 1.3e-09 - . ID=BALIOE_19600;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_19600;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_19600_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 7853 c1 Prodigal gene 3891302 3891727 . - . ID=BALIOE_19605_gene;locus_tag=BALIOE_19605 | |
| 7854 c1 Prodigal CDS 3891302 3891727 . - 0 ID=BALIOE_19605;Name=hypothetical protein;locus_tag=BALIOE_19605;product=hypothetical protein;Parent=BALIOE_19605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7855 c1 Prodigal gene 3891734 3892468 . - . ID=BALIOE_19610_gene;locus_tag=BALIOE_19610 | |
| 7856 c1 Prodigal CDS 3891734 3892468 . - 0 ID=BALIOE_19610;Name=hypothetical protein;locus_tag=BALIOE_19610;product=hypothetical protein;Parent=BALIOE_19610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7857 c1 Prodigal gene 3892720 3893907 . + . ID=BALIOE_19615_gene;locus_tag=BALIOE_19615 | |
| 7858 c1 Prodigal CDS 3892720 3893907 . + 0 ID=BALIOE_19615;Name=hypothetical protein;locus_tag=BALIOE_19615;product=hypothetical protein;Parent=BALIOE_19615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7859 c1 Prodigal gene 3894047 3894706 . + . ID=BALIOE_19620_gene;locus_tag=BALIOE_19620 | |
| 7860 c1 Prodigal CDS 3894047 3894706 . + 0 ID=BALIOE_19620;Name=hypothetical protein;locus_tag=BALIOE_19620;product=hypothetical protein;Parent=BALIOE_19620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7861 c1 Prodigal gene 3894746 3895702 . - . ID=BALIOE_19625_gene;locus_tag=BALIOE_19625 | |
| 7862 c1 Prodigal CDS 3894746 3895702 . - 0 ID=BALIOE_19625;Name=hypothetical protein;locus_tag=BALIOE_19625;product=hypothetical protein;Parent=BALIOE_19625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7863 c1 Prodigal gene 3895839 3897002 . + . ID=BALIOE_19630_gene;locus_tag=BALIOE_19630 | |
| 7864 c1 Prodigal CDS 3895839 3897002 . + 0 ID=BALIOE_19630;Name=hypothetical protein;locus_tag=BALIOE_19630;product=hypothetical protein;Parent=BALIOE_19630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7865 c1 Prodigal gene 3897107 3897934 . + . ID=BALIOE_19635_gene;locus_tag=BALIOE_19635 | |
| 7866 c1 Prodigal CDS 3897107 3897934 . + 0 ID=BALIOE_19635;Name=hypothetical protein;locus_tag=BALIOE_19635;product=hypothetical protein;Parent=BALIOE_19635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7867 c1 Prodigal gene 3898134 3898409 . + . ID=BALIOE_19640_gene;locus_tag=BALIOE_19640 | |
| 7868 c1 Prodigal CDS 3898134 3898409 . + 0 ID=BALIOE_19640;Name=hypothetical protein;locus_tag=BALIOE_19640;product=hypothetical protein;Parent=BALIOE_19640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7869 c1 Prodigal gene 3898403 3899056 . + . ID=BALIOE_19645_gene;locus_tag=BALIOE_19645 | |
| 7870 c1 Prodigal CDS 3898403 3899056 . + 0 ID=BALIOE_19645;Name=hypothetical protein;locus_tag=BALIOE_19645;product=hypothetical protein;Parent=BALIOE_19645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7871 c1 Prodigal gene 3899105 3899362 . + . ID=BALIOE_19650_gene;locus_tag=BALIOE_19650 | |
| 7872 c1 Prodigal CDS 3899105 3899362 . + 0 ID=BALIOE_19650;Name=hypothetical protein;locus_tag=BALIOE_19650;product=hypothetical protein;Parent=BALIOE_19650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7873 c1 Prodigal gene 3899405 3901624 . - . ID=BALIOE_19655_gene;locus_tag=BALIOE_19655 | |
| 7874 c1 Prodigal CDS 3899405 3901624 . - 0 ID=BALIOE_19655;Name=hypothetical protein;locus_tag=BALIOE_19655;product=hypothetical protein;Parent=BALIOE_19655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7875 c1 Prodigal gene 3901735 3903147 . - . ID=BALIOE_19660_gene;locus_tag=BALIOE_19660 | |
| 7876 c1 Prodigal CDS 3901735 3903147 . - 0 ID=BALIOE_19660;Name=hypothetical protein;locus_tag=BALIOE_19660;product=hypothetical protein;Parent=BALIOE_19660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7877 c1 Prodigal gene 3903222 3903959 . - . ID=BALIOE_19665_gene;locus_tag=BALIOE_19665 | |
| 7878 c1 Prodigal CDS 3903222 3903959 . - 0 ID=BALIOE_19665;Name=hypothetical protein;locus_tag=BALIOE_19665;product=hypothetical protein;Parent=BALIOE_19665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7879 c1 Prodigal gene 3904193 3906451 . - . ID=BALIOE_19670_gene;locus_tag=BALIOE_19670 | |
| 7880 c1 Prodigal CDS 3904193 3906451 . - 0 ID=BALIOE_19670;Name=hypothetical protein;locus_tag=BALIOE_19670;product=hypothetical protein;Parent=BALIOE_19670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7881 c1 Prodigal gene 3906589 3908196 . - . ID=BALIOE_19675_gene;locus_tag=BALIOE_19675 | |
| 7882 c1 Prodigal CDS 3906589 3908196 . - 0 ID=BALIOE_19675;Name=hypothetical protein;locus_tag=BALIOE_19675;product=hypothetical protein;Parent=BALIOE_19675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7883 c1 Prodigal gene 3908305 3908787 . - . ID=BALIOE_19680_gene;locus_tag=BALIOE_19680 | |
| 7884 c1 Prodigal CDS 3908305 3908787 . - 0 ID=BALIOE_19680;Name=hypothetical protein;locus_tag=BALIOE_19680;product=hypothetical protein;Parent=BALIOE_19680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7885 c1 Prodigal gene 3908840 3909232 . - . ID=BALIOE_19685_gene;locus_tag=BALIOE_19685 | |
| 7886 c1 Prodigal CDS 3908840 3909232 . - 0 ID=BALIOE_19685;Name=hypothetical protein;locus_tag=BALIOE_19685;product=hypothetical protein;Parent=BALIOE_19685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7887 c1 Prodigal gene 3909384 3910043 . + . ID=BALIOE_19690_gene;locus_tag=BALIOE_19690 | |
| 7888 c1 Prodigal CDS 3909384 3910043 . + 0 ID=BALIOE_19690;Name=hypothetical protein;locus_tag=BALIOE_19690;product=hypothetical protein;Parent=BALIOE_19690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7889 c1 Prodigal gene 3910040 3911389 . + . ID=BALIOE_19695_gene;locus_tag=BALIOE_19695 | |
| 7890 c1 Prodigal CDS 3910040 3911389 . + 0 ID=BALIOE_19695;Name=hypothetical protein;locus_tag=BALIOE_19695;product=hypothetical protein;Parent=BALIOE_19695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7891 c1 Prodigal gene 3911499 3912080 . + . ID=BALIOE_19700_gene;locus_tag=BALIOE_19700 | |
| 7892 c1 Prodigal CDS 3911499 3912080 . + 0 ID=BALIOE_19700;Name=hypothetical protein;locus_tag=BALIOE_19700;product=hypothetical protein;Parent=BALIOE_19700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7893 c1 Prodigal gene 3912111 3912425 . + . ID=BALIOE_19705_gene;locus_tag=BALIOE_19705 | |
| 7894 c1 Prodigal CDS 3912111 3912425 . + 0 ID=BALIOE_19705;Name=hypothetical protein;locus_tag=BALIOE_19705;product=hypothetical protein;Parent=BALIOE_19705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7895 c1 Prodigal gene 3912470 3913357 . - . ID=BALIOE_19710_gene;locus_tag=BALIOE_19710 | |
| 7896 c1 Prodigal CDS 3912470 3913357 . - 0 ID=BALIOE_19710;Name=hypothetical protein;locus_tag=BALIOE_19710;product=hypothetical protein;Parent=BALIOE_19710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7897 c1 Prodigal gene 3913354 3914301 . - . ID=BALIOE_19715_gene;locus_tag=BALIOE_19715 | |
| 7898 c1 Prodigal CDS 3913354 3914301 . - 0 ID=BALIOE_19715;Name=hypothetical protein;locus_tag=BALIOE_19715;product=hypothetical protein;Parent=BALIOE_19715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7899 c1 Prodigal gene 3914312 3915349 . - . ID=BALIOE_19720_gene;locus_tag=BALIOE_19720 | |
| 7900 c1 Prodigal CDS 3914312 3915349 . - 0 ID=BALIOE_19720;Name=hypothetical protein;locus_tag=BALIOE_19720;product=hypothetical protein;Parent=BALIOE_19720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7901 c1 Prodigal gene 3915358 3916341 . - . ID=BALIOE_19725_gene;locus_tag=BALIOE_19725 | |
| 7902 c1 Prodigal CDS 3915358 3916341 . - 0 ID=BALIOE_19725;Name=hypothetical protein;locus_tag=BALIOE_19725;product=hypothetical protein;Parent=BALIOE_19725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7903 c1 Prodigal gene 3916338 3917147 . - . ID=BALIOE_19730_gene;locus_tag=BALIOE_19730 | |
| 7904 c1 Prodigal CDS 3916338 3917147 . - 0 ID=BALIOE_19730;Name=hypothetical protein;locus_tag=BALIOE_19730;product=hypothetical protein;Parent=BALIOE_19730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7905 c1 Prodigal gene 3917521 3919662 . + . ID=BALIOE_19735_gene;locus_tag=BALIOE_19735 | |
| 7906 c1 Prodigal CDS 3917521 3919662 . + 0 ID=BALIOE_19735;Name=hypothetical protein;locus_tag=BALIOE_19735;product=hypothetical protein;Parent=BALIOE_19735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7907 c1 Prodigal gene 3919726 3921618 . - . ID=BALIOE_19740_gene;locus_tag=BALIOE_19740 | |
| 7908 c1 Prodigal CDS 3919726 3921618 . - 0 ID=BALIOE_19740;Name=hypothetical protein;locus_tag=BALIOE_19740;product=hypothetical protein;Parent=BALIOE_19740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7909 c1 Prodigal gene 3921647 3922228 . - . ID=BALIOE_19745_gene;locus_tag=BALIOE_19745 | |
| 7910 c1 Prodigal CDS 3921647 3922228 . - 0 ID=BALIOE_19745;Name=hypothetical protein;locus_tag=BALIOE_19745;product=hypothetical protein;Parent=BALIOE_19745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7911 c1 Prodigal gene 3922228 3923055 . - . ID=BALIOE_19750_gene;locus_tag=BALIOE_19750 | |
| 7912 c1 Prodigal CDS 3922228 3923055 . - 0 ID=BALIOE_19750;Name=hypothetical protein;locus_tag=BALIOE_19750;product=hypothetical protein;Parent=BALIOE_19750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7913 c1 Prodigal gene 3923080 3923502 . - . ID=BALIOE_19755_gene;locus_tag=BALIOE_19755 | |
| 7914 c1 Prodigal CDS 3923080 3923502 . - 0 ID=BALIOE_19755;Name=hypothetical protein;locus_tag=BALIOE_19755;product=hypothetical protein;Parent=BALIOE_19755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7915 c1 Prodigal gene 3923503 3924132 . - . ID=BALIOE_19760_gene;locus_tag=BALIOE_19760 | |
| 7916 c1 Prodigal CDS 3923503 3924132 . - 0 ID=BALIOE_19760;Name=hypothetical protein;locus_tag=BALIOE_19760;product=hypothetical protein;Parent=BALIOE_19760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7917 c1 Prodigal gene 3924337 3925818 . + . ID=BALIOE_19765_gene;locus_tag=BALIOE_19765 | |
| 7918 c1 Prodigal CDS 3924337 3925818 . + 0 ID=BALIOE_19765;Name=hypothetical protein;locus_tag=BALIOE_19765;product=hypothetical protein;Parent=BALIOE_19765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7919 c1 Prodigal gene 3925966 3926637 . + . ID=BALIOE_19770_gene;locus_tag=BALIOE_19770 | |
| 7920 c1 Prodigal CDS 3925966 3926637 . + 0 ID=BALIOE_19770;Name=hypothetical protein;locus_tag=BALIOE_19770;product=hypothetical protein;Parent=BALIOE_19770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7921 c1 Prodigal gene 3926643 3927803 . + . ID=BALIOE_19775_gene;locus_tag=BALIOE_19775 | |
| 7922 c1 Prodigal CDS 3926643 3927803 . + 0 ID=BALIOE_19775;Name=hypothetical protein;locus_tag=BALIOE_19775;product=hypothetical protein;Parent=BALIOE_19775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7923 c1 Prodigal gene 3927841 3928656 . - . ID=BALIOE_19780_gene;locus_tag=BALIOE_19780 | |
| 7924 c1 Prodigal CDS 3927841 3928656 . - 0 ID=BALIOE_19780;Name=hypothetical protein;locus_tag=BALIOE_19780;product=hypothetical protein;Parent=BALIOE_19780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7925 c1 Prodigal gene 3928772 3929545 . + . ID=BALIOE_19785_gene;locus_tag=BALIOE_19785 | |
| 7926 c1 Prodigal CDS 3928772 3929545 . + 0 ID=BALIOE_19785;Name=hypothetical protein;locus_tag=BALIOE_19785;product=hypothetical protein;Parent=BALIOE_19785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7927 c1 Prodigal gene 3929603 3929773 . - . ID=BALIOE_19790_gene;locus_tag=BALIOE_19790 | |
| 7928 c1 Prodigal CDS 3929603 3929773 . - 0 ID=BALIOE_19790;Name=hypothetical protein;locus_tag=BALIOE_19790;product=hypothetical protein;Parent=BALIOE_19790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7929 c1 Prodigal gene 3930035 3930688 . - . ID=BALIOE_19795_gene;locus_tag=BALIOE_19795 | |
| 7930 c1 Prodigal CDS 3930035 3930688 . - 0 ID=BALIOE_19795;Name=hypothetical protein;locus_tag=BALIOE_19795;product=hypothetical protein;Parent=BALIOE_19795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7931 c1 Prodigal gene 3931062 3931361 . + . ID=BALIOE_19800_gene;locus_tag=BALIOE_19800 | |
| 7932 c1 Prodigal CDS 3931062 3931361 . + 0 ID=BALIOE_19800;Name=hypothetical protein;locus_tag=BALIOE_19800;product=hypothetical protein;Parent=BALIOE_19800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7933 c1 Prodigal gene 3931396 3931596 . - . ID=BALIOE_19805_gene;locus_tag=BALIOE_19805 | |
| 7934 c1 Prodigal CDS 3931396 3931596 . - 0 ID=BALIOE_19805;Name=hypothetical protein;locus_tag=BALIOE_19805;product=hypothetical protein;Parent=BALIOE_19805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7935 c1 Prodigal gene 3931865 3932479 . + . ID=BALIOE_19810_gene;locus_tag=BALIOE_19810 | |
| 7936 c1 Prodigal CDS 3931865 3932479 . + 0 ID=BALIOE_19810;Name=hypothetical protein;locus_tag=BALIOE_19810;product=hypothetical protein;Parent=BALIOE_19810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7937 c1 Prodigal gene 3932521 3934182 . + . ID=BALIOE_19815_gene;locus_tag=BALIOE_19815 | |
| 7938 c1 Prodigal CDS 3932521 3934182 . + 0 ID=BALIOE_19815;Name=hypothetical protein;locus_tag=BALIOE_19815;product=hypothetical protein;Parent=BALIOE_19815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7939 c1 Prodigal gene 3934976 3936409 . - . ID=BALIOE_19820_gene;locus_tag=BALIOE_19820 | |
| 7940 c1 Prodigal CDS 3934976 3936409 . - 0 ID=BALIOE_19820;Name=hypothetical protein;locus_tag=BALIOE_19820;product=hypothetical protein;Parent=BALIOE_19820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7941 c1 Prodigal gene 3936457 3939297 . - . ID=BALIOE_19825_gene;locus_tag=BALIOE_19825 | |
| 7942 c1 Prodigal CDS 3936457 3939297 . - 0 ID=BALIOE_19825;Name=hypothetical protein;locus_tag=BALIOE_19825;product=hypothetical protein;Parent=BALIOE_19825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7943 c1 Prodigal gene 3939320 3940621 . - . ID=BALIOE_19830_gene;locus_tag=BALIOE_19830 | |
| 7944 c1 Prodigal CDS 3939320 3940621 . - 0 ID=BALIOE_19830;Name=hypothetical protein;locus_tag=BALIOE_19830;product=hypothetical protein;Parent=BALIOE_19830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7945 c1 Prodigal gene 3940863 3941483 . + . ID=BALIOE_19835_gene;locus_tag=BALIOE_19835 | |
| 7946 c1 Prodigal CDS 3940863 3941483 . + 0 ID=BALIOE_19835;Name=hypothetical protein;locus_tag=BALIOE_19835;product=hypothetical protein;Parent=BALIOE_19835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7947 c1 Prodigal gene 3941547 3942785 . + . ID=BALIOE_19840_gene;locus_tag=BALIOE_19840 | |
| 7948 c1 Prodigal CDS 3941547 3942785 . + 0 ID=BALIOE_19840;Name=hypothetical protein;locus_tag=BALIOE_19840;product=hypothetical protein;Parent=BALIOE_19840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7949 c1 Infernal gene 3942851 3942921 . - . ID=BALIOE_19845_gene;locus_tag=BALIOE_19845;gene=naRNA4 | |
| 7950 c1 Infernal ncRNA 3942851 3942921 1.4e-10 - . ID=BALIOE_19845;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_19845;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_19845_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 7951 c1 Prodigal gene 3942966 3943787 . - . ID=BALIOE_19850_gene;locus_tag=BALIOE_19850 | |
| 7952 c1 Prodigal CDS 3942966 3943787 . - 0 ID=BALIOE_19850;Name=hypothetical protein;locus_tag=BALIOE_19850;product=hypothetical protein;Parent=BALIOE_19850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7953 c1 Prodigal gene 3943878 3944246 . - . ID=BALIOE_19855_gene;locus_tag=BALIOE_19855 | |
| 7954 c1 Prodigal CDS 3943878 3944246 . - 0 ID=BALIOE_19855;Name=hypothetical protein;locus_tag=BALIOE_19855;product=hypothetical protein;Parent=BALIOE_19855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7955 c1 Prodigal gene 3944352 3944969 . + . ID=BALIOE_19860_gene;locus_tag=BALIOE_19860 | |
| 7956 c1 Prodigal CDS 3944352 3944969 . + 0 ID=BALIOE_19860;Name=hypothetical protein;locus_tag=BALIOE_19860;product=hypothetical protein;Parent=BALIOE_19860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7957 c1 Prodigal gene 3944982 3945914 . - . ID=BALIOE_19865_gene;locus_tag=BALIOE_19865 | |
| 7958 c1 Prodigal CDS 3944982 3945914 . - 0 ID=BALIOE_19865;Name=hypothetical protein;locus_tag=BALIOE_19865;product=hypothetical protein;Parent=BALIOE_19865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7959 c1 Prodigal gene 3946121 3947032 . + . ID=BALIOE_19870_gene;locus_tag=BALIOE_19870 | |
| 7960 c1 Prodigal CDS 3946121 3947032 . + 0 ID=BALIOE_19870;Name=hypothetical protein;locus_tag=BALIOE_19870;product=hypothetical protein;Parent=BALIOE_19870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7961 c1 Prodigal gene 3947029 3947634 . + . ID=BALIOE_19875_gene;locus_tag=BALIOE_19875 | |
| 7962 c1 Prodigal CDS 3947029 3947634 . + 0 ID=BALIOE_19875;Name=hypothetical protein;locus_tag=BALIOE_19875;product=hypothetical protein;Parent=BALIOE_19875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7963 c1 Prodigal gene 3947683 3949146 . + . ID=BALIOE_19880_gene;locus_tag=BALIOE_19880 | |
| 7964 c1 Prodigal CDS 3947683 3949146 . + 0 ID=BALIOE_19880;Name=hypothetical protein;locus_tag=BALIOE_19880;product=hypothetical protein;Parent=BALIOE_19880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7965 c1 Prodigal gene 3949189 3950202 . - . ID=BALIOE_19885_gene;locus_tag=BALIOE_19885 | |
| 7966 c1 Prodigal CDS 3949189 3950202 . - 0 ID=BALIOE_19885;Name=hypothetical protein;locus_tag=BALIOE_19885;product=hypothetical protein;Parent=BALIOE_19885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7967 c1 Prodigal gene 3950440 3950655 . + . ID=BALIOE_19890_gene;locus_tag=BALIOE_19890 | |
| 7968 c1 Prodigal CDS 3950440 3950655 . + 0 ID=BALIOE_19890;Name=hypothetical protein;locus_tag=BALIOE_19890;product=hypothetical protein;Parent=BALIOE_19890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7969 c1 Prodigal gene 3950766 3952511 . + . ID=BALIOE_19895_gene;locus_tag=BALIOE_19895 | |
| 7970 c1 Prodigal CDS 3950766 3952511 . + 0 ID=BALIOE_19895;Name=hypothetical protein;locus_tag=BALIOE_19895;product=hypothetical protein;Parent=BALIOE_19895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7971 c1 Prodigal gene 3952706 3954547 . + . ID=BALIOE_19900_gene;locus_tag=BALIOE_19900 | |
| 7972 c1 Prodigal CDS 3952706 3954547 . + 0 ID=BALIOE_19900;Name=hypothetical protein;locus_tag=BALIOE_19900;product=hypothetical protein;Parent=BALIOE_19900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7973 c1 Prodigal gene 3954626 3955132 . - . ID=BALIOE_19905_gene;locus_tag=BALIOE_19905 | |
| 7974 c1 Prodigal CDS 3954626 3955132 . - 0 ID=BALIOE_19905;Name=hypothetical protein;locus_tag=BALIOE_19905;product=hypothetical protein;Parent=BALIOE_19905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7975 c1 tRNAscan-SE gene 3955257 3955332 . + . ID=BALIOE_19910_gene;locus_tag=BALIOE_19910;gene=Ile2_trna | |
| 7976 c1 tRNAscan-SE tRNA 3955257 3955332 . + . ID=BALIOE_19910;Name=tRNA-Ile2;locus_tag=BALIOE_19910;product=tRNA-Ile2;gene=Ile2_trna;Parent=BALIOE_19910_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 7977 c1 Prodigal gene 3955386 3956150 . - . ID=BALIOE_19915_gene;locus_tag=BALIOE_19915 | |
| 7978 c1 Prodigal CDS 3955386 3956150 . - 0 ID=BALIOE_19915;Name=hypothetical protein;locus_tag=BALIOE_19915;product=hypothetical protein;Parent=BALIOE_19915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7979 c1 Prodigal gene 3956438 3957061 . + . ID=BALIOE_19920_gene;locus_tag=BALIOE_19920 | |
| 7980 c1 Prodigal CDS 3956438 3957061 . + 0 ID=BALIOE_19920;Name=hypothetical protein;locus_tag=BALIOE_19920;product=hypothetical protein;Parent=BALIOE_19920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7981 c1 Prodigal gene 3957215 3958735 . - . ID=BALIOE_19925_gene;locus_tag=BALIOE_19925 | |
| 7982 c1 Prodigal CDS 3957215 3958735 . - 0 ID=BALIOE_19925;Name=hypothetical protein;locus_tag=BALIOE_19925;product=hypothetical protein;Parent=BALIOE_19925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7983 c1 Prodigal gene 3959042 3960532 . + . ID=BALIOE_19930_gene;locus_tag=BALIOE_19930 | |
| 7984 c1 Prodigal CDS 3959042 3960532 . + 0 ID=BALIOE_19930;Name=hypothetical protein;locus_tag=BALIOE_19930;product=hypothetical protein;Parent=BALIOE_19930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7985 c1 Prodigal gene 3960574 3960906 . - . ID=BALIOE_19935_gene;locus_tag=BALIOE_19935 | |
| 7986 c1 Prodigal CDS 3960574 3960906 . - 0 ID=BALIOE_19935;Name=hypothetical protein;locus_tag=BALIOE_19935;product=hypothetical protein;Parent=BALIOE_19935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7987 c1 Prodigal gene 3961125 3962108 . + . ID=BALIOE_19940_gene;locus_tag=BALIOE_19940 | |
| 7988 c1 Prodigal CDS 3961125 3962108 . + 0 ID=BALIOE_19940;Name=hypothetical protein;locus_tag=BALIOE_19940;product=hypothetical protein;Parent=BALIOE_19940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7989 c1 Prodigal gene 3962292 3965384 . + . ID=BALIOE_19945_gene;locus_tag=BALIOE_19945 | |
| 7990 c1 Prodigal CDS 3962292 3965384 . + 0 ID=BALIOE_19945;Name=hypothetical protein;locus_tag=BALIOE_19945;product=hypothetical protein;Parent=BALIOE_19945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7991 c1 Prodigal gene 3965381 3965830 . + . ID=BALIOE_19950_gene;locus_tag=BALIOE_19950 | |
| 7992 c1 Prodigal CDS 3965381 3965830 . + 0 ID=BALIOE_19950;Name=hypothetical protein;locus_tag=BALIOE_19950;product=hypothetical protein;Parent=BALIOE_19950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7993 c1 Prodigal gene 3965893 3967326 . + . ID=BALIOE_19955_gene;locus_tag=BALIOE_19955 | |
| 7994 c1 Prodigal CDS 3965893 3967326 . + 0 ID=BALIOE_19955;Name=hypothetical protein;locus_tag=BALIOE_19955;product=hypothetical protein;Parent=BALIOE_19955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7995 c1 Prodigal gene 3967460 3968530 . + . ID=BALIOE_19960_gene;locus_tag=BALIOE_19960 | |
| 7996 c1 Prodigal CDS 3967460 3968530 . + 0 ID=BALIOE_19960;Name=hypothetical protein;locus_tag=BALIOE_19960;product=hypothetical protein;Parent=BALIOE_19960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7997 c1 Prodigal gene 3968547 3970898 . + . ID=BALIOE_19965_gene;locus_tag=BALIOE_19965 | |
| 7998 c1 Prodigal CDS 3968547 3970898 . + 0 ID=BALIOE_19965;Name=hypothetical protein;locus_tag=BALIOE_19965;product=hypothetical protein;Parent=BALIOE_19965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 7999 c1 Infernal gene 3971060 3971141 . - . ID=BALIOE_19970_gene;locus_tag=BALIOE_19970;gene=naRNA4 | |
| 8000 c1 Infernal ncRNA 3971060 3971141 1.3e-09 - . ID=BALIOE_19970;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_19970;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_19970_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 8001 c1 Infernal gene 3971160 3971241 . - . ID=BALIOE_19975_gene;locus_tag=BALIOE_19975;gene=naRNA4 | |
| 8002 c1 Infernal ncRNA 3971160 3971241 2.8e-08 - . ID=BALIOE_19975;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_19975;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_19975_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 8003 c1 Prodigal gene 3971424 3973442 . + . ID=BALIOE_19980_gene;locus_tag=BALIOE_19980 | |
| 8004 c1 Prodigal CDS 3971424 3973442 . + 0 ID=BALIOE_19980;Name=hypothetical protein;locus_tag=BALIOE_19980;product=hypothetical protein;Parent=BALIOE_19980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8005 c1 Prodigal gene 3973487 3973903 . - . ID=BALIOE_19985_gene;locus_tag=BALIOE_19985 | |
| 8006 c1 Prodigal CDS 3973487 3973903 . - 0 ID=BALIOE_19985;Name=hypothetical protein;locus_tag=BALIOE_19985;product=hypothetical protein;Parent=BALIOE_19985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8007 c1 Prodigal gene 3973900 3974214 . - . ID=BALIOE_19990_gene;locus_tag=BALIOE_19990 | |
| 8008 c1 Prodigal CDS 3973900 3974214 . - 0 ID=BALIOE_19990;Name=hypothetical protein;locus_tag=BALIOE_19990;product=hypothetical protein;Parent=BALIOE_19990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8009 c1 Prodigal gene 3974498 3975634 . - . ID=BALIOE_19995_gene;locus_tag=BALIOE_19995 | |
| 8010 c1 Prodigal CDS 3974498 3975634 . - 0 ID=BALIOE_19995;Name=hypothetical protein;locus_tag=BALIOE_19995;product=hypothetical protein;Parent=BALIOE_19995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8011 c1 Prodigal gene 3975719 3976222 . + . ID=BALIOE_20000_gene;locus_tag=BALIOE_20000 | |
| 8012 c1 Prodigal CDS 3975719 3976222 . + 0 ID=BALIOE_20000;Name=hypothetical protein;locus_tag=BALIOE_20000;product=hypothetical protein;Parent=BALIOE_20000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8013 c1 Prodigal gene 3976299 3976991 . + . ID=BALIOE_20005_gene;locus_tag=BALIOE_20005 | |
| 8014 c1 Prodigal CDS 3976299 3976991 . + 0 ID=BALIOE_20005;Name=hypothetical protein;locus_tag=BALIOE_20005;product=hypothetical protein;Parent=BALIOE_20005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8015 c1 Prodigal gene 3977070 3978056 . + . ID=BALIOE_20010_gene;locus_tag=BALIOE_20010 | |
| 8016 c1 Prodigal CDS 3977070 3978056 . + 0 ID=BALIOE_20010;Name=hypothetical protein;locus_tag=BALIOE_20010;product=hypothetical protein;Parent=BALIOE_20010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8017 c1 Prodigal gene 3978340 3979305 . + . ID=BALIOE_20015_gene;locus_tag=BALIOE_20015 | |
| 8018 c1 Prodigal CDS 3978340 3979305 . + 0 ID=BALIOE_20015;Name=hypothetical protein;locus_tag=BALIOE_20015;product=hypothetical protein;Parent=BALIOE_20015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8019 c1 Prodigal gene 3979704 3980948 . + . ID=BALIOE_20020_gene;locus_tag=BALIOE_20020 | |
| 8020 c1 Prodigal CDS 3979704 3980948 . + 0 ID=BALIOE_20020;Name=hypothetical protein;locus_tag=BALIOE_20020;product=hypothetical protein;Parent=BALIOE_20020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8021 c1 Prodigal gene 3980953 3981504 . - . ID=BALIOE_20025_gene;locus_tag=BALIOE_20025 | |
| 8022 c1 Prodigal CDS 3980953 3981504 . - 0 ID=BALIOE_20025;Name=hypothetical protein;locus_tag=BALIOE_20025;product=hypothetical protein;Parent=BALIOE_20025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8023 c1 Prodigal gene 3981587 3983074 . - . ID=BALIOE_20030_gene;locus_tag=BALIOE_20030 | |
| 8024 c1 Prodigal CDS 3981587 3983074 . - 0 ID=BALIOE_20030;Name=hypothetical protein;locus_tag=BALIOE_20030;product=hypothetical protein;Parent=BALIOE_20030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8025 c1 Prodigal gene 3983089 3984501 . - . ID=BALIOE_20035_gene;locus_tag=BALIOE_20035 | |
| 8026 c1 Prodigal CDS 3983089 3984501 . - 0 ID=BALIOE_20035;Name=hypothetical protein;locus_tag=BALIOE_20035;product=hypothetical protein;Parent=BALIOE_20035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8027 c1 Prodigal gene 3984984 3986282 . + . ID=BALIOE_20040_gene;locus_tag=BALIOE_20040 | |
| 8028 c1 Prodigal CDS 3984984 3986282 . + 0 ID=BALIOE_20040;Name=hypothetical protein;locus_tag=BALIOE_20040;product=hypothetical protein;Parent=BALIOE_20040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8029 c1 Prodigal gene 3986412 3987188 . + . ID=BALIOE_20045_gene;locus_tag=BALIOE_20045 | |
| 8030 c1 Prodigal CDS 3986412 3987188 . + 0 ID=BALIOE_20045;Name=hypothetical protein;locus_tag=BALIOE_20045;product=hypothetical protein;Parent=BALIOE_20045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8031 c1 Prodigal gene 3987533 3988195 . + . ID=BALIOE_20050_gene;locus_tag=BALIOE_20050 | |
| 8032 c1 Prodigal CDS 3987533 3988195 . + 0 ID=BALIOE_20050;Name=hypothetical protein;locus_tag=BALIOE_20050;product=hypothetical protein;Parent=BALIOE_20050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8033 c1 Prodigal gene 3988199 3988582 . + . ID=BALIOE_20055_gene;locus_tag=BALIOE_20055 | |
| 8034 c1 Prodigal CDS 3988199 3988582 . + 0 ID=BALIOE_20055;Name=hypothetical protein;locus_tag=BALIOE_20055;product=hypothetical protein;Parent=BALIOE_20055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8035 c1 Prodigal gene 3988729 3989097 . + . ID=BALIOE_20060_gene;locus_tag=BALIOE_20060 | |
| 8036 c1 Prodigal CDS 3988729 3989097 . + 0 ID=BALIOE_20060;Name=hypothetical protein;locus_tag=BALIOE_20060;product=hypothetical protein;Parent=BALIOE_20060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8037 c1 Prodigal gene 3989135 3989440 . + . ID=BALIOE_20065_gene;locus_tag=BALIOE_20065 | |
| 8038 c1 Prodigal CDS 3989135 3989440 . + 0 ID=BALIOE_20065;Name=hypothetical protein;locus_tag=BALIOE_20065;product=hypothetical protein;Parent=BALIOE_20065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8039 c1 Prodigal gene 3989443 3989847 . + . ID=BALIOE_20070_gene;locus_tag=BALIOE_20070 | |
| 8040 c1 Prodigal CDS 3989443 3989847 . + 0 ID=BALIOE_20070;Name=hypothetical protein;locus_tag=BALIOE_20070;product=hypothetical protein;Parent=BALIOE_20070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8041 c1 Prodigal gene 3989837 3990136 . + . ID=BALIOE_20075_gene;locus_tag=BALIOE_20075 | |
| 8042 c1 Prodigal CDS 3989837 3990136 . + 0 ID=BALIOE_20075;Name=hypothetical protein;locus_tag=BALIOE_20075;product=hypothetical protein;Parent=BALIOE_20075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8043 c1 Prodigal gene 3990232 3990714 . + . ID=BALIOE_20080_gene;locus_tag=BALIOE_20080 | |
| 8044 c1 Prodigal CDS 3990232 3990714 . + 0 ID=BALIOE_20080;Name=hypothetical protein;locus_tag=BALIOE_20080;product=hypothetical protein;Parent=BALIOE_20080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8045 c1 Prodigal gene 3990784 3991770 . + . ID=BALIOE_20085_gene;locus_tag=BALIOE_20085 | |
| 8046 c1 Prodigal CDS 3990784 3991770 . + 0 ID=BALIOE_20085;Name=hypothetical protein;locus_tag=BALIOE_20085;product=hypothetical protein;Parent=BALIOE_20085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8047 c1 Prodigal gene 3992062 3992427 . + . ID=BALIOE_20090_gene;locus_tag=BALIOE_20090 | |
| 8048 c1 Prodigal CDS 3992062 3992427 . + 0 ID=BALIOE_20090;Name=hypothetical protein;locus_tag=BALIOE_20090;product=hypothetical protein;Parent=BALIOE_20090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8049 c1 Prodigal gene 3992668 3993024 . + . ID=BALIOE_20095_gene;locus_tag=BALIOE_20095 | |
| 8050 c1 Prodigal CDS 3992668 3993024 . + 0 ID=BALIOE_20095;Name=hypothetical protein;locus_tag=BALIOE_20095;product=hypothetical protein;Parent=BALIOE_20095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8051 c1 Prodigal gene 3993075 3993971 . - . ID=BALIOE_20100_gene;locus_tag=BALIOE_20100 | |
| 8052 c1 Prodigal CDS 3993075 3993971 . - 0 ID=BALIOE_20100;Name=hypothetical protein;locus_tag=BALIOE_20100;product=hypothetical protein;Parent=BALIOE_20100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8053 c1 Prodigal gene 3994076 3994777 . + . ID=BALIOE_20105_gene;locus_tag=BALIOE_20105 | |
| 8054 c1 Prodigal CDS 3994076 3994777 . + 0 ID=BALIOE_20105;Name=hypothetical protein;locus_tag=BALIOE_20105;product=hypothetical protein;Parent=BALIOE_20105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8055 c1 Prodigal gene 3994800 3994964 . + . ID=BALIOE_20110_gene;locus_tag=BALIOE_20110 | |
| 8056 c1 Prodigal CDS 3994800 3994964 . + 0 ID=BALIOE_20110;Name=hypothetical protein;locus_tag=BALIOE_20110;product=hypothetical protein;Parent=BALIOE_20110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8057 c1 Prodigal gene 3995098 3996408 . - . ID=BALIOE_20115_gene;locus_tag=BALIOE_20115 | |
| 8058 c1 Prodigal CDS 3995098 3996408 . - 0 ID=BALIOE_20115;Name=hypothetical protein;locus_tag=BALIOE_20115;product=hypothetical protein;Parent=BALIOE_20115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8059 c1 Prodigal gene 3996436 3997767 . - . ID=BALIOE_20120_gene;locus_tag=BALIOE_20120 | |
| 8060 c1 Prodigal CDS 3996436 3997767 . - 0 ID=BALIOE_20120;Name=hypothetical protein;locus_tag=BALIOE_20120;product=hypothetical protein;Parent=BALIOE_20120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8061 c1 Prodigal gene 3998042 3999406 . - . ID=BALIOE_20125_gene;locus_tag=BALIOE_20125 | |
| 8062 c1 Prodigal CDS 3998042 3999406 . - 0 ID=BALIOE_20125;Name=hypothetical protein;locus_tag=BALIOE_20125;product=hypothetical protein;Parent=BALIOE_20125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8063 c1 Prodigal gene 3999478 3999867 . - . ID=BALIOE_20130_gene;locus_tag=BALIOE_20130 | |
| 8064 c1 Prodigal CDS 3999478 3999867 . - 0 ID=BALIOE_20130;Name=hypothetical protein;locus_tag=BALIOE_20130;product=hypothetical protein;Parent=BALIOE_20130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8065 c1 Prodigal gene 3999881 4002175 . - . ID=BALIOE_20135_gene;locus_tag=BALIOE_20135 | |
| 8066 c1 Prodigal CDS 3999881 4002175 . - 0 ID=BALIOE_20135;Name=hypothetical protein;locus_tag=BALIOE_20135;product=hypothetical protein;Parent=BALIOE_20135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8067 c1 Prodigal gene 4002209 4003417 . - . ID=BALIOE_20140_gene;locus_tag=BALIOE_20140 | |
| 8068 c1 Prodigal CDS 4002209 4003417 . - 0 ID=BALIOE_20140;Name=hypothetical protein;locus_tag=BALIOE_20140;product=hypothetical protein;Parent=BALIOE_20140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8069 c1 Prodigal gene 4003443 4004774 . - . ID=BALIOE_20145_gene;locus_tag=BALIOE_20145 | |
| 8070 c1 Prodigal CDS 4003443 4004774 . - 0 ID=BALIOE_20145;Name=hypothetical protein;locus_tag=BALIOE_20145;product=hypothetical protein;Parent=BALIOE_20145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8071 c1 Prodigal gene 4004796 4005785 . - . ID=BALIOE_20150_gene;locus_tag=BALIOE_20150 | |
| 8072 c1 Prodigal CDS 4004796 4005785 . - 0 ID=BALIOE_20150;Name=hypothetical protein;locus_tag=BALIOE_20150;product=hypothetical protein;Parent=BALIOE_20150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8073 c1 Prodigal gene 4005884 4006822 . - . ID=BALIOE_20155_gene;locus_tag=BALIOE_20155 | |
| 8074 c1 Prodigal CDS 4005884 4006822 . - 0 ID=BALIOE_20155;Name=hypothetical protein;locus_tag=BALIOE_20155;product=hypothetical protein;Parent=BALIOE_20155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8075 c1 Prodigal gene 4007011 4007355 . + . ID=BALIOE_20160_gene;locus_tag=BALIOE_20160 | |
| 8076 c1 Prodigal CDS 4007011 4007355 . + 0 ID=BALIOE_20160;Name=hypothetical protein;locus_tag=BALIOE_20160;product=hypothetical protein;Parent=BALIOE_20160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8077 c1 Prodigal gene 4007611 4008150 . + . ID=BALIOE_20165_gene;locus_tag=BALIOE_20165 | |
| 8078 c1 Prodigal CDS 4007611 4008150 . + 0 ID=BALIOE_20165;Name=hypothetical protein;locus_tag=BALIOE_20165;product=hypothetical protein;Parent=BALIOE_20165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8079 c1 Prodigal gene 4008172 4009359 . + . ID=BALIOE_20170_gene;locus_tag=BALIOE_20170 | |
| 8080 c1 Prodigal CDS 4008172 4009359 . + 0 ID=BALIOE_20170;Name=hypothetical protein;locus_tag=BALIOE_20170;product=hypothetical protein;Parent=BALIOE_20170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8081 c1 Prodigal gene 4009988 4011133 . - . ID=BALIOE_20175_gene;locus_tag=BALIOE_20175 | |
| 8082 c1 Prodigal CDS 4009988 4011133 . - 0 ID=BALIOE_20175;Name=hypothetical protein;locus_tag=BALIOE_20175;product=hypothetical protein;Parent=BALIOE_20175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8083 c1 Prodigal gene 4011230 4012120 . - . ID=BALIOE_20180_gene;locus_tag=BALIOE_20180 | |
| 8084 c1 Prodigal CDS 4011230 4012120 . - 0 ID=BALIOE_20180;Name=hypothetical protein;locus_tag=BALIOE_20180;product=hypothetical protein;Parent=BALIOE_20180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8085 c1 Prodigal gene 4012150 4012920 . - . ID=BALIOE_20185_gene;locus_tag=BALIOE_20185 | |
| 8086 c1 Prodigal CDS 4012150 4012920 . - 0 ID=BALIOE_20185;Name=hypothetical protein;locus_tag=BALIOE_20185;product=hypothetical protein;Parent=BALIOE_20185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8087 c1 Prodigal gene 4012936 4014270 . - . ID=BALIOE_20190_gene;locus_tag=BALIOE_20190 | |
| 8088 c1 Prodigal CDS 4012936 4014270 . - 0 ID=BALIOE_20190;Name=hypothetical protein;locus_tag=BALIOE_20190;product=hypothetical protein;Parent=BALIOE_20190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8089 c1 Prodigal gene 4014645 4016216 . + . ID=BALIOE_20195_gene;locus_tag=BALIOE_20195 | |
| 8090 c1 Prodigal CDS 4014645 4016216 . + 0 ID=BALIOE_20195;Name=hypothetical protein;locus_tag=BALIOE_20195;product=hypothetical protein;Parent=BALIOE_20195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8091 c1 Prodigal gene 4016365 4016700 . + . ID=BALIOE_20200_gene;locus_tag=BALIOE_20200 | |
| 8092 c1 Prodigal CDS 4016365 4016700 . + 0 ID=BALIOE_20200;Name=hypothetical protein;locus_tag=BALIOE_20200;product=hypothetical protein;Parent=BALIOE_20200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8093 c1 Prodigal gene 4016700 4017164 . + . ID=BALIOE_20205_gene;locus_tag=BALIOE_20205 | |
| 8094 c1 Prodigal CDS 4016700 4017164 . + 0 ID=BALIOE_20205;Name=hypothetical protein;locus_tag=BALIOE_20205;product=hypothetical protein;Parent=BALIOE_20205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8095 c1 Prodigal gene 4017219 4018028 . - . ID=BALIOE_20210_gene;locus_tag=BALIOE_20210 | |
| 8096 c1 Prodigal CDS 4017219 4018028 . - 0 ID=BALIOE_20210;Name=hypothetical protein;locus_tag=BALIOE_20210;product=hypothetical protein;Parent=BALIOE_20210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8097 c1 Prodigal gene 4018277 4019557 . + . ID=BALIOE_20215_gene;locus_tag=BALIOE_20215 | |
| 8098 c1 Prodigal CDS 4018277 4019557 . + 0 ID=BALIOE_20215;Name=hypothetical protein;locus_tag=BALIOE_20215;product=hypothetical protein;Parent=BALIOE_20215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8099 c1 Prodigal gene 4019580 4020053 . + . ID=BALIOE_20220_gene;locus_tag=BALIOE_20220 | |
| 8100 c1 Prodigal CDS 4019580 4020053 . + 0 ID=BALIOE_20220;Name=hypothetical protein;locus_tag=BALIOE_20220;product=hypothetical protein;Parent=BALIOE_20220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8101 c1 Prodigal gene 4020064 4020843 . + . ID=BALIOE_20225_gene;locus_tag=BALIOE_20225 | |
| 8102 c1 Prodigal CDS 4020064 4020843 . + 0 ID=BALIOE_20225;Name=hypothetical protein;locus_tag=BALIOE_20225;product=hypothetical protein;Parent=BALIOE_20225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8103 c1 Prodigal gene 4020833 4021711 . + . ID=BALIOE_20230_gene;locus_tag=BALIOE_20230 | |
| 8104 c1 Prodigal CDS 4020833 4021711 . + 0 ID=BALIOE_20230;Name=hypothetical protein;locus_tag=BALIOE_20230;product=hypothetical protein;Parent=BALIOE_20230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8105 c1 Prodigal gene 4021729 4022163 . + . ID=BALIOE_20235_gene;locus_tag=BALIOE_20235 | |
| 8106 c1 Prodigal CDS 4021729 4022163 . + 0 ID=BALIOE_20235;Name=hypothetical protein;locus_tag=BALIOE_20235;product=hypothetical protein;Parent=BALIOE_20235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8107 c1 Prodigal gene 4022160 4023293 . + . ID=BALIOE_20240_gene;locus_tag=BALIOE_20240 | |
| 8108 c1 Prodigal CDS 4022160 4023293 . + 0 ID=BALIOE_20240;Name=hypothetical protein;locus_tag=BALIOE_20240;product=hypothetical protein;Parent=BALIOE_20240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8109 c1 Prodigal gene 4023644 4024798 . + . ID=BALIOE_20245_gene;locus_tag=BALIOE_20245 | |
| 8110 c1 Prodigal CDS 4023644 4024798 . + 0 ID=BALIOE_20245;Name=hypothetical protein;locus_tag=BALIOE_20245;product=hypothetical protein;Parent=BALIOE_20245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8111 c1 Prodigal gene 4024811 4025671 . + . ID=BALIOE_20250_gene;locus_tag=BALIOE_20250 | |
| 8112 c1 Prodigal CDS 4024811 4025671 . + 0 ID=BALIOE_20250;Name=hypothetical protein;locus_tag=BALIOE_20250;product=hypothetical protein;Parent=BALIOE_20250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8113 c1 Prodigal gene 4025838 4026314 . + . ID=BALIOE_20255_gene;locus_tag=BALIOE_20255 | |
| 8114 c1 Prodigal CDS 4025838 4026314 . + 0 ID=BALIOE_20255;Name=hypothetical protein;locus_tag=BALIOE_20255;product=hypothetical protein;Parent=BALIOE_20255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8115 c1 Prodigal gene 4026527 4027156 . + . ID=BALIOE_20260_gene;locus_tag=BALIOE_20260 | |
| 8116 c1 Prodigal CDS 4026527 4027156 . + 0 ID=BALIOE_20260;Name=hypothetical protein;locus_tag=BALIOE_20260;product=hypothetical protein;Parent=BALIOE_20260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8117 c1 Prodigal gene 4027146 4027937 . + . ID=BALIOE_20265_gene;locus_tag=BALIOE_20265 | |
| 8118 c1 Prodigal CDS 4027146 4027937 . + 0 ID=BALIOE_20265;Name=hypothetical protein;locus_tag=BALIOE_20265;product=hypothetical protein;Parent=BALIOE_20265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8119 c1 Prodigal gene 4027992 4028153 . + . ID=BALIOE_20270_gene;locus_tag=BALIOE_20270 | |
| 8120 c1 Prodigal CDS 4027992 4028153 . + 0 ID=BALIOE_20270;Name=hypothetical protein;locus_tag=BALIOE_20270;product=hypothetical protein;Parent=BALIOE_20270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8121 c1 Prodigal gene 4028184 4028693 . + . ID=BALIOE_20275_gene;locus_tag=BALIOE_20275 | |
| 8122 c1 Prodigal CDS 4028184 4028693 . + 0 ID=BALIOE_20275;Name=hypothetical protein;locus_tag=BALIOE_20275;product=hypothetical protein;Parent=BALIOE_20275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8123 c1 Prodigal gene 4029094 4029678 . + . ID=BALIOE_20280_gene;locus_tag=BALIOE_20280 | |
| 8124 c1 Prodigal CDS 4029094 4029678 . + 0 ID=BALIOE_20280;Name=hypothetical protein;locus_tag=BALIOE_20280;product=hypothetical protein;Parent=BALIOE_20280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8125 c1 Prodigal gene 4029779 4030453 . + . ID=BALIOE_20285_gene;locus_tag=BALIOE_20285 | |
| 8126 c1 Prodigal CDS 4029779 4030453 . + 0 ID=BALIOE_20285;Name=hypothetical protein;locus_tag=BALIOE_20285;product=hypothetical protein;Parent=BALIOE_20285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8127 c1 Prodigal gene 4030482 4032998 . + . ID=BALIOE_20290_gene;locus_tag=BALIOE_20290 | |
| 8128 c1 Prodigal CDS 4030482 4032998 . + 0 ID=BALIOE_20290;Name=hypothetical protein;locus_tag=BALIOE_20290;product=hypothetical protein;Parent=BALIOE_20290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8129 c1 Prodigal gene 4033009 4033362 . + . ID=BALIOE_20295_gene;locus_tag=BALIOE_20295 | |
| 8130 c1 Prodigal CDS 4033009 4033362 . + 0 ID=BALIOE_20295;Name=hypothetical protein;locus_tag=BALIOE_20295;product=hypothetical protein;Parent=BALIOE_20295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8131 c1 Prodigal gene 4033388 4033714 . + . ID=BALIOE_20300_gene;locus_tag=BALIOE_20300 | |
| 8132 c1 Prodigal CDS 4033388 4033714 . + 0 ID=BALIOE_20300;Name=hypothetical protein;locus_tag=BALIOE_20300;product=hypothetical protein;Parent=BALIOE_20300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8133 c1 Prodigal gene 4033714 4034601 . + . ID=BALIOE_20305_gene;locus_tag=BALIOE_20305 | |
| 8134 c1 Prodigal CDS 4033714 4034601 . + 0 ID=BALIOE_20305;Name=hypothetical protein;locus_tag=BALIOE_20305;product=hypothetical protein;Parent=BALIOE_20305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8135 c1 Prodigal gene 4034567 4035058 . + . ID=BALIOE_20310_gene;locus_tag=BALIOE_20310 | |
| 8136 c1 Prodigal CDS 4034567 4035058 . + 0 ID=BALIOE_20310;Name=hypothetical protein;locus_tag=BALIOE_20310;product=hypothetical protein;Parent=BALIOE_20310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8137 c1 Prodigal gene 4035101 4035961 . - . ID=BALIOE_20315_gene;locus_tag=BALIOE_20315 | |
| 8138 c1 Prodigal CDS 4035101 4035961 . - 0 ID=BALIOE_20315;Name=hypothetical protein;locus_tag=BALIOE_20315;product=hypothetical protein;Parent=BALIOE_20315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8139 c1 Prodigal gene 4036026 4038062 . + . ID=BALIOE_20320_gene;locus_tag=BALIOE_20320 | |
| 8140 c1 Prodigal CDS 4036026 4038062 . + 0 ID=BALIOE_20320;Name=hypothetical protein;locus_tag=BALIOE_20320;product=hypothetical protein;Parent=BALIOE_20320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8141 c1 Prodigal gene 4038020 4038415 . + . ID=BALIOE_20325_gene;locus_tag=BALIOE_20325 | |
| 8142 c1 Prodigal CDS 4038020 4038415 . + 0 ID=BALIOE_20325;Name=hypothetical protein;locus_tag=BALIOE_20325;product=hypothetical protein;Parent=BALIOE_20325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8143 c1 Prodigal gene 4038435 4039025 . + . ID=BALIOE_20330_gene;locus_tag=BALIOE_20330 | |
| 8144 c1 Prodigal CDS 4038435 4039025 . + 0 ID=BALIOE_20330;Name=hypothetical protein;locus_tag=BALIOE_20330;product=hypothetical protein;Parent=BALIOE_20330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8145 c1 Prodigal gene 4039035 4039610 . + . ID=BALIOE_20335_gene;locus_tag=BALIOE_20335 | |
| 8146 c1 Prodigal CDS 4039035 4039610 . + 0 ID=BALIOE_20335;Name=hypothetical protein;locus_tag=BALIOE_20335;product=hypothetical protein;Parent=BALIOE_20335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8147 c1 Prodigal gene 4039724 4040764 . - . ID=BALIOE_20340_gene;locus_tag=BALIOE_20340 | |
| 8148 c1 Prodigal CDS 4039724 4040764 . - 0 ID=BALIOE_20340;Name=hypothetical protein;locus_tag=BALIOE_20340;product=hypothetical protein;Parent=BALIOE_20340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8149 c1 Prodigal gene 4040837 4041472 . - . ID=BALIOE_20345_gene;locus_tag=BALIOE_20345 | |
| 8150 c1 Prodigal CDS 4040837 4041472 . - 0 ID=BALIOE_20345;Name=hypothetical protein;locus_tag=BALIOE_20345;product=hypothetical protein;Parent=BALIOE_20345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8151 c1 Prodigal gene 4041600 4042118 . + . ID=BALIOE_20350_gene;locus_tag=BALIOE_20350 | |
| 8152 c1 Prodigal CDS 4041600 4042118 . + 0 ID=BALIOE_20350;Name=hypothetical protein;locus_tag=BALIOE_20350;product=hypothetical protein;Parent=BALIOE_20350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8153 c1 Prodigal gene 4042098 4042541 . - . ID=BALIOE_20355_gene;locus_tag=BALIOE_20355 | |
| 8154 c1 Prodigal CDS 4042098 4042541 . - 0 ID=BALIOE_20355;Name=hypothetical protein;locus_tag=BALIOE_20355;product=hypothetical protein;Parent=BALIOE_20355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8155 c1 Prodigal gene 4042592 4042894 . + . ID=BALIOE_20360_gene;locus_tag=BALIOE_20360 | |
| 8156 c1 Prodigal CDS 4042592 4042894 . + 0 ID=BALIOE_20360;Name=hypothetical protein;locus_tag=BALIOE_20360;product=hypothetical protein;Parent=BALIOE_20360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8157 c1 Prodigal gene 4042881 4043384 . - . ID=BALIOE_20365_gene;locus_tag=BALIOE_20365 | |
| 8158 c1 Prodigal CDS 4042881 4043384 . - 0 ID=BALIOE_20365;Name=hypothetical protein;locus_tag=BALIOE_20365;product=hypothetical protein;Parent=BALIOE_20365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8159 c1 Prodigal gene 4043378 4043902 . - . ID=BALIOE_20370_gene;locus_tag=BALIOE_20370 | |
| 8160 c1 Prodigal CDS 4043378 4043902 . - 0 ID=BALIOE_20370;Name=hypothetical protein;locus_tag=BALIOE_20370;product=hypothetical protein;Parent=BALIOE_20370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8161 c1 Prodigal gene 4044111 4045106 . + . ID=BALIOE_20375_gene;locus_tag=BALIOE_20375 | |
| 8162 c1 Prodigal CDS 4044111 4045106 . + 0 ID=BALIOE_20375;Name=hypothetical protein;locus_tag=BALIOE_20375;product=hypothetical protein;Parent=BALIOE_20375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8163 c1 Prodigal gene 4045115 4045993 . + . ID=BALIOE_20380_gene;locus_tag=BALIOE_20380 | |
| 8164 c1 Prodigal CDS 4045115 4045993 . + 0 ID=BALIOE_20380;Name=hypothetical protein;locus_tag=BALIOE_20380;product=hypothetical protein;Parent=BALIOE_20380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8165 c1 Prodigal gene 4046074 4047081 . + . ID=BALIOE_20385_gene;locus_tag=BALIOE_20385 | |
| 8166 c1 Prodigal CDS 4046074 4047081 . + 0 ID=BALIOE_20385;Name=hypothetical protein;locus_tag=BALIOE_20385;product=hypothetical protein;Parent=BALIOE_20385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8167 c1 Prodigal gene 4047198 4048442 . - . ID=BALIOE_20390_gene;locus_tag=BALIOE_20390 | |
| 8168 c1 Prodigal CDS 4047198 4048442 . - 0 ID=BALIOE_20390;Name=hypothetical protein;locus_tag=BALIOE_20390;product=hypothetical protein;Parent=BALIOE_20390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8169 c1 Prodigal gene 4048596 4050485 . - . ID=BALIOE_20395_gene;locus_tag=BALIOE_20395 | |
| 8170 c1 Prodigal CDS 4048596 4050485 . - 0 ID=BALIOE_20395;Name=hypothetical protein;locus_tag=BALIOE_20395;product=hypothetical protein;Parent=BALIOE_20395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8171 c1 Prodigal gene 4050665 4051549 . - . ID=BALIOE_20400_gene;locus_tag=BALIOE_20400 | |
| 8172 c1 Prodigal CDS 4050665 4051549 . - 0 ID=BALIOE_20400;Name=hypothetical protein;locus_tag=BALIOE_20400;product=hypothetical protein;Parent=BALIOE_20400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8173 c1 Prodigal gene 4051658 4053793 . - . ID=BALIOE_20405_gene;locus_tag=BALIOE_20405 | |
| 8174 c1 Prodigal CDS 4051658 4053793 . - 0 ID=BALIOE_20405;Name=hypothetical protein;locus_tag=BALIOE_20405;product=hypothetical protein;Parent=BALIOE_20405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8175 c1 Prodigal gene 4054040 4054309 . - . ID=BALIOE_20410_gene;locus_tag=BALIOE_20410 | |
| 8176 c1 Prodigal CDS 4054040 4054309 . - 0 ID=BALIOE_20410;Name=hypothetical protein;locus_tag=BALIOE_20410;product=hypothetical protein;Parent=BALIOE_20410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8177 c1 Prodigal gene 4054458 4055402 . - . ID=BALIOE_20415_gene;locus_tag=BALIOE_20415 | |
| 8178 c1 Prodigal CDS 4054458 4055402 . - 0 ID=BALIOE_20415;Name=hypothetical protein;locus_tag=BALIOE_20415;product=hypothetical protein;Parent=BALIOE_20415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8179 c1 Prodigal gene 4055402 4055803 . - . ID=BALIOE_20420_gene;locus_tag=BALIOE_20420 | |
| 8180 c1 Prodigal CDS 4055402 4055803 . - 0 ID=BALIOE_20420;Name=hypothetical protein;locus_tag=BALIOE_20420;product=hypothetical protein;Parent=BALIOE_20420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8181 c1 Infernal gene 4055881 4055951 . - . ID=BALIOE_20425_gene;locus_tag=BALIOE_20425;gene=naRNA4 | |
| 8182 c1 Infernal ncRNA 4055881 4055951 4.6e-11 - . ID=BALIOE_20425;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_20425;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_20425_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 8183 c1 Prodigal gene 4055968 4058640 . - . ID=BALIOE_20430_gene;locus_tag=BALIOE_20430 | |
| 8184 c1 Prodigal CDS 4055968 4058640 . - 0 ID=BALIOE_20430;Name=hypothetical protein;locus_tag=BALIOE_20430;product=hypothetical protein;Parent=BALIOE_20430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8185 c1 Prodigal gene 4058665 4060152 . - . ID=BALIOE_20435_gene;locus_tag=BALIOE_20435 | |
| 8186 c1 Prodigal CDS 4058665 4060152 . - 0 ID=BALIOE_20435;Name=hypothetical protein;locus_tag=BALIOE_20435;product=hypothetical protein;Parent=BALIOE_20435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8187 c1 Prodigal gene 4060180 4060632 . - . ID=BALIOE_20440_gene;locus_tag=BALIOE_20440 | |
| 8188 c1 Prodigal CDS 4060180 4060632 . - 0 ID=BALIOE_20440;Name=hypothetical protein;locus_tag=BALIOE_20440;product=hypothetical protein;Parent=BALIOE_20440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8189 c1 tRNAscan-SE gene 4060839 4060915 . - . ID=BALIOE_20445_gene;locus_tag=BALIOE_20445;gene=fMet_trna | |
| 8190 c1 tRNAscan-SE tRNA 4060839 4060915 . - . ID=BALIOE_20445;Name=tRNA-fMet;locus_tag=BALIOE_20445;product=tRNA-fMet;gene=fMet_trna;Parent=BALIOE_20445_gene;inference=profile:tRNAscan:2.0;Note=SO:0000266 | |
| 8191 c1 Prodigal gene 4061263 4062606 . + . ID=BALIOE_20450_gene;locus_tag=BALIOE_20450 | |
| 8192 c1 Prodigal CDS 4061263 4062606 . + 0 ID=BALIOE_20450;Name=hypothetical protein;locus_tag=BALIOE_20450;product=hypothetical protein;Parent=BALIOE_20450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8193 c1 Prodigal gene 4062614 4064131 . - . ID=BALIOE_20455_gene;locus_tag=BALIOE_20455 | |
| 8194 c1 Prodigal CDS 4062614 4064131 . - 0 ID=BALIOE_20455;Name=hypothetical protein;locus_tag=BALIOE_20455;product=hypothetical protein;Parent=BALIOE_20455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8195 c1 tRNAscan-SE gene 4064698 4064784 . - . ID=BALIOE_20460_gene;locus_tag=BALIOE_20460;gene=Leu_trna | |
| 8196 c1 tRNAscan-SE tRNA 4064698 4064784 . - . ID=BALIOE_20460;Name=tRNA-Leu;locus_tag=BALIOE_20460;product=tRNA-Leu;gene=Leu_trna;Parent=BALIOE_20460_gene;inference=profile:tRNAscan:2.0;Note=SO:0000264 | |
| 8197 c1 Prodigal gene 4064799 4065131 . - . ID=BALIOE_20465_gene;locus_tag=BALIOE_20465 | |
| 8198 c1 Prodigal CDS 4064799 4065131 . - 0 ID=BALIOE_20465;Name=hypothetical protein;locus_tag=BALIOE_20465;product=hypothetical protein;Parent=BALIOE_20465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8199 c1 Prodigal gene 4065359 4066696 . - . ID=BALIOE_20470_gene;locus_tag=BALIOE_20470 | |
| 8200 c1 Prodigal CDS 4065359 4066696 . - 0 ID=BALIOE_20470;Name=hypothetical protein;locus_tag=BALIOE_20470;product=hypothetical protein;Parent=BALIOE_20470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8201 c1 Prodigal gene 4066689 4067537 . - . ID=BALIOE_20475_gene;locus_tag=BALIOE_20475 | |
| 8202 c1 Prodigal CDS 4066689 4067537 . - 0 ID=BALIOE_20475;Name=hypothetical protein;locus_tag=BALIOE_20475;product=hypothetical protein;Parent=BALIOE_20475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8203 c1 Prodigal gene 4067627 4069570 . - . ID=BALIOE_20480_gene;locus_tag=BALIOE_20480 | |
| 8204 c1 Prodigal CDS 4067627 4069570 . - 0 ID=BALIOE_20480;Name=hypothetical protein;locus_tag=BALIOE_20480;product=hypothetical protein;Parent=BALIOE_20480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8205 c1 Prodigal gene 4069661 4070290 . - . ID=BALIOE_20485_gene;locus_tag=BALIOE_20485 | |
| 8206 c1 Prodigal CDS 4069661 4070290 . - 0 ID=BALIOE_20485;Name=hypothetical protein;locus_tag=BALIOE_20485;product=hypothetical protein;Parent=BALIOE_20485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8207 c1 Prodigal gene 4070416 4070709 . + . ID=BALIOE_20490_gene;locus_tag=BALIOE_20490 | |
| 8208 c1 Prodigal CDS 4070416 4070709 . + 0 ID=BALIOE_20490;Name=hypothetical protein;locus_tag=BALIOE_20490;product=hypothetical protein;Parent=BALIOE_20490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8209 c1 Prodigal gene 4070865 4071341 . - . ID=BALIOE_20495_gene;locus_tag=BALIOE_20495 | |
| 8210 c1 Prodigal CDS 4070865 4071341 . - 0 ID=BALIOE_20495;Name=hypothetical protein;locus_tag=BALIOE_20495;product=hypothetical protein;Parent=BALIOE_20495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8211 c1 Prodigal gene 4071589 4073022 . + . ID=BALIOE_20500_gene;locus_tag=BALIOE_20500 | |
| 8212 c1 Prodigal CDS 4071589 4073022 . + 0 ID=BALIOE_20500;Name=hypothetical protein;locus_tag=BALIOE_20500;product=hypothetical protein;Parent=BALIOE_20500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8213 c1 Prodigal gene 4073062 4074234 . - . ID=BALIOE_20505_gene;locus_tag=BALIOE_20505 | |
| 8214 c1 Prodigal CDS 4073062 4074234 . - 0 ID=BALIOE_20505;Name=hypothetical protein;locus_tag=BALIOE_20505;product=hypothetical protein;Parent=BALIOE_20505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8215 c1 Prodigal gene 4074250 4075215 . - . ID=BALIOE_20510_gene;locus_tag=BALIOE_20510 | |
| 8216 c1 Prodigal CDS 4074250 4075215 . - 0 ID=BALIOE_20510;Name=hypothetical protein;locus_tag=BALIOE_20510;product=hypothetical protein;Parent=BALIOE_20510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8217 c1 Prodigal gene 4075342 4075599 . - . ID=BALIOE_20515_gene;locus_tag=BALIOE_20515 | |
| 8218 c1 Prodigal CDS 4075342 4075599 . - 0 ID=BALIOE_20515;Name=hypothetical protein;locus_tag=BALIOE_20515;product=hypothetical protein;Parent=BALIOE_20515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8219 c1 Prodigal gene 4075620 4075931 . - . ID=BALIOE_20520_gene;locus_tag=BALIOE_20520 | |
| 8220 c1 Prodigal CDS 4075620 4075931 . - 0 ID=BALIOE_20520;Name=hypothetical protein;locus_tag=BALIOE_20520;product=hypothetical protein;Parent=BALIOE_20520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8221 c1 Prodigal gene 4076190 4077161 . + . ID=BALIOE_20525_gene;locus_tag=BALIOE_20525 | |
| 8222 c1 Prodigal CDS 4076190 4077161 . + 0 ID=BALIOE_20525;Name=hypothetical protein;locus_tag=BALIOE_20525;product=hypothetical protein;Parent=BALIOE_20525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8223 c1 Prodigal gene 4077390 4077668 . + . ID=BALIOE_20530_gene;locus_tag=BALIOE_20530 | |
| 8224 c1 Prodigal CDS 4077390 4077668 . + 0 ID=BALIOE_20530;Name=hypothetical protein;locus_tag=BALIOE_20530;product=hypothetical protein;Parent=BALIOE_20530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8225 c1 Prodigal gene 4077716 4078975 . - . ID=BALIOE_20535_gene;locus_tag=BALIOE_20535 | |
| 8226 c1 Prodigal CDS 4077716 4078975 . - 0 ID=BALIOE_20535;Name=hypothetical protein;locus_tag=BALIOE_20535;product=hypothetical protein;Parent=BALIOE_20535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8227 c1 Prodigal gene 4079030 4079299 . - . ID=BALIOE_20540_gene;locus_tag=BALIOE_20540 | |
| 8228 c1 Prodigal CDS 4079030 4079299 . - 0 ID=BALIOE_20540;Name=hypothetical protein;locus_tag=BALIOE_20540;product=hypothetical protein;Parent=BALIOE_20540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8229 c1 Prodigal gene 4079444 4079737 . - . ID=BALIOE_20545_gene;locus_tag=BALIOE_20545 | |
| 8230 c1 Prodigal CDS 4079444 4079737 . - 0 ID=BALIOE_20545;Name=hypothetical protein;locus_tag=BALIOE_20545;product=hypothetical protein;Parent=BALIOE_20545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8231 c1 Prodigal gene 4079737 4080372 . - . ID=BALIOE_20550_gene;locus_tag=BALIOE_20550 | |
| 8232 c1 Prodigal CDS 4079737 4080372 . - 0 ID=BALIOE_20550;Name=hypothetical protein;locus_tag=BALIOE_20550;product=hypothetical protein;Parent=BALIOE_20550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8233 c1 Prodigal gene 4080391 4080942 . - . ID=BALIOE_20555_gene;locus_tag=BALIOE_20555 | |
| 8234 c1 Prodigal CDS 4080391 4080942 . - 0 ID=BALIOE_20555;Name=hypothetical protein;locus_tag=BALIOE_20555;product=hypothetical protein;Parent=BALIOE_20555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8235 c1 Prodigal gene 4080947 4081729 . - . ID=BALIOE_20560_gene;locus_tag=BALIOE_20560 | |
| 8236 c1 Prodigal CDS 4080947 4081729 . - 0 ID=BALIOE_20560;Name=hypothetical protein;locus_tag=BALIOE_20560;product=hypothetical protein;Parent=BALIOE_20560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8237 c1 Prodigal gene 4081737 4082546 . - . ID=BALIOE_20565_gene;locus_tag=BALIOE_20565 | |
| 8238 c1 Prodigal CDS 4081737 4082546 . - 0 ID=BALIOE_20565;Name=hypothetical protein;locus_tag=BALIOE_20565;product=hypothetical protein;Parent=BALIOE_20565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8239 c1 Prodigal gene 4082756 4083733 . + . ID=BALIOE_20570_gene;locus_tag=BALIOE_20570 | |
| 8240 c1 Prodigal CDS 4082756 4083733 . + 0 ID=BALIOE_20570;Name=hypothetical protein;locus_tag=BALIOE_20570;product=hypothetical protein;Parent=BALIOE_20570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8241 c1 Prodigal gene 4083747 4084733 . + . ID=BALIOE_20575_gene;locus_tag=BALIOE_20575 | |
| 8242 c1 Prodigal CDS 4083747 4084733 . + 0 ID=BALIOE_20575;Name=hypothetical protein;locus_tag=BALIOE_20575;product=hypothetical protein;Parent=BALIOE_20575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8243 c1 Prodigal gene 4084754 4085320 . + . ID=BALIOE_20580_gene;locus_tag=BALIOE_20580 | |
| 8244 c1 Prodigal CDS 4084754 4085320 . + 0 ID=BALIOE_20580;Name=hypothetical protein;locus_tag=BALIOE_20580;product=hypothetical protein;Parent=BALIOE_20580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8245 c1 Prodigal gene 4085317 4085892 . + . ID=BALIOE_20585_gene;locus_tag=BALIOE_20585 | |
| 8246 c1 Prodigal CDS 4085317 4085892 . + 0 ID=BALIOE_20585;Name=hypothetical protein;locus_tag=BALIOE_20585;product=hypothetical protein;Parent=BALIOE_20585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8247 c1 Prodigal gene 4085861 4086418 . + . ID=BALIOE_20590_gene;locus_tag=BALIOE_20590 | |
| 8248 c1 Prodigal CDS 4085861 4086418 . + 0 ID=BALIOE_20590;Name=hypothetical protein;locus_tag=BALIOE_20590;product=hypothetical protein;Parent=BALIOE_20590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8249 c1 Prodigal gene 4086425 4087150 . + . ID=BALIOE_20595_gene;locus_tag=BALIOE_20595 | |
| 8250 c1 Prodigal CDS 4086425 4087150 . + 0 ID=BALIOE_20595;Name=hypothetical protein;locus_tag=BALIOE_20595;product=hypothetical protein;Parent=BALIOE_20595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8251 c1 Prodigal gene 4087198 4088631 . + . ID=BALIOE_20600_gene;locus_tag=BALIOE_20600 | |
| 8252 c1 Prodigal CDS 4087198 4088631 . + 0 ID=BALIOE_20600;Name=hypothetical protein;locus_tag=BALIOE_20600;product=hypothetical protein;Parent=BALIOE_20600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8253 c1 Prodigal gene 4088654 4088941 . + . ID=BALIOE_20605_gene;locus_tag=BALIOE_20605 | |
| 8254 c1 Prodigal CDS 4088654 4088941 . + 0 ID=BALIOE_20605;Name=hypothetical protein;locus_tag=BALIOE_20605;product=hypothetical protein;Parent=BALIOE_20605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8255 c1 Prodigal gene 4089059 4089550 . + . ID=BALIOE_20610_gene;locus_tag=BALIOE_20610 | |
| 8256 c1 Prodigal CDS 4089059 4089550 . + 0 ID=BALIOE_20610;Name=hypothetical protein;locus_tag=BALIOE_20610;product=hypothetical protein;Parent=BALIOE_20610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8257 c1 Prodigal gene 4089596 4090450 . + . ID=BALIOE_20615_gene;locus_tag=BALIOE_20615 | |
| 8258 c1 Prodigal CDS 4089596 4090450 . + 0 ID=BALIOE_20615;Name=hypothetical protein;locus_tag=BALIOE_20615;product=hypothetical protein;Parent=BALIOE_20615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8259 c1 Prodigal gene 4090447 4090719 . + . ID=BALIOE_20620_gene;locus_tag=BALIOE_20620 | |
| 8260 c1 Prodigal CDS 4090447 4090719 . + 0 ID=BALIOE_20620;Name=hypothetical protein;locus_tag=BALIOE_20620;product=hypothetical protein;Parent=BALIOE_20620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8261 c1 Prodigal gene 4090933 4091565 . + . ID=BALIOE_20625_gene;locus_tag=BALIOE_20625 | |
| 8262 c1 Prodigal CDS 4090933 4091565 . + 0 ID=BALIOE_20625;Name=hypothetical protein;locus_tag=BALIOE_20625;product=hypothetical protein;Parent=BALIOE_20625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8263 c1 Prodigal gene 4091562 4092290 . - . ID=BALIOE_20630_gene;locus_tag=BALIOE_20630 | |
| 8264 c1 Prodigal CDS 4091562 4092290 . - 0 ID=BALIOE_20630;Name=hypothetical protein;locus_tag=BALIOE_20630;product=hypothetical protein;Parent=BALIOE_20630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8265 c1 Prodigal gene 4092287 4092940 . - . ID=BALIOE_20635_gene;locus_tag=BALIOE_20635 | |
| 8266 c1 Prodigal CDS 4092287 4092940 . - 0 ID=BALIOE_20635;Name=hypothetical protein;locus_tag=BALIOE_20635;product=hypothetical protein;Parent=BALIOE_20635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8267 c1 Prodigal gene 4093170 4095506 . - . ID=BALIOE_20640_gene;locus_tag=BALIOE_20640 | |
| 8268 c1 Prodigal CDS 4093170 4095506 . - 0 ID=BALIOE_20640;Name=hypothetical protein;locus_tag=BALIOE_20640;product=hypothetical protein;Parent=BALIOE_20640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8269 c1 Prodigal gene 4095602 4096531 . - . ID=BALIOE_20645_gene;locus_tag=BALIOE_20645 | |
| 8270 c1 Prodigal CDS 4095602 4096531 . - 0 ID=BALIOE_20645;Name=hypothetical protein;locus_tag=BALIOE_20645;product=hypothetical protein;Parent=BALIOE_20645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8271 c1 Prodigal gene 4097112 4101665 . + . ID=BALIOE_20650_gene;locus_tag=BALIOE_20650 | |
| 8272 c1 Prodigal CDS 4097112 4101665 . + 0 ID=BALIOE_20650;Name=hypothetical protein;locus_tag=BALIOE_20650;product=hypothetical protein;Parent=BALIOE_20650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8273 c1 Prodigal gene 4101678 4103096 . + . ID=BALIOE_20655_gene;locus_tag=BALIOE_20655 | |
| 8274 c1 Prodigal CDS 4101678 4103096 . + 0 ID=BALIOE_20655;Name=hypothetical protein;locus_tag=BALIOE_20655;product=hypothetical protein;Parent=BALIOE_20655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8275 c1 Prodigal gene 4103280 4104329 . + . ID=BALIOE_20660_gene;locus_tag=BALIOE_20660 | |
| 8276 c1 Prodigal CDS 4103280 4104329 . + 0 ID=BALIOE_20660;Name=hypothetical protein;locus_tag=BALIOE_20660;product=hypothetical protein;Parent=BALIOE_20660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8277 c1 Prodigal gene 4104389 4104853 . - . ID=BALIOE_20665_gene;locus_tag=BALIOE_20665 | |
| 8278 c1 Prodigal CDS 4104389 4104853 . - 0 ID=BALIOE_20665;Name=hypothetical protein;locus_tag=BALIOE_20665;product=hypothetical protein;Parent=BALIOE_20665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8279 c1 Prodigal gene 4104850 4105725 . - . ID=BALIOE_20670_gene;locus_tag=BALIOE_20670 | |
| 8280 c1 Prodigal CDS 4104850 4105725 . - 0 ID=BALIOE_20670;Name=hypothetical protein;locus_tag=BALIOE_20670;product=hypothetical protein;Parent=BALIOE_20670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8281 c1 Prodigal gene 4105722 4106411 . - . ID=BALIOE_20675_gene;locus_tag=BALIOE_20675 | |
| 8282 c1 Prodigal CDS 4105722 4106411 . - 0 ID=BALIOE_20675;Name=hypothetical protein;locus_tag=BALIOE_20675;product=hypothetical protein;Parent=BALIOE_20675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8283 c1 Prodigal gene 4106459 4107949 . - . ID=BALIOE_20680_gene;locus_tag=BALIOE_20680 | |
| 8284 c1 Prodigal CDS 4106459 4107949 . - 0 ID=BALIOE_20680;Name=hypothetical protein;locus_tag=BALIOE_20680;product=hypothetical protein;Parent=BALIOE_20680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8285 c1 Prodigal gene 4108058 4108951 . - . ID=BALIOE_20685_gene;locus_tag=BALIOE_20685 | |
| 8286 c1 Prodigal CDS 4108058 4108951 . - 0 ID=BALIOE_20685;Name=hypothetical protein;locus_tag=BALIOE_20685;product=hypothetical protein;Parent=BALIOE_20685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8287 c1 Prodigal gene 4109073 4109864 . - . ID=BALIOE_20690_gene;locus_tag=BALIOE_20690 | |
| 8288 c1 Prodigal CDS 4109073 4109864 . - 0 ID=BALIOE_20690;Name=hypothetical protein;locus_tag=BALIOE_20690;product=hypothetical protein;Parent=BALIOE_20690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8289 c1 Prodigal gene 4110244 4111608 . + . ID=BALIOE_20695_gene;locus_tag=BALIOE_20695 | |
| 8290 c1 Prodigal CDS 4110244 4111608 . + 0 ID=BALIOE_20695;Name=hypothetical protein;locus_tag=BALIOE_20695;product=hypothetical protein;Parent=BALIOE_20695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8291 c1 Prodigal gene 4111643 4112140 . - . ID=BALIOE_20700_gene;locus_tag=BALIOE_20700 | |
| 8292 c1 Prodigal CDS 4111643 4112140 . - 0 ID=BALIOE_20700;Name=hypothetical protein;locus_tag=BALIOE_20700;product=hypothetical protein;Parent=BALIOE_20700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8293 c1 Prodigal gene 4112146 4112784 . - . ID=BALIOE_20705_gene;locus_tag=BALIOE_20705 | |
| 8294 c1 Prodigal CDS 4112146 4112784 . - 0 ID=BALIOE_20705;Name=hypothetical protein;locus_tag=BALIOE_20705;product=hypothetical protein;Parent=BALIOE_20705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8295 c1 Prodigal gene 4113179 4113571 . - . ID=BALIOE_20710_gene;locus_tag=BALIOE_20710 | |
| 8296 c1 Prodigal CDS 4113179 4113571 . - 0 ID=BALIOE_20710;Name=hypothetical protein;locus_tag=BALIOE_20710;product=hypothetical protein;Parent=BALIOE_20710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8297 c1 Prodigal gene 4113587 4114015 . - . ID=BALIOE_20715_gene;locus_tag=BALIOE_20715 | |
| 8298 c1 Prodigal CDS 4113587 4114015 . - 0 ID=BALIOE_20715;Name=hypothetical protein;locus_tag=BALIOE_20715;product=hypothetical protein;Parent=BALIOE_20715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8299 c1 Prodigal gene 4114234 4115361 . - . ID=BALIOE_20720_gene;locus_tag=BALIOE_20720 | |
| 8300 c1 Prodigal CDS 4114234 4115361 . - 0 ID=BALIOE_20720;Name=hypothetical protein;locus_tag=BALIOE_20720;product=hypothetical protein;Parent=BALIOE_20720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8301 c1 Prodigal gene 4115555 4115953 . + . ID=BALIOE_20725_gene;locus_tag=BALIOE_20725 | |
| 8302 c1 Prodigal CDS 4115555 4115953 . + 0 ID=BALIOE_20725;Name=hypothetical protein;locus_tag=BALIOE_20725;product=hypothetical protein;Parent=BALIOE_20725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8303 c1 Prodigal gene 4116107 4117474 . + . ID=BALIOE_20730_gene;locus_tag=BALIOE_20730 | |
| 8304 c1 Prodigal CDS 4116107 4117474 . + 0 ID=BALIOE_20730;Name=hypothetical protein;locus_tag=BALIOE_20730;product=hypothetical protein;Parent=BALIOE_20730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8305 c1 Prodigal gene 4117564 4118631 . + . ID=BALIOE_20735_gene;locus_tag=BALIOE_20735 | |
| 8306 c1 Prodigal CDS 4117564 4118631 . + 0 ID=BALIOE_20735;Name=hypothetical protein;locus_tag=BALIOE_20735;product=hypothetical protein;Parent=BALIOE_20735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8307 c1 Prodigal gene 4118695 4119633 . - . ID=BALIOE_20740_gene;locus_tag=BALIOE_20740 | |
| 8308 c1 Prodigal CDS 4118695 4119633 . - 0 ID=BALIOE_20740;Name=hypothetical protein;locus_tag=BALIOE_20740;product=hypothetical protein;Parent=BALIOE_20740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8309 c1 Prodigal gene 4120068 4120538 . + . ID=BALIOE_20745_gene;locus_tag=BALIOE_20745 | |
| 8310 c1 Prodigal CDS 4120068 4120538 . + 0 ID=BALIOE_20745;Name=hypothetical protein;locus_tag=BALIOE_20745;product=hypothetical protein;Parent=BALIOE_20745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8311 c1 Prodigal gene 4120903 4121166 . + . ID=BALIOE_20750_gene;locus_tag=BALIOE_20750 | |
| 8312 c1 Prodigal CDS 4120903 4121166 . + 0 ID=BALIOE_20750;Name=hypothetical protein;locus_tag=BALIOE_20750;product=hypothetical protein;Parent=BALIOE_20750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8313 c1 Prodigal gene 4121222 4121494 . - . ID=BALIOE_20755_gene;locus_tag=BALIOE_20755 | |
| 8314 c1 Prodigal CDS 4121222 4121494 . - 0 ID=BALIOE_20755;Name=hypothetical protein;locus_tag=BALIOE_20755;product=hypothetical protein;Parent=BALIOE_20755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8315 c1 Prodigal gene 4121586 4123553 . - . ID=BALIOE_20760_gene;locus_tag=BALIOE_20760 | |
| 8316 c1 Prodigal CDS 4121586 4123553 . - 0 ID=BALIOE_20760;Name=hypothetical protein;locus_tag=BALIOE_20760;product=hypothetical protein;Parent=BALIOE_20760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8317 c1 Prodigal gene 4123559 4124488 . - . ID=BALIOE_20765_gene;locus_tag=BALIOE_20765 | |
| 8318 c1 Prodigal CDS 4123559 4124488 . - 0 ID=BALIOE_20765;Name=hypothetical protein;locus_tag=BALIOE_20765;product=hypothetical protein;Parent=BALIOE_20765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8319 c1 Prodigal gene 4124496 4124699 . - . ID=BALIOE_20770_gene;locus_tag=BALIOE_20770 | |
| 8320 c1 Prodigal CDS 4124496 4124699 . - 0 ID=BALIOE_20770;Name=hypothetical protein;locus_tag=BALIOE_20770;product=hypothetical protein;Parent=BALIOE_20770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8321 c1 Prodigal gene 4124882 4125811 . + . ID=BALIOE_20775_gene;locus_tag=BALIOE_20775 | |
| 8322 c1 Prodigal CDS 4124882 4125811 . + 0 ID=BALIOE_20775;Name=hypothetical protein;locus_tag=BALIOE_20775;product=hypothetical protein;Parent=BALIOE_20775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8323 c1 Prodigal gene 4125945 4127390 . - . ID=BALIOE_20780_gene;locus_tag=BALIOE_20780 | |
| 8324 c1 Prodigal CDS 4125945 4127390 . - 0 ID=BALIOE_20780;Name=hypothetical protein;locus_tag=BALIOE_20780;product=hypothetical protein;Parent=BALIOE_20780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8325 c1 Prodigal gene 4127546 4131346 . - . ID=BALIOE_20785_gene;locus_tag=BALIOE_20785 | |
| 8326 c1 Prodigal CDS 4127546 4131346 . - 0 ID=BALIOE_20785;Name=hypothetical protein;locus_tag=BALIOE_20785;product=hypothetical protein;Parent=BALIOE_20785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8327 c1 Prodigal gene 4131414 4132883 . - . ID=BALIOE_20790_gene;locus_tag=BALIOE_20790 | |
| 8328 c1 Prodigal CDS 4131414 4132883 . - 0 ID=BALIOE_20790;Name=hypothetical protein;locus_tag=BALIOE_20790;product=hypothetical protein;Parent=BALIOE_20790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8329 c1 Prodigal gene 4132873 4133466 . - . ID=BALIOE_20795_gene;locus_tag=BALIOE_20795 | |
| 8330 c1 Prodigal CDS 4132873 4133466 . - 0 ID=BALIOE_20795;Name=hypothetical protein;locus_tag=BALIOE_20795;product=hypothetical protein;Parent=BALIOE_20795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8331 c1 Prodigal gene 4133475 4133963 . - . ID=BALIOE_20800_gene;locus_tag=BALIOE_20800 | |
| 8332 c1 Prodigal CDS 4133475 4133963 . - 0 ID=BALIOE_20800;Name=hypothetical protein;locus_tag=BALIOE_20800;product=hypothetical protein;Parent=BALIOE_20800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8333 c1 Prodigal gene 4133963 4135066 . - . ID=BALIOE_20805_gene;locus_tag=BALIOE_20805 | |
| 8334 c1 Prodigal CDS 4133963 4135066 . - 0 ID=BALIOE_20805;Name=hypothetical protein;locus_tag=BALIOE_20805;product=hypothetical protein;Parent=BALIOE_20805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8335 c1 Prodigal gene 4135132 4136175 . - . ID=BALIOE_20810_gene;locus_tag=BALIOE_20810 | |
| 8336 c1 Prodigal CDS 4135132 4136175 . - 0 ID=BALIOE_20810;Name=hypothetical protein;locus_tag=BALIOE_20810;product=hypothetical protein;Parent=BALIOE_20810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8337 c1 Prodigal gene 4136480 4138420 . - . ID=BALIOE_20815_gene;locus_tag=BALIOE_20815 | |
| 8338 c1 Prodigal CDS 4136480 4138420 . - 0 ID=BALIOE_20815;Name=hypothetical protein;locus_tag=BALIOE_20815;product=hypothetical protein;Parent=BALIOE_20815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8339 c1 Prodigal gene 4138572 4139546 . + . ID=BALIOE_20820_gene;locus_tag=BALIOE_20820 | |
| 8340 c1 Prodigal CDS 4138572 4139546 . + 0 ID=BALIOE_20820;Name=hypothetical protein;locus_tag=BALIOE_20820;product=hypothetical protein;Parent=BALIOE_20820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8341 c1 Prodigal gene 4140524 4140994 . + . ID=BALIOE_20825_gene;locus_tag=BALIOE_20825 | |
| 8342 c1 Prodigal CDS 4140524 4140994 . + 0 ID=BALIOE_20825;Name=hypothetical protein;locus_tag=BALIOE_20825;product=hypothetical protein;Parent=BALIOE_20825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8343 c1 Prodigal gene 4141005 4142354 . + . ID=BALIOE_20830_gene;locus_tag=BALIOE_20830 | |
| 8344 c1 Prodigal CDS 4141005 4142354 . + 0 ID=BALIOE_20830;Name=hypothetical protein;locus_tag=BALIOE_20830;product=hypothetical protein;Parent=BALIOE_20830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8345 c1 Prodigal gene 4142463 4142705 . + . ID=BALIOE_20835_gene;locus_tag=BALIOE_20835 | |
| 8346 c1 Prodigal CDS 4142463 4142705 . + 0 ID=BALIOE_20835;Name=hypothetical protein;locus_tag=BALIOE_20835;product=hypothetical protein;Parent=BALIOE_20835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8347 c1 Prodigal gene 4142695 4144146 . + . ID=BALIOE_20840_gene;locus_tag=BALIOE_20840 | |
| 8348 c1 Prodigal CDS 4142695 4144146 . + 0 ID=BALIOE_20840;Name=hypothetical protein;locus_tag=BALIOE_20840;product=hypothetical protein;Parent=BALIOE_20840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8349 c1 Prodigal gene 4144158 4145039 . + . ID=BALIOE_20845_gene;locus_tag=BALIOE_20845 | |
| 8350 c1 Prodigal CDS 4144158 4145039 . + 0 ID=BALIOE_20845;Name=hypothetical protein;locus_tag=BALIOE_20845;product=hypothetical protein;Parent=BALIOE_20845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8351 c1 Prodigal gene 4145368 4146333 . + . ID=BALIOE_20850_gene;locus_tag=BALIOE_20850 | |
| 8352 c1 Prodigal CDS 4145368 4146333 . + 0 ID=BALIOE_20850;Name=hypothetical protein;locus_tag=BALIOE_20850;product=hypothetical protein;Parent=BALIOE_20850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8353 c1 Prodigal gene 4146359 4146655 . + . ID=BALIOE_20855_gene;locus_tag=BALIOE_20855 | |
| 8354 c1 Prodigal CDS 4146359 4146655 . + 0 ID=BALIOE_20855;Name=hypothetical protein;locus_tag=BALIOE_20855;product=hypothetical protein;Parent=BALIOE_20855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8355 c1 Prodigal gene 4146740 4147624 . + . ID=BALIOE_20860_gene;locus_tag=BALIOE_20860 | |
| 8356 c1 Prodigal CDS 4146740 4147624 . + 0 ID=BALIOE_20860;Name=hypothetical protein;locus_tag=BALIOE_20860;product=hypothetical protein;Parent=BALIOE_20860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8357 c1 Prodigal gene 4147708 4147887 . + . ID=BALIOE_20865_gene;locus_tag=BALIOE_20865 | |
| 8358 c1 Prodigal CDS 4147708 4147887 . + 0 ID=BALIOE_20865;Name=hypothetical protein;locus_tag=BALIOE_20865;product=hypothetical protein;Parent=BALIOE_20865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8359 c1 Prodigal gene 4147890 4148552 . - . ID=BALIOE_20870_gene;locus_tag=BALIOE_20870 | |
| 8360 c1 Prodigal CDS 4147890 4148552 . - 0 ID=BALIOE_20870;Name=hypothetical protein;locus_tag=BALIOE_20870;product=hypothetical protein;Parent=BALIOE_20870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8361 c1 Prodigal gene 4148951 4150108 . + . ID=BALIOE_20875_gene;locus_tag=BALIOE_20875 | |
| 8362 c1 Prodigal CDS 4148951 4150108 . + 0 ID=BALIOE_20875;Name=hypothetical protein;locus_tag=BALIOE_20875;product=hypothetical protein;Parent=BALIOE_20875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8363 c1 Prodigal gene 4150120 4152006 . + . ID=BALIOE_20880_gene;locus_tag=BALIOE_20880 | |
| 8364 c1 Prodigal CDS 4150120 4152006 . + 0 ID=BALIOE_20880;Name=hypothetical protein;locus_tag=BALIOE_20880;product=hypothetical protein;Parent=BALIOE_20880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8365 c1 Prodigal gene 4152037 4153269 . + . ID=BALIOE_20885_gene;locus_tag=BALIOE_20885 | |
| 8366 c1 Prodigal CDS 4152037 4153269 . + 0 ID=BALIOE_20885;Name=hypothetical protein;locus_tag=BALIOE_20885;product=hypothetical protein;Parent=BALIOE_20885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8367 c1 Prodigal gene 4153120 4153416 . - . ID=BALIOE_20890_gene;locus_tag=BALIOE_20890 | |
| 8368 c1 Prodigal CDS 4153120 4153416 . - 0 ID=BALIOE_20890;Name=hypothetical protein;locus_tag=BALIOE_20890;product=hypothetical protein;Parent=BALIOE_20890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8369 c1 Prodigal gene 4153522 4153743 . + . ID=BALIOE_20895_gene;locus_tag=BALIOE_20895 | |
| 8370 c1 Prodigal CDS 4153522 4153743 . + 0 ID=BALIOE_20895;Name=hypothetical protein;locus_tag=BALIOE_20895;product=hypothetical protein;Parent=BALIOE_20895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8371 c1 Prodigal gene 4154174 4155199 . + . ID=BALIOE_20900_gene;locus_tag=BALIOE_20900 | |
| 8372 c1 Prodigal CDS 4154174 4155199 . + 0 ID=BALIOE_20900;Name=hypothetical protein;locus_tag=BALIOE_20900;product=hypothetical protein;Parent=BALIOE_20900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8373 c1 Prodigal gene 4155267 4156448 . + . ID=BALIOE_20905_gene;locus_tag=BALIOE_20905 | |
| 8374 c1 Prodigal CDS 4155267 4156448 . + 0 ID=BALIOE_20905;Name=hypothetical protein;locus_tag=BALIOE_20905;product=hypothetical protein;Parent=BALIOE_20905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8375 c1 Prodigal gene 4156458 4157561 . + . ID=BALIOE_20910_gene;locus_tag=BALIOE_20910 | |
| 8376 c1 Prodigal CDS 4156458 4157561 . + 0 ID=BALIOE_20910;Name=hypothetical protein;locus_tag=BALIOE_20910;product=hypothetical protein;Parent=BALIOE_20910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8377 c1 Prodigal gene 4157569 4158327 . + . ID=BALIOE_20915_gene;locus_tag=BALIOE_20915 | |
| 8378 c1 Prodigal CDS 4157569 4158327 . + 0 ID=BALIOE_20915;Name=hypothetical protein;locus_tag=BALIOE_20915;product=hypothetical protein;Parent=BALIOE_20915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8379 c1 tRNAscan-SE gene 4158713 4158788 . - . ID=BALIOE_20920_gene;locus_tag=BALIOE_20920;gene=Thr_trna | |
| 8380 c1 tRNAscan-SE tRNA 4158713 4158788 . - . ID=BALIOE_20920;Name=tRNA-Thr;locus_tag=BALIOE_20920;product=tRNA-Thr;gene=Thr_trna;Parent=BALIOE_20920_gene;inference=profile:tRNAscan:2.0;Note=SO:0000270 | |
| 8381 c1 tRNAscan-SE gene 4162099 4162174 . - . ID=BALIOE_20925_gene;locus_tag=BALIOE_20925;gene=Ala_trna | |
| 8382 c1 tRNAscan-SE tRNA 4162099 4162174 . - . ID=BALIOE_20925;Name=tRNA-Ala;locus_tag=BALIOE_20925;product=tRNA-Ala;gene=Ala_trna;Parent=BALIOE_20925_gene;inference=profile:tRNAscan:2.0;Note=SO:0000254 | |
| 8383 c1 tRNAscan-SE gene 4162217 4162293 . - . ID=BALIOE_20930_gene;locus_tag=BALIOE_20930;gene=Ile_trna | |
| 8384 c1 tRNAscan-SE tRNA 4162217 4162293 . - . ID=BALIOE_20930;Name=tRNA-Ile;locus_tag=BALIOE_20930;product=tRNA-Ile;gene=Ile_trna;Parent=BALIOE_20930_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 8385 c1 Infernal gene 4162362 4163903 . - . ID=BALIOE_20935_gene;locus_tag=BALIOE_20935;gene=16S_rrna | |
| 8386 c1 Infernal rRNA 4162362 4163903 9.6e-49 - . ID=BALIOE_20935;Name=16S ribosomal RNA;locus_tag=BALIOE_20935;gene=16S_rrna;product=16S ribosomal RNA;Dbxref=GO:0005840,GO:0003735,RFAM:RF00177;Parent=BALIOE_20935_gene;inference=profile:Rfam:RF00177;Note=SO:0001000 | |
| 8387 c1 Prodigal gene 4164376 4164930 . + . ID=BALIOE_20940_gene;locus_tag=BALIOE_20940 | |
| 8388 c1 Prodigal CDS 4164376 4164930 . + 0 ID=BALIOE_20940;Name=hypothetical protein;locus_tag=BALIOE_20940;product=hypothetical protein;Parent=BALIOE_20940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8389 c1 Prodigal gene 4164906 4165163 . - . ID=BALIOE_20945_gene;locus_tag=BALIOE_20945 | |
| 8390 c1 Prodigal CDS 4164906 4165163 . - 0 ID=BALIOE_20945;Name=hypothetical protein;locus_tag=BALIOE_20945;product=hypothetical protein;Parent=BALIOE_20945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8391 c1 Prodigal gene 4165160 4165978 . - . ID=BALIOE_20950_gene;locus_tag=BALIOE_20950 | |
| 8392 c1 Prodigal CDS 4165160 4165978 . - 0 ID=BALIOE_20950;Name=hypothetical protein;locus_tag=BALIOE_20950;product=hypothetical protein;Parent=BALIOE_20950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8393 c1 Prodigal gene 4165983 4166555 . - . ID=BALIOE_20955_gene;locus_tag=BALIOE_20955 | |
| 8394 c1 Prodigal CDS 4165983 4166555 . - 0 ID=BALIOE_20955;Name=hypothetical protein;locus_tag=BALIOE_20955;product=hypothetical protein;Parent=BALIOE_20955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8395 c1 Prodigal gene 4166560 4167102 . - . ID=BALIOE_20960_gene;locus_tag=BALIOE_20960 | |
| 8396 c1 Prodigal CDS 4166560 4167102 . - 0 ID=BALIOE_20960;Name=hypothetical protein;locus_tag=BALIOE_20960;product=hypothetical protein;Parent=BALIOE_20960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8397 c1 Prodigal gene 4167131 4167604 . - . ID=BALIOE_20965_gene;locus_tag=BALIOE_20965 | |
| 8398 c1 Prodigal CDS 4167131 4167604 . - 0 ID=BALIOE_20965;Name=hypothetical protein;locus_tag=BALIOE_20965;product=hypothetical protein;Parent=BALIOE_20965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8399 c1 Prodigal gene 4167576 4168700 . - . ID=BALIOE_20970_gene;locus_tag=BALIOE_20970 | |
| 8400 c1 Prodigal CDS 4167576 4168700 . - 0 ID=BALIOE_20970;Name=hypothetical protein;locus_tag=BALIOE_20970;product=hypothetical protein;Parent=BALIOE_20970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8401 c1 Prodigal gene 4168830 4169339 . + . ID=BALIOE_20975_gene;locus_tag=BALIOE_20975 | |
| 8402 c1 Prodigal CDS 4168830 4169339 . + 0 ID=BALIOE_20975;Name=hypothetical protein;locus_tag=BALIOE_20975;product=hypothetical protein;Parent=BALIOE_20975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8403 c1 Prodigal gene 4169354 4170301 . + . ID=BALIOE_20980_gene;locus_tag=BALIOE_20980 | |
| 8404 c1 Prodigal CDS 4169354 4170301 . + 0 ID=BALIOE_20980;Name=hypothetical protein;locus_tag=BALIOE_20980;product=hypothetical protein;Parent=BALIOE_20980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8405 c1 Prodigal gene 4170347 4171636 . + . ID=BALIOE_20985_gene;locus_tag=BALIOE_20985 | |
| 8406 c1 Prodigal CDS 4170347 4171636 . + 0 ID=BALIOE_20985;Name=hypothetical protein;locus_tag=BALIOE_20985;product=hypothetical protein;Parent=BALIOE_20985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8407 c1 Prodigal gene 4171658 4173034 . + . ID=BALIOE_20990_gene;locus_tag=BALIOE_20990 | |
| 8408 c1 Prodigal CDS 4171658 4173034 . + 0 ID=BALIOE_20990;Name=hypothetical protein;locus_tag=BALIOE_20990;product=hypothetical protein;Parent=BALIOE_20990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8409 c1 Prodigal gene 4173164 4173574 . + . ID=BALIOE_20995_gene;locus_tag=BALIOE_20995 | |
| 8410 c1 Prodigal CDS 4173164 4173574 . + 0 ID=BALIOE_20995;Name=hypothetical protein;locus_tag=BALIOE_20995;product=hypothetical protein;Parent=BALIOE_20995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8411 c1 Prodigal gene 4173571 4173789 . - . ID=BALIOE_21000_gene;locus_tag=BALIOE_21000 | |
| 8412 c1 Prodigal CDS 4173571 4173789 . - 0 ID=BALIOE_21000;Name=hypothetical protein;locus_tag=BALIOE_21000;product=hypothetical protein;Parent=BALIOE_21000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8413 c1 Prodigal gene 4173845 4174270 . - . ID=BALIOE_21005_gene;locus_tag=BALIOE_21005 | |
| 8414 c1 Prodigal CDS 4173845 4174270 . - 0 ID=BALIOE_21005;Name=hypothetical protein;locus_tag=BALIOE_21005;product=hypothetical protein;Parent=BALIOE_21005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8415 c1 Prodigal gene 4174281 4174649 . - . ID=BALIOE_21010_gene;locus_tag=BALIOE_21010 | |
| 8416 c1 Prodigal CDS 4174281 4174649 . - 0 ID=BALIOE_21010;Name=hypothetical protein;locus_tag=BALIOE_21010;product=hypothetical protein;Parent=BALIOE_21010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8417 c1 Prodigal gene 4174756 4175139 . - . ID=BALIOE_21015_gene;locus_tag=BALIOE_21015 | |
| 8418 c1 Prodigal CDS 4174756 4175139 . - 0 ID=BALIOE_21015;Name=hypothetical protein;locus_tag=BALIOE_21015;product=hypothetical protein;Parent=BALIOE_21015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8419 c1 Prodigal gene 4175180 4176169 . - . ID=BALIOE_21020_gene;locus_tag=BALIOE_21020 | |
| 8420 c1 Prodigal CDS 4175180 4176169 . - 0 ID=BALIOE_21020;Name=hypothetical protein;locus_tag=BALIOE_21020;product=hypothetical protein;Parent=BALIOE_21020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8421 c1 Prodigal gene 4176195 4176815 . - . ID=BALIOE_21025_gene;locus_tag=BALIOE_21025 | |
| 8422 c1 Prodigal CDS 4176195 4176815 . - 0 ID=BALIOE_21025;Name=hypothetical protein;locus_tag=BALIOE_21025;product=hypothetical protein;Parent=BALIOE_21025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8423 c1 Prodigal gene 4176849 4177238 . - . ID=BALIOE_21030_gene;locus_tag=BALIOE_21030 | |
| 8424 c1 Prodigal CDS 4176849 4177238 . - 0 ID=BALIOE_21030;Name=hypothetical protein;locus_tag=BALIOE_21030;product=hypothetical protein;Parent=BALIOE_21030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8425 c1 Prodigal gene 4177255 4177611 . - . ID=BALIOE_21035_gene;locus_tag=BALIOE_21035 | |
| 8426 c1 Prodigal CDS 4177255 4177611 . - 0 ID=BALIOE_21035;Name=hypothetical protein;locus_tag=BALIOE_21035;product=hypothetical protein;Parent=BALIOE_21035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8427 c1 Prodigal gene 4177758 4177874 . - . ID=BALIOE_21040_gene;locus_tag=BALIOE_21040 | |
| 8428 c1 Prodigal CDS 4177758 4177874 . - 0 ID=BALIOE_21040;Name=hypothetical protein;locus_tag=BALIOE_21040;product=hypothetical protein;Parent=BALIOE_21040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8429 c1 Prodigal gene 4177906 4179237 . - . ID=BALIOE_21045_gene;locus_tag=BALIOE_21045 | |
| 8430 c1 Prodigal CDS 4177906 4179237 . - 0 ID=BALIOE_21045;Name=hypothetical protein;locus_tag=BALIOE_21045;product=hypothetical protein;Parent=BALIOE_21045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8431 c1 Prodigal gene 4179245 4179679 . - . ID=BALIOE_21050_gene;locus_tag=BALIOE_21050 | |
| 8432 c1 Prodigal CDS 4179245 4179679 . - 0 ID=BALIOE_21050;Name=hypothetical protein;locus_tag=BALIOE_21050;product=hypothetical protein;Parent=BALIOE_21050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8433 c1 Prodigal gene 4179683 4179862 . - . ID=BALIOE_21055_gene;locus_tag=BALIOE_21055 | |
| 8434 c1 Prodigal CDS 4179683 4179862 . - 0 ID=BALIOE_21055;Name=hypothetical protein;locus_tag=BALIOE_21055;product=hypothetical protein;Parent=BALIOE_21055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8435 c1 Prodigal gene 4179866 4180369 . - . ID=BALIOE_21060_gene;locus_tag=BALIOE_21060 | |
| 8436 c1 Prodigal CDS 4179866 4180369 . - 0 ID=BALIOE_21060;Name=hypothetical protein;locus_tag=BALIOE_21060;product=hypothetical protein;Parent=BALIOE_21060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8437 c1 Prodigal gene 4180384 4180737 . - . ID=BALIOE_21065_gene;locus_tag=BALIOE_21065 | |
| 8438 c1 Prodigal CDS 4180384 4180737 . - 0 ID=BALIOE_21065;Name=hypothetical protein;locus_tag=BALIOE_21065;product=hypothetical protein;Parent=BALIOE_21065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8439 c1 Prodigal gene 4180747 4181280 . - . ID=BALIOE_21070_gene;locus_tag=BALIOE_21070 | |
| 8440 c1 Prodigal CDS 4180747 4181280 . - 0 ID=BALIOE_21070;Name=hypothetical protein;locus_tag=BALIOE_21070;product=hypothetical protein;Parent=BALIOE_21070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8441 c1 Prodigal gene 4181293 4181685 . - . ID=BALIOE_21075_gene;locus_tag=BALIOE_21075 | |
| 8442 c1 Prodigal CDS 4181293 4181685 . - 0 ID=BALIOE_21075;Name=hypothetical protein;locus_tag=BALIOE_21075;product=hypothetical protein;Parent=BALIOE_21075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8443 c1 Prodigal gene 4181719 4182024 . - . ID=BALIOE_21080_gene;locus_tag=BALIOE_21080 | |
| 8444 c1 Prodigal CDS 4181719 4182024 . - 0 ID=BALIOE_21080;Name=hypothetical protein;locus_tag=BALIOE_21080;product=hypothetical protein;Parent=BALIOE_21080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8445 c1 Prodigal gene 4182039 4182578 . - . ID=BALIOE_21085_gene;locus_tag=BALIOE_21085 | |
| 8446 c1 Prodigal CDS 4182039 4182578 . - 0 ID=BALIOE_21085;Name=hypothetical protein;locus_tag=BALIOE_21085;product=hypothetical protein;Parent=BALIOE_21085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8447 c1 Prodigal gene 4182593 4182907 . - . ID=BALIOE_21090_gene;locus_tag=BALIOE_21090 | |
| 8448 c1 Prodigal CDS 4182593 4182907 . - 0 ID=BALIOE_21090;Name=hypothetical protein;locus_tag=BALIOE_21090;product=hypothetical protein;Parent=BALIOE_21090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8449 c1 Prodigal gene 4182918 4183289 . - . ID=BALIOE_21095_gene;locus_tag=BALIOE_21095 | |
| 8450 c1 Prodigal CDS 4182918 4183289 . - 0 ID=BALIOE_21095;Name=hypothetical protein;locus_tag=BALIOE_21095;product=hypothetical protein;Parent=BALIOE_21095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8451 c1 Prodigal gene 4183454 4183708 . - . ID=BALIOE_21100_gene;locus_tag=BALIOE_21100 | |
| 8452 c1 Prodigal CDS 4183454 4183708 . - 0 ID=BALIOE_21100;Name=hypothetical protein;locus_tag=BALIOE_21100;product=hypothetical protein;Parent=BALIOE_21100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8453 c1 Prodigal gene 4183708 4183899 . - . ID=BALIOE_21105_gene;locus_tag=BALIOE_21105 | |
| 8454 c1 Prodigal CDS 4183708 4183899 . - 0 ID=BALIOE_21105;Name=hypothetical protein;locus_tag=BALIOE_21105;product=hypothetical protein;Parent=BALIOE_21105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8455 c1 Prodigal gene 4183899 4184309 . - . ID=BALIOE_21110_gene;locus_tag=BALIOE_21110 | |
| 8456 c1 Prodigal CDS 4183899 4184309 . - 0 ID=BALIOE_21110;Name=hypothetical protein;locus_tag=BALIOE_21110;product=hypothetical protein;Parent=BALIOE_21110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8457 c1 Prodigal gene 4184322 4185023 . - . ID=BALIOE_21115_gene;locus_tag=BALIOE_21115 | |
| 8458 c1 Prodigal CDS 4184322 4185023 . - 0 ID=BALIOE_21115;Name=hypothetical protein;locus_tag=BALIOE_21115;product=hypothetical protein;Parent=BALIOE_21115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8459 c1 Prodigal gene 4185041 4185373 . - . ID=BALIOE_21120_gene;locus_tag=BALIOE_21120 | |
| 8460 c1 Prodigal CDS 4185041 4185373 . - 0 ID=BALIOE_21120;Name=hypothetical protein;locus_tag=BALIOE_21120;product=hypothetical protein;Parent=BALIOE_21120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8461 c1 Prodigal gene 4185388 4185666 . - . ID=BALIOE_21125_gene;locus_tag=BALIOE_21125 | |
| 8462 c1 Prodigal CDS 4185388 4185666 . - 0 ID=BALIOE_21125;Name=hypothetical protein;locus_tag=BALIOE_21125;product=hypothetical protein;Parent=BALIOE_21125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8463 c1 Prodigal gene 4185683 4186504 . - . ID=BALIOE_21130_gene;locus_tag=BALIOE_21130 | |
| 8464 c1 Prodigal CDS 4185683 4186504 . - 0 ID=BALIOE_21130;Name=hypothetical protein;locus_tag=BALIOE_21130;product=hypothetical protein;Parent=BALIOE_21130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8465 c1 Prodigal gene 4186522 4186824 . - . ID=BALIOE_21135_gene;locus_tag=BALIOE_21135 | |
| 8466 c1 Prodigal CDS 4186522 4186824 . - 0 ID=BALIOE_21135;Name=hypothetical protein;locus_tag=BALIOE_21135;product=hypothetical protein;Parent=BALIOE_21135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8467 c1 Prodigal gene 4186821 4187426 . - . ID=BALIOE_21140_gene;locus_tag=BALIOE_21140 | |
| 8468 c1 Prodigal CDS 4186821 4187426 . - 0 ID=BALIOE_21140;Name=hypothetical protein;locus_tag=BALIOE_21140;product=hypothetical protein;Parent=BALIOE_21140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8469 c1 Prodigal gene 4187437 4188066 . - . ID=BALIOE_21145_gene;locus_tag=BALIOE_21145 | |
| 8470 c1 Prodigal CDS 4187437 4188066 . - 0 ID=BALIOE_21145;Name=hypothetical protein;locus_tag=BALIOE_21145;product=hypothetical protein;Parent=BALIOE_21145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8471 c1 Prodigal gene 4188099 4188410 . - . ID=BALIOE_21150_gene;locus_tag=BALIOE_21150 | |
| 8472 c1 Prodigal CDS 4188099 4188410 . - 0 ID=BALIOE_21150;Name=hypothetical protein;locus_tag=BALIOE_21150;product=hypothetical protein;Parent=BALIOE_21150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8473 c1 Prodigal gene 4188789 4189256 . + . ID=BALIOE_21155_gene;locus_tag=BALIOE_21155 | |
| 8474 c1 Prodigal CDS 4188789 4189256 . + 0 ID=BALIOE_21155;Name=hypothetical protein;locus_tag=BALIOE_21155;product=hypothetical protein;Parent=BALIOE_21155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8475 c1 Prodigal gene 4189253 4189729 . - . ID=BALIOE_21160_gene;locus_tag=BALIOE_21160 | |
| 8476 c1 Prodigal CDS 4189253 4189729 . - 0 ID=BALIOE_21160;Name=hypothetical protein;locus_tag=BALIOE_21160;product=hypothetical protein;Parent=BALIOE_21160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8477 c1 Prodigal gene 4189802 4189996 . - . ID=BALIOE_21165_gene;locus_tag=BALIOE_21165 | |
| 8478 c1 Prodigal CDS 4189802 4189996 . - 0 ID=BALIOE_21165;Name=hypothetical protein;locus_tag=BALIOE_21165;product=hypothetical protein;Parent=BALIOE_21165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8479 c1 Prodigal gene 4190179 4191363 . - . ID=BALIOE_21170_gene;locus_tag=BALIOE_21170 | |
| 8480 c1 Prodigal CDS 4190179 4191363 . - 0 ID=BALIOE_21170;Name=hypothetical protein;locus_tag=BALIOE_21170;product=hypothetical protein;Parent=BALIOE_21170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8481 c1 Prodigal gene 4191434 4193548 . - . ID=BALIOE_21175_gene;locus_tag=BALIOE_21175 | |
| 8482 c1 Prodigal CDS 4191434 4193548 . - 0 ID=BALIOE_21175;Name=hypothetical protein;locus_tag=BALIOE_21175;product=hypothetical protein;Parent=BALIOE_21175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8483 c1 Prodigal gene 4193645 4194115 . - . ID=BALIOE_21180_gene;locus_tag=BALIOE_21180 | |
| 8484 c1 Prodigal CDS 4193645 4194115 . - 0 ID=BALIOE_21180;Name=hypothetical protein;locus_tag=BALIOE_21180;product=hypothetical protein;Parent=BALIOE_21180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8485 c1 Prodigal gene 4194212 4194586 . - . ID=BALIOE_21185_gene;locus_tag=BALIOE_21185 | |
| 8486 c1 Prodigal CDS 4194212 4194586 . - 0 ID=BALIOE_21185;Name=hypothetical protein;locus_tag=BALIOE_21185;product=hypothetical protein;Parent=BALIOE_21185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8487 c1 Prodigal gene 4194712 4194999 . - . ID=BALIOE_21190_gene;locus_tag=BALIOE_21190 | |
| 8488 c1 Prodigal CDS 4194712 4194999 . - 0 ID=BALIOE_21190;Name=hypothetical protein;locus_tag=BALIOE_21190;product=hypothetical protein;Parent=BALIOE_21190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8489 c1 Prodigal gene 4195007 4195366 . - . ID=BALIOE_21195_gene;locus_tag=BALIOE_21195 | |
| 8490 c1 Prodigal CDS 4195007 4195366 . - 0 ID=BALIOE_21195;Name=hypothetical protein;locus_tag=BALIOE_21195;product=hypothetical protein;Parent=BALIOE_21195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8491 c1 Prodigal gene 4195366 4195752 . - . ID=BALIOE_21200_gene;locus_tag=BALIOE_21200 | |
| 8492 c1 Prodigal CDS 4195366 4195752 . - 0 ID=BALIOE_21200;Name=hypothetical protein;locus_tag=BALIOE_21200;product=hypothetical protein;Parent=BALIOE_21200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8493 c1 Prodigal gene 4195752 4196474 . - . ID=BALIOE_21205_gene;locus_tag=BALIOE_21205 | |
| 8494 c1 Prodigal CDS 4195752 4196474 . - 0 ID=BALIOE_21205;Name=hypothetical protein;locus_tag=BALIOE_21205;product=hypothetical protein;Parent=BALIOE_21205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8495 c1 Prodigal gene 4196641 4197453 . - . ID=BALIOE_21210_gene;locus_tag=BALIOE_21210 | |
| 8496 c1 Prodigal CDS 4196641 4197453 . - 0 ID=BALIOE_21210;Name=hypothetical protein;locus_tag=BALIOE_21210;product=hypothetical protein;Parent=BALIOE_21210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8497 c1 Prodigal gene 4197674 4197892 . + . ID=BALIOE_21215_gene;locus_tag=BALIOE_21215 | |
| 8498 c1 Prodigal CDS 4197674 4197892 . + 0 ID=BALIOE_21215;Name=hypothetical protein;locus_tag=BALIOE_21215;product=hypothetical protein;Parent=BALIOE_21215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8499 c1 Prodigal gene 4197941 4198531 . - . ID=BALIOE_21220_gene;locus_tag=BALIOE_21220 | |
| 8500 c1 Prodigal CDS 4197941 4198531 . - 0 ID=BALIOE_21220;Name=hypothetical protein;locus_tag=BALIOE_21220;product=hypothetical protein;Parent=BALIOE_21220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8501 c1 Prodigal gene 4198626 4198826 . - . ID=BALIOE_21225_gene;locus_tag=BALIOE_21225 | |
| 8502 c1 Prodigal CDS 4198626 4198826 . - 0 ID=BALIOE_21225;Name=hypothetical protein;locus_tag=BALIOE_21225;product=hypothetical protein;Parent=BALIOE_21225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8503 c1 Prodigal gene 4198863 4200641 . - . ID=BALIOE_21230_gene;locus_tag=BALIOE_21230 | |
| 8504 c1 Prodigal CDS 4198863 4200641 . - 0 ID=BALIOE_21230;Name=hypothetical protein;locus_tag=BALIOE_21230;product=hypothetical protein;Parent=BALIOE_21230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8505 c1 Prodigal gene 4200641 4201192 . - . ID=BALIOE_21235_gene;locus_tag=BALIOE_21235 | |
| 8506 c1 Prodigal CDS 4200641 4201192 . - 0 ID=BALIOE_21235;Name=hypothetical protein;locus_tag=BALIOE_21235;product=hypothetical protein;Parent=BALIOE_21235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8507 c1 Prodigal gene 4201323 4203236 . + . ID=BALIOE_21240_gene;locus_tag=BALIOE_21240 | |
| 8508 c1 Prodigal CDS 4201323 4203236 . + 0 ID=BALIOE_21240;Name=hypothetical protein;locus_tag=BALIOE_21240;product=hypothetical protein;Parent=BALIOE_21240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8509 c1 Prodigal gene 4203236 4204258 . + . ID=BALIOE_21245_gene;locus_tag=BALIOE_21245 | |
| 8510 c1 Prodigal CDS 4203236 4204258 . + 0 ID=BALIOE_21245;Name=hypothetical protein;locus_tag=BALIOE_21245;product=hypothetical protein;Parent=BALIOE_21245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8511 c1 Prodigal gene 4204252 4204470 . + . ID=BALIOE_21250_gene;locus_tag=BALIOE_21250 | |
| 8512 c1 Prodigal CDS 4204252 4204470 . + 0 ID=BALIOE_21250;Name=hypothetical protein;locus_tag=BALIOE_21250;product=hypothetical protein;Parent=BALIOE_21250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8513 c1 Prodigal gene 4204524 4205393 . + . ID=BALIOE_21255_gene;locus_tag=BALIOE_21255 | |
| 8514 c1 Prodigal CDS 4204524 4205393 . + 0 ID=BALIOE_21255;Name=hypothetical protein;locus_tag=BALIOE_21255;product=hypothetical protein;Parent=BALIOE_21255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8515 c1 Prodigal gene 4205448 4205852 . - . ID=BALIOE_21260_gene;locus_tag=BALIOE_21260 | |
| 8516 c1 Prodigal CDS 4205448 4205852 . - 0 ID=BALIOE_21260;Name=hypothetical protein;locus_tag=BALIOE_21260;product=hypothetical protein;Parent=BALIOE_21260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8517 c1 Prodigal gene 4206154 4206786 . + . ID=BALIOE_21265_gene;locus_tag=BALIOE_21265 | |
| 8518 c1 Prodigal CDS 4206154 4206786 . + 0 ID=BALIOE_21265;Name=hypothetical protein;locus_tag=BALIOE_21265;product=hypothetical protein;Parent=BALIOE_21265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8519 c1 Prodigal gene 4206837 4208927 . + . ID=BALIOE_21270_gene;locus_tag=BALIOE_21270 | |
| 8520 c1 Prodigal CDS 4206837 4208927 . + 0 ID=BALIOE_21270;Name=hypothetical protein;locus_tag=BALIOE_21270;product=hypothetical protein;Parent=BALIOE_21270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8521 c1 Prodigal gene 4208994 4210214 . - . ID=BALIOE_21275_gene;locus_tag=BALIOE_21275 | |
| 8522 c1 Prodigal CDS 4208994 4210214 . - 0 ID=BALIOE_21275;Name=hypothetical protein;locus_tag=BALIOE_21275;product=hypothetical protein;Parent=BALIOE_21275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8523 c1 Prodigal gene 4210300 4210863 . - . ID=BALIOE_21280_gene;locus_tag=BALIOE_21280 | |
| 8524 c1 Prodigal CDS 4210300 4210863 . - 0 ID=BALIOE_21280;Name=hypothetical protein;locus_tag=BALIOE_21280;product=hypothetical protein;Parent=BALIOE_21280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8525 c1 Prodigal gene 4210895 4211497 . - . ID=BALIOE_21285_gene;locus_tag=BALIOE_21285 | |
| 8526 c1 Prodigal CDS 4210895 4211497 . - 0 ID=BALIOE_21285;Name=hypothetical protein;locus_tag=BALIOE_21285;product=hypothetical protein;Parent=BALIOE_21285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8527 c1 Prodigal gene 4211487 4211654 . - . ID=BALIOE_21290_gene;locus_tag=BALIOE_21290 | |
| 8528 c1 Prodigal CDS 4211487 4211654 . - 0 ID=BALIOE_21290;Name=hypothetical protein;locus_tag=BALIOE_21290;product=hypothetical protein;Parent=BALIOE_21290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8529 c1 Prodigal gene 4211759 4212331 . - . ID=BALIOE_21295_gene;locus_tag=BALIOE_21295 | |
| 8530 c1 Prodigal CDS 4211759 4212331 . - 0 ID=BALIOE_21295;Name=hypothetical protein;locus_tag=BALIOE_21295;product=hypothetical protein;Parent=BALIOE_21295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8531 c1 Prodigal gene 4212602 4213783 . + . ID=BALIOE_21300_gene;locus_tag=BALIOE_21300 | |
| 8532 c1 Prodigal CDS 4212602 4213783 . + 0 ID=BALIOE_21300;Name=hypothetical protein;locus_tag=BALIOE_21300;product=hypothetical protein;Parent=BALIOE_21300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8533 c1 Prodigal gene 4214045 4216588 . + . ID=BALIOE_21305_gene;locus_tag=BALIOE_21305 | |
| 8534 c1 Prodigal CDS 4214045 4216588 . + 0 ID=BALIOE_21305;Name=hypothetical protein;locus_tag=BALIOE_21305;product=hypothetical protein;Parent=BALIOE_21305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8535 c1 Prodigal gene 4216585 4216911 . + . ID=BALIOE_21310_gene;locus_tag=BALIOE_21310 | |
| 8536 c1 Prodigal CDS 4216585 4216911 . + 0 ID=BALIOE_21310;Name=hypothetical protein;locus_tag=BALIOE_21310;product=hypothetical protein;Parent=BALIOE_21310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8537 c1 Prodigal gene 4217037 4217843 . + . ID=BALIOE_21315_gene;locus_tag=BALIOE_21315 | |
| 8538 c1 Prodigal CDS 4217037 4217843 . + 0 ID=BALIOE_21315;Name=hypothetical protein;locus_tag=BALIOE_21315;product=hypothetical protein;Parent=BALIOE_21315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8539 c1 Prodigal gene 4217862 4219235 . + . ID=BALIOE_21320_gene;locus_tag=BALIOE_21320 | |
| 8540 c1 Prodigal CDS 4217862 4219235 . + 0 ID=BALIOE_21320;Name=hypothetical protein;locus_tag=BALIOE_21320;product=hypothetical protein;Parent=BALIOE_21320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8541 c1 Prodigal gene 4219490 4219657 . + . ID=BALIOE_21325_gene;locus_tag=BALIOE_21325 | |
| 8542 c1 Prodigal CDS 4219490 4219657 . + 0 ID=BALIOE_21325;Name=hypothetical protein;locus_tag=BALIOE_21325;product=hypothetical protein;Parent=BALIOE_21325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8543 c1 Prodigal gene 4219953 4221290 . + . ID=BALIOE_21330_gene;locus_tag=BALIOE_21330 | |
| 8544 c1 Prodigal CDS 4219953 4221290 . + 0 ID=BALIOE_21330;Name=hypothetical protein;locus_tag=BALIOE_21330;product=hypothetical protein;Parent=BALIOE_21330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8545 c1 Prodigal gene 4221311 4222333 . + . ID=BALIOE_21335_gene;locus_tag=BALIOE_21335 | |
| 8546 c1 Prodigal CDS 4221311 4222333 . + 0 ID=BALIOE_21335;Name=hypothetical protein;locus_tag=BALIOE_21335;product=hypothetical protein;Parent=BALIOE_21335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8547 c1 Prodigal gene 4222384 4223211 . + . ID=BALIOE_21340_gene;locus_tag=BALIOE_21340 | |
| 8548 c1 Prodigal CDS 4222384 4223211 . + 0 ID=BALIOE_21340;Name=hypothetical protein;locus_tag=BALIOE_21340;product=hypothetical protein;Parent=BALIOE_21340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8549 c1 Prodigal gene 4223211 4223543 . + . ID=BALIOE_21345_gene;locus_tag=BALIOE_21345 | |
| 8550 c1 Prodigal CDS 4223211 4223543 . + 0 ID=BALIOE_21345;Name=hypothetical protein;locus_tag=BALIOE_21345;product=hypothetical protein;Parent=BALIOE_21345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8551 c1 Prodigal gene 4223562 4223996 . + . ID=BALIOE_21350_gene;locus_tag=BALIOE_21350 | |
| 8552 c1 Prodigal CDS 4223562 4223996 . + 0 ID=BALIOE_21350;Name=hypothetical protein;locus_tag=BALIOE_21350;product=hypothetical protein;Parent=BALIOE_21350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8553 c1 Prodigal gene 4224096 4224827 . + . ID=BALIOE_21355_gene;locus_tag=BALIOE_21355 | |
| 8554 c1 Prodigal CDS 4224096 4224827 . + 0 ID=BALIOE_21355;Name=hypothetical protein;locus_tag=BALIOE_21355;product=hypothetical protein;Parent=BALIOE_21355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8555 c1 Prodigal gene 4224958 4225962 . - . ID=BALIOE_21360_gene;locus_tag=BALIOE_21360 | |
| 8556 c1 Prodigal CDS 4224958 4225962 . - 0 ID=BALIOE_21360;Name=hypothetical protein;locus_tag=BALIOE_21360;product=hypothetical protein;Parent=BALIOE_21360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8557 c1 Prodigal gene 4225955 4226713 . - . ID=BALIOE_21365_gene;locus_tag=BALIOE_21365 | |
| 8558 c1 Prodigal CDS 4225955 4226713 . - 0 ID=BALIOE_21365;Name=hypothetical protein;locus_tag=BALIOE_21365;product=hypothetical protein;Parent=BALIOE_21365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8559 c1 Prodigal gene 4226706 4227383 . - . ID=BALIOE_21370_gene;locus_tag=BALIOE_21370 | |
| 8560 c1 Prodigal CDS 4226706 4227383 . - 0 ID=BALIOE_21370;Name=hypothetical protein;locus_tag=BALIOE_21370;product=hypothetical protein;Parent=BALIOE_21370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8561 c1 Prodigal gene 4227401 4228237 . - . ID=BALIOE_21375_gene;locus_tag=BALIOE_21375 | |
| 8562 c1 Prodigal CDS 4227401 4228237 . - 0 ID=BALIOE_21375;Name=hypothetical protein;locus_tag=BALIOE_21375;product=hypothetical protein;Parent=BALIOE_21375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8563 c1 Prodigal gene 4228344 4229630 . - . ID=BALIOE_21380_gene;locus_tag=BALIOE_21380 | |
| 8564 c1 Prodigal CDS 4228344 4229630 . - 0 ID=BALIOE_21380;Name=hypothetical protein;locus_tag=BALIOE_21380;product=hypothetical protein;Parent=BALIOE_21380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8565 c1 Prodigal gene 4229722 4230810 . - . ID=BALIOE_21385_gene;locus_tag=BALIOE_21385 | |
| 8566 c1 Prodigal CDS 4229722 4230810 . - 0 ID=BALIOE_21385;Name=hypothetical protein;locus_tag=BALIOE_21385;product=hypothetical protein;Parent=BALIOE_21385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8567 c1 Prodigal gene 4230867 4231544 . - . ID=BALIOE_21390_gene;locus_tag=BALIOE_21390 | |
| 8568 c1 Prodigal CDS 4230867 4231544 . - 0 ID=BALIOE_21390;Name=hypothetical protein;locus_tag=BALIOE_21390;product=hypothetical protein;Parent=BALIOE_21390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8569 c1 Prodigal gene 4231789 4232997 . - . ID=BALIOE_21395_gene;locus_tag=BALIOE_21395 | |
| 8570 c1 Prodigal CDS 4231789 4232997 . - 0 ID=BALIOE_21395;Name=hypothetical protein;locus_tag=BALIOE_21395;product=hypothetical protein;Parent=BALIOE_21395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8571 c1 Prodigal gene 4232939 4233343 . - . ID=BALIOE_21400_gene;locus_tag=BALIOE_21400 | |
| 8572 c1 Prodigal CDS 4232939 4233343 . - 0 ID=BALIOE_21400;Name=hypothetical protein;locus_tag=BALIOE_21400;product=hypothetical protein;Parent=BALIOE_21400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8573 c1 Prodigal gene 4233333 4233773 . - . ID=BALIOE_21405_gene;locus_tag=BALIOE_21405 | |
| 8574 c1 Prodigal CDS 4233333 4233773 . - 0 ID=BALIOE_21405;Name=hypothetical protein;locus_tag=BALIOE_21405;product=hypothetical protein;Parent=BALIOE_21405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8575 c1 Prodigal gene 4233757 4234296 . - . ID=BALIOE_21410_gene;locus_tag=BALIOE_21410 | |
| 8576 c1 Prodigal CDS 4233757 4234296 . - 0 ID=BALIOE_21410;Name=hypothetical protein;locus_tag=BALIOE_21410;product=hypothetical protein;Parent=BALIOE_21410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8577 c1 Prodigal gene 4234280 4235074 . - . ID=BALIOE_21415_gene;locus_tag=BALIOE_21415 | |
| 8578 c1 Prodigal CDS 4234280 4235074 . - 0 ID=BALIOE_21415;Name=hypothetical protein;locus_tag=BALIOE_21415;product=hypothetical protein;Parent=BALIOE_21415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8579 c1 Prodigal gene 4235194 4237746 . + . ID=BALIOE_21420_gene;locus_tag=BALIOE_21420 | |
| 8580 c1 Prodigal CDS 4235194 4237746 . + 0 ID=BALIOE_21420;Name=hypothetical protein;locus_tag=BALIOE_21420;product=hypothetical protein;Parent=BALIOE_21420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8581 c1 Prodigal gene 4237911 4238471 . - . ID=BALIOE_21425_gene;locus_tag=BALIOE_21425 | |
| 8582 c1 Prodigal CDS 4237911 4238471 . - 0 ID=BALIOE_21425;Name=hypothetical protein;locus_tag=BALIOE_21425;product=hypothetical protein;Parent=BALIOE_21425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8583 c1 Prodigal gene 4238803 4240926 . + . ID=BALIOE_21430_gene;locus_tag=BALIOE_21430 | |
| 8584 c1 Prodigal CDS 4238803 4240926 . + 0 ID=BALIOE_21430;Name=hypothetical protein;locus_tag=BALIOE_21430;product=hypothetical protein;Parent=BALIOE_21430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8585 c1 Prodigal gene 4240991 4241659 . + . ID=BALIOE_21435_gene;locus_tag=BALIOE_21435 | |
| 8586 c1 Prodigal CDS 4240991 4241659 . + 0 ID=BALIOE_21435;Name=hypothetical protein;locus_tag=BALIOE_21435;product=hypothetical protein;Parent=BALIOE_21435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8587 c1 Prodigal gene 4241670 4242071 . + . ID=BALIOE_21440_gene;locus_tag=BALIOE_21440 | |
| 8588 c1 Prodigal CDS 4241670 4242071 . + 0 ID=BALIOE_21440;Name=hypothetical protein;locus_tag=BALIOE_21440;product=hypothetical protein;Parent=BALIOE_21440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8589 c1 Prodigal gene 4242096 4242974 . + . ID=BALIOE_21445_gene;locus_tag=BALIOE_21445 | |
| 8590 c1 Prodigal CDS 4242096 4242974 . + 0 ID=BALIOE_21445;Name=hypothetical protein;locus_tag=BALIOE_21445;product=hypothetical protein;Parent=BALIOE_21445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8591 c1 Prodigal gene 4243037 4244761 . - . ID=BALIOE_21450_gene;locus_tag=BALIOE_21450 | |
| 8592 c1 Prodigal CDS 4243037 4244761 . - 0 ID=BALIOE_21450;Name=hypothetical protein;locus_tag=BALIOE_21450;product=hypothetical protein;Parent=BALIOE_21450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8593 c1 Prodigal gene 4245140 4246762 . + . ID=BALIOE_21455_gene;locus_tag=BALIOE_21455 | |
| 8594 c1 Prodigal CDS 4245140 4246762 . + 0 ID=BALIOE_21455;Name=hypothetical protein;locus_tag=BALIOE_21455;product=hypothetical protein;Parent=BALIOE_21455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8595 c1 Prodigal gene 4246838 4248190 . - . ID=BALIOE_21460_gene;locus_tag=BALIOE_21460 | |
| 8596 c1 Prodigal CDS 4246838 4248190 . - 0 ID=BALIOE_21460;Name=hypothetical protein;locus_tag=BALIOE_21460;product=hypothetical protein;Parent=BALIOE_21460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8597 c1 Prodigal gene 4248187 4248906 . - . ID=BALIOE_21465_gene;locus_tag=BALIOE_21465 | |
| 8598 c1 Prodigal CDS 4248187 4248906 . - 0 ID=BALIOE_21465;Name=hypothetical protein;locus_tag=BALIOE_21465;product=hypothetical protein;Parent=BALIOE_21465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8599 c1 Prodigal gene 4249134 4249610 . + . ID=BALIOE_21470_gene;locus_tag=BALIOE_21470 | |
| 8600 c1 Prodigal CDS 4249134 4249610 . + 0 ID=BALIOE_21470;Name=hypothetical protein;locus_tag=BALIOE_21470;product=hypothetical protein;Parent=BALIOE_21470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8601 c1 Prodigal gene 4249707 4252028 . + . ID=BALIOE_21475_gene;locus_tag=BALIOE_21475 | |
| 8602 c1 Prodigal CDS 4249707 4252028 . + 0 ID=BALIOE_21475;Name=hypothetical protein;locus_tag=BALIOE_21475;product=hypothetical protein;Parent=BALIOE_21475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8603 c1 Prodigal gene 4252466 4252693 . + . ID=BALIOE_21480_gene;locus_tag=BALIOE_21480 | |
| 8604 c1 Prodigal CDS 4252466 4252693 . + 0 ID=BALIOE_21480;Name=hypothetical protein;locus_tag=BALIOE_21480;product=hypothetical protein;Parent=BALIOE_21480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8605 c1 Prodigal gene 4252710 4255031 . + . ID=BALIOE_21485_gene;locus_tag=BALIOE_21485 | |
| 8606 c1 Prodigal CDS 4252710 4255031 . + 0 ID=BALIOE_21485;Name=hypothetical protein;locus_tag=BALIOE_21485;product=hypothetical protein;Parent=BALIOE_21485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8607 c1 Prodigal gene 4255031 4255267 . + . ID=BALIOE_21490_gene;locus_tag=BALIOE_21490 | |
| 8608 c1 Prodigal CDS 4255031 4255267 . + 0 ID=BALIOE_21490;Name=hypothetical protein;locus_tag=BALIOE_21490;product=hypothetical protein;Parent=BALIOE_21490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8609 c1 Prodigal gene 4255470 4256348 . + . ID=BALIOE_21495_gene;locus_tag=BALIOE_21495 | |
| 8610 c1 Prodigal CDS 4255470 4256348 . + 0 ID=BALIOE_21495;Name=hypothetical protein;locus_tag=BALIOE_21495;product=hypothetical protein;Parent=BALIOE_21495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8611 c1 Prodigal gene 4256375 4257145 . - . ID=BALIOE_21500_gene;locus_tag=BALIOE_21500 | |
| 8612 c1 Prodigal CDS 4256375 4257145 . - 0 ID=BALIOE_21500;Name=hypothetical protein;locus_tag=BALIOE_21500;product=hypothetical protein;Parent=BALIOE_21500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8613 c1 Prodigal gene 4257183 4257866 . + . ID=BALIOE_21505_gene;locus_tag=BALIOE_21505 | |
| 8614 c1 Prodigal CDS 4257183 4257866 . + 0 ID=BALIOE_21505;Name=hypothetical protein;locus_tag=BALIOE_21505;product=hypothetical protein;Parent=BALIOE_21505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8615 c1 Prodigal gene 4257925 4258500 . + . ID=BALIOE_21510_gene;locus_tag=BALIOE_21510 | |
| 8616 c1 Prodigal CDS 4257925 4258500 . + 0 ID=BALIOE_21510;Name=hypothetical protein;locus_tag=BALIOE_21510;product=hypothetical protein;Parent=BALIOE_21510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8617 c1 Prodigal gene 4258861 4260177 . + . ID=BALIOE_21515_gene;locus_tag=BALIOE_21515 | |
| 8618 c1 Prodigal CDS 4258861 4260177 . + 0 ID=BALIOE_21515;Name=hypothetical protein;locus_tag=BALIOE_21515;product=hypothetical protein;Parent=BALIOE_21515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8619 c1 Prodigal gene 4260222 4262306 . - . ID=BALIOE_21520_gene;locus_tag=BALIOE_21520 | |
| 8620 c1 Prodigal CDS 4260222 4262306 . - 0 ID=BALIOE_21520;Name=hypothetical protein;locus_tag=BALIOE_21520;product=hypothetical protein;Parent=BALIOE_21520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8621 c1 Prodigal gene 4262316 4264709 . - . ID=BALIOE_21525_gene;locus_tag=BALIOE_21525 | |
| 8622 c1 Prodigal CDS 4262316 4264709 . - 0 ID=BALIOE_21525;Name=hypothetical protein;locus_tag=BALIOE_21525;product=hypothetical protein;Parent=BALIOE_21525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8623 c1 Prodigal gene 4265321 4268026 . + . ID=BALIOE_21530_gene;locus_tag=BALIOE_21530 | |
| 8624 c1 Prodigal CDS 4265321 4268026 . + 0 ID=BALIOE_21530;Name=hypothetical protein;locus_tag=BALIOE_21530;product=hypothetical protein;Parent=BALIOE_21530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8625 c1 Prodigal gene 4268093 4268371 . + . ID=BALIOE_21535_gene;locus_tag=BALIOE_21535 | |
| 8626 c1 Prodigal CDS 4268093 4268371 . + 0 ID=BALIOE_21535;Name=hypothetical protein;locus_tag=BALIOE_21535;product=hypothetical protein;Parent=BALIOE_21535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8627 c1 Prodigal gene 4268362 4268847 . + . ID=BALIOE_21540_gene;locus_tag=BALIOE_21540 | |
| 8628 c1 Prodigal CDS 4268362 4268847 . + 0 ID=BALIOE_21540;Name=hypothetical protein;locus_tag=BALIOE_21540;product=hypothetical protein;Parent=BALIOE_21540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8629 c1 Prodigal gene 4268897 4269925 . - . ID=BALIOE_21545_gene;locus_tag=BALIOE_21545 | |
| 8630 c1 Prodigal CDS 4268897 4269925 . - 0 ID=BALIOE_21545;Name=hypothetical protein;locus_tag=BALIOE_21545;product=hypothetical protein;Parent=BALIOE_21545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8631 c1 Prodigal gene 4269929 4271155 . - . ID=BALIOE_21550_gene;locus_tag=BALIOE_21550 | |
| 8632 c1 Prodigal CDS 4269929 4271155 . - 0 ID=BALIOE_21550;Name=hypothetical protein;locus_tag=BALIOE_21550;product=hypothetical protein;Parent=BALIOE_21550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8633 c1 Prodigal gene 4271343 4272941 . + . ID=BALIOE_21555_gene;locus_tag=BALIOE_21555 | |
| 8634 c1 Prodigal CDS 4271343 4272941 . + 0 ID=BALIOE_21555;Name=hypothetical protein;locus_tag=BALIOE_21555;product=hypothetical protein;Parent=BALIOE_21555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8635 c1 Prodigal gene 4272923 4273681 . - . ID=BALIOE_21560_gene;locus_tag=BALIOE_21560 | |
| 8636 c1 Prodigal CDS 4272923 4273681 . - 0 ID=BALIOE_21560;Name=hypothetical protein;locus_tag=BALIOE_21560;product=hypothetical protein;Parent=BALIOE_21560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8637 c1 Prodigal gene 4273698 4274528 . - . ID=BALIOE_21565_gene;locus_tag=BALIOE_21565 | |
| 8638 c1 Prodigal CDS 4273698 4274528 . - 0 ID=BALIOE_21565;Name=hypothetical protein;locus_tag=BALIOE_21565;product=hypothetical protein;Parent=BALIOE_21565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8639 c1 Prodigal gene 4274573 4274899 . - . ID=BALIOE_21570_gene;locus_tag=BALIOE_21570 | |
| 8640 c1 Prodigal CDS 4274573 4274899 . - 0 ID=BALIOE_21570;Name=hypothetical protein;locus_tag=BALIOE_21570;product=hypothetical protein;Parent=BALIOE_21570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8641 c1 Prodigal gene 4275089 4276594 . + . ID=BALIOE_21575_gene;locus_tag=BALIOE_21575 | |
| 8642 c1 Prodigal CDS 4275089 4276594 . + 0 ID=BALIOE_21575;Name=hypothetical protein;locus_tag=BALIOE_21575;product=hypothetical protein;Parent=BALIOE_21575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8643 c1 Prodigal gene 4276809 4277411 . - . ID=BALIOE_21580_gene;locus_tag=BALIOE_21580 | |
| 8644 c1 Prodigal CDS 4276809 4277411 . - 0 ID=BALIOE_21580;Name=hypothetical protein;locus_tag=BALIOE_21580;product=hypothetical protein;Parent=BALIOE_21580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8645 c1 Prodigal gene 4277411 4278403 . - . ID=BALIOE_21585_gene;locus_tag=BALIOE_21585 | |
| 8646 c1 Prodigal CDS 4277411 4278403 . - 0 ID=BALIOE_21585;Name=hypothetical protein;locus_tag=BALIOE_21585;product=hypothetical protein;Parent=BALIOE_21585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8647 c1 Prodigal gene 4278429 4279937 . - . ID=BALIOE_21590_gene;locus_tag=BALIOE_21590 | |
| 8648 c1 Prodigal CDS 4278429 4279937 . - 0 ID=BALIOE_21590;Name=hypothetical protein;locus_tag=BALIOE_21590;product=hypothetical protein;Parent=BALIOE_21590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8649 c1 Prodigal gene 4280062 4282509 . - . ID=BALIOE_21595_gene;locus_tag=BALIOE_21595 | |
| 8650 c1 Prodigal CDS 4280062 4282509 . - 0 ID=BALIOE_21595;Name=hypothetical protein;locus_tag=BALIOE_21595;product=hypothetical protein;Parent=BALIOE_21595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8651 c1 Prodigal gene 4282528 4283961 . - . ID=BALIOE_21600_gene;locus_tag=BALIOE_21600 | |
| 8652 c1 Prodigal CDS 4282528 4283961 . - 0 ID=BALIOE_21600;Name=hypothetical protein;locus_tag=BALIOE_21600;product=hypothetical protein;Parent=BALIOE_21600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8653 c1 Prodigal gene 4283961 4285256 . - . ID=BALIOE_21605_gene;locus_tag=BALIOE_21605 | |
| 8654 c1 Prodigal CDS 4283961 4285256 . - 0 ID=BALIOE_21605;Name=hypothetical protein;locus_tag=BALIOE_21605;product=hypothetical protein;Parent=BALIOE_21605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8655 c1 Prodigal gene 4285274 4287247 . - . ID=BALIOE_21610_gene;locus_tag=BALIOE_21610 | |
| 8656 c1 Prodigal CDS 4285274 4287247 . - 0 ID=BALIOE_21610;Name=hypothetical protein;locus_tag=BALIOE_21610;product=hypothetical protein;Parent=BALIOE_21610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8657 c1 Prodigal gene 4287244 4289430 . - . ID=BALIOE_21615_gene;locus_tag=BALIOE_21615 | |
| 8658 c1 Prodigal CDS 4287244 4289430 . - 0 ID=BALIOE_21615;Name=hypothetical protein;locus_tag=BALIOE_21615;product=hypothetical protein;Parent=BALIOE_21615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8659 c1 Prodigal gene 4289703 4290806 . - . ID=BALIOE_21620_gene;locus_tag=BALIOE_21620 | |
| 8660 c1 Prodigal CDS 4289703 4290806 . - 0 ID=BALIOE_21620;Name=hypothetical protein;locus_tag=BALIOE_21620;product=hypothetical protein;Parent=BALIOE_21620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8661 c1 Prodigal gene 4290998 4291591 . + . ID=BALIOE_21625_gene;locus_tag=BALIOE_21625 | |
| 8662 c1 Prodigal CDS 4290998 4291591 . + 0 ID=BALIOE_21625;Name=hypothetical protein;locus_tag=BALIOE_21625;product=hypothetical protein;Parent=BALIOE_21625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8663 c1 Prodigal gene 4291637 4292932 . - . ID=BALIOE_21630_gene;locus_tag=BALIOE_21630 | |
| 8664 c1 Prodigal CDS 4291637 4292932 . - 0 ID=BALIOE_21630;Name=hypothetical protein;locus_tag=BALIOE_21630;product=hypothetical protein;Parent=BALIOE_21630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8665 c1 Prodigal gene 4292991 4293965 . - . ID=BALIOE_21635_gene;locus_tag=BALIOE_21635 | |
| 8666 c1 Prodigal CDS 4292991 4293965 . - 0 ID=BALIOE_21635;Name=hypothetical protein;locus_tag=BALIOE_21635;product=hypothetical protein;Parent=BALIOE_21635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8667 c1 Prodigal gene 4293969 4294358 . - . ID=BALIOE_21640_gene;locus_tag=BALIOE_21640 | |
| 8668 c1 Prodigal CDS 4293969 4294358 . - 0 ID=BALIOE_21640;Name=hypothetical protein;locus_tag=BALIOE_21640;product=hypothetical protein;Parent=BALIOE_21640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8669 c1 Prodigal gene 4294355 4294963 . - . ID=BALIOE_21645_gene;locus_tag=BALIOE_21645 | |
| 8670 c1 Prodigal CDS 4294355 4294963 . - 0 ID=BALIOE_21645;Name=hypothetical protein;locus_tag=BALIOE_21645;product=hypothetical protein;Parent=BALIOE_21645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8671 c1 Prodigal gene 4295103 4296443 . - . ID=BALIOE_21650_gene;locus_tag=BALIOE_21650 | |
| 8672 c1 Prodigal CDS 4295103 4296443 . - 0 ID=BALIOE_21650;Name=hypothetical protein;locus_tag=BALIOE_21650;product=hypothetical protein;Parent=BALIOE_21650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8673 c1 Prodigal gene 4296447 4296974 . - . ID=BALIOE_21655_gene;locus_tag=BALIOE_21655 | |
| 8674 c1 Prodigal CDS 4296447 4296974 . - 0 ID=BALIOE_21655;Name=hypothetical protein;locus_tag=BALIOE_21655;product=hypothetical protein;Parent=BALIOE_21655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8675 c1 Prodigal gene 4297113 4298108 . - . ID=BALIOE_21660_gene;locus_tag=BALIOE_21660 | |
| 8676 c1 Prodigal CDS 4297113 4298108 . - 0 ID=BALIOE_21660;Name=hypothetical protein;locus_tag=BALIOE_21660;product=hypothetical protein;Parent=BALIOE_21660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8677 c1 Prodigal gene 4298332 4299027 . - . ID=BALIOE_21665_gene;locus_tag=BALIOE_21665 | |
| 8678 c1 Prodigal CDS 4298332 4299027 . - 0 ID=BALIOE_21665;Name=hypothetical protein;locus_tag=BALIOE_21665;product=hypothetical protein;Parent=BALIOE_21665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8679 c1 Prodigal gene 4299150 4300187 . - . ID=BALIOE_21670_gene;locus_tag=BALIOE_21670 | |
| 8680 c1 Prodigal CDS 4299150 4300187 . - 0 ID=BALIOE_21670;Name=hypothetical protein;locus_tag=BALIOE_21670;product=hypothetical protein;Parent=BALIOE_21670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8681 c1 Prodigal gene 4300521 4301009 . + . ID=BALIOE_21675_gene;locus_tag=BALIOE_21675 | |
| 8682 c1 Prodigal CDS 4300521 4301009 . + 0 ID=BALIOE_21675;Name=hypothetical protein;locus_tag=BALIOE_21675;product=hypothetical protein;Parent=BALIOE_21675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8683 c1 Prodigal gene 4301220 4302131 . + . ID=BALIOE_21680_gene;locus_tag=BALIOE_21680 | |
| 8684 c1 Prodigal CDS 4301220 4302131 . + 0 ID=BALIOE_21680;Name=hypothetical protein;locus_tag=BALIOE_21680;product=hypothetical protein;Parent=BALIOE_21680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8685 c1 Prodigal gene 4302080 4302496 . - . ID=BALIOE_21685_gene;locus_tag=BALIOE_21685 | |
| 8686 c1 Prodigal CDS 4302080 4302496 . - 0 ID=BALIOE_21685;Name=hypothetical protein;locus_tag=BALIOE_21685;product=hypothetical protein;Parent=BALIOE_21685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8687 c1 Prodigal gene 4302865 4304610 . - . ID=BALIOE_21690_gene;locus_tag=BALIOE_21690 | |
| 8688 c1 Prodigal CDS 4302865 4304610 . - 0 ID=BALIOE_21690;Name=hypothetical protein;locus_tag=BALIOE_21690;product=hypothetical protein;Parent=BALIOE_21690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8689 c1 Prodigal gene 4304730 4305170 . + . ID=BALIOE_21695_gene;locus_tag=BALIOE_21695 | |
| 8690 c1 Prodigal CDS 4304730 4305170 . + 0 ID=BALIOE_21695;Name=hypothetical protein;locus_tag=BALIOE_21695;product=hypothetical protein;Parent=BALIOE_21695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8691 c1 Prodigal gene 4305157 4305900 . - . ID=BALIOE_21700_gene;locus_tag=BALIOE_21700 | |
| 8692 c1 Prodigal CDS 4305157 4305900 . - 0 ID=BALIOE_21700;Name=hypothetical protein;locus_tag=BALIOE_21700;product=hypothetical protein;Parent=BALIOE_21700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8693 c1 Prodigal gene 4305897 4306967 . - . ID=BALIOE_21705_gene;locus_tag=BALIOE_21705 | |
| 8694 c1 Prodigal CDS 4305897 4306967 . - 0 ID=BALIOE_21705;Name=hypothetical protein;locus_tag=BALIOE_21705;product=hypothetical protein;Parent=BALIOE_21705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8695 c1 Prodigal gene 4306969 4307814 . - . ID=BALIOE_21710_gene;locus_tag=BALIOE_21710 | |
| 8696 c1 Prodigal CDS 4306969 4307814 . - 0 ID=BALIOE_21710;Name=hypothetical protein;locus_tag=BALIOE_21710;product=hypothetical protein;Parent=BALIOE_21710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8697 c1 Prodigal gene 4307811 4308698 . - . ID=BALIOE_21715_gene;locus_tag=BALIOE_21715 | |
| 8698 c1 Prodigal CDS 4307811 4308698 . - 0 ID=BALIOE_21715;Name=hypothetical protein;locus_tag=BALIOE_21715;product=hypothetical protein;Parent=BALIOE_21715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8699 c1 Prodigal gene 4308796 4310112 . - . ID=BALIOE_21720_gene;locus_tag=BALIOE_21720 | |
| 8700 c1 Prodigal CDS 4308796 4310112 . - 0 ID=BALIOE_21720;Name=hypothetical protein;locus_tag=BALIOE_21720;product=hypothetical protein;Parent=BALIOE_21720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8701 c1 Prodigal gene 4310472 4311218 . - . ID=BALIOE_21725_gene;locus_tag=BALIOE_21725 | |
| 8702 c1 Prodigal CDS 4310472 4311218 . - 0 ID=BALIOE_21725;Name=hypothetical protein;locus_tag=BALIOE_21725;product=hypothetical protein;Parent=BALIOE_21725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8703 c1 Prodigal gene 4311337 4312050 . - . ID=BALIOE_21730_gene;locus_tag=BALIOE_21730 | |
| 8704 c1 Prodigal CDS 4311337 4312050 . - 0 ID=BALIOE_21730;Name=hypothetical protein;locus_tag=BALIOE_21730;product=hypothetical protein;Parent=BALIOE_21730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8705 c1 Prodigal gene 4312052 4312819 . - . ID=BALIOE_21735_gene;locus_tag=BALIOE_21735 | |
| 8706 c1 Prodigal CDS 4312052 4312819 . - 0 ID=BALIOE_21735;Name=hypothetical protein;locus_tag=BALIOE_21735;product=hypothetical protein;Parent=BALIOE_21735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8707 c1 Prodigal gene 4312816 4314093 . - . ID=BALIOE_21740_gene;locus_tag=BALIOE_21740 | |
| 8708 c1 Prodigal CDS 4312816 4314093 . - 0 ID=BALIOE_21740;Name=hypothetical protein;locus_tag=BALIOE_21740;product=hypothetical protein;Parent=BALIOE_21740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8709 c1 Prodigal gene 4314090 4315016 . - . ID=BALIOE_21745_gene;locus_tag=BALIOE_21745 | |
| 8710 c1 Prodigal CDS 4314090 4315016 . - 0 ID=BALIOE_21745;Name=hypothetical protein;locus_tag=BALIOE_21745;product=hypothetical protein;Parent=BALIOE_21745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8711 c1 Prodigal gene 4315064 4316173 . - . ID=BALIOE_21750_gene;locus_tag=BALIOE_21750 | |
| 8712 c1 Prodigal CDS 4315064 4316173 . - 0 ID=BALIOE_21750;Name=hypothetical protein;locus_tag=BALIOE_21750;product=hypothetical protein;Parent=BALIOE_21750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8713 c1 Prodigal gene 4316597 4316980 . + . ID=BALIOE_21755_gene;locus_tag=BALIOE_21755 | |
| 8714 c1 Prodigal CDS 4316597 4316980 . + 0 ID=BALIOE_21755;Name=hypothetical protein;locus_tag=BALIOE_21755;product=hypothetical protein;Parent=BALIOE_21755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8715 c1 Prodigal gene 4316977 4317504 . - . ID=BALIOE_21760_gene;locus_tag=BALIOE_21760 | |
| 8716 c1 Prodigal CDS 4316977 4317504 . - 0 ID=BALIOE_21760;Name=hypothetical protein;locus_tag=BALIOE_21760;product=hypothetical protein;Parent=BALIOE_21760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8717 c1 Prodigal gene 4317511 4317777 . - . ID=BALIOE_21765_gene;locus_tag=BALIOE_21765 | |
| 8718 c1 Prodigal CDS 4317511 4317777 . - 0 ID=BALIOE_21765;Name=hypothetical protein;locus_tag=BALIOE_21765;product=hypothetical protein;Parent=BALIOE_21765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8719 c1 Prodigal gene 4317927 4319030 . - . ID=BALIOE_21770_gene;locus_tag=BALIOE_21770 | |
| 8720 c1 Prodigal CDS 4317927 4319030 . - 0 ID=BALIOE_21770;Name=hypothetical protein;locus_tag=BALIOE_21770;product=hypothetical protein;Parent=BALIOE_21770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8721 c1 Prodigal gene 4319301 4320155 . - . ID=BALIOE_21775_gene;locus_tag=BALIOE_21775 | |
| 8722 c1 Prodigal CDS 4319301 4320155 . - 0 ID=BALIOE_21775;Name=hypothetical protein;locus_tag=BALIOE_21775;product=hypothetical protein;Parent=BALIOE_21775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8723 c1 Prodigal gene 4320400 4321458 . - . ID=BALIOE_21780_gene;locus_tag=BALIOE_21780 | |
| 8724 c1 Prodigal CDS 4320400 4321458 . - 0 ID=BALIOE_21780;Name=hypothetical protein;locus_tag=BALIOE_21780;product=hypothetical protein;Parent=BALIOE_21780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8725 c1 Prodigal gene 4321451 4322119 . - . ID=BALIOE_21785_gene;locus_tag=BALIOE_21785 | |
| 8726 c1 Prodigal CDS 4321451 4322119 . - 0 ID=BALIOE_21785;Name=hypothetical protein;locus_tag=BALIOE_21785;product=hypothetical protein;Parent=BALIOE_21785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8727 c1 Prodigal gene 4322122 4323618 . - . ID=BALIOE_21790_gene;locus_tag=BALIOE_21790 | |
| 8728 c1 Prodigal CDS 4322122 4323618 . - 0 ID=BALIOE_21790;Name=hypothetical protein;locus_tag=BALIOE_21790;product=hypothetical protein;Parent=BALIOE_21790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8729 c1 Prodigal gene 4323768 4324364 . + . ID=BALIOE_21795_gene;locus_tag=BALIOE_21795 | |
| 8730 c1 Prodigal CDS 4323768 4324364 . + 0 ID=BALIOE_21795;Name=hypothetical protein;locus_tag=BALIOE_21795;product=hypothetical protein;Parent=BALIOE_21795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8731 c1 Prodigal gene 4324354 4324623 . + . ID=BALIOE_21800_gene;locus_tag=BALIOE_21800 | |
| 8732 c1 Prodigal CDS 4324354 4324623 . + 0 ID=BALIOE_21800;Name=hypothetical protein;locus_tag=BALIOE_21800;product=hypothetical protein;Parent=BALIOE_21800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8733 c1 Prodigal gene 4324626 4324985 . - . ID=BALIOE_21805_gene;locus_tag=BALIOE_21805 | |
| 8734 c1 Prodigal CDS 4324626 4324985 . - 0 ID=BALIOE_21805;Name=hypothetical protein;locus_tag=BALIOE_21805;product=hypothetical protein;Parent=BALIOE_21805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8735 c1 Prodigal gene 4325126 4325752 . + . ID=BALIOE_21810_gene;locus_tag=BALIOE_21810 | |
| 8736 c1 Prodigal CDS 4325126 4325752 . + 0 ID=BALIOE_21810;Name=hypothetical protein;locus_tag=BALIOE_21810;product=hypothetical protein;Parent=BALIOE_21810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8737 c1 Prodigal gene 4325826 4328024 . + . ID=BALIOE_21815_gene;locus_tag=BALIOE_21815 | |
| 8738 c1 Prodigal CDS 4325826 4328024 . + 0 ID=BALIOE_21815;Name=hypothetical protein;locus_tag=BALIOE_21815;product=hypothetical protein;Parent=BALIOE_21815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8739 c1 Prodigal gene 4328126 4328371 . - . ID=BALIOE_21820_gene;locus_tag=BALIOE_21820 | |
| 8740 c1 Prodigal CDS 4328126 4328371 . - 0 ID=BALIOE_21820;Name=hypothetical protein;locus_tag=BALIOE_21820;product=hypothetical protein;Parent=BALIOE_21820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8741 c1 Prodigal gene 4328592 4329257 . + . ID=BALIOE_21825_gene;locus_tag=BALIOE_21825 | |
| 8742 c1 Prodigal CDS 4328592 4329257 . + 0 ID=BALIOE_21825;Name=hypothetical protein;locus_tag=BALIOE_21825;product=hypothetical protein;Parent=BALIOE_21825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8743 c1 Prodigal gene 4329330 4329887 . + . ID=BALIOE_21830_gene;locus_tag=BALIOE_21830 | |
| 8744 c1 Prodigal CDS 4329330 4329887 . + 0 ID=BALIOE_21830;Name=hypothetical protein;locus_tag=BALIOE_21830;product=hypothetical protein;Parent=BALIOE_21830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8745 c1 Prodigal gene 4329891 4331141 . - . ID=BALIOE_21835_gene;locus_tag=BALIOE_21835 | |
| 8746 c1 Prodigal CDS 4329891 4331141 . - 0 ID=BALIOE_21835;Name=hypothetical protein;locus_tag=BALIOE_21835;product=hypothetical protein;Parent=BALIOE_21835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8747 c1 Prodigal gene 4331240 4332289 . + . ID=BALIOE_21840_gene;locus_tag=BALIOE_21840 | |
| 8748 c1 Prodigal CDS 4331240 4332289 . + 0 ID=BALIOE_21840;Name=hypothetical protein;locus_tag=BALIOE_21840;product=hypothetical protein;Parent=BALIOE_21840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8749 c1 Prodigal gene 4332681 4333058 . + . ID=BALIOE_21845_gene;locus_tag=BALIOE_21845 | |
| 8750 c1 Prodigal CDS 4332681 4333058 . + 0 ID=BALIOE_21845;Name=hypothetical protein;locus_tag=BALIOE_21845;product=hypothetical protein;Parent=BALIOE_21845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8751 c1 Prodigal gene 4333127 4334185 . + . ID=BALIOE_21850_gene;locus_tag=BALIOE_21850 | |
| 8752 c1 Prodigal CDS 4333127 4334185 . + 0 ID=BALIOE_21850;Name=hypothetical protein;locus_tag=BALIOE_21850;product=hypothetical protein;Parent=BALIOE_21850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8753 c1 Prodigal gene 4334226 4334948 . + . ID=BALIOE_21855_gene;locus_tag=BALIOE_21855 | |
| 8754 c1 Prodigal CDS 4334226 4334948 . + 0 ID=BALIOE_21855;Name=hypothetical protein;locus_tag=BALIOE_21855;product=hypothetical protein;Parent=BALIOE_21855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8755 c1 Prodigal gene 4334945 4335766 . + . ID=BALIOE_21860_gene;locus_tag=BALIOE_21860 | |
| 8756 c1 Prodigal CDS 4334945 4335766 . + 0 ID=BALIOE_21860;Name=hypothetical protein;locus_tag=BALIOE_21860;product=hypothetical protein;Parent=BALIOE_21860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8757 c1 Prodigal gene 4335741 4335998 . + . ID=BALIOE_21865_gene;locus_tag=BALIOE_21865 | |
| 8758 c1 Prodigal CDS 4335741 4335998 . + 0 ID=BALIOE_21865;Name=hypothetical protein;locus_tag=BALIOE_21865;product=hypothetical protein;Parent=BALIOE_21865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8759 c1 Prodigal gene 4336010 4336261 . + . ID=BALIOE_21870_gene;locus_tag=BALIOE_21870 | |
| 8760 c1 Prodigal CDS 4336010 4336261 . + 0 ID=BALIOE_21870;Name=hypothetical protein;locus_tag=BALIOE_21870;product=hypothetical protein;Parent=BALIOE_21870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8761 c1 Prodigal gene 4336266 4336847 . + . ID=BALIOE_21875_gene;locus_tag=BALIOE_21875 | |
| 8762 c1 Prodigal CDS 4336266 4336847 . + 0 ID=BALIOE_21875;Name=hypothetical protein;locus_tag=BALIOE_21875;product=hypothetical protein;Parent=BALIOE_21875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8763 c1 Prodigal gene 4336844 4338205 . + . ID=BALIOE_21880_gene;locus_tag=BALIOE_21880 | |
| 8764 c1 Prodigal CDS 4336844 4338205 . + 0 ID=BALIOE_21880;Name=hypothetical protein;locus_tag=BALIOE_21880;product=hypothetical protein;Parent=BALIOE_21880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8765 c1 Prodigal gene 4338192 4338545 . + . ID=BALIOE_21885_gene;locus_tag=BALIOE_21885 | |
| 8766 c1 Prodigal CDS 4338192 4338545 . + 0 ID=BALIOE_21885;Name=hypothetical protein;locus_tag=BALIOE_21885;product=hypothetical protein;Parent=BALIOE_21885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8767 c1 Prodigal gene 4338536 4340212 . + . ID=BALIOE_21890_gene;locus_tag=BALIOE_21890 | |
| 8768 c1 Prodigal CDS 4338536 4340212 . + 0 ID=BALIOE_21890;Name=hypothetical protein;locus_tag=BALIOE_21890;product=hypothetical protein;Parent=BALIOE_21890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8769 c1 Prodigal gene 4340216 4340638 . + . ID=BALIOE_21895_gene;locus_tag=BALIOE_21895 | |
| 8770 c1 Prodigal CDS 4340216 4340638 . + 0 ID=BALIOE_21895;Name=hypothetical protein;locus_tag=BALIOE_21895;product=hypothetical protein;Parent=BALIOE_21895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8771 c1 Prodigal gene 4340635 4341240 . + . ID=BALIOE_21900_gene;locus_tag=BALIOE_21900 | |
| 8772 c1 Prodigal CDS 4340635 4341240 . + 0 ID=BALIOE_21900;Name=hypothetical protein;locus_tag=BALIOE_21900;product=hypothetical protein;Parent=BALIOE_21900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8773 c1 Prodigal gene 4341209 4343527 . + . ID=BALIOE_21905_gene;locus_tag=BALIOE_21905 | |
| 8774 c1 Prodigal CDS 4341209 4343527 . + 0 ID=BALIOE_21905;Name=hypothetical protein;locus_tag=BALIOE_21905;product=hypothetical protein;Parent=BALIOE_21905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8775 c1 Prodigal gene 4343524 4344108 . + . ID=BALIOE_21910_gene;locus_tag=BALIOE_21910 | |
| 8776 c1 Prodigal CDS 4343524 4344108 . + 0 ID=BALIOE_21910;Name=hypothetical protein;locus_tag=BALIOE_21910;product=hypothetical protein;Parent=BALIOE_21910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8777 c1 Prodigal gene 4344110 4345279 . + . ID=BALIOE_21915_gene;locus_tag=BALIOE_21915 | |
| 8778 c1 Prodigal CDS 4344110 4345279 . + 0 ID=BALIOE_21915;Name=hypothetical protein;locus_tag=BALIOE_21915;product=hypothetical protein;Parent=BALIOE_21915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8779 c1 Prodigal gene 4345276 4345740 . + . ID=BALIOE_21920_gene;locus_tag=BALIOE_21920 | |
| 8780 c1 Prodigal CDS 4345276 4345740 . + 0 ID=BALIOE_21920;Name=hypothetical protein;locus_tag=BALIOE_21920;product=hypothetical protein;Parent=BALIOE_21920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8781 c1 Prodigal gene 4345740 4346471 . + . ID=BALIOE_21925_gene;locus_tag=BALIOE_21925 | |
| 8782 c1 Prodigal CDS 4345740 4346471 . + 0 ID=BALIOE_21925;Name=hypothetical protein;locus_tag=BALIOE_21925;product=hypothetical protein;Parent=BALIOE_21925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8783 c1 Prodigal gene 4346468 4347697 . + . ID=BALIOE_21930_gene;locus_tag=BALIOE_21930 | |
| 8784 c1 Prodigal CDS 4346468 4347697 . + 0 ID=BALIOE_21930;Name=hypothetical protein;locus_tag=BALIOE_21930;product=hypothetical protein;Parent=BALIOE_21930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8785 c1 Prodigal gene 4347699 4348286 . + . ID=BALIOE_21935_gene;locus_tag=BALIOE_21935 | |
| 8786 c1 Prodigal CDS 4347699 4348286 . + 0 ID=BALIOE_21935;Name=hypothetical protein;locus_tag=BALIOE_21935;product=hypothetical protein;Parent=BALIOE_21935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8787 c1 Prodigal gene 4348397 4349971 . + . ID=BALIOE_21940_gene;locus_tag=BALIOE_21940 | |
| 8788 c1 Prodigal CDS 4348397 4349971 . + 0 ID=BALIOE_21940;Name=hypothetical protein;locus_tag=BALIOE_21940;product=hypothetical protein;Parent=BALIOE_21940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8789 c1 Prodigal gene 4349971 4350915 . + . ID=BALIOE_21945_gene;locus_tag=BALIOE_21945 | |
| 8790 c1 Prodigal CDS 4349971 4350915 . + 0 ID=BALIOE_21945;Name=hypothetical protein;locus_tag=BALIOE_21945;product=hypothetical protein;Parent=BALIOE_21945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8791 c1 Prodigal gene 4350912 4351745 . + . ID=BALIOE_21950_gene;locus_tag=BALIOE_21950 | |
| 8792 c1 Prodigal CDS 4350912 4351745 . + 0 ID=BALIOE_21950;Name=hypothetical protein;locus_tag=BALIOE_21950;product=hypothetical protein;Parent=BALIOE_21950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8793 c1 Prodigal gene 4351745 4352509 . + . ID=BALIOE_21955_gene;locus_tag=BALIOE_21955 | |
| 8794 c1 Prodigal CDS 4351745 4352509 . + 0 ID=BALIOE_21955;Name=hypothetical protein;locus_tag=BALIOE_21955;product=hypothetical protein;Parent=BALIOE_21955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8795 c1 Prodigal gene 4352506 4353312 . + . ID=BALIOE_21960_gene;locus_tag=BALIOE_21960 | |
| 8796 c1 Prodigal CDS 4352506 4353312 . + 0 ID=BALIOE_21960;Name=hypothetical protein;locus_tag=BALIOE_21960;product=hypothetical protein;Parent=BALIOE_21960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8797 c1 Prodigal gene 4353318 4353719 . + . ID=BALIOE_21965_gene;locus_tag=BALIOE_21965 | |
| 8798 c1 Prodigal CDS 4353318 4353719 . + 0 ID=BALIOE_21965;Name=hypothetical protein;locus_tag=BALIOE_21965;product=hypothetical protein;Parent=BALIOE_21965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8799 c1 Prodigal gene 4353918 4354664 . + . ID=BALIOE_21970_gene;locus_tag=BALIOE_21970 | |
| 8800 c1 Prodigal CDS 4353918 4354664 . + 0 ID=BALIOE_21970;Name=hypothetical protein;locus_tag=BALIOE_21970;product=hypothetical protein;Parent=BALIOE_21970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8801 c1 Prodigal gene 4354689 4355162 . + . ID=BALIOE_21975_gene;locus_tag=BALIOE_21975 | |
| 8802 c1 Prodigal CDS 4354689 4355162 . + 0 ID=BALIOE_21975;Name=hypothetical protein;locus_tag=BALIOE_21975;product=hypothetical protein;Parent=BALIOE_21975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8803 c1 Prodigal gene 4355159 4355440 . + . ID=BALIOE_21980_gene;locus_tag=BALIOE_21980 | |
| 8804 c1 Prodigal CDS 4355159 4355440 . + 0 ID=BALIOE_21980;Name=hypothetical protein;locus_tag=BALIOE_21980;product=hypothetical protein;Parent=BALIOE_21980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8805 c1 Prodigal gene 4355517 4356875 . + . ID=BALIOE_21985_gene;locus_tag=BALIOE_21985 | |
| 8806 c1 Prodigal CDS 4355517 4356875 . + 0 ID=BALIOE_21985;Name=hypothetical protein;locus_tag=BALIOE_21985;product=hypothetical protein;Parent=BALIOE_21985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8807 c1 Prodigal gene 4356868 4358376 . + . ID=BALIOE_21990_gene;locus_tag=BALIOE_21990 | |
| 8808 c1 Prodigal CDS 4356868 4358376 . + 0 ID=BALIOE_21990;Name=hypothetical protein;locus_tag=BALIOE_21990;product=hypothetical protein;Parent=BALIOE_21990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8809 c1 Prodigal gene 4358366 4358635 . + . ID=BALIOE_21995_gene;locus_tag=BALIOE_21995 | |
| 8810 c1 Prodigal CDS 4358366 4358635 . + 0 ID=BALIOE_21995;Name=hypothetical protein;locus_tag=BALIOE_21995;product=hypothetical protein;Parent=BALIOE_21995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8811 c1 Prodigal gene 4358667 4359527 . + . ID=BALIOE_22000_gene;locus_tag=BALIOE_22000 | |
| 8812 c1 Prodigal CDS 4358667 4359527 . + 0 ID=BALIOE_22000;Name=hypothetical protein;locus_tag=BALIOE_22000;product=hypothetical protein;Parent=BALIOE_22000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8813 c1 Prodigal gene 4359577 4359936 . - . ID=BALIOE_22005_gene;locus_tag=BALIOE_22005 | |
| 8814 c1 Prodigal CDS 4359577 4359936 . - 0 ID=BALIOE_22005;Name=hypothetical protein;locus_tag=BALIOE_22005;product=hypothetical protein;Parent=BALIOE_22005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8815 c1 Prodigal gene 4359933 4360208 . - . ID=BALIOE_22010_gene;locus_tag=BALIOE_22010 | |
| 8816 c1 Prodigal CDS 4359933 4360208 . - 0 ID=BALIOE_22010;Name=hypothetical protein;locus_tag=BALIOE_22010;product=hypothetical protein;Parent=BALIOE_22010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8817 c1 Prodigal gene 4360281 4361405 . - . ID=BALIOE_22015_gene;locus_tag=BALIOE_22015 | |
| 8818 c1 Prodigal CDS 4360281 4361405 . - 0 ID=BALIOE_22015;Name=hypothetical protein;locus_tag=BALIOE_22015;product=hypothetical protein;Parent=BALIOE_22015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8819 c1 Prodigal gene 4361405 4364140 . - . ID=BALIOE_22020_gene;locus_tag=BALIOE_22020 | |
| 8820 c1 Prodigal CDS 4361405 4364140 . - 0 ID=BALIOE_22020;Name=hypothetical protein;locus_tag=BALIOE_22020;product=hypothetical protein;Parent=BALIOE_22020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8821 c1 Prodigal gene 4364137 4365204 . - . ID=BALIOE_22025_gene;locus_tag=BALIOE_22025 | |
| 8822 c1 Prodigal CDS 4364137 4365204 . - 0 ID=BALIOE_22025;Name=hypothetical protein;locus_tag=BALIOE_22025;product=hypothetical protein;Parent=BALIOE_22025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8823 c1 Prodigal gene 4365570 4367192 . - . ID=BALIOE_22030_gene;locus_tag=BALIOE_22030 | |
| 8824 c1 Prodigal CDS 4365570 4367192 . - 0 ID=BALIOE_22030;Name=hypothetical protein;locus_tag=BALIOE_22030;product=hypothetical protein;Parent=BALIOE_22030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8825 c1 Prodigal gene 4367454 4369064 . - . ID=BALIOE_22035_gene;locus_tag=BALIOE_22035 | |
| 8826 c1 Prodigal CDS 4367454 4369064 . - 0 ID=BALIOE_22035;Name=hypothetical protein;locus_tag=BALIOE_22035;product=hypothetical protein;Parent=BALIOE_22035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8827 c1 Prodigal gene 4369448 4370500 . + . ID=BALIOE_22040_gene;locus_tag=BALIOE_22040 | |
| 8828 c1 Prodigal CDS 4369448 4370500 . + 0 ID=BALIOE_22040;Name=hypothetical protein;locus_tag=BALIOE_22040;product=hypothetical protein;Parent=BALIOE_22040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8829 c1 Prodigal gene 4370527 4370682 . - . ID=BALIOE_22045_gene;locus_tag=BALIOE_22045 | |
| 8830 c1 Prodigal CDS 4370527 4370682 . - 0 ID=BALIOE_22045;Name=hypothetical protein;locus_tag=BALIOE_22045;product=hypothetical protein;Parent=BALIOE_22045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8831 c1 Prodigal gene 4370818 4372020 . - . ID=BALIOE_22050_gene;locus_tag=BALIOE_22050 | |
| 8832 c1 Prodigal CDS 4370818 4372020 . - 0 ID=BALIOE_22050;Name=hypothetical protein;locus_tag=BALIOE_22050;product=hypothetical protein;Parent=BALIOE_22050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8833 c1 Prodigal gene 4372252 4373751 . + . ID=BALIOE_22055_gene;locus_tag=BALIOE_22055 | |
| 8834 c1 Prodigal CDS 4372252 4373751 . + 0 ID=BALIOE_22055;Name=hypothetical protein;locus_tag=BALIOE_22055;product=hypothetical protein;Parent=BALIOE_22055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8835 c1 Prodigal gene 4373822 4374157 . - . ID=BALIOE_22060_gene;locus_tag=BALIOE_22060 | |
| 8836 c1 Prodigal CDS 4373822 4374157 . - 0 ID=BALIOE_22060;Name=hypothetical protein;locus_tag=BALIOE_22060;product=hypothetical protein;Parent=BALIOE_22060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8837 c1 Prodigal gene 4374548 4374982 . + . ID=BALIOE_22065_gene;locus_tag=BALIOE_22065 | |
| 8838 c1 Prodigal CDS 4374548 4374982 . + 0 ID=BALIOE_22065;Name=hypothetical protein;locus_tag=BALIOE_22065;product=hypothetical protein;Parent=BALIOE_22065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8839 c1 Prodigal gene 4375299 4376768 . + . ID=BALIOE_22070_gene;locus_tag=BALIOE_22070 | |
| 8840 c1 Prodigal CDS 4375299 4376768 . + 0 ID=BALIOE_22070;Name=hypothetical protein;locus_tag=BALIOE_22070;product=hypothetical protein;Parent=BALIOE_22070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8841 c1 Prodigal gene 4376817 4377569 . - . ID=BALIOE_22075_gene;locus_tag=BALIOE_22075 | |
| 8842 c1 Prodigal CDS 4376817 4377569 . - 0 ID=BALIOE_22075;Name=hypothetical protein;locus_tag=BALIOE_22075;product=hypothetical protein;Parent=BALIOE_22075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8843 c1 Prodigal gene 4377577 4379619 . - . ID=BALIOE_22080_gene;locus_tag=BALIOE_22080 | |
| 8844 c1 Prodigal CDS 4377577 4379619 . - 0 ID=BALIOE_22080;Name=hypothetical protein;locus_tag=BALIOE_22080;product=hypothetical protein;Parent=BALIOE_22080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8845 c1 Prodigal gene 4379822 4380664 . + . ID=BALIOE_22085_gene;locus_tag=BALIOE_22085 | |
| 8846 c1 Prodigal CDS 4379822 4380664 . + 0 ID=BALIOE_22085;Name=hypothetical protein;locus_tag=BALIOE_22085;product=hypothetical protein;Parent=BALIOE_22085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8847 c1 Prodigal gene 4380736 4382088 . + . ID=BALIOE_22090_gene;locus_tag=BALIOE_22090 | |
| 8848 c1 Prodigal CDS 4380736 4382088 . + 0 ID=BALIOE_22090;Name=hypothetical protein;locus_tag=BALIOE_22090;product=hypothetical protein;Parent=BALIOE_22090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8849 c1 Prodigal gene 4382253 4382426 . + . ID=BALIOE_22095_gene;locus_tag=BALIOE_22095 | |
| 8850 c1 Prodigal CDS 4382253 4382426 . + 0 ID=BALIOE_22095;Name=hypothetical protein;locus_tag=BALIOE_22095;product=hypothetical protein;Parent=BALIOE_22095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8851 c1 Prodigal gene 4382969 4383322 . + . ID=BALIOE_22100_gene;locus_tag=BALIOE_22100 | |
| 8852 c1 Prodigal CDS 4382969 4383322 . + 0 ID=BALIOE_22100;Name=hypothetical protein;locus_tag=BALIOE_22100;product=hypothetical protein;Parent=BALIOE_22100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8853 c1 Prodigal gene 4383376 4384665 . + . ID=BALIOE_22105_gene;locus_tag=BALIOE_22105 | |
| 8854 c1 Prodigal CDS 4383376 4384665 . + 0 ID=BALIOE_22105;Name=hypothetical protein;locus_tag=BALIOE_22105;product=hypothetical protein;Parent=BALIOE_22105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8855 c1 Prodigal gene 4384678 4385103 . + . ID=BALIOE_22110_gene;locus_tag=BALIOE_22110 | |
| 8856 c1 Prodigal CDS 4384678 4385103 . + 0 ID=BALIOE_22110;Name=hypothetical protein;locus_tag=BALIOE_22110;product=hypothetical protein;Parent=BALIOE_22110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8857 c1 Prodigal gene 4385730 4386845 . + . ID=BALIOE_22115_gene;locus_tag=BALIOE_22115 | |
| 8858 c1 Prodigal CDS 4385730 4386845 . + 0 ID=BALIOE_22115;Name=hypothetical protein;locus_tag=BALIOE_22115;product=hypothetical protein;Parent=BALIOE_22115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8859 c1 Prodigal gene 4387199 4387765 . + . ID=BALIOE_22120_gene;locus_tag=BALIOE_22120 | |
| 8860 c1 Prodigal CDS 4387199 4387765 . + 0 ID=BALIOE_22120;Name=hypothetical protein;locus_tag=BALIOE_22120;product=hypothetical protein;Parent=BALIOE_22120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8861 c1 Prodigal gene 4387921 4388451 . + . ID=BALIOE_22125_gene;locus_tag=BALIOE_22125 | |
| 8862 c1 Prodigal CDS 4387921 4388451 . + 0 ID=BALIOE_22125;Name=hypothetical protein;locus_tag=BALIOE_22125;product=hypothetical protein;Parent=BALIOE_22125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8863 c1 Prodigal gene 4388512 4389540 . - . ID=BALIOE_22130_gene;locus_tag=BALIOE_22130 | |
| 8864 c1 Prodigal CDS 4388512 4389540 . - 0 ID=BALIOE_22130;Name=hypothetical protein;locus_tag=BALIOE_22130;product=hypothetical protein;Parent=BALIOE_22130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8865 c1 Prodigal gene 4389589 4391571 . - . ID=BALIOE_22135_gene;locus_tag=BALIOE_22135 | |
| 8866 c1 Prodigal CDS 4389589 4391571 . - 0 ID=BALIOE_22135;Name=hypothetical protein;locus_tag=BALIOE_22135;product=hypothetical protein;Parent=BALIOE_22135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8867 c1 Prodigal gene 4392254 4393168 . + . ID=BALIOE_22140_gene;locus_tag=BALIOE_22140 | |
| 8868 c1 Prodigal CDS 4392254 4393168 . + 0 ID=BALIOE_22140;Name=hypothetical protein;locus_tag=BALIOE_22140;product=hypothetical protein;Parent=BALIOE_22140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8869 c1 Prodigal gene 4393188 4394525 . + . ID=BALIOE_22145_gene;locus_tag=BALIOE_22145 | |
| 8870 c1 Prodigal CDS 4393188 4394525 . + 0 ID=BALIOE_22145;Name=hypothetical protein;locus_tag=BALIOE_22145;product=hypothetical protein;Parent=BALIOE_22145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8871 c1 Prodigal gene 4394538 4395032 . + . ID=BALIOE_22150_gene;locus_tag=BALIOE_22150 | |
| 8872 c1 Prodigal CDS 4394538 4395032 . + 0 ID=BALIOE_22150;Name=hypothetical protein;locus_tag=BALIOE_22150;product=hypothetical protein;Parent=BALIOE_22150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8873 c1 Prodigal gene 4395032 4395655 . + . ID=BALIOE_22155_gene;locus_tag=BALIOE_22155 | |
| 8874 c1 Prodigal CDS 4395032 4395655 . + 0 ID=BALIOE_22155;Name=hypothetical protein;locus_tag=BALIOE_22155;product=hypothetical protein;Parent=BALIOE_22155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8875 c1 Prodigal gene 4395740 4396696 . + . ID=BALIOE_22160_gene;locus_tag=BALIOE_22160 | |
| 8876 c1 Prodigal CDS 4395740 4396696 . + 0 ID=BALIOE_22160;Name=hypothetical protein;locus_tag=BALIOE_22160;product=hypothetical protein;Parent=BALIOE_22160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8877 c1 Prodigal gene 4396693 4397463 . + . ID=BALIOE_22165_gene;locus_tag=BALIOE_22165 | |
| 8878 c1 Prodigal CDS 4396693 4397463 . + 0 ID=BALIOE_22165;Name=hypothetical protein;locus_tag=BALIOE_22165;product=hypothetical protein;Parent=BALIOE_22165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8879 c1 Prodigal gene 4397515 4398090 . - . ID=BALIOE_22170_gene;locus_tag=BALIOE_22170 | |
| 8880 c1 Prodigal CDS 4397515 4398090 . - 0 ID=BALIOE_22170;Name=hypothetical protein;locus_tag=BALIOE_22170;product=hypothetical protein;Parent=BALIOE_22170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8881 c1 Prodigal gene 4398226 4398564 . - . ID=BALIOE_22175_gene;locus_tag=BALIOE_22175 | |
| 8882 c1 Prodigal CDS 4398226 4398564 . - 0 ID=BALIOE_22175;Name=hypothetical protein;locus_tag=BALIOE_22175;product=hypothetical protein;Parent=BALIOE_22175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8883 c1 Prodigal gene 4398668 4399000 . - . ID=BALIOE_22180_gene;locus_tag=BALIOE_22180 | |
| 8884 c1 Prodigal CDS 4398668 4399000 . - 0 ID=BALIOE_22180;Name=hypothetical protein;locus_tag=BALIOE_22180;product=hypothetical protein;Parent=BALIOE_22180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8885 c1 Prodigal gene 4399255 4399827 . + . ID=BALIOE_22185_gene;locus_tag=BALIOE_22185 | |
| 8886 c1 Prodigal CDS 4399255 4399827 . + 0 ID=BALIOE_22185;Name=hypothetical protein;locus_tag=BALIOE_22185;product=hypothetical protein;Parent=BALIOE_22185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8887 c1 Prodigal gene 4400626 4401153 . + . ID=BALIOE_22190_gene;locus_tag=BALIOE_22190 | |
| 8888 c1 Prodigal CDS 4400626 4401153 . + 0 ID=BALIOE_22190;Name=hypothetical protein;locus_tag=BALIOE_22190;product=hypothetical protein;Parent=BALIOE_22190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8889 c1 Prodigal gene 4401154 4401432 . - . ID=BALIOE_22195_gene;locus_tag=BALIOE_22195 | |
| 8890 c1 Prodigal CDS 4401154 4401432 . - 0 ID=BALIOE_22195;Name=hypothetical protein;locus_tag=BALIOE_22195;product=hypothetical protein;Parent=BALIOE_22195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8891 c1 Prodigal gene 4401492 4402649 . + . ID=BALIOE_22200_gene;locus_tag=BALIOE_22200 | |
| 8892 c1 Prodigal CDS 4401492 4402649 . + 0 ID=BALIOE_22200;Name=hypothetical protein;locus_tag=BALIOE_22200;product=hypothetical protein;Parent=BALIOE_22200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8893 c1 Prodigal gene 4402674 4405787 . + . ID=BALIOE_22205_gene;locus_tag=BALIOE_22205 | |
| 8894 c1 Prodigal CDS 4402674 4405787 . + 0 ID=BALIOE_22205;Name=hypothetical protein;locus_tag=BALIOE_22205;product=hypothetical protein;Parent=BALIOE_22205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8895 c1 Prodigal gene 4405724 4406005 . - . ID=BALIOE_22210_gene;locus_tag=BALIOE_22210 | |
| 8896 c1 Prodigal CDS 4405724 4406005 . - 0 ID=BALIOE_22210;Name=hypothetical protein;locus_tag=BALIOE_22210;product=hypothetical protein;Parent=BALIOE_22210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8897 c1 Prodigal gene 4406150 4406878 . - . ID=BALIOE_22215_gene;locus_tag=BALIOE_22215 | |
| 8898 c1 Prodigal CDS 4406150 4406878 . - 0 ID=BALIOE_22215;Name=hypothetical protein;locus_tag=BALIOE_22215;product=hypothetical protein;Parent=BALIOE_22215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8899 c1 Prodigal gene 4407246 4408070 . - . ID=BALIOE_22220_gene;locus_tag=BALIOE_22220 | |
| 8900 c1 Prodigal CDS 4407246 4408070 . - 0 ID=BALIOE_22220;Name=hypothetical protein;locus_tag=BALIOE_22220;product=hypothetical protein;Parent=BALIOE_22220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8901 c1 Prodigal gene 4408441 4409841 . - . ID=BALIOE_22225_gene;locus_tag=BALIOE_22225 | |
| 8902 c1 Prodigal CDS 4408441 4409841 . - 0 ID=BALIOE_22225;Name=hypothetical protein;locus_tag=BALIOE_22225;product=hypothetical protein;Parent=BALIOE_22225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8903 c1 Prodigal gene 4410052 4411449 . - . ID=BALIOE_22230_gene;locus_tag=BALIOE_22230 | |
| 8904 c1 Prodigal CDS 4410052 4411449 . - 0 ID=BALIOE_22230;Name=hypothetical protein;locus_tag=BALIOE_22230;product=hypothetical protein;Parent=BALIOE_22230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8905 c1 Prodigal gene 4411854 4413503 . + . ID=BALIOE_22235_gene;locus_tag=BALIOE_22235 | |
| 8906 c1 Prodigal CDS 4411854 4413503 . + 0 ID=BALIOE_22235;Name=hypothetical protein;locus_tag=BALIOE_22235;product=hypothetical protein;Parent=BALIOE_22235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8907 c1 Prodigal gene 4413554 4414156 . - . ID=BALIOE_22240_gene;locus_tag=BALIOE_22240 | |
| 8908 c1 Prodigal CDS 4413554 4414156 . - 0 ID=BALIOE_22240;Name=hypothetical protein;locus_tag=BALIOE_22240;product=hypothetical protein;Parent=BALIOE_22240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8909 c1 Prodigal gene 4414604 4415575 . + . ID=BALIOE_22245_gene;locus_tag=BALIOE_22245 | |
| 8910 c1 Prodigal CDS 4414604 4415575 . + 0 ID=BALIOE_22245;Name=hypothetical protein;locus_tag=BALIOE_22245;product=hypothetical protein;Parent=BALIOE_22245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8911 c1 Prodigal gene 4415624 4416637 . + . ID=BALIOE_22250_gene;locus_tag=BALIOE_22250 | |
| 8912 c1 Prodigal CDS 4415624 4416637 . + 0 ID=BALIOE_22250;Name=hypothetical protein;locus_tag=BALIOE_22250;product=hypothetical protein;Parent=BALIOE_22250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8913 c1 Prodigal gene 4417049 4418371 . + . ID=BALIOE_22255_gene;locus_tag=BALIOE_22255 | |
| 8914 c1 Prodigal CDS 4417049 4418371 . + 0 ID=BALIOE_22255;Name=hypothetical protein;locus_tag=BALIOE_22255;product=hypothetical protein;Parent=BALIOE_22255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8915 c1 Prodigal gene 4418553 4420613 . - . ID=BALIOE_22260_gene;locus_tag=BALIOE_22260 | |
| 8916 c1 Prodigal CDS 4418553 4420613 . - 0 ID=BALIOE_22260;Name=hypothetical protein;locus_tag=BALIOE_22260;product=hypothetical protein;Parent=BALIOE_22260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8917 c1 Prodigal gene 4420683 4421450 . - . ID=BALIOE_22265_gene;locus_tag=BALIOE_22265 | |
| 8918 c1 Prodigal CDS 4420683 4421450 . - 0 ID=BALIOE_22265;Name=hypothetical protein;locus_tag=BALIOE_22265;product=hypothetical protein;Parent=BALIOE_22265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8919 c1 Prodigal gene 4421682 4422611 . + . ID=BALIOE_22270_gene;locus_tag=BALIOE_22270 | |
| 8920 c1 Prodigal CDS 4421682 4422611 . + 0 ID=BALIOE_22270;Name=hypothetical protein;locus_tag=BALIOE_22270;product=hypothetical protein;Parent=BALIOE_22270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8921 c1 Prodigal gene 4422707 4424203 . - . ID=BALIOE_22275_gene;locus_tag=BALIOE_22275 | |
| 8922 c1 Prodigal CDS 4422707 4424203 . - 0 ID=BALIOE_22275;Name=hypothetical protein;locus_tag=BALIOE_22275;product=hypothetical protein;Parent=BALIOE_22275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8923 c1 Prodigal gene 4424424 4425710 . - . ID=BALIOE_22280_gene;locus_tag=BALIOE_22280 | |
| 8924 c1 Prodigal CDS 4424424 4425710 . - 0 ID=BALIOE_22280;Name=hypothetical protein;locus_tag=BALIOE_22280;product=hypothetical protein;Parent=BALIOE_22280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8925 c1 Prodigal gene 4425893 4427842 . - . ID=BALIOE_22285_gene;locus_tag=BALIOE_22285 | |
| 8926 c1 Prodigal CDS 4425893 4427842 . - 0 ID=BALIOE_22285;Name=hypothetical protein;locus_tag=BALIOE_22285;product=hypothetical protein;Parent=BALIOE_22285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8927 c1 Prodigal gene 4427963 4430971 . - . ID=BALIOE_22290_gene;locus_tag=BALIOE_22290 | |
| 8928 c1 Prodigal CDS 4427963 4430971 . - 0 ID=BALIOE_22290;Name=hypothetical protein;locus_tag=BALIOE_22290;product=hypothetical protein;Parent=BALIOE_22290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8929 c1 Prodigal gene 4430926 4431426 . - . ID=BALIOE_22295_gene;locus_tag=BALIOE_22295 | |
| 8930 c1 Prodigal CDS 4430926 4431426 . - 0 ID=BALIOE_22295;Name=hypothetical protein;locus_tag=BALIOE_22295;product=hypothetical protein;Parent=BALIOE_22295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8931 c1 Prodigal gene 4431408 4432514 . - . ID=BALIOE_22300_gene;locus_tag=BALIOE_22300 | |
| 8932 c1 Prodigal CDS 4431408 4432514 . - 0 ID=BALIOE_22300;Name=hypothetical protein;locus_tag=BALIOE_22300;product=hypothetical protein;Parent=BALIOE_22300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8933 c1 Prodigal gene 4432521 4434842 . - . ID=BALIOE_22305_gene;locus_tag=BALIOE_22305 | |
| 8934 c1 Prodigal CDS 4432521 4434842 . - 0 ID=BALIOE_22305;Name=hypothetical protein;locus_tag=BALIOE_22305;product=hypothetical protein;Parent=BALIOE_22305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8935 c1 Prodigal gene 4434889 4437507 . - . ID=BALIOE_22310_gene;locus_tag=BALIOE_22310 | |
| 8936 c1 Prodigal CDS 4434889 4437507 . - 0 ID=BALIOE_22310;Name=hypothetical protein;locus_tag=BALIOE_22310;product=hypothetical protein;Parent=BALIOE_22310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8937 c1 Prodigal gene 4437504 4438040 . - . ID=BALIOE_22315_gene;locus_tag=BALIOE_22315 | |
| 8938 c1 Prodigal CDS 4437504 4438040 . - 0 ID=BALIOE_22315;Name=hypothetical protein;locus_tag=BALIOE_22315;product=hypothetical protein;Parent=BALIOE_22315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8939 c1 Prodigal gene 4438059 4438256 . - . ID=BALIOE_22320_gene;locus_tag=BALIOE_22320 | |
| 8940 c1 Prodigal CDS 4438059 4438256 . - 0 ID=BALIOE_22320;Name=hypothetical protein;locus_tag=BALIOE_22320;product=hypothetical protein;Parent=BALIOE_22320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8941 c1 Prodigal gene 4438268 4438456 . - . ID=BALIOE_22325_gene;locus_tag=BALIOE_22325 | |
| 8942 c1 Prodigal CDS 4438268 4438456 . - 0 ID=BALIOE_22325;Name=hypothetical protein;locus_tag=BALIOE_22325;product=hypothetical protein;Parent=BALIOE_22325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8943 c1 Prodigal gene 4438741 4440300 . + . ID=BALIOE_22330_gene;locus_tag=BALIOE_22330 | |
| 8944 c1 Prodigal CDS 4438741 4440300 . + 0 ID=BALIOE_22330;Name=hypothetical protein;locus_tag=BALIOE_22330;product=hypothetical protein;Parent=BALIOE_22330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8945 c1 Prodigal gene 4440297 4440488 . + . ID=BALIOE_22335_gene;locus_tag=BALIOE_22335 | |
| 8946 c1 Prodigal CDS 4440297 4440488 . + 0 ID=BALIOE_22335;Name=hypothetical protein;locus_tag=BALIOE_22335;product=hypothetical protein;Parent=BALIOE_22335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8947 c1 Prodigal gene 4440485 4442164 . + . ID=BALIOE_22340_gene;locus_tag=BALIOE_22340 | |
| 8948 c1 Prodigal CDS 4440485 4442164 . + 0 ID=BALIOE_22340;Name=hypothetical protein;locus_tag=BALIOE_22340;product=hypothetical protein;Parent=BALIOE_22340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8949 c1 Prodigal gene 4442251 4442358 . - . ID=BALIOE_22345_gene;locus_tag=BALIOE_22345 | |
| 8950 c1 Prodigal CDS 4442251 4442358 . - 0 ID=BALIOE_22345;Name=hypothetical protein;locus_tag=BALIOE_22345;product=hypothetical protein;Parent=BALIOE_22345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8951 c1 Prodigal gene 4442834 4444105 . + . ID=BALIOE_22350_gene;locus_tag=BALIOE_22350 | |
| 8952 c1 Prodigal CDS 4442834 4444105 . + 0 ID=BALIOE_22350;Name=hypothetical protein;locus_tag=BALIOE_22350;product=hypothetical protein;Parent=BALIOE_22350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8953 c1 Prodigal gene 4444135 4445139 . - . ID=BALIOE_22355_gene;locus_tag=BALIOE_22355 | |
| 8954 c1 Prodigal CDS 4444135 4445139 . - 0 ID=BALIOE_22355;Name=hypothetical protein;locus_tag=BALIOE_22355;product=hypothetical protein;Parent=BALIOE_22355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8955 c1 Prodigal gene 4445136 4446119 . - . ID=BALIOE_22360_gene;locus_tag=BALIOE_22360 | |
| 8956 c1 Prodigal CDS 4445136 4446119 . - 0 ID=BALIOE_22360;Name=hypothetical protein;locus_tag=BALIOE_22360;product=hypothetical protein;Parent=BALIOE_22360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8957 c1 Prodigal gene 4446130 4447032 . - . ID=BALIOE_22365_gene;locus_tag=BALIOE_22365 | |
| 8958 c1 Prodigal CDS 4446130 4447032 . - 0 ID=BALIOE_22365;Name=hypothetical protein;locus_tag=BALIOE_22365;product=hypothetical protein;Parent=BALIOE_22365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8959 c1 Prodigal gene 4447042 4448061 . - . ID=BALIOE_22370_gene;locus_tag=BALIOE_22370 | |
| 8960 c1 Prodigal CDS 4447042 4448061 . - 0 ID=BALIOE_22370;Name=hypothetical protein;locus_tag=BALIOE_22370;product=hypothetical protein;Parent=BALIOE_22370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8961 c1 Prodigal gene 4448212 4449819 . - . ID=BALIOE_22375_gene;locus_tag=BALIOE_22375 | |
| 8962 c1 Prodigal CDS 4448212 4449819 . - 0 ID=BALIOE_22375;Name=hypothetical protein;locus_tag=BALIOE_22375;product=hypothetical protein;Parent=BALIOE_22375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8963 c1 Infernal gene 4450389 4450470 . + . ID=BALIOE_22380_gene;locus_tag=BALIOE_22380;gene=naRNA4 | |
| 8964 c1 Infernal ncRNA 4450389 4450470 1.8e-10 + . ID=BALIOE_22380;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_22380;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_22380_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 8965 c1 tRNAscan-SE gene 4450564 4450640 . - . ID=BALIOE_22385_gene;locus_tag=BALIOE_22385;gene=Pro_trna | |
| 8966 c1 tRNAscan-SE tRNA 4450564 4450640 . - . ID=BALIOE_22385;Name=tRNA-Pro;locus_tag=BALIOE_22385;product=tRNA-Pro;gene=Pro_trna;Parent=BALIOE_22385_gene;inference=profile:tRNAscan:2.0;Note=SO:0000268 | |
| 8967 c1 Prodigal gene 4450732 4452423 . - . ID=BALIOE_22390_gene;locus_tag=BALIOE_22390 | |
| 8968 c1 Prodigal CDS 4450732 4452423 . - 0 ID=BALIOE_22390;Name=hypothetical protein;locus_tag=BALIOE_22390;product=hypothetical protein;Parent=BALIOE_22390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8969 c1 Prodigal gene 4452678 4453208 . - . ID=BALIOE_22395_gene;locus_tag=BALIOE_22395 | |
| 8970 c1 Prodigal CDS 4452678 4453208 . - 0 ID=BALIOE_22395;Name=hypothetical protein;locus_tag=BALIOE_22395;product=hypothetical protein;Parent=BALIOE_22395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8971 c1 Prodigal gene 4453213 4454268 . - . ID=BALIOE_22400_gene;locus_tag=BALIOE_22400 | |
| 8972 c1 Prodigal CDS 4453213 4454268 . - 0 ID=BALIOE_22400;Name=hypothetical protein;locus_tag=BALIOE_22400;product=hypothetical protein;Parent=BALIOE_22400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8973 c1 Prodigal gene 4454283 4455740 . - . ID=BALIOE_22405_gene;locus_tag=BALIOE_22405 | |
| 8974 c1 Prodigal CDS 4454283 4455740 . - 0 ID=BALIOE_22405;Name=hypothetical protein;locus_tag=BALIOE_22405;product=hypothetical protein;Parent=BALIOE_22405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8975 c1 Prodigal gene 4455753 4456856 . - . ID=BALIOE_22410_gene;locus_tag=BALIOE_22410 | |
| 8976 c1 Prodigal CDS 4455753 4456856 . - 0 ID=BALIOE_22410;Name=hypothetical protein;locus_tag=BALIOE_22410;product=hypothetical protein;Parent=BALIOE_22410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8977 c1 Prodigal gene 4456885 4457571 . - . ID=BALIOE_22415_gene;locus_tag=BALIOE_22415 | |
| 8978 c1 Prodigal CDS 4456885 4457571 . - 0 ID=BALIOE_22415;Name=hypothetical protein;locus_tag=BALIOE_22415;product=hypothetical protein;Parent=BALIOE_22415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8979 c1 Prodigal gene 4457636 4458160 . - . ID=BALIOE_22420_gene;locus_tag=BALIOE_22420 | |
| 8980 c1 Prodigal CDS 4457636 4458160 . - 0 ID=BALIOE_22420;Name=hypothetical protein;locus_tag=BALIOE_22420;product=hypothetical protein;Parent=BALIOE_22420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8981 c1 Prodigal gene 4458504 4459706 . - . ID=BALIOE_22425_gene;locus_tag=BALIOE_22425 | |
| 8982 c1 Prodigal CDS 4458504 4459706 . - 0 ID=BALIOE_22425;Name=hypothetical protein;locus_tag=BALIOE_22425;product=hypothetical protein;Parent=BALIOE_22425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8983 c1 Prodigal gene 4459935 4460633 . - . ID=BALIOE_22430_gene;locus_tag=BALIOE_22430 | |
| 8984 c1 Prodigal CDS 4459935 4460633 . - 0 ID=BALIOE_22430;Name=hypothetical protein;locus_tag=BALIOE_22430;product=hypothetical protein;Parent=BALIOE_22430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8985 c1 Prodigal gene 4460791 4461354 . + . ID=BALIOE_22435_gene;locus_tag=BALIOE_22435 | |
| 8986 c1 Prodigal CDS 4460791 4461354 . + 0 ID=BALIOE_22435;Name=hypothetical protein;locus_tag=BALIOE_22435;product=hypothetical protein;Parent=BALIOE_22435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8987 c1 Prodigal gene 4461351 4461791 . + . ID=BALIOE_22440_gene;locus_tag=BALIOE_22440 | |
| 8988 c1 Prodigal CDS 4461351 4461791 . + 0 ID=BALIOE_22440;Name=hypothetical protein;locus_tag=BALIOE_22440;product=hypothetical protein;Parent=BALIOE_22440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8989 c1 Prodigal gene 4461760 4464093 . - . ID=BALIOE_22445_gene;locus_tag=BALIOE_22445 | |
| 8990 c1 Prodigal CDS 4461760 4464093 . - 0 ID=BALIOE_22445;Name=hypothetical protein;locus_tag=BALIOE_22445;product=hypothetical protein;Parent=BALIOE_22445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8991 c1 Prodigal gene 4464246 4464905 . + . ID=BALIOE_22450_gene;locus_tag=BALIOE_22450 | |
| 8992 c1 Prodigal CDS 4464246 4464905 . + 0 ID=BALIOE_22450;Name=hypothetical protein;locus_tag=BALIOE_22450;product=hypothetical protein;Parent=BALIOE_22450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8993 c1 Prodigal gene 4465009 4465983 . + . ID=BALIOE_22455_gene;locus_tag=BALIOE_22455 | |
| 8994 c1 Prodigal CDS 4465009 4465983 . + 0 ID=BALIOE_22455;Name=hypothetical protein;locus_tag=BALIOE_22455;product=hypothetical protein;Parent=BALIOE_22455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8995 c1 Prodigal gene 4466033 4466743 . - . ID=BALIOE_22460_gene;locus_tag=BALIOE_22460 | |
| 8996 c1 Prodigal CDS 4466033 4466743 . - 0 ID=BALIOE_22460;Name=hypothetical protein;locus_tag=BALIOE_22460;product=hypothetical protein;Parent=BALIOE_22460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8997 c1 Prodigal gene 4467177 4467467 . + . ID=BALIOE_22465_gene;locus_tag=BALIOE_22465 | |
| 8998 c1 Prodigal CDS 4467177 4467467 . + 0 ID=BALIOE_22465;Name=hypothetical protein;locus_tag=BALIOE_22465;product=hypothetical protein;Parent=BALIOE_22465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 8999 c1 Prodigal gene 4467748 4467960 . + . ID=BALIOE_22470_gene;locus_tag=BALIOE_22470 | |
| 9000 c1 Prodigal CDS 4467748 4467960 . + 0 ID=BALIOE_22470;Name=hypothetical protein;locus_tag=BALIOE_22470;product=hypothetical protein;Parent=BALIOE_22470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9001 c1 Prodigal gene 4468148 4468360 . - . ID=BALIOE_22475_gene;locus_tag=BALIOE_22475 | |
| 9002 c1 Prodigal CDS 4468148 4468360 . - 0 ID=BALIOE_22475;Name=hypothetical protein;locus_tag=BALIOE_22475;product=hypothetical protein;Parent=BALIOE_22475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9003 c1 Prodigal gene 4468623 4470692 . - . ID=BALIOE_22480_gene;locus_tag=BALIOE_22480 | |
| 9004 c1 Prodigal CDS 4468623 4470692 . - 0 ID=BALIOE_22480;Name=hypothetical protein;locus_tag=BALIOE_22480;product=hypothetical protein;Parent=BALIOE_22480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9005 c1 Prodigal gene 4470702 4471613 . - . ID=BALIOE_22485_gene;locus_tag=BALIOE_22485 | |
| 9006 c1 Prodigal CDS 4470702 4471613 . - 0 ID=BALIOE_22485;Name=hypothetical protein;locus_tag=BALIOE_22485;product=hypothetical protein;Parent=BALIOE_22485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9007 c1 Prodigal gene 4471708 4472007 . - . ID=BALIOE_22490_gene;locus_tag=BALIOE_22490 | |
| 9008 c1 Prodigal CDS 4471708 4472007 . - 0 ID=BALIOE_22490;Name=hypothetical protein;locus_tag=BALIOE_22490;product=hypothetical protein;Parent=BALIOE_22490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9009 c1 Prodigal gene 4472182 4473177 . + . ID=BALIOE_22495_gene;locus_tag=BALIOE_22495 | |
| 9010 c1 Prodigal CDS 4472182 4473177 . + 0 ID=BALIOE_22495;Name=hypothetical protein;locus_tag=BALIOE_22495;product=hypothetical protein;Parent=BALIOE_22495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9011 c1 Prodigal gene 4473219 4473656 . - . ID=BALIOE_22500_gene;locus_tag=BALIOE_22500 | |
| 9012 c1 Prodigal CDS 4473219 4473656 . - 0 ID=BALIOE_22500;Name=hypothetical protein;locus_tag=BALIOE_22500;product=hypothetical protein;Parent=BALIOE_22500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9013 c1 Prodigal gene 4473702 4474043 . - . ID=BALIOE_22505_gene;locus_tag=BALIOE_22505 | |
| 9014 c1 Prodigal CDS 4473702 4474043 . - 0 ID=BALIOE_22505;Name=hypothetical protein;locus_tag=BALIOE_22505;product=hypothetical protein;Parent=BALIOE_22505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9015 c1 Prodigal gene 4474212 4475666 . - . ID=BALIOE_22510_gene;locus_tag=BALIOE_22510 | |
| 9016 c1 Prodigal CDS 4474212 4475666 . - 0 ID=BALIOE_22510;Name=hypothetical protein;locus_tag=BALIOE_22510;product=hypothetical protein;Parent=BALIOE_22510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9017 c1 Prodigal gene 4475738 4477060 . - . ID=BALIOE_22515_gene;locus_tag=BALIOE_22515 | |
| 9018 c1 Prodigal CDS 4475738 4477060 . - 0 ID=BALIOE_22515;Name=hypothetical protein;locus_tag=BALIOE_22515;product=hypothetical protein;Parent=BALIOE_22515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9019 c1 Prodigal gene 4477426 4478418 . + . ID=BALIOE_22520_gene;locus_tag=BALIOE_22520 | |
| 9020 c1 Prodigal CDS 4477426 4478418 . + 0 ID=BALIOE_22520;Name=hypothetical protein;locus_tag=BALIOE_22520;product=hypothetical protein;Parent=BALIOE_22520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9021 c1 Prodigal gene 4478496 4480037 . + . ID=BALIOE_22525_gene;locus_tag=BALIOE_22525 | |
| 9022 c1 Prodigal CDS 4478496 4480037 . + 0 ID=BALIOE_22525;Name=hypothetical protein;locus_tag=BALIOE_22525;product=hypothetical protein;Parent=BALIOE_22525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9023 c1 Prodigal gene 4480015 4481196 . + . ID=BALIOE_22530_gene;locus_tag=BALIOE_22530 | |
| 9024 c1 Prodigal CDS 4480015 4481196 . + 0 ID=BALIOE_22530;Name=hypothetical protein;locus_tag=BALIOE_22530;product=hypothetical protein;Parent=BALIOE_22530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9025 c1 Prodigal gene 4481274 4482452 . + . ID=BALIOE_22535_gene;locus_tag=BALIOE_22535 | |
| 9026 c1 Prodigal CDS 4481274 4482452 . + 0 ID=BALIOE_22535;Name=hypothetical protein;locus_tag=BALIOE_22535;product=hypothetical protein;Parent=BALIOE_22535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9027 c1 Prodigal gene 4482560 4483384 . - . ID=BALIOE_22540_gene;locus_tag=BALIOE_22540 | |
| 9028 c1 Prodigal CDS 4482560 4483384 . - 0 ID=BALIOE_22540;Name=hypothetical protein;locus_tag=BALIOE_22540;product=hypothetical protein;Parent=BALIOE_22540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9029 c1 Prodigal gene 4483704 4485734 . + . ID=BALIOE_22545_gene;locus_tag=BALIOE_22545 | |
| 9030 c1 Prodigal CDS 4483704 4485734 . + 0 ID=BALIOE_22545;Name=hypothetical protein;locus_tag=BALIOE_22545;product=hypothetical protein;Parent=BALIOE_22545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9031 c1 Prodigal gene 4485912 4487165 . + . ID=BALIOE_22550_gene;locus_tag=BALIOE_22550 | |
| 9032 c1 Prodigal CDS 4485912 4487165 . + 0 ID=BALIOE_22550;Name=hypothetical protein;locus_tag=BALIOE_22550;product=hypothetical protein;Parent=BALIOE_22550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9033 c1 Prodigal gene 4487317 4487790 . - . ID=BALIOE_22555_gene;locus_tag=BALIOE_22555 | |
| 9034 c1 Prodigal CDS 4487317 4487790 . - 0 ID=BALIOE_22555;Name=hypothetical protein;locus_tag=BALIOE_22555;product=hypothetical protein;Parent=BALIOE_22555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9035 c1 Prodigal gene 4488034 4488849 . - . ID=BALIOE_22560_gene;locus_tag=BALIOE_22560 | |
| 9036 c1 Prodigal CDS 4488034 4488849 . - 0 ID=BALIOE_22560;Name=hypothetical protein;locus_tag=BALIOE_22560;product=hypothetical protein;Parent=BALIOE_22560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9037 c1 Prodigal gene 4489075 4490475 . + . ID=BALIOE_22565_gene;locus_tag=BALIOE_22565 | |
| 9038 c1 Prodigal CDS 4489075 4490475 . + 0 ID=BALIOE_22565;Name=hypothetical protein;locus_tag=BALIOE_22565;product=hypothetical protein;Parent=BALIOE_22565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9039 c1 Prodigal gene 4490486 4492456 . + . ID=BALIOE_22570_gene;locus_tag=BALIOE_22570 | |
| 9040 c1 Prodigal CDS 4490486 4492456 . + 0 ID=BALIOE_22570;Name=hypothetical protein;locus_tag=BALIOE_22570;product=hypothetical protein;Parent=BALIOE_22570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9041 c1 Prodigal gene 4492586 4493326 . - . ID=BALIOE_22575_gene;locus_tag=BALIOE_22575 | |
| 9042 c1 Prodigal CDS 4492586 4493326 . - 0 ID=BALIOE_22575;Name=hypothetical protein;locus_tag=BALIOE_22575;product=hypothetical protein;Parent=BALIOE_22575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9043 c1 Prodigal gene 4493450 4494424 . + . ID=BALIOE_22580_gene;locus_tag=BALIOE_22580 | |
| 9044 c1 Prodigal CDS 4493450 4494424 . + 0 ID=BALIOE_22580;Name=hypothetical protein;locus_tag=BALIOE_22580;product=hypothetical protein;Parent=BALIOE_22580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9045 c1 Prodigal gene 4494421 4495557 . - . ID=BALIOE_22585_gene;locus_tag=BALIOE_22585 | |
| 9046 c1 Prodigal CDS 4494421 4495557 . - 0 ID=BALIOE_22585;Name=hypothetical protein;locus_tag=BALIOE_22585;product=hypothetical protein;Parent=BALIOE_22585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9047 c1 Prodigal gene 4495563 4495886 . - . ID=BALIOE_22590_gene;locus_tag=BALIOE_22590 | |
| 9048 c1 Prodigal CDS 4495563 4495886 . - 0 ID=BALIOE_22590;Name=hypothetical protein;locus_tag=BALIOE_22590;product=hypothetical protein;Parent=BALIOE_22590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9049 c1 Prodigal gene 4496431 4497969 . - . ID=BALIOE_22595_gene;locus_tag=BALIOE_22595 | |
| 9050 c1 Prodigal CDS 4496431 4497969 . - 0 ID=BALIOE_22595;Name=hypothetical protein;locus_tag=BALIOE_22595;product=hypothetical protein;Parent=BALIOE_22595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9051 c1 Prodigal gene 4498077 4499372 . - . ID=BALIOE_22600_gene;locus_tag=BALIOE_22600 | |
| 9052 c1 Prodigal CDS 4498077 4499372 . - 0 ID=BALIOE_22600;Name=hypothetical protein;locus_tag=BALIOE_22600;product=hypothetical protein;Parent=BALIOE_22600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9053 c1 Prodigal gene 4499502 4500653 . - . ID=BALIOE_22605_gene;locus_tag=BALIOE_22605 | |
| 9054 c1 Prodigal CDS 4499502 4500653 . - 0 ID=BALIOE_22605;Name=hypothetical protein;locus_tag=BALIOE_22605;product=hypothetical protein;Parent=BALIOE_22605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9055 c1 Prodigal gene 4500842 4502686 . - . ID=BALIOE_22610_gene;locus_tag=BALIOE_22610 | |
| 9056 c1 Prodigal CDS 4500842 4502686 . - 0 ID=BALIOE_22610;Name=hypothetical protein;locus_tag=BALIOE_22610;product=hypothetical protein;Parent=BALIOE_22610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9057 c1 Prodigal gene 4502683 4504074 . - . ID=BALIOE_22615_gene;locus_tag=BALIOE_22615 | |
| 9058 c1 Prodigal CDS 4502683 4504074 . - 0 ID=BALIOE_22615;Name=hypothetical protein;locus_tag=BALIOE_22615;product=hypothetical protein;Parent=BALIOE_22615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9059 c1 Prodigal gene 4504172 4504780 . - . ID=BALIOE_22620_gene;locus_tag=BALIOE_22620 | |
| 9060 c1 Prodigal CDS 4504172 4504780 . - 0 ID=BALIOE_22620;Name=hypothetical protein;locus_tag=BALIOE_22620;product=hypothetical protein;Parent=BALIOE_22620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9061 c1 Prodigal gene 4505009 4509238 . + . ID=BALIOE_22625_gene;locus_tag=BALIOE_22625 | |
| 9062 c1 Prodigal CDS 4505009 4509238 . + 0 ID=BALIOE_22625;Name=hypothetical protein;locus_tag=BALIOE_22625;product=hypothetical protein;Parent=BALIOE_22625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9063 c1 Prodigal gene 4509250 4509711 . + . ID=BALIOE_22630_gene;locus_tag=BALIOE_22630 | |
| 9064 c1 Prodigal CDS 4509250 4509711 . + 0 ID=BALIOE_22630;Name=hypothetical protein;locus_tag=BALIOE_22630;product=hypothetical protein;Parent=BALIOE_22630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9065 c1 Prodigal gene 4511315 4512451 . - . ID=BALIOE_22635_gene;locus_tag=BALIOE_22635 | |
| 9066 c1 Prodigal CDS 4511315 4512451 . - 0 ID=BALIOE_22635;Name=hypothetical protein;locus_tag=BALIOE_22635;product=hypothetical protein;Parent=BALIOE_22635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9067 c1 Prodigal gene 4512454 4512816 . - . ID=BALIOE_22640_gene;locus_tag=BALIOE_22640 | |
| 9068 c1 Prodigal CDS 4512454 4512816 . - 0 ID=BALIOE_22640;Name=hypothetical protein;locus_tag=BALIOE_22640;product=hypothetical protein;Parent=BALIOE_22640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9069 c1 Prodigal gene 4513353 4515266 . + . ID=BALIOE_22645_gene;locus_tag=BALIOE_22645 | |
| 9070 c1 Prodigal CDS 4513353 4515266 . + 0 ID=BALIOE_22645;Name=hypothetical protein;locus_tag=BALIOE_22645;product=hypothetical protein;Parent=BALIOE_22645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9071 c1 Prodigal gene 4515361 4516509 . + . ID=BALIOE_22650_gene;locus_tag=BALIOE_22650 | |
| 9072 c1 Prodigal CDS 4515361 4516509 . + 0 ID=BALIOE_22650;Name=hypothetical protein;locus_tag=BALIOE_22650;product=hypothetical protein;Parent=BALIOE_22650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9073 c1 Prodigal gene 4516509 4517096 . + . ID=BALIOE_22655_gene;locus_tag=BALIOE_22655 | |
| 9074 c1 Prodigal CDS 4516509 4517096 . + 0 ID=BALIOE_22655;Name=hypothetical protein;locus_tag=BALIOE_22655;product=hypothetical protein;Parent=BALIOE_22655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9075 c1 Prodigal gene 4517108 4517317 . - . ID=BALIOE_22660_gene;locus_tag=BALIOE_22660 | |
| 9076 c1 Prodigal CDS 4517108 4517317 . - 0 ID=BALIOE_22660;Name=hypothetical protein;locus_tag=BALIOE_22660;product=hypothetical protein;Parent=BALIOE_22660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9077 c1 Prodigal gene 4517602 4517964 . + . ID=BALIOE_22665_gene;locus_tag=BALIOE_22665 | |
| 9078 c1 Prodigal CDS 4517602 4517964 . + 0 ID=BALIOE_22665;Name=hypothetical protein;locus_tag=BALIOE_22665;product=hypothetical protein;Parent=BALIOE_22665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9079 c1 Prodigal gene 4518609 4519190 . + . ID=BALIOE_22670_gene;locus_tag=BALIOE_22670 | |
| 9080 c1 Prodigal CDS 4518609 4519190 . + 0 ID=BALIOE_22670;Name=hypothetical protein;locus_tag=BALIOE_22670;product=hypothetical protein;Parent=BALIOE_22670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9081 c1 Prodigal gene 4519234 4524000 . + . ID=BALIOE_22675_gene;locus_tag=BALIOE_22675 | |
| 9082 c1 Prodigal CDS 4519234 4524000 . + 0 ID=BALIOE_22675;Name=hypothetical protein;locus_tag=BALIOE_22675;product=hypothetical protein;Parent=BALIOE_22675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9083 c1 Prodigal gene 4524368 4526023 . + . ID=BALIOE_22680_gene;locus_tag=BALIOE_22680 | |
| 9084 c1 Prodigal CDS 4524368 4526023 . + 0 ID=BALIOE_22680;Name=hypothetical protein;locus_tag=BALIOE_22680;product=hypothetical protein;Parent=BALIOE_22680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9085 c1 Prodigal gene 4526023 4526799 . + . ID=BALIOE_22685_gene;locus_tag=BALIOE_22685 | |
| 9086 c1 Prodigal CDS 4526023 4526799 . + 0 ID=BALIOE_22685;Name=hypothetical protein;locus_tag=BALIOE_22685;product=hypothetical protein;Parent=BALIOE_22685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9087 c1 Prodigal gene 4526796 4527986 . + . ID=BALIOE_22690_gene;locus_tag=BALIOE_22690 | |
| 9088 c1 Prodigal CDS 4526796 4527986 . + 0 ID=BALIOE_22690;Name=hypothetical protein;locus_tag=BALIOE_22690;product=hypothetical protein;Parent=BALIOE_22690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9089 c1 Prodigal gene 4528172 4528645 . + . ID=BALIOE_22695_gene;locus_tag=BALIOE_22695 | |
| 9090 c1 Prodigal CDS 4528172 4528645 . + 0 ID=BALIOE_22695;Name=hypothetical protein;locus_tag=BALIOE_22695;product=hypothetical protein;Parent=BALIOE_22695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9091 c1 Prodigal gene 4528698 4529519 . - . ID=BALIOE_22700_gene;locus_tag=BALIOE_22700 | |
| 9092 c1 Prodigal CDS 4528698 4529519 . - 0 ID=BALIOE_22700;Name=hypothetical protein;locus_tag=BALIOE_22700;product=hypothetical protein;Parent=BALIOE_22700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9093 c1 Prodigal gene 4529599 4530618 . - . ID=BALIOE_22705_gene;locus_tag=BALIOE_22705 | |
| 9094 c1 Prodigal CDS 4529599 4530618 . - 0 ID=BALIOE_22705;Name=hypothetical protein;locus_tag=BALIOE_22705;product=hypothetical protein;Parent=BALIOE_22705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9095 c1 Prodigal gene 4530618 4531085 . - . ID=BALIOE_22710_gene;locus_tag=BALIOE_22710 | |
| 9096 c1 Prodigal CDS 4530618 4531085 . - 0 ID=BALIOE_22710;Name=hypothetical protein;locus_tag=BALIOE_22710;product=hypothetical protein;Parent=BALIOE_22710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9097 c1 Prodigal gene 4531148 4531399 . - . ID=BALIOE_22715_gene;locus_tag=BALIOE_22715 | |
| 9098 c1 Prodigal CDS 4531148 4531399 . - 0 ID=BALIOE_22715;Name=hypothetical protein;locus_tag=BALIOE_22715;product=hypothetical protein;Parent=BALIOE_22715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9099 c1 Prodigal gene 4531541 4531972 . - . ID=BALIOE_22720_gene;locus_tag=BALIOE_22720 | |
| 9100 c1 Prodigal CDS 4531541 4531972 . - 0 ID=BALIOE_22720;Name=hypothetical protein;locus_tag=BALIOE_22720;product=hypothetical protein;Parent=BALIOE_22720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9101 c1 Prodigal gene 4532217 4533761 . + . ID=BALIOE_22725_gene;locus_tag=BALIOE_22725 | |
| 9102 c1 Prodigal CDS 4532217 4533761 . + 0 ID=BALIOE_22725;Name=hypothetical protein;locus_tag=BALIOE_22725;product=hypothetical protein;Parent=BALIOE_22725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9103 c1 Prodigal gene 4533795 4535054 . + . ID=BALIOE_22730_gene;locus_tag=BALIOE_22730 | |
| 9104 c1 Prodigal CDS 4533795 4535054 . + 0 ID=BALIOE_22730;Name=hypothetical protein;locus_tag=BALIOE_22730;product=hypothetical protein;Parent=BALIOE_22730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9105 c1 Prodigal gene 4535058 4536017 . + . ID=BALIOE_22735_gene;locus_tag=BALIOE_22735 | |
| 9106 c1 Prodigal CDS 4535058 4536017 . + 0 ID=BALIOE_22735;Name=hypothetical protein;locus_tag=BALIOE_22735;product=hypothetical protein;Parent=BALIOE_22735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9107 c1 Prodigal gene 4536023 4537039 . - . ID=BALIOE_22740_gene;locus_tag=BALIOE_22740 | |
| 9108 c1 Prodigal CDS 4536023 4537039 . - 0 ID=BALIOE_22740;Name=hypothetical protein;locus_tag=BALIOE_22740;product=hypothetical protein;Parent=BALIOE_22740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9109 c1 Prodigal gene 4537278 4538303 . - . ID=BALIOE_22745_gene;locus_tag=BALIOE_22745 | |
| 9110 c1 Prodigal CDS 4537278 4538303 . - 0 ID=BALIOE_22745;Name=hypothetical protein;locus_tag=BALIOE_22745;product=hypothetical protein;Parent=BALIOE_22745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9111 c1 Prodigal gene 4538313 4539509 . - . ID=BALIOE_22750_gene;locus_tag=BALIOE_22750 | |
| 9112 c1 Prodigal CDS 4538313 4539509 . - 0 ID=BALIOE_22750;Name=hypothetical protein;locus_tag=BALIOE_22750;product=hypothetical protein;Parent=BALIOE_22750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9113 c1 Prodigal gene 4539784 4540656 . - . ID=BALIOE_22755_gene;locus_tag=BALIOE_22755 | |
| 9114 c1 Prodigal CDS 4539784 4540656 . - 0 ID=BALIOE_22755;Name=hypothetical protein;locus_tag=BALIOE_22755;product=hypothetical protein;Parent=BALIOE_22755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9115 c1 Prodigal gene 4540945 4541877 . + . ID=BALIOE_22760_gene;locus_tag=BALIOE_22760 | |
| 9116 c1 Prodigal CDS 4540945 4541877 . + 0 ID=BALIOE_22760;Name=hypothetical protein;locus_tag=BALIOE_22760;product=hypothetical protein;Parent=BALIOE_22760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9117 c1 Prodigal gene 4541887 4542933 . + . ID=BALIOE_22765_gene;locus_tag=BALIOE_22765 | |
| 9118 c1 Prodigal CDS 4541887 4542933 . + 0 ID=BALIOE_22765;Name=hypothetical protein;locus_tag=BALIOE_22765;product=hypothetical protein;Parent=BALIOE_22765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9119 c1 Prodigal gene 4542937 4543929 . + . ID=BALIOE_22770_gene;locus_tag=BALIOE_22770 | |
| 9120 c1 Prodigal CDS 4542937 4543929 . + 0 ID=BALIOE_22770;Name=hypothetical protein;locus_tag=BALIOE_22770;product=hypothetical protein;Parent=BALIOE_22770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9121 c1 Prodigal gene 4543926 4545134 . + . ID=BALIOE_22775_gene;locus_tag=BALIOE_22775 | |
| 9122 c1 Prodigal CDS 4543926 4545134 . + 0 ID=BALIOE_22775;Name=hypothetical protein;locus_tag=BALIOE_22775;product=hypothetical protein;Parent=BALIOE_22775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9123 c1 Prodigal gene 4545170 4546312 . - . ID=BALIOE_22780_gene;locus_tag=BALIOE_22780 | |
| 9124 c1 Prodigal CDS 4545170 4546312 . - 0 ID=BALIOE_22780;Name=hypothetical protein;locus_tag=BALIOE_22780;product=hypothetical protein;Parent=BALIOE_22780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9125 c1 Prodigal gene 4546321 4547334 . - . ID=BALIOE_22785_gene;locus_tag=BALIOE_22785 | |
| 9126 c1 Prodigal CDS 4546321 4547334 . - 0 ID=BALIOE_22785;Name=hypothetical protein;locus_tag=BALIOE_22785;product=hypothetical protein;Parent=BALIOE_22785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9127 c1 Prodigal gene 4547359 4548066 . - . ID=BALIOE_22790_gene;locus_tag=BALIOE_22790 | |
| 9128 c1 Prodigal CDS 4547359 4548066 . - 0 ID=BALIOE_22790;Name=hypothetical protein;locus_tag=BALIOE_22790;product=hypothetical protein;Parent=BALIOE_22790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9129 c1 Prodigal gene 4548092 4549099 . - . ID=BALIOE_22795_gene;locus_tag=BALIOE_22795 | |
| 9130 c1 Prodigal CDS 4548092 4549099 . - 0 ID=BALIOE_22795;Name=hypothetical protein;locus_tag=BALIOE_22795;product=hypothetical protein;Parent=BALIOE_22795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9131 c1 Prodigal gene 4549142 4549939 . - . ID=BALIOE_22800_gene;locus_tag=BALIOE_22800 | |
| 9132 c1 Prodigal CDS 4549142 4549939 . - 0 ID=BALIOE_22800;Name=hypothetical protein;locus_tag=BALIOE_22800;product=hypothetical protein;Parent=BALIOE_22800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9133 c1 Prodigal gene 4549932 4551056 . - . ID=BALIOE_22805_gene;locus_tag=BALIOE_22805 | |
| 9134 c1 Prodigal CDS 4549932 4551056 . - 0 ID=BALIOE_22805;Name=hypothetical protein;locus_tag=BALIOE_22805;product=hypothetical protein;Parent=BALIOE_22805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9135 c1 Prodigal gene 4551053 4552111 . - . ID=BALIOE_22810_gene;locus_tag=BALIOE_22810 | |
| 9136 c1 Prodigal CDS 4551053 4552111 . - 0 ID=BALIOE_22810;Name=hypothetical protein;locus_tag=BALIOE_22810;product=hypothetical protein;Parent=BALIOE_22810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9137 c1 Prodigal gene 4552524 4553801 . + . ID=BALIOE_22815_gene;locus_tag=BALIOE_22815 | |
| 9138 c1 Prodigal CDS 4552524 4553801 . + 0 ID=BALIOE_22815;Name=hypothetical protein;locus_tag=BALIOE_22815;product=hypothetical protein;Parent=BALIOE_22815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9139 c1 Prodigal gene 4553809 4554288 . + . ID=BALIOE_22820_gene;locus_tag=BALIOE_22820 | |
| 9140 c1 Prodigal CDS 4553809 4554288 . + 0 ID=BALIOE_22820;Name=hypothetical protein;locus_tag=BALIOE_22820;product=hypothetical protein;Parent=BALIOE_22820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9141 c1 Prodigal gene 4554327 4555136 . - . ID=BALIOE_22825_gene;locus_tag=BALIOE_22825 | |
| 9142 c1 Prodigal CDS 4554327 4555136 . - 0 ID=BALIOE_22825;Name=hypothetical protein;locus_tag=BALIOE_22825;product=hypothetical protein;Parent=BALIOE_22825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9143 c1 Prodigal gene 4555234 4555401 . - . ID=BALIOE_22830_gene;locus_tag=BALIOE_22830 | |
| 9144 c1 Prodigal CDS 4555234 4555401 . - 0 ID=BALIOE_22830;Name=hypothetical protein;locus_tag=BALIOE_22830;product=hypothetical protein;Parent=BALIOE_22830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9145 c1 Prodigal gene 4555422 4555658 . - . ID=BALIOE_22835_gene;locus_tag=BALIOE_22835 | |
| 9146 c1 Prodigal CDS 4555422 4555658 . - 0 ID=BALIOE_22835;Name=hypothetical protein;locus_tag=BALIOE_22835;product=hypothetical protein;Parent=BALIOE_22835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9147 c1 Prodigal gene 4555875 4556543 . - . ID=BALIOE_22840_gene;locus_tag=BALIOE_22840 | |
| 9148 c1 Prodigal CDS 4555875 4556543 . - 0 ID=BALIOE_22840;Name=hypothetical protein;locus_tag=BALIOE_22840;product=hypothetical protein;Parent=BALIOE_22840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9149 c1 Prodigal gene 4556715 4557935 . + . ID=BALIOE_22845_gene;locus_tag=BALIOE_22845 | |
| 9150 c1 Prodigal CDS 4556715 4557935 . + 0 ID=BALIOE_22845;Name=hypothetical protein;locus_tag=BALIOE_22845;product=hypothetical protein;Parent=BALIOE_22845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9151 c1 Prodigal gene 4557913 4558371 . + . ID=BALIOE_22850_gene;locus_tag=BALIOE_22850 | |
| 9152 c1 Prodigal CDS 4557913 4558371 . + 0 ID=BALIOE_22850;Name=hypothetical protein;locus_tag=BALIOE_22850;product=hypothetical protein;Parent=BALIOE_22850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9153 c1 Prodigal gene 4558478 4559074 . + . ID=BALIOE_22855_gene;locus_tag=BALIOE_22855 | |
| 9154 c1 Prodigal CDS 4558478 4559074 . + 0 ID=BALIOE_22855;Name=hypothetical protein;locus_tag=BALIOE_22855;product=hypothetical protein;Parent=BALIOE_22855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9155 c1 Prodigal gene 4559111 4559752 . - . ID=BALIOE_22860_gene;locus_tag=BALIOE_22860 | |
| 9156 c1 Prodigal CDS 4559111 4559752 . - 0 ID=BALIOE_22860;Name=hypothetical protein;locus_tag=BALIOE_22860;product=hypothetical protein;Parent=BALIOE_22860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9157 c1 Prodigal gene 4559818 4560534 . - . ID=BALIOE_22865_gene;locus_tag=BALIOE_22865 | |
| 9158 c1 Prodigal CDS 4559818 4560534 . - 0 ID=BALIOE_22865;Name=hypothetical protein;locus_tag=BALIOE_22865;product=hypothetical protein;Parent=BALIOE_22865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9159 c1 Prodigal gene 4560661 4561524 . + . ID=BALIOE_22870_gene;locus_tag=BALIOE_22870 | |
| 9160 c1 Prodigal CDS 4560661 4561524 . + 0 ID=BALIOE_22870;Name=hypothetical protein;locus_tag=BALIOE_22870;product=hypothetical protein;Parent=BALIOE_22870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9161 c1 Prodigal gene 4561745 4562569 . + . ID=BALIOE_22875_gene;locus_tag=BALIOE_22875 | |
| 9162 c1 Prodigal CDS 4561745 4562569 . + 0 ID=BALIOE_22875;Name=hypothetical protein;locus_tag=BALIOE_22875;product=hypothetical protein;Parent=BALIOE_22875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9163 c1 Prodigal gene 4562861 4563478 . + . ID=BALIOE_22880_gene;locus_tag=BALIOE_22880 | |
| 9164 c1 Prodigal CDS 4562861 4563478 . + 0 ID=BALIOE_22880;Name=hypothetical protein;locus_tag=BALIOE_22880;product=hypothetical protein;Parent=BALIOE_22880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9165 c1 Prodigal gene 4563475 4565157 . - . ID=BALIOE_22885_gene;locus_tag=BALIOE_22885 | |
| 9166 c1 Prodigal CDS 4563475 4565157 . - 0 ID=BALIOE_22885;Name=hypothetical protein;locus_tag=BALIOE_22885;product=hypothetical protein;Parent=BALIOE_22885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9167 c1 Prodigal gene 4565415 4566038 . + . ID=BALIOE_22890_gene;locus_tag=BALIOE_22890 | |
| 9168 c1 Prodigal CDS 4565415 4566038 . + 0 ID=BALIOE_22890;Name=hypothetical protein;locus_tag=BALIOE_22890;product=hypothetical protein;Parent=BALIOE_22890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9169 c1 Prodigal gene 4566093 4566368 . + . ID=BALIOE_22895_gene;locus_tag=BALIOE_22895 | |
| 9170 c1 Prodigal CDS 4566093 4566368 . + 0 ID=BALIOE_22895;Name=hypothetical protein;locus_tag=BALIOE_22895;product=hypothetical protein;Parent=BALIOE_22895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9171 c1 Prodigal gene 4566387 4568495 . + . ID=BALIOE_22900_gene;locus_tag=BALIOE_22900 | |
| 9172 c1 Prodigal CDS 4566387 4568495 . + 0 ID=BALIOE_22900;Name=hypothetical protein;locus_tag=BALIOE_22900;product=hypothetical protein;Parent=BALIOE_22900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9173 c1 Prodigal gene 4568535 4569191 . + . ID=BALIOE_22905_gene;locus_tag=BALIOE_22905 | |
| 9174 c1 Prodigal CDS 4568535 4569191 . + 0 ID=BALIOE_22905;Name=hypothetical protein;locus_tag=BALIOE_22905;product=hypothetical protein;Parent=BALIOE_22905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9175 c1 Prodigal gene 4569197 4571278 . + . ID=BALIOE_22910_gene;locus_tag=BALIOE_22910 | |
| 9176 c1 Prodigal CDS 4569197 4571278 . + 0 ID=BALIOE_22910;Name=hypothetical protein;locus_tag=BALIOE_22910;product=hypothetical protein;Parent=BALIOE_22910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9177 c1 Prodigal gene 4571263 4572129 . - . ID=BALIOE_22915_gene;locus_tag=BALIOE_22915 | |
| 9178 c1 Prodigal CDS 4571263 4572129 . - 0 ID=BALIOE_22915;Name=hypothetical protein;locus_tag=BALIOE_22915;product=hypothetical protein;Parent=BALIOE_22915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9179 c1 Prodigal gene 4572132 4573337 . - . ID=BALIOE_22920_gene;locus_tag=BALIOE_22920 | |
| 9180 c1 Prodigal CDS 4572132 4573337 . - 0 ID=BALIOE_22920;Name=hypothetical protein;locus_tag=BALIOE_22920;product=hypothetical protein;Parent=BALIOE_22920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9181 c1 Prodigal gene 4573617 4575008 . + . ID=BALIOE_22925_gene;locus_tag=BALIOE_22925 | |
| 9182 c1 Prodigal CDS 4573617 4575008 . + 0 ID=BALIOE_22925;Name=hypothetical protein;locus_tag=BALIOE_22925;product=hypothetical protein;Parent=BALIOE_22925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9183 c1 Prodigal gene 4575129 4576838 . + . ID=BALIOE_22930_gene;locus_tag=BALIOE_22930 | |
| 9184 c1 Prodigal CDS 4575129 4576838 . + 0 ID=BALIOE_22930;Name=hypothetical protein;locus_tag=BALIOE_22930;product=hypothetical protein;Parent=BALIOE_22930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9185 c1 Prodigal gene 4576891 4579209 . - . ID=BALIOE_22935_gene;locus_tag=BALIOE_22935 | |
| 9186 c1 Prodigal CDS 4576891 4579209 . - 0 ID=BALIOE_22935;Name=hypothetical protein;locus_tag=BALIOE_22935;product=hypothetical protein;Parent=BALIOE_22935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9187 c1 Prodigal gene 4579219 4580601 . - . ID=BALIOE_22940_gene;locus_tag=BALIOE_22940 | |
| 9188 c1 Prodigal CDS 4579219 4580601 . - 0 ID=BALIOE_22940;Name=hypothetical protein;locus_tag=BALIOE_22940;product=hypothetical protein;Parent=BALIOE_22940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9189 c1 tRNAscan-SE gene 4580894 4580988 . + . ID=BALIOE_22945_gene;locus_tag=BALIOE_22945;gene=SeC_trna | |
| 9190 c1 tRNAscan-SE tRNA 4580894 4580988 . + . ID=BALIOE_22945;Name=tRNA-SeC;locus_tag=BALIOE_22945;product=tRNA-SeC;gene=SeC_trna;Parent=BALIOE_22945_gene;inference=profile:tRNAscan:2.0;Note=SO:0005857 | |
| 9191 c1 Prodigal gene 4581184 4582365 . + . ID=BALIOE_22950_gene;locus_tag=BALIOE_22950 | |
| 9192 c1 Prodigal CDS 4581184 4582365 . + 0 ID=BALIOE_22950;Name=hypothetical protein;locus_tag=BALIOE_22950;product=hypothetical protein;Parent=BALIOE_22950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9193 c1 Prodigal gene 4582500 4582814 . + . ID=BALIOE_22955_gene;locus_tag=BALIOE_22955 | |
| 9194 c1 Prodigal CDS 4582500 4582814 . + 0 ID=BALIOE_22955;Name=hypothetical protein;locus_tag=BALIOE_22955;product=hypothetical protein;Parent=BALIOE_22955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9195 c1 Prodigal gene 4582934 4583680 . + . ID=BALIOE_22960_gene;locus_tag=BALIOE_22960 | |
| 9196 c1 Prodigal CDS 4582934 4583680 . + 0 ID=BALIOE_22960;Name=hypothetical protein;locus_tag=BALIOE_22960;product=hypothetical protein;Parent=BALIOE_22960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9197 c1 Prodigal gene 4583931 4584305 . + . ID=BALIOE_22965_gene;locus_tag=BALIOE_22965 | |
| 9198 c1 Prodigal CDS 4583931 4584305 . + 0 ID=BALIOE_22965;Name=hypothetical protein;locus_tag=BALIOE_22965;product=hypothetical protein;Parent=BALIOE_22965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9199 c1 Prodigal gene 4584302 4584793 . + . ID=BALIOE_22970_gene;locus_tag=BALIOE_22970 | |
| 9200 c1 Prodigal CDS 4584302 4584793 . + 0 ID=BALIOE_22970;Name=hypothetical protein;locus_tag=BALIOE_22970;product=hypothetical protein;Parent=BALIOE_22970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9201 c1 Prodigal gene 4584805 4585002 . + . ID=BALIOE_22975_gene;locus_tag=BALIOE_22975 | |
| 9202 c1 Prodigal CDS 4584805 4585002 . + 0 ID=BALIOE_22975;Name=hypothetical protein;locus_tag=BALIOE_22975;product=hypothetical protein;Parent=BALIOE_22975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9203 c1 Prodigal gene 4585087 4585428 . + . ID=BALIOE_22980_gene;locus_tag=BALIOE_22980 | |
| 9204 c1 Prodigal CDS 4585087 4585428 . + 0 ID=BALIOE_22980;Name=hypothetical protein;locus_tag=BALIOE_22980;product=hypothetical protein;Parent=BALIOE_22980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9205 c1 Prodigal gene 4585489 4585632 . + . ID=BALIOE_22985_gene;locus_tag=BALIOE_22985 | |
| 9206 c1 Prodigal CDS 4585489 4585632 . + 0 ID=BALIOE_22985;Name=hypothetical protein;locus_tag=BALIOE_22985;product=hypothetical protein;Parent=BALIOE_22985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9207 c1 Prodigal gene 4586205 4586585 . + . ID=BALIOE_22990_gene;locus_tag=BALIOE_22990 | |
| 9208 c1 Prodigal CDS 4586205 4586585 . + 0 ID=BALIOE_22990;Name=hypothetical protein;locus_tag=BALIOE_22990;product=hypothetical protein;Parent=BALIOE_22990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9209 c1 Prodigal gene 4586582 4586929 . + . ID=BALIOE_22995_gene;locus_tag=BALIOE_22995 | |
| 9210 c1 Prodigal CDS 4586582 4586929 . + 0 ID=BALIOE_22995;Name=hypothetical protein;locus_tag=BALIOE_22995;product=hypothetical protein;Parent=BALIOE_22995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9211 c1 Prodigal gene 4586979 4588517 . + . ID=BALIOE_23000_gene;locus_tag=BALIOE_23000 | |
| 9212 c1 Prodigal CDS 4586979 4588517 . + 0 ID=BALIOE_23000;Name=hypothetical protein;locus_tag=BALIOE_23000;product=hypothetical protein;Parent=BALIOE_23000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9213 c1 Prodigal gene 4589382 4590128 . - . ID=BALIOE_23005_gene;locus_tag=BALIOE_23005 | |
| 9214 c1 Prodigal CDS 4589382 4590128 . - 0 ID=BALIOE_23005;Name=hypothetical protein;locus_tag=BALIOE_23005;product=hypothetical protein;Parent=BALIOE_23005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9215 c1 Prodigal gene 4590213 4590491 . - . ID=BALIOE_23010_gene;locus_tag=BALIOE_23010 | |
| 9216 c1 Prodigal CDS 4590213 4590491 . - 0 ID=BALIOE_23010;Name=hypothetical protein;locus_tag=BALIOE_23010;product=hypothetical protein;Parent=BALIOE_23010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9217 c1 Prodigal gene 4590497 4590718 . - . ID=BALIOE_23015_gene;locus_tag=BALIOE_23015 | |
| 9218 c1 Prodigal CDS 4590497 4590718 . - 0 ID=BALIOE_23015;Name=hypothetical protein;locus_tag=BALIOE_23015;product=hypothetical protein;Parent=BALIOE_23015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9219 c1 Prodigal gene 4590754 4591161 . - . ID=BALIOE_23020_gene;locus_tag=BALIOE_23020 | |
| 9220 c1 Prodigal CDS 4590754 4591161 . - 0 ID=BALIOE_23020;Name=hypothetical protein;locus_tag=BALIOE_23020;product=hypothetical protein;Parent=BALIOE_23020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9221 c1 Prodigal gene 4591168 4592106 . - . ID=BALIOE_23025_gene;locus_tag=BALIOE_23025 | |
| 9222 c1 Prodigal CDS 4591168 4592106 . - 0 ID=BALIOE_23025;Name=hypothetical protein;locus_tag=BALIOE_23025;product=hypothetical protein;Parent=BALIOE_23025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9223 c1 Prodigal gene 4592127 4593251 . - . ID=BALIOE_23030_gene;locus_tag=BALIOE_23030 | |
| 9224 c1 Prodigal CDS 4592127 4593251 . - 0 ID=BALIOE_23030;Name=hypothetical protein;locus_tag=BALIOE_23030;product=hypothetical protein;Parent=BALIOE_23030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9225 c1 Prodigal gene 4593264 4593842 . - . ID=BALIOE_23035_gene;locus_tag=BALIOE_23035 | |
| 9226 c1 Prodigal CDS 4593264 4593842 . - 0 ID=BALIOE_23035;Name=hypothetical protein;locus_tag=BALIOE_23035;product=hypothetical protein;Parent=BALIOE_23035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9227 c1 Prodigal gene 4593901 4594956 . - . ID=BALIOE_23040_gene;locus_tag=BALIOE_23040 | |
| 9228 c1 Prodigal CDS 4593901 4594956 . - 0 ID=BALIOE_23040;Name=hypothetical protein;locus_tag=BALIOE_23040;product=hypothetical protein;Parent=BALIOE_23040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9229 c1 Prodigal gene 4595099 4596319 . + . ID=BALIOE_23045_gene;locus_tag=BALIOE_23045 | |
| 9230 c1 Prodigal CDS 4595099 4596319 . + 0 ID=BALIOE_23045;Name=hypothetical protein;locus_tag=BALIOE_23045;product=hypothetical protein;Parent=BALIOE_23045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9231 c1 Prodigal gene 4596583 4599387 . - . ID=BALIOE_23050_gene;locus_tag=BALIOE_23050 | |
| 9232 c1 Prodigal CDS 4596583 4599387 . - 0 ID=BALIOE_23050;Name=hypothetical protein;locus_tag=BALIOE_23050;product=hypothetical protein;Parent=BALIOE_23050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9233 c1 Prodigal gene 4599447 4599917 . - . ID=BALIOE_23055_gene;locus_tag=BALIOE_23055 | |
| 9234 c1 Prodigal CDS 4599447 4599917 . - 0 ID=BALIOE_23055;Name=hypothetical protein;locus_tag=BALIOE_23055;product=hypothetical protein;Parent=BALIOE_23055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9235 c1 Prodigal gene 4600055 4601731 . - . ID=BALIOE_23060_gene;locus_tag=BALIOE_23060 | |
| 9236 c1 Prodigal CDS 4600055 4601731 . - 0 ID=BALIOE_23060;Name=hypothetical protein;locus_tag=BALIOE_23060;product=hypothetical protein;Parent=BALIOE_23060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9237 c1 Prodigal gene 4602155 4602766 . - . ID=BALIOE_23065_gene;locus_tag=BALIOE_23065 | |
| 9238 c1 Prodigal CDS 4602155 4602766 . - 0 ID=BALIOE_23065;Name=hypothetical protein;locus_tag=BALIOE_23065;product=hypothetical protein;Parent=BALIOE_23065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9239 c1 Prodigal gene 4603032 4603415 . + . ID=BALIOE_23070_gene;locus_tag=BALIOE_23070 | |
| 9240 c1 Prodigal CDS 4603032 4603415 . + 0 ID=BALIOE_23070;Name=hypothetical protein;locus_tag=BALIOE_23070;product=hypothetical protein;Parent=BALIOE_23070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9241 c1 Prodigal gene 4603613 4604119 . - . ID=BALIOE_23075_gene;locus_tag=BALIOE_23075 | |
| 9242 c1 Prodigal CDS 4603613 4604119 . - 0 ID=BALIOE_23075;Name=hypothetical protein;locus_tag=BALIOE_23075;product=hypothetical protein;Parent=BALIOE_23075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9243 c1 Prodigal gene 4604150 4605067 . - . ID=BALIOE_23080_gene;locus_tag=BALIOE_23080 | |
| 9244 c1 Prodigal CDS 4604150 4605067 . - 0 ID=BALIOE_23080;Name=hypothetical protein;locus_tag=BALIOE_23080;product=hypothetical protein;Parent=BALIOE_23080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9245 c1 Prodigal gene 4605439 4605759 . - . ID=BALIOE_23085_gene;locus_tag=BALIOE_23085 | |
| 9246 c1 Prodigal CDS 4605439 4605759 . - 0 ID=BALIOE_23085;Name=hypothetical protein;locus_tag=BALIOE_23085;product=hypothetical protein;Parent=BALIOE_23085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9247 c1 Prodigal gene 4605819 4607159 . - . ID=BALIOE_23090_gene;locus_tag=BALIOE_23090 | |
| 9248 c1 Prodigal CDS 4605819 4607159 . - 0 ID=BALIOE_23090;Name=hypothetical protein;locus_tag=BALIOE_23090;product=hypothetical protein;Parent=BALIOE_23090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9249 c1 Prodigal gene 4607143 4609170 . - . ID=BALIOE_23095_gene;locus_tag=BALIOE_23095 | |
| 9250 c1 Prodigal CDS 4607143 4609170 . - 0 ID=BALIOE_23095;Name=hypothetical protein;locus_tag=BALIOE_23095;product=hypothetical protein;Parent=BALIOE_23095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9251 c1 Prodigal gene 4609167 4609520 . - . ID=BALIOE_23100_gene;locus_tag=BALIOE_23100 | |
| 9252 c1 Prodigal CDS 4609167 4609520 . - 0 ID=BALIOE_23100;Name=hypothetical protein;locus_tag=BALIOE_23100;product=hypothetical protein;Parent=BALIOE_23100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9253 c1 Prodigal gene 4609705 4610004 . + . ID=BALIOE_23105_gene;locus_tag=BALIOE_23105 | |
| 9254 c1 Prodigal CDS 4609705 4610004 . + 0 ID=BALIOE_23105;Name=hypothetical protein;locus_tag=BALIOE_23105;product=hypothetical protein;Parent=BALIOE_23105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9255 c1 Prodigal gene 4610088 4610465 . + . ID=BALIOE_23110_gene;locus_tag=BALIOE_23110 | |
| 9256 c1 Prodigal CDS 4610088 4610465 . + 0 ID=BALIOE_23110;Name=hypothetical protein;locus_tag=BALIOE_23110;product=hypothetical protein;Parent=BALIOE_23110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9257 c1 Prodigal gene 4610468 4611040 . + . ID=BALIOE_23115_gene;locus_tag=BALIOE_23115 | |
| 9258 c1 Prodigal CDS 4610468 4611040 . + 0 ID=BALIOE_23115;Name=hypothetical protein;locus_tag=BALIOE_23115;product=hypothetical protein;Parent=BALIOE_23115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9259 c1 Prodigal gene 4611046 4611501 . + . ID=BALIOE_23120_gene;locus_tag=BALIOE_23120 | |
| 9260 c1 Prodigal CDS 4611046 4611501 . + 0 ID=BALIOE_23120;Name=hypothetical protein;locus_tag=BALIOE_23120;product=hypothetical protein;Parent=BALIOE_23120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9261 c1 Prodigal gene 4611501 4613039 . + . ID=BALIOE_23125_gene;locus_tag=BALIOE_23125 | |
| 9262 c1 Prodigal CDS 4611501 4613039 . + 0 ID=BALIOE_23125;Name=hypothetical protein;locus_tag=BALIOE_23125;product=hypothetical protein;Parent=BALIOE_23125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9263 c1 Prodigal gene 4613053 4613508 . + . ID=BALIOE_23130_gene;locus_tag=BALIOE_23130 | |
| 9264 c1 Prodigal CDS 4613053 4613508 . + 0 ID=BALIOE_23130;Name=hypothetical protein;locus_tag=BALIOE_23130;product=hypothetical protein;Parent=BALIOE_23130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9265 c1 Prodigal gene 4613892 4614305 . - . ID=BALIOE_23135_gene;locus_tag=BALIOE_23135 | |
| 9266 c1 Prodigal CDS 4613892 4614305 . - 0 ID=BALIOE_23135;Name=hypothetical protein;locus_tag=BALIOE_23135;product=hypothetical protein;Parent=BALIOE_23135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9267 c1 Prodigal gene 4614360 4614731 . - . ID=BALIOE_23140_gene;locus_tag=BALIOE_23140 | |
| 9268 c1 Prodigal CDS 4614360 4614731 . - 0 ID=BALIOE_23140;Name=hypothetical protein;locus_tag=BALIOE_23140;product=hypothetical protein;Parent=BALIOE_23140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9269 c1 Prodigal gene 4614927 4615385 . + . ID=BALIOE_23145_gene;locus_tag=BALIOE_23145 | |
| 9270 c1 Prodigal CDS 4614927 4615385 . + 0 ID=BALIOE_23145;Name=hypothetical protein;locus_tag=BALIOE_23145;product=hypothetical protein;Parent=BALIOE_23145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9271 c1 Prodigal gene 4615382 4616419 . - . ID=BALIOE_23150_gene;locus_tag=BALIOE_23150 | |
| 9272 c1 Prodigal CDS 4615382 4616419 . - 0 ID=BALIOE_23150;Name=hypothetical protein;locus_tag=BALIOE_23150;product=hypothetical protein;Parent=BALIOE_23150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9273 c1 Prodigal gene 4616412 4617188 . - . ID=BALIOE_23155_gene;locus_tag=BALIOE_23155 | |
| 9274 c1 Prodigal CDS 4616412 4617188 . - 0 ID=BALIOE_23155;Name=hypothetical protein;locus_tag=BALIOE_23155;product=hypothetical protein;Parent=BALIOE_23155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9275 c1 Prodigal gene 4617188 4617457 . - . ID=BALIOE_23160_gene;locus_tag=BALIOE_23160 | |
| 9276 c1 Prodigal CDS 4617188 4617457 . - 0 ID=BALIOE_23160;Name=hypothetical protein;locus_tag=BALIOE_23160;product=hypothetical protein;Parent=BALIOE_23160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9277 c1 Prodigal gene 4617457 4618110 . - . ID=BALIOE_23165_gene;locus_tag=BALIOE_23165 | |
| 9278 c1 Prodigal CDS 4617457 4618110 . - 0 ID=BALIOE_23165;Name=hypothetical protein;locus_tag=BALIOE_23165;product=hypothetical protein;Parent=BALIOE_23165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9279 c1 Prodigal gene 4618115 4618768 . - . ID=BALIOE_23170_gene;locus_tag=BALIOE_23170 | |
| 9280 c1 Prodigal CDS 4618115 4618768 . - 0 ID=BALIOE_23170;Name=hypothetical protein;locus_tag=BALIOE_23170;product=hypothetical protein;Parent=BALIOE_23170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9281 c1 Prodigal gene 4618755 4619354 . - . ID=BALIOE_23175_gene;locus_tag=BALIOE_23175 | |
| 9282 c1 Prodigal CDS 4618755 4619354 . - 0 ID=BALIOE_23175;Name=hypothetical protein;locus_tag=BALIOE_23175;product=hypothetical protein;Parent=BALIOE_23175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9283 c1 Prodigal gene 4619351 4619665 . - . ID=BALIOE_23180_gene;locus_tag=BALIOE_23180 | |
| 9284 c1 Prodigal CDS 4619351 4619665 . - 0 ID=BALIOE_23180;Name=hypothetical protein;locus_tag=BALIOE_23180;product=hypothetical protein;Parent=BALIOE_23180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9285 c1 Prodigal gene 4619678 4619896 . - . ID=BALIOE_23185_gene;locus_tag=BALIOE_23185 | |
| 9286 c1 Prodigal CDS 4619678 4619896 . - 0 ID=BALIOE_23185;Name=hypothetical protein;locus_tag=BALIOE_23185;product=hypothetical protein;Parent=BALIOE_23185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9287 c1 Prodigal gene 4619911 4620282 . - . ID=BALIOE_23190_gene;locus_tag=BALIOE_23190 | |
| 9288 c1 Prodigal CDS 4619911 4620282 . - 0 ID=BALIOE_23190;Name=hypothetical protein;locus_tag=BALIOE_23190;product=hypothetical protein;Parent=BALIOE_23190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9289 c1 Prodigal gene 4621596 4622741 . + . ID=BALIOE_23195_gene;locus_tag=BALIOE_23195 | |
| 9290 c1 Prodigal CDS 4621596 4622741 . + 0 ID=BALIOE_23195;Name=hypothetical protein;locus_tag=BALIOE_23195;product=hypothetical protein;Parent=BALIOE_23195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9291 c1 Prodigal gene 4622869 4623687 . + . ID=BALIOE_23200_gene;locus_tag=BALIOE_23200 | |
| 9292 c1 Prodigal CDS 4622869 4623687 . + 0 ID=BALIOE_23200;Name=hypothetical protein;locus_tag=BALIOE_23200;product=hypothetical protein;Parent=BALIOE_23200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9293 c1 Prodigal gene 4624081 4624188 . - . ID=BALIOE_23205_gene;locus_tag=BALIOE_23205 | |
| 9294 c1 Prodigal CDS 4624081 4624188 . - 0 ID=BALIOE_23205;Name=hypothetical protein;locus_tag=BALIOE_23205;product=hypothetical protein;Parent=BALIOE_23205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9295 c1 Prodigal gene 4624707 4625630 . + . ID=BALIOE_23210_gene;locus_tag=BALIOE_23210 | |
| 9296 c1 Prodigal CDS 4624707 4625630 . + 0 ID=BALIOE_23210;Name=hypothetical protein;locus_tag=BALIOE_23210;product=hypothetical protein;Parent=BALIOE_23210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9297 c1 Prodigal gene 4625634 4626452 . - . ID=BALIOE_23215_gene;locus_tag=BALIOE_23215 | |
| 9298 c1 Prodigal CDS 4625634 4626452 . - 0 ID=BALIOE_23215;Name=hypothetical protein;locus_tag=BALIOE_23215;product=hypothetical protein;Parent=BALIOE_23215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9299 c1 Prodigal gene 4626674 4626967 . + . ID=BALIOE_23220_gene;locus_tag=BALIOE_23220 | |
| 9300 c1 Prodigal CDS 4626674 4626967 . + 0 ID=BALIOE_23220;Name=hypothetical protein;locus_tag=BALIOE_23220;product=hypothetical protein;Parent=BALIOE_23220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9301 c1 Prodigal gene 4627008 4628246 . - . ID=BALIOE_23225_gene;locus_tag=BALIOE_23225 | |
| 9302 c1 Prodigal CDS 4627008 4628246 . - 0 ID=BALIOE_23225;Name=hypothetical protein;locus_tag=BALIOE_23225;product=hypothetical protein;Parent=BALIOE_23225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9303 c1 Prodigal gene 4628432 4628785 . + . ID=BALIOE_23230_gene;locus_tag=BALIOE_23230 | |
| 9304 c1 Prodigal CDS 4628432 4628785 . + 0 ID=BALIOE_23230;Name=hypothetical protein;locus_tag=BALIOE_23230;product=hypothetical protein;Parent=BALIOE_23230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9305 c1 Prodigal gene 4628769 4629092 . + . ID=BALIOE_23235_gene;locus_tag=BALIOE_23235 | |
| 9306 c1 Prodigal CDS 4628769 4629092 . + 0 ID=BALIOE_23235;Name=hypothetical protein;locus_tag=BALIOE_23235;product=hypothetical protein;Parent=BALIOE_23235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9307 c1 Prodigal gene 4629208 4629660 . - . ID=BALIOE_23240_gene;locus_tag=BALIOE_23240 | |
| 9308 c1 Prodigal CDS 4629208 4629660 . - 0 ID=BALIOE_23240;Name=hypothetical protein;locus_tag=BALIOE_23240;product=hypothetical protein;Parent=BALIOE_23240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9309 c1 Prodigal gene 4629713 4630078 . - . ID=BALIOE_23245_gene;locus_tag=BALIOE_23245 | |
| 9310 c1 Prodigal CDS 4629713 4630078 . - 0 ID=BALIOE_23245;Name=hypothetical protein;locus_tag=BALIOE_23245;product=hypothetical protein;Parent=BALIOE_23245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9311 c1 Prodigal gene 4630051 4631046 . - . ID=BALIOE_23250_gene;locus_tag=BALIOE_23250 | |
| 9312 c1 Prodigal CDS 4630051 4631046 . - 0 ID=BALIOE_23250;Name=hypothetical protein;locus_tag=BALIOE_23250;product=hypothetical protein;Parent=BALIOE_23250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9313 c1 Prodigal gene 4631221 4632987 . + . ID=BALIOE_23255_gene;locus_tag=BALIOE_23255 | |
| 9314 c1 Prodigal CDS 4631221 4632987 . + 0 ID=BALIOE_23255;Name=hypothetical protein;locus_tag=BALIOE_23255;product=hypothetical protein;Parent=BALIOE_23255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9315 c1 Prodigal gene 4633033 4634424 . - . ID=BALIOE_23260_gene;locus_tag=BALIOE_23260 | |
| 9316 c1 Prodigal CDS 4633033 4634424 . - 0 ID=BALIOE_23260;Name=hypothetical protein;locus_tag=BALIOE_23260;product=hypothetical protein;Parent=BALIOE_23260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9317 c1 Prodigal gene 4634562 4635881 . - . ID=BALIOE_23265_gene;locus_tag=BALIOE_23265 | |
| 9318 c1 Prodigal CDS 4634562 4635881 . - 0 ID=BALIOE_23265;Name=hypothetical protein;locus_tag=BALIOE_23265;product=hypothetical protein;Parent=BALIOE_23265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9319 c1 Prodigal gene 4635891 4637393 . - . ID=BALIOE_23270_gene;locus_tag=BALIOE_23270 | |
| 9320 c1 Prodigal CDS 4635891 4637393 . - 0 ID=BALIOE_23270;Name=hypothetical protein;locus_tag=BALIOE_23270;product=hypothetical protein;Parent=BALIOE_23270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9321 c1 Prodigal gene 4637393 4637983 . - . ID=BALIOE_23275_gene;locus_tag=BALIOE_23275 | |
| 9322 c1 Prodigal CDS 4637393 4637983 . - 0 ID=BALIOE_23275;Name=hypothetical protein;locus_tag=BALIOE_23275;product=hypothetical protein;Parent=BALIOE_23275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9323 c1 Prodigal gene 4638145 4639248 . - . ID=BALIOE_23280_gene;locus_tag=BALIOE_23280 | |
| 9324 c1 Prodigal CDS 4638145 4639248 . - 0 ID=BALIOE_23280;Name=hypothetical protein;locus_tag=BALIOE_23280;product=hypothetical protein;Parent=BALIOE_23280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9325 c1 Prodigal gene 4639264 4639578 . - . ID=BALIOE_23285_gene;locus_tag=BALIOE_23285 | |
| 9326 c1 Prodigal CDS 4639264 4639578 . - 0 ID=BALIOE_23285;Name=hypothetical protein;locus_tag=BALIOE_23285;product=hypothetical protein;Parent=BALIOE_23285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9327 c1 Prodigal gene 4639856 4640338 . - . ID=BALIOE_23290_gene;locus_tag=BALIOE_23290 | |
| 9328 c1 Prodigal CDS 4639856 4640338 . - 0 ID=BALIOE_23290;Name=hypothetical protein;locus_tag=BALIOE_23290;product=hypothetical protein;Parent=BALIOE_23290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9329 c1 Prodigal gene 4640486 4641139 . - . ID=BALIOE_23295_gene;locus_tag=BALIOE_23295 | |
| 9330 c1 Prodigal CDS 4640486 4641139 . - 0 ID=BALIOE_23295;Name=hypothetical protein;locus_tag=BALIOE_23295;product=hypothetical protein;Parent=BALIOE_23295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9331 c1 Prodigal gene 4641402 4641692 . - . ID=BALIOE_23300_gene;locus_tag=BALIOE_23300 | |
| 9332 c1 Prodigal CDS 4641402 4641692 . - 0 ID=BALIOE_23300;Name=hypothetical protein;locus_tag=BALIOE_23300;product=hypothetical protein;Parent=BALIOE_23300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9333 c1 Prodigal gene 4641696 4643384 . - . ID=BALIOE_23305_gene;locus_tag=BALIOE_23305 | |
| 9334 c1 Prodigal CDS 4641696 4643384 . - 0 ID=BALIOE_23305;Name=hypothetical protein;locus_tag=BALIOE_23305;product=hypothetical protein;Parent=BALIOE_23305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9335 c1 Prodigal gene 4644153 4644242 . + . ID=BALIOE_23310_gene;locus_tag=BALIOE_23310 | |
| 9336 c1 Prodigal CDS 4644153 4644242 . + 0 ID=BALIOE_23310;Name=hypothetical protein;locus_tag=BALIOE_23310;product=hypothetical protein;Parent=BALIOE_23310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9337 c1 Prodigal gene 4644522 4645706 . + . ID=BALIOE_23315_gene;locus_tag=BALIOE_23315 | |
| 9338 c1 Prodigal CDS 4644522 4645706 . + 0 ID=BALIOE_23315;Name=hypothetical protein;locus_tag=BALIOE_23315;product=hypothetical protein;Parent=BALIOE_23315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9339 c1 Prodigal gene 4645714 4646211 . - . ID=BALIOE_23320_gene;locus_tag=BALIOE_23320 | |
| 9340 c1 Prodigal CDS 4645714 4646211 . - 0 ID=BALIOE_23320;Name=hypothetical protein;locus_tag=BALIOE_23320;product=hypothetical protein;Parent=BALIOE_23320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9341 c1 Prodigal gene 4646208 4646570 . - . ID=BALIOE_23325_gene;locus_tag=BALIOE_23325 | |
| 9342 c1 Prodigal CDS 4646208 4646570 . - 0 ID=BALIOE_23325;Name=hypothetical protein;locus_tag=BALIOE_23325;product=hypothetical protein;Parent=BALIOE_23325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9343 c1 Prodigal gene 4646560 4646907 . - . ID=BALIOE_23330_gene;locus_tag=BALIOE_23330 | |
| 9344 c1 Prodigal CDS 4646560 4646907 . - 0 ID=BALIOE_23330;Name=hypothetical protein;locus_tag=BALIOE_23330;product=hypothetical protein;Parent=BALIOE_23330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9345 c1 Prodigal gene 4647016 4647465 . + . ID=BALIOE_23335_gene;locus_tag=BALIOE_23335 | |
| 9346 c1 Prodigal CDS 4647016 4647465 . + 0 ID=BALIOE_23335;Name=hypothetical protein;locus_tag=BALIOE_23335;product=hypothetical protein;Parent=BALIOE_23335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9347 c1 Prodigal gene 4647512 4649005 . - . ID=BALIOE_23340_gene;locus_tag=BALIOE_23340 | |
| 9348 c1 Prodigal CDS 4647512 4649005 . - 0 ID=BALIOE_23340;Name=hypothetical protein;locus_tag=BALIOE_23340;product=hypothetical protein;Parent=BALIOE_23340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9349 c1 Prodigal gene 4649002 4650717 . - . ID=BALIOE_23345_gene;locus_tag=BALIOE_23345 | |
| 9350 c1 Prodigal CDS 4649002 4650717 . - 0 ID=BALIOE_23345;Name=hypothetical protein;locus_tag=BALIOE_23345;product=hypothetical protein;Parent=BALIOE_23345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9351 c1 Prodigal gene 4650884 4651777 . + . ID=BALIOE_23350_gene;locus_tag=BALIOE_23350 | |
| 9352 c1 Prodigal CDS 4650884 4651777 . + 0 ID=BALIOE_23350;Name=hypothetical protein;locus_tag=BALIOE_23350;product=hypothetical protein;Parent=BALIOE_23350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9353 c1 Prodigal gene 4651774 4653096 . - . ID=BALIOE_23355_gene;locus_tag=BALIOE_23355 | |
| 9354 c1 Prodigal CDS 4651774 4653096 . - 0 ID=BALIOE_23355;Name=hypothetical protein;locus_tag=BALIOE_23355;product=hypothetical protein;Parent=BALIOE_23355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9355 c1 Prodigal gene 4653096 4654712 . - . ID=BALIOE_23360_gene;locus_tag=BALIOE_23360 | |
| 9356 c1 Prodigal CDS 4653096 4654712 . - 0 ID=BALIOE_23360;Name=hypothetical protein;locus_tag=BALIOE_23360;product=hypothetical protein;Parent=BALIOE_23360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9357 c1 Prodigal gene 4655008 4655724 . + . ID=BALIOE_23365_gene;locus_tag=BALIOE_23365 | |
| 9358 c1 Prodigal CDS 4655008 4655724 . + 0 ID=BALIOE_23365;Name=hypothetical protein;locus_tag=BALIOE_23365;product=hypothetical protein;Parent=BALIOE_23365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9359 c1 Prodigal gene 4655721 4657382 . - . ID=BALIOE_23370_gene;locus_tag=BALIOE_23370 | |
| 9360 c1 Prodigal CDS 4655721 4657382 . - 0 ID=BALIOE_23370;Name=hypothetical protein;locus_tag=BALIOE_23370;product=hypothetical protein;Parent=BALIOE_23370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9361 c1 Prodigal gene 4657578 4658006 . - . ID=BALIOE_23375_gene;locus_tag=BALIOE_23375 | |
| 9362 c1 Prodigal CDS 4657578 4658006 . - 0 ID=BALIOE_23375;Name=hypothetical protein;locus_tag=BALIOE_23375;product=hypothetical protein;Parent=BALIOE_23375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9363 c1 Prodigal gene 4658118 4658531 . - . ID=BALIOE_23380_gene;locus_tag=BALIOE_23380 | |
| 9364 c1 Prodigal CDS 4658118 4658531 . - 0 ID=BALIOE_23380;Name=hypothetical protein;locus_tag=BALIOE_23380;product=hypothetical protein;Parent=BALIOE_23380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9365 c1 Prodigal gene 4658909 4659169 . + . ID=BALIOE_23385_gene;locus_tag=BALIOE_23385 | |
| 9366 c1 Prodigal CDS 4658909 4659169 . + 0 ID=BALIOE_23385;Name=hypothetical protein;locus_tag=BALIOE_23385;product=hypothetical protein;Parent=BALIOE_23385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9367 c1 Prodigal gene 4659171 4660385 . - . ID=BALIOE_23390_gene;locus_tag=BALIOE_23390 | |
| 9368 c1 Prodigal CDS 4659171 4660385 . - 0 ID=BALIOE_23390;Name=hypothetical protein;locus_tag=BALIOE_23390;product=hypothetical protein;Parent=BALIOE_23390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9369 c1 Prodigal gene 4660486 4661550 . + . ID=BALIOE_23395_gene;locus_tag=BALIOE_23395 | |
| 9370 c1 Prodigal CDS 4660486 4661550 . + 0 ID=BALIOE_23395;Name=hypothetical protein;locus_tag=BALIOE_23395;product=hypothetical protein;Parent=BALIOE_23395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9371 c1 Prodigal gene 4661796 4662452 . + . ID=BALIOE_23400_gene;locus_tag=BALIOE_23400 | |
| 9372 c1 Prodigal CDS 4661796 4662452 . + 0 ID=BALIOE_23400;Name=hypothetical protein;locus_tag=BALIOE_23400;product=hypothetical protein;Parent=BALIOE_23400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9373 c1 Prodigal gene 4662498 4663310 . - . ID=BALIOE_23405_gene;locus_tag=BALIOE_23405 | |
| 9374 c1 Prodigal CDS 4662498 4663310 . - 0 ID=BALIOE_23405;Name=hypothetical protein;locus_tag=BALIOE_23405;product=hypothetical protein;Parent=BALIOE_23405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9375 c1 Prodigal gene 4663425 4663823 . - . ID=BALIOE_23410_gene;locus_tag=BALIOE_23410 | |
| 9376 c1 Prodigal CDS 4663425 4663823 . - 0 ID=BALIOE_23410;Name=hypothetical protein;locus_tag=BALIOE_23410;product=hypothetical protein;Parent=BALIOE_23410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9377 c1 Prodigal gene 4664063 4666477 . - . ID=BALIOE_23415_gene;locus_tag=BALIOE_23415 | |
| 9378 c1 Prodigal CDS 4664063 4666477 . - 0 ID=BALIOE_23415;Name=hypothetical protein;locus_tag=BALIOE_23415;product=hypothetical protein;Parent=BALIOE_23415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9379 c1 Prodigal gene 4666506 4667579 . - . ID=BALIOE_23420_gene;locus_tag=BALIOE_23420 | |
| 9380 c1 Prodigal CDS 4666506 4667579 . - 0 ID=BALIOE_23420;Name=hypothetical protein;locus_tag=BALIOE_23420;product=hypothetical protein;Parent=BALIOE_23420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9381 c1 Prodigal gene 4667579 4668679 . - . ID=BALIOE_23425_gene;locus_tag=BALIOE_23425 | |
| 9382 c1 Prodigal CDS 4667579 4668679 . - 0 ID=BALIOE_23425;Name=hypothetical protein;locus_tag=BALIOE_23425;product=hypothetical protein;Parent=BALIOE_23425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9383 c1 Prodigal gene 4668684 4670087 . - . ID=BALIOE_23430_gene;locus_tag=BALIOE_23430;gene=dnaA | |
| 9384 c1 Prodigal CDS 4668684 4670087 . - 0 ID=BALIOE_23430;Name=Chromosomal replication initiator protein DnaA;locus_tag=BALIOE_23430;product=Chromosomal replication initiator protein DnaA;Dbxref=GO:0003688,GO:0005524,GO:0005737,GO:0006270,GO:0006275;gene=dnaA;Parent=BALIOE_23430_gene;inference=ab initio prediction:Prodigal:2.6;Note=COG:COG0593,COG:L,RefSeq:WP_000059116.1,SO:0001217,UniParc:UPI0000129520,UniRef:UniRef100_Q8XBZ3,UniRef:UniRef50_Q9KVX6,UniRef:UniRef90_Q6CYR4 | |
| 9385 c1 Prodigal gene 4670694 4670834 . + . ID=BALIOE_23435_gene;locus_tag=BALIOE_23435 | |
| 9386 c1 Prodigal CDS 4670694 4670834 . + 0 ID=BALIOE_23435;Name=hypothetical protein;locus_tag=BALIOE_23435;product=hypothetical protein;Parent=BALIOE_23435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9387 c1 Prodigal gene 4670884 4671210 . + . ID=BALIOE_23440_gene;locus_tag=BALIOE_23440 | |
| 9388 c1 Prodigal CDS 4670884 4671210 . + 0 ID=BALIOE_23440;Name=hypothetical protein;locus_tag=BALIOE_23440;product=hypothetical protein;Parent=BALIOE_23440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9389 c1 Prodigal gene 4671434 4673080 . + . ID=BALIOE_23445_gene;locus_tag=BALIOE_23445 | |
| 9390 c1 Prodigal CDS 4671434 4673080 . + 0 ID=BALIOE_23445;Name=hypothetical protein;locus_tag=BALIOE_23445;product=hypothetical protein;Parent=BALIOE_23445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9391 c1 Prodigal gene 4673186 4674550 . + . ID=BALIOE_23450_gene;locus_tag=BALIOE_23450 | |
| 9392 c1 Prodigal CDS 4673186 4674550 . + 0 ID=BALIOE_23450;Name=hypothetical protein;locus_tag=BALIOE_23450;product=hypothetical protein;Parent=BALIOE_23450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9393 c1 Prodigal gene 4674700 4674930 . - . ID=BALIOE_23455_gene;locus_tag=BALIOE_23455 | |
| 9394 c1 Prodigal CDS 4674700 4674930 . - 0 ID=BALIOE_23455;Name=hypothetical protein;locus_tag=BALIOE_23455;product=hypothetical protein;Parent=BALIOE_23455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9395 c1 Prodigal gene 4674881 4676869 . - . ID=BALIOE_23460_gene;locus_tag=BALIOE_23460 | |
| 9396 c1 Prodigal CDS 4674881 4676869 . - 0 ID=BALIOE_23460;Name=hypothetical protein;locus_tag=BALIOE_23460;product=hypothetical protein;Parent=BALIOE_23460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9397 c1 Prodigal gene 4677564 4678979 . + . ID=BALIOE_23465_gene;locus_tag=BALIOE_23465 | |
| 9398 c1 Prodigal CDS 4677564 4678979 . + 0 ID=BALIOE_23465;Name=hypothetical protein;locus_tag=BALIOE_23465;product=hypothetical protein;Parent=BALIOE_23465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9399 c1 Prodigal gene 4679070 4680317 . + . ID=BALIOE_23470_gene;locus_tag=BALIOE_23470 | |
| 9400 c1 Prodigal CDS 4679070 4680317 . + 0 ID=BALIOE_23470;Name=hypothetical protein;locus_tag=BALIOE_23470;product=hypothetical protein;Parent=BALIOE_23470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9401 c1 Prodigal gene 4680449 4681624 . + . ID=BALIOE_23475_gene;locus_tag=BALIOE_23475 | |
| 9402 c1 Prodigal CDS 4680449 4681624 . + 0 ID=BALIOE_23475;Name=hypothetical protein;locus_tag=BALIOE_23475;product=hypothetical protein;Parent=BALIOE_23475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9403 c1 Prodigal gene 4681599 4682558 . + . ID=BALIOE_23480_gene;locus_tag=BALIOE_23480 | |
| 9404 c1 Prodigal CDS 4681599 4682558 . + 0 ID=BALIOE_23480;Name=hypothetical protein;locus_tag=BALIOE_23480;product=hypothetical protein;Parent=BALIOE_23480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9405 c1 Prodigal gene 4682715 4683464 . + . ID=BALIOE_23485_gene;locus_tag=BALIOE_23485 | |
| 9406 c1 Prodigal CDS 4682715 4683464 . + 0 ID=BALIOE_23485;Name=hypothetical protein;locus_tag=BALIOE_23485;product=hypothetical protein;Parent=BALIOE_23485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9407 c1 Prodigal gene 4683486 4684052 . + . ID=BALIOE_23490_gene;locus_tag=BALIOE_23490 | |
| 9408 c1 Prodigal CDS 4683486 4684052 . + 0 ID=BALIOE_23490;Name=hypothetical protein;locus_tag=BALIOE_23490;product=hypothetical protein;Parent=BALIOE_23490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9409 c1 Prodigal gene 4684106 4685443 . - . ID=BALIOE_23495_gene;locus_tag=BALIOE_23495 | |
| 9410 c1 Prodigal CDS 4684106 4685443 . - 0 ID=BALIOE_23495;Name=hypothetical protein;locus_tag=BALIOE_23495;product=hypothetical protein;Parent=BALIOE_23495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9411 c1 Prodigal gene 4685609 4686274 . + . ID=BALIOE_23500_gene;locus_tag=BALIOE_23500 | |
| 9412 c1 Prodigal CDS 4685609 4686274 . + 0 ID=BALIOE_23500;Name=hypothetical protein;locus_tag=BALIOE_23500;product=hypothetical protein;Parent=BALIOE_23500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9413 c1 Prodigal gene 4686411 4688819 . - . ID=BALIOE_23505_gene;locus_tag=BALIOE_23505 | |
| 9414 c1 Prodigal CDS 4686411 4688819 . - 0 ID=BALIOE_23505;Name=hypothetical protein;locus_tag=BALIOE_23505;product=hypothetical protein;Parent=BALIOE_23505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9415 c1 Prodigal gene 4689120 4689791 . + . ID=BALIOE_23510_gene;locus_tag=BALIOE_23510 | |
| 9416 c1 Prodigal CDS 4689120 4689791 . + 0 ID=BALIOE_23510;Name=hypothetical protein;locus_tag=BALIOE_23510;product=hypothetical protein;Parent=BALIOE_23510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9417 c1 Prodigal gene 4689882 4690307 . + . ID=BALIOE_23515_gene;locus_tag=BALIOE_23515 | |
| 9418 c1 Prodigal CDS 4689882 4690307 . + 0 ID=BALIOE_23515;Name=hypothetical protein;locus_tag=BALIOE_23515;product=hypothetical protein;Parent=BALIOE_23515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9419 c1 Prodigal gene 4690776 4693037 . - . ID=BALIOE_23520_gene;locus_tag=BALIOE_23520 | |
| 9420 c1 Prodigal CDS 4690776 4693037 . - 0 ID=BALIOE_23520;Name=hypothetical protein;locus_tag=BALIOE_23520;product=hypothetical protein;Parent=BALIOE_23520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9421 c1 Prodigal gene 4693127 4693261 . - . ID=BALIOE_23525_gene;locus_tag=BALIOE_23525 | |
| 9422 c1 Prodigal CDS 4693127 4693261 . - 0 ID=BALIOE_23525;Name=hypothetical protein;locus_tag=BALIOE_23525;product=hypothetical protein;Parent=BALIOE_23525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9423 c1 Prodigal gene 4693686 4694411 . - . ID=BALIOE_23530_gene;locus_tag=BALIOE_23530 | |
| 9424 c1 Prodigal CDS 4693686 4694411 . - 0 ID=BALIOE_23530;Name=hypothetical protein;locus_tag=BALIOE_23530;product=hypothetical protein;Parent=BALIOE_23530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9425 c1 Prodigal gene 4694426 4695199 . - . ID=BALIOE_23535_gene;locus_tag=BALIOE_23535 | |
| 9426 c1 Prodigal CDS 4694426 4695199 . - 0 ID=BALIOE_23535;Name=hypothetical protein;locus_tag=BALIOE_23535;product=hypothetical protein;Parent=BALIOE_23535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9427 c1 Prodigal gene 4695382 4696272 . - . ID=BALIOE_23540_gene;locus_tag=BALIOE_23540 | |
| 9428 c1 Prodigal CDS 4695382 4696272 . - 0 ID=BALIOE_23540;Name=hypothetical protein;locus_tag=BALIOE_23540;product=hypothetical protein;Parent=BALIOE_23540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9429 c1 Prodigal gene 4696272 4697231 . - . ID=BALIOE_23545_gene;locus_tag=BALIOE_23545 | |
| 9430 c1 Prodigal CDS 4696272 4697231 . - 0 ID=BALIOE_23545;Name=hypothetical protein;locus_tag=BALIOE_23545;product=hypothetical protein;Parent=BALIOE_23545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9431 c1 Prodigal gene 4697318 4698358 . - . ID=BALIOE_23550_gene;locus_tag=BALIOE_23550 | |
| 9432 c1 Prodigal CDS 4697318 4698358 . - 0 ID=BALIOE_23550;Name=hypothetical protein;locus_tag=BALIOE_23550;product=hypothetical protein;Parent=BALIOE_23550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9433 c1 Prodigal gene 4698570 4699652 . - . ID=BALIOE_23555_gene;locus_tag=BALIOE_23555 | |
| 9434 c1 Prodigal CDS 4698570 4699652 . - 0 ID=BALIOE_23555;Name=hypothetical protein;locus_tag=BALIOE_23555;product=hypothetical protein;Parent=BALIOE_23555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9435 c1 Prodigal gene 4699680 4700750 . - . ID=BALIOE_23560_gene;locus_tag=BALIOE_23560 | |
| 9436 c1 Prodigal CDS 4699680 4700750 . - 0 ID=BALIOE_23560;Name=hypothetical protein;locus_tag=BALIOE_23560;product=hypothetical protein;Parent=BALIOE_23560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9437 c1 Prodigal gene 4700762 4703296 . - . ID=BALIOE_23565_gene;locus_tag=BALIOE_23565 | |
| 9438 c1 Prodigal CDS 4700762 4703296 . - 0 ID=BALIOE_23565;Name=hypothetical protein;locus_tag=BALIOE_23565;product=hypothetical protein;Parent=BALIOE_23565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9439 c1 Prodigal gene 4703620 4704003 . - . ID=BALIOE_23570_gene;locus_tag=BALIOE_23570 | |
| 9440 c1 Prodigal CDS 4703620 4704003 . - 0 ID=BALIOE_23570;Name=hypothetical protein;locus_tag=BALIOE_23570;product=hypothetical protein;Parent=BALIOE_23570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9441 c1 Prodigal gene 4704107 4704709 . - . ID=BALIOE_23575_gene;locus_tag=BALIOE_23575 | |
| 9442 c1 Prodigal CDS 4704107 4704709 . - 0 ID=BALIOE_23575;Name=hypothetical protein;locus_tag=BALIOE_23575;product=hypothetical protein;Parent=BALIOE_23575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9443 c1 Prodigal gene 4705409 4707238 . - . ID=BALIOE_23580_gene;locus_tag=BALIOE_23580 | |
| 9444 c1 Prodigal CDS 4705409 4707238 . - 0 ID=BALIOE_23580;Name=hypothetical protein;locus_tag=BALIOE_23580;product=hypothetical protein;Parent=BALIOE_23580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9445 c1 Prodigal gene 4707400 4708770 . - . ID=BALIOE_23585_gene;locus_tag=BALIOE_23585 | |
| 9446 c1 Prodigal CDS 4707400 4708770 . - 0 ID=BALIOE_23585;Name=hypothetical protein;locus_tag=BALIOE_23585;product=hypothetical protein;Parent=BALIOE_23585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9447 c1 Prodigal gene 4709122 4709541 . - . ID=BALIOE_23590_gene;locus_tag=BALIOE_23590 | |
| 9448 c1 Prodigal CDS 4709122 4709541 . - 0 ID=BALIOE_23590;Name=hypothetical protein;locus_tag=BALIOE_23590;product=hypothetical protein;Parent=BALIOE_23590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9449 c1 Prodigal gene 4709562 4710944 . - . ID=BALIOE_23595_gene;locus_tag=BALIOE_23595 | |
| 9450 c1 Prodigal CDS 4709562 4710944 . - 0 ID=BALIOE_23595;Name=hypothetical protein;locus_tag=BALIOE_23595;product=hypothetical protein;Parent=BALIOE_23595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9451 c1 Prodigal gene 4710971 4711834 . - . ID=BALIOE_23600_gene;locus_tag=BALIOE_23600 | |
| 9452 c1 Prodigal CDS 4710971 4711834 . - 0 ID=BALIOE_23600;Name=hypothetical protein;locus_tag=BALIOE_23600;product=hypothetical protein;Parent=BALIOE_23600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9453 c1 Prodigal gene 4711885 4713426 . - . ID=BALIOE_23605_gene;locus_tag=BALIOE_23605 | |
| 9454 c1 Prodigal CDS 4711885 4713426 . - 0 ID=BALIOE_23605;Name=hypothetical protein;locus_tag=BALIOE_23605;product=hypothetical protein;Parent=BALIOE_23605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9455 c1 Prodigal gene 4713439 4713972 . - . ID=BALIOE_23610_gene;locus_tag=BALIOE_23610 | |
| 9456 c1 Prodigal CDS 4713439 4713972 . - 0 ID=BALIOE_23610;Name=hypothetical protein;locus_tag=BALIOE_23610;product=hypothetical protein;Parent=BALIOE_23610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9457 c1 Prodigal gene 4713987 4714457 . - . ID=BALIOE_23615_gene;locus_tag=BALIOE_23615 | |
| 9458 c1 Prodigal CDS 4713987 4714457 . - 0 ID=BALIOE_23615;Name=hypothetical protein;locus_tag=BALIOE_23615;product=hypothetical protein;Parent=BALIOE_23615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9459 c1 Prodigal gene 4714519 4714758 . - . ID=BALIOE_23620_gene;locus_tag=BALIOE_23620 | |
| 9460 c1 Prodigal CDS 4714519 4714758 . - 0 ID=BALIOE_23620;Name=hypothetical protein;locus_tag=BALIOE_23620;product=hypothetical protein;Parent=BALIOE_23620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9461 c1 Prodigal gene 4714805 4715620 . - . ID=BALIOE_23625_gene;locus_tag=BALIOE_23625 | |
| 9462 c1 Prodigal CDS 4714805 4715620 . - 0 ID=BALIOE_23625;Name=hypothetical protein;locus_tag=BALIOE_23625;product=hypothetical protein;Parent=BALIOE_23625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9463 c1 Prodigal gene 4715629 4716009 . - . ID=BALIOE_23630_gene;locus_tag=BALIOE_23630 | |
| 9464 c1 Prodigal CDS 4715629 4716009 . - 0 ID=BALIOE_23630;Name=hypothetical protein;locus_tag=BALIOE_23630;product=hypothetical protein;Parent=BALIOE_23630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9465 c1 Prodigal gene 4716626 4717249 . - . ID=BALIOE_23635_gene;locus_tag=BALIOE_23635 | |
| 9466 c1 Prodigal CDS 4716626 4717249 . - 0 ID=BALIOE_23635;Name=hypothetical protein;locus_tag=BALIOE_23635;product=hypothetical protein;Parent=BALIOE_23635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9467 c1 Prodigal gene 4717313 4719202 . - . ID=BALIOE_23640_gene;locus_tag=BALIOE_23640 | |
| 9468 c1 Prodigal CDS 4717313 4719202 . - 0 ID=BALIOE_23640;Name=hypothetical protein;locus_tag=BALIOE_23640;product=hypothetical protein;Parent=BALIOE_23640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9469 c1 Prodigal gene 4719581 4720024 . - . ID=BALIOE_23645_gene;locus_tag=BALIOE_23645 | |
| 9470 c1 Prodigal CDS 4719581 4720024 . - 0 ID=BALIOE_23645;Name=hypothetical protein;locus_tag=BALIOE_23645;product=hypothetical protein;Parent=BALIOE_23645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9471 c1 Prodigal gene 4720114 4720572 . - . ID=BALIOE_23650_gene;locus_tag=BALIOE_23650 | |
| 9472 c1 Prodigal CDS 4720114 4720572 . - 0 ID=BALIOE_23650;Name=hypothetical protein;locus_tag=BALIOE_23650;product=hypothetical protein;Parent=BALIOE_23650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9473 c1 Prodigal gene 4720724 4721716 . + . ID=BALIOE_23655_gene;locus_tag=BALIOE_23655 | |
| 9474 c1 Prodigal CDS 4720724 4721716 . + 0 ID=BALIOE_23655;Name=hypothetical protein;locus_tag=BALIOE_23655;product=hypothetical protein;Parent=BALIOE_23655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9475 c1 Prodigal gene 4721721 4723172 . - . ID=BALIOE_23660_gene;locus_tag=BALIOE_23660 | |
| 9476 c1 Prodigal CDS 4721721 4723172 . - 0 ID=BALIOE_23660;Name=hypothetical protein;locus_tag=BALIOE_23660;product=hypothetical protein;Parent=BALIOE_23660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9477 c1 Prodigal gene 4723166 4724662 . - . ID=BALIOE_23665_gene;locus_tag=BALIOE_23665 | |
| 9478 c1 Prodigal CDS 4723166 4724662 . - 0 ID=BALIOE_23665;Name=hypothetical protein;locus_tag=BALIOE_23665;product=hypothetical protein;Parent=BALIOE_23665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9479 c1 Prodigal gene 4724885 4726753 . + . ID=BALIOE_23670_gene;locus_tag=BALIOE_23670 | |
| 9480 c1 Prodigal CDS 4724885 4726753 . + 0 ID=BALIOE_23670;Name=hypothetical protein;locus_tag=BALIOE_23670;product=hypothetical protein;Parent=BALIOE_23670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9481 c1 Prodigal gene 4726920 4727339 . + . ID=BALIOE_23675_gene;locus_tag=BALIOE_23675 | |
| 9482 c1 Prodigal CDS 4726920 4727339 . + 0 ID=BALIOE_23675;Name=hypothetical protein;locus_tag=BALIOE_23675;product=hypothetical protein;Parent=BALIOE_23675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9483 c1 Prodigal gene 4727347 4728852 . + . ID=BALIOE_23680_gene;locus_tag=BALIOE_23680 | |
| 9484 c1 Prodigal CDS 4727347 4728852 . + 0 ID=BALIOE_23680;Name=hypothetical protein;locus_tag=BALIOE_23680;product=hypothetical protein;Parent=BALIOE_23680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9485 c1 Prodigal gene 4728857 4729822 . + . ID=BALIOE_23685_gene;locus_tag=BALIOE_23685 | |
| 9486 c1 Prodigal CDS 4728857 4729822 . + 0 ID=BALIOE_23685;Name=hypothetical protein;locus_tag=BALIOE_23685;product=hypothetical protein;Parent=BALIOE_23685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9487 c1 Prodigal gene 4729847 4730737 . + . ID=BALIOE_23690_gene;locus_tag=BALIOE_23690 | |
| 9488 c1 Prodigal CDS 4729847 4730737 . + 0 ID=BALIOE_23690;Name=hypothetical protein;locus_tag=BALIOE_23690;product=hypothetical protein;Parent=BALIOE_23690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9489 c1 Prodigal gene 4730863 4731792 . + . ID=BALIOE_23695_gene;locus_tag=BALIOE_23695 | |
| 9490 c1 Prodigal CDS 4730863 4731792 . + 0 ID=BALIOE_23695;Name=hypothetical protein;locus_tag=BALIOE_23695;product=hypothetical protein;Parent=BALIOE_23695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9491 c1 Prodigal gene 4731796 4732788 . + . ID=BALIOE_23700_gene;locus_tag=BALIOE_23700 | |
| 9492 c1 Prodigal CDS 4731796 4732788 . + 0 ID=BALIOE_23700;Name=hypothetical protein;locus_tag=BALIOE_23700;product=hypothetical protein;Parent=BALIOE_23700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9493 c1 Prodigal gene 4732754 4734181 . - . ID=BALIOE_23705_gene;locus_tag=BALIOE_23705 | |
| 9494 c1 Prodigal CDS 4732754 4734181 . - 0 ID=BALIOE_23705;Name=hypothetical protein;locus_tag=BALIOE_23705;product=hypothetical protein;Parent=BALIOE_23705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9495 c1 Prodigal gene 4734204 4734896 . - . ID=BALIOE_23710_gene;locus_tag=BALIOE_23710 | |
| 9496 c1 Prodigal CDS 4734204 4734896 . - 0 ID=BALIOE_23710;Name=hypothetical protein;locus_tag=BALIOE_23710;product=hypothetical protein;Parent=BALIOE_23710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9497 c1 Infernal gene 4735377 4736918 . + . ID=BALIOE_23715_gene;locus_tag=BALIOE_23715;gene=16S_rrna | |
| 9498 c1 Infernal rRNA 4735377 4736918 9.1e-49 + . ID=BALIOE_23715;Name=16S ribosomal RNA;locus_tag=BALIOE_23715;gene=16S_rrna;product=16S ribosomal RNA;Dbxref=GO:0005840,GO:0003735,RFAM:RF00177;Parent=BALIOE_23715_gene;inference=profile:Rfam:RF00177;Note=SO:0001000 | |
| 9499 c1 tRNAscan-SE gene 4737004 4737079 . + . ID=BALIOE_23720_gene;locus_tag=BALIOE_23720;gene=Glu_trna | |
| 9500 c1 tRNAscan-SE tRNA 4737004 4737079 . + . ID=BALIOE_23720;Name=tRNA-Glu;locus_tag=BALIOE_23720;product=tRNA-Glu;gene=Glu_trna;Parent=BALIOE_23720_gene;inference=profile:tRNAscan:2.0;Note=SO:0000259 | |
| 9501 c1 tRNAscan-SE gene 4740442 4740518 . + . ID=BALIOE_23725_gene;locus_tag=BALIOE_23725;gene=Asp_trna | |
| 9502 c1 tRNAscan-SE tRNA 4740442 4740518 . + . ID=BALIOE_23725;Name=tRNA-Asp;locus_tag=BALIOE_23725;product=tRNA-Asp;gene=Asp_trna;Parent=BALIOE_23725_gene;inference=profile:tRNAscan:2.0;Note=SO:0000256 | |
| 9503 c1 tRNAscan-SE gene 4740527 4740602 . + . ID=BALIOE_23730_gene;locus_tag=BALIOE_23730;gene=Trp_trna | |
| 9504 c1 tRNAscan-SE tRNA 4740527 4740602 . + . ID=BALIOE_23730;Name=tRNA-Trp;locus_tag=BALIOE_23730;product=tRNA-Trp;gene=Trp_trna;Parent=BALIOE_23730_gene;inference=profile:tRNAscan:2.0;Note=SO:0000271 | |
| 9505 c1 Prodigal gene 4740698 4741537 . - . ID=BALIOE_23735_gene;locus_tag=BALIOE_23735 | |
| 9506 c1 Prodigal CDS 4740698 4741537 . - 0 ID=BALIOE_23735;Name=hypothetical protein;locus_tag=BALIOE_23735;product=hypothetical protein;Parent=BALIOE_23735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9507 c1 Prodigal gene 4741656 4741994 . + . ID=BALIOE_23740_gene;locus_tag=BALIOE_23740 | |
| 9508 c1 Prodigal CDS 4741656 4741994 . + 0 ID=BALIOE_23740;Name=hypothetical protein;locus_tag=BALIOE_23740;product=hypothetical protein;Parent=BALIOE_23740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9509 c1 Prodigal gene 4742019 4743539 . - . ID=BALIOE_23745_gene;locus_tag=BALIOE_23745 | |
| 9510 c1 Prodigal CDS 4742019 4743539 . - 0 ID=BALIOE_23745;Name=hypothetical protein;locus_tag=BALIOE_23745;product=hypothetical protein;Parent=BALIOE_23745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9511 c1 Prodigal gene 4743694 4743783 . + . ID=BALIOE_23750_gene;locus_tag=BALIOE_23750 | |
| 9512 c1 Prodigal CDS 4743694 4743783 . + 0 ID=BALIOE_23750;Name=hypothetical protein;locus_tag=BALIOE_23750;product=hypothetical protein;Parent=BALIOE_23750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9513 c1 Prodigal gene 4744130 4745776 . + . ID=BALIOE_23755_gene;locus_tag=BALIOE_23755 | |
| 9514 c1 Prodigal CDS 4744130 4745776 . + 0 ID=BALIOE_23755;Name=hypothetical protein;locus_tag=BALIOE_23755;product=hypothetical protein;Parent=BALIOE_23755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9515 c1 Prodigal gene 4745773 4746036 . + . ID=BALIOE_23760_gene;locus_tag=BALIOE_23760 | |
| 9516 c1 Prodigal CDS 4745773 4746036 . + 0 ID=BALIOE_23760;Name=hypothetical protein;locus_tag=BALIOE_23760;product=hypothetical protein;Parent=BALIOE_23760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9517 c1 Prodigal gene 4746056 4746985 . + . ID=BALIOE_23765_gene;locus_tag=BALIOE_23765 | |
| 9518 c1 Prodigal CDS 4746056 4746985 . + 0 ID=BALIOE_23765;Name=hypothetical protein;locus_tag=BALIOE_23765;product=hypothetical protein;Parent=BALIOE_23765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9519 c1 Prodigal gene 4747050 4748900 . + . ID=BALIOE_23770_gene;locus_tag=BALIOE_23770 | |
| 9520 c1 Prodigal CDS 4747050 4748900 . + 0 ID=BALIOE_23770;Name=hypothetical protein;locus_tag=BALIOE_23770;product=hypothetical protein;Parent=BALIOE_23770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9521 c1 Prodigal gene 4748903 4750447 . + . ID=BALIOE_23775_gene;locus_tag=BALIOE_23775 | |
| 9522 c1 Prodigal CDS 4748903 4750447 . + 0 ID=BALIOE_23775;Name=hypothetical protein;locus_tag=BALIOE_23775;product=hypothetical protein;Parent=BALIOE_23775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9523 c1 Prodigal gene 4750499 4751392 . - . ID=BALIOE_23780_gene;locus_tag=BALIOE_23780 | |
| 9524 c1 Prodigal CDS 4750499 4751392 . - 0 ID=BALIOE_23780;Name=hypothetical protein;locus_tag=BALIOE_23780;product=hypothetical protein;Parent=BALIOE_23780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9525 c1 Prodigal gene 4751542 4753017 . + . ID=BALIOE_23785_gene;locus_tag=BALIOE_23785 | |
| 9526 c1 Prodigal CDS 4751542 4753017 . + 0 ID=BALIOE_23785;Name=hypothetical protein;locus_tag=BALIOE_23785;product=hypothetical protein;Parent=BALIOE_23785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9527 c1 Prodigal gene 4753063 4753344 . - . ID=BALIOE_23790_gene;locus_tag=BALIOE_23790 | |
| 9528 c1 Prodigal CDS 4753063 4753344 . - 0 ID=BALIOE_23790;Name=hypothetical protein;locus_tag=BALIOE_23790;product=hypothetical protein;Parent=BALIOE_23790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9529 c1 Prodigal gene 4753543 4753992 . - . ID=BALIOE_23795_gene;locus_tag=BALIOE_23795 | |
| 9530 c1 Prodigal CDS 4753543 4753992 . - 0 ID=BALIOE_23795;Name=hypothetical protein;locus_tag=BALIOE_23795;product=hypothetical protein;Parent=BALIOE_23795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9531 c1 Prodigal gene 4754209 4756230 . + . ID=BALIOE_23800_gene;locus_tag=BALIOE_23800 | |
| 9532 c1 Prodigal CDS 4754209 4756230 . + 0 ID=BALIOE_23800;Name=hypothetical protein;locus_tag=BALIOE_23800;product=hypothetical protein;Parent=BALIOE_23800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9533 c1 Prodigal gene 4756277 4757761 . - . ID=BALIOE_23805_gene;locus_tag=BALIOE_23805 | |
| 9534 c1 Prodigal CDS 4756277 4757761 . - 0 ID=BALIOE_23805;Name=hypothetical protein;locus_tag=BALIOE_23805;product=hypothetical protein;Parent=BALIOE_23805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9535 c1 Prodigal gene 4757897 4759162 . - . ID=BALIOE_23810_gene;locus_tag=BALIOE_23810 | |
| 9536 c1 Prodigal CDS 4757897 4759162 . - 0 ID=BALIOE_23810;Name=hypothetical protein;locus_tag=BALIOE_23810;product=hypothetical protein;Parent=BALIOE_23810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9537 c1 Prodigal gene 4759293 4759622 . + . ID=BALIOE_23815_gene;locus_tag=BALIOE_23815 | |
| 9538 c1 Prodigal CDS 4759293 4759622 . + 0 ID=BALIOE_23815;Name=hypothetical protein;locus_tag=BALIOE_23815;product=hypothetical protein;Parent=BALIOE_23815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9539 c1 Prodigal gene 4759949 4761208 . + . ID=BALIOE_23820_gene;locus_tag=BALIOE_23820 | |
| 9540 c1 Prodigal CDS 4759949 4761208 . + 0 ID=BALIOE_23820;Name=hypothetical protein;locus_tag=BALIOE_23820;product=hypothetical protein;Parent=BALIOE_23820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9541 c1 Prodigal gene 4761218 4761436 . + . ID=BALIOE_23825_gene;locus_tag=BALIOE_23825 | |
| 9542 c1 Prodigal CDS 4761218 4761436 . + 0 ID=BALIOE_23825;Name=hypothetical protein;locus_tag=BALIOE_23825;product=hypothetical protein;Parent=BALIOE_23825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9543 c1 Prodigal gene 4761448 4762551 . + . ID=BALIOE_23830_gene;locus_tag=BALIOE_23830 | |
| 9544 c1 Prodigal CDS 4761448 4762551 . + 0 ID=BALIOE_23830;Name=hypothetical protein;locus_tag=BALIOE_23830;product=hypothetical protein;Parent=BALIOE_23830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9545 c1 Prodigal gene 4762563 4763609 . + . ID=BALIOE_23835_gene;locus_tag=BALIOE_23835 | |
| 9546 c1 Prodigal CDS 4762563 4763609 . + 0 ID=BALIOE_23835;Name=hypothetical protein;locus_tag=BALIOE_23835;product=hypothetical protein;Parent=BALIOE_23835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9547 c1 Prodigal gene 4763665 4764795 . + . ID=BALIOE_23840_gene;locus_tag=BALIOE_23840 | |
| 9548 c1 Prodigal CDS 4763665 4764795 . + 0 ID=BALIOE_23840;Name=hypothetical protein;locus_tag=BALIOE_23840;product=hypothetical protein;Parent=BALIOE_23840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9549 c1 Prodigal gene 4764792 4766054 . + . ID=BALIOE_23845_gene;locus_tag=BALIOE_23845 | |
| 9550 c1 Prodigal CDS 4764792 4766054 . + 0 ID=BALIOE_23845;Name=hypothetical protein;locus_tag=BALIOE_23845;product=hypothetical protein;Parent=BALIOE_23845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9551 c1 Prodigal gene 4766054 4767121 . + . ID=BALIOE_23850_gene;locus_tag=BALIOE_23850 | |
| 9552 c1 Prodigal CDS 4766054 4767121 . + 0 ID=BALIOE_23850;Name=hypothetical protein;locus_tag=BALIOE_23850;product=hypothetical protein;Parent=BALIOE_23850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9553 c1 Prodigal gene 4767140 4768021 . + . ID=BALIOE_23855_gene;locus_tag=BALIOE_23855 | |
| 9554 c1 Prodigal CDS 4767140 4768021 . + 0 ID=BALIOE_23855;Name=hypothetical protein;locus_tag=BALIOE_23855;product=hypothetical protein;Parent=BALIOE_23855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9555 c1 Prodigal gene 4767999 4768673 . + . ID=BALIOE_23860_gene;locus_tag=BALIOE_23860 | |
| 9556 c1 Prodigal CDS 4767999 4768673 . + 0 ID=BALIOE_23860;Name=hypothetical protein;locus_tag=BALIOE_23860;product=hypothetical protein;Parent=BALIOE_23860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9557 c1 Prodigal gene 4768678 4769808 . + . ID=BALIOE_23865_gene;locus_tag=BALIOE_23865 | |
| 9558 c1 Prodigal CDS 4768678 4769808 . + 0 ID=BALIOE_23865;Name=hypothetical protein;locus_tag=BALIOE_23865;product=hypothetical protein;Parent=BALIOE_23865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9559 c1 Prodigal gene 4769810 4771060 . + . ID=BALIOE_23870_gene;locus_tag=BALIOE_23870 | |
| 9560 c1 Prodigal CDS 4769810 4771060 . + 0 ID=BALIOE_23870;Name=hypothetical protein;locus_tag=BALIOE_23870;product=hypothetical protein;Parent=BALIOE_23870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9561 c1 Prodigal gene 4771057 4772136 . + . ID=BALIOE_23875_gene;locus_tag=BALIOE_23875 | |
| 9562 c1 Prodigal CDS 4771057 4772136 . + 0 ID=BALIOE_23875;Name=hypothetical protein;locus_tag=BALIOE_23875;product=hypothetical protein;Parent=BALIOE_23875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9563 c1 Prodigal gene 4772133 4773485 . + . ID=BALIOE_23880_gene;locus_tag=BALIOE_23880 | |
| 9564 c1 Prodigal CDS 4772133 4773485 . + 0 ID=BALIOE_23880;Name=hypothetical protein;locus_tag=BALIOE_23880;product=hypothetical protein;Parent=BALIOE_23880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9565 c1 Prodigal gene 4773488 4774228 . + . ID=BALIOE_23885_gene;locus_tag=BALIOE_23885 | |
| 9566 c1 Prodigal CDS 4773488 4774228 . + 0 ID=BALIOE_23885;Name=hypothetical protein;locus_tag=BALIOE_23885;product=hypothetical protein;Parent=BALIOE_23885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9567 c1 Prodigal gene 4774419 4775804 . + . ID=BALIOE_23890_gene;locus_tag=BALIOE_23890 | |
| 9568 c1 Prodigal CDS 4774419 4775804 . + 0 ID=BALIOE_23890;Name=hypothetical protein;locus_tag=BALIOE_23890;product=hypothetical protein;Parent=BALIOE_23890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9569 c1 tRNAscan-SE gene 4775907 4775983 . + . ID=BALIOE_23895_gene;locus_tag=BALIOE_23895;gene=Arg_trna | |
| 9570 c1 tRNAscan-SE tRNA 4775907 4775983 . + . ID=BALIOE_23895;Name=tRNA-Arg;locus_tag=BALIOE_23895;product=tRNA-Arg;gene=Arg_trna;Parent=BALIOE_23895_gene;inference=profile:tRNAscan:2.0;Note=SO:0001036 | |
| 9571 c1 tRNAscan-SE gene 4776042 4776117 . + . ID=BALIOE_23900_gene;locus_tag=BALIOE_23900;gene=His_trna | |
| 9572 c1 tRNAscan-SE tRNA 4776042 4776117 . + . ID=BALIOE_23900;Name=tRNA-His;locus_tag=BALIOE_23900;product=tRNA-His;gene=His_trna;Parent=BALIOE_23900_gene;inference=profile:tRNAscan:2.0;Note=SO:0000262 | |
| 9573 c1 tRNAscan-SE gene 4776138 4776224 . + . ID=BALIOE_23905_gene;locus_tag=BALIOE_23905;gene=Leu_trna | |
| 9574 c1 tRNAscan-SE tRNA 4776138 4776224 . + . ID=BALIOE_23905;Name=tRNA-Leu;locus_tag=BALIOE_23905;product=tRNA-Leu;gene=Leu_trna;Parent=BALIOE_23905_gene;inference=profile:tRNAscan:2.0;Note=SO:0000264 | |
| 9575 c1 tRNAscan-SE gene 4776273 4776343 . + . ID=BALIOE_23910_gene;locus_tag=BALIOE_23910;gene=Pro_trna;pseudo=true | |
| 9576 c1 tRNAscan-SE tRNA 4776273 4776343 . + . ID=BALIOE_23910;Name=(pseudo) tRNA-Pro;locus_tag=BALIOE_23910;product=(pseudo) tRNA-Pro;gene=Pro_trna;pseudo=true;Parent=BALIOE_23910_gene;inference=profile:tRNAscan:2.0;Note=SO:0000268 | |
| 9577 c1 tRNAscan-SE gene 4776364 4776450 . + . ID=BALIOE_23915_gene;locus_tag=BALIOE_23915;gene=Leu_trna | |
| 9578 c1 tRNAscan-SE tRNA 4776364 4776450 . + . ID=BALIOE_23915;Name=tRNA-Leu;locus_tag=BALIOE_23915;product=tRNA-Leu;gene=Leu_trna;Parent=BALIOE_23915_gene;inference=profile:tRNAscan:2.0;Note=SO:0000264 | |
| 9579 c1 tRNAscan-SE gene 4776493 4776569 . + . ID=BALIOE_23920_gene;locus_tag=BALIOE_23920;gene=Pro_trna | |
| 9580 c1 tRNAscan-SE tRNA 4776493 4776569 . + . ID=BALIOE_23920;Name=tRNA-Pro;locus_tag=BALIOE_23920;product=tRNA-Pro;gene=Pro_trna;Parent=BALIOE_23920_gene;inference=profile:tRNAscan:2.0;Note=SO:0000268 | |
| 9581 c1 Prodigal gene 4776716 4777951 . + . ID=BALIOE_23925_gene;locus_tag=BALIOE_23925 | |
| 9582 c1 Prodigal CDS 4776716 4777951 . + 0 ID=BALIOE_23925;Name=hypothetical protein;locus_tag=BALIOE_23925;product=hypothetical protein;Parent=BALIOE_23925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9583 c1 Prodigal gene 4778119 4779774 . - . ID=BALIOE_23930_gene;locus_tag=BALIOE_23930 | |
| 9584 c1 Prodigal CDS 4778119 4779774 . - 0 ID=BALIOE_23930;Name=hypothetical protein;locus_tag=BALIOE_23930;product=hypothetical protein;Parent=BALIOE_23930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9585 c1 Prodigal gene 4780453 4781649 . - . ID=BALIOE_23935_gene;locus_tag=BALIOE_23935 | |
| 9586 c1 Prodigal CDS 4780453 4781649 . - 0 ID=BALIOE_23935;Name=hypothetical protein;locus_tag=BALIOE_23935;product=hypothetical protein;Parent=BALIOE_23935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9587 c1 Prodigal gene 4781652 4782851 . - . ID=BALIOE_23940_gene;locus_tag=BALIOE_23940 | |
| 9588 c1 Prodigal CDS 4781652 4782851 . - 0 ID=BALIOE_23940;Name=hypothetical protein;locus_tag=BALIOE_23940;product=hypothetical protein;Parent=BALIOE_23940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9589 c1 Prodigal gene 4782873 4783613 . - . ID=BALIOE_23945_gene;locus_tag=BALIOE_23945 | |
| 9590 c1 Prodigal CDS 4782873 4783613 . - 0 ID=BALIOE_23945;Name=hypothetical protein;locus_tag=BALIOE_23945;product=hypothetical protein;Parent=BALIOE_23945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9591 c1 Prodigal gene 4783610 4784572 . - . ID=BALIOE_23950_gene;locus_tag=BALIOE_23950 | |
| 9592 c1 Prodigal CDS 4783610 4784572 . - 0 ID=BALIOE_23950;Name=hypothetical protein;locus_tag=BALIOE_23950;product=hypothetical protein;Parent=BALIOE_23950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9593 c1 Prodigal gene 4784938 4787484 . + . ID=BALIOE_23955_gene;locus_tag=BALIOE_23955 | |
| 9594 c1 Prodigal CDS 4784938 4787484 . + 0 ID=BALIOE_23955;Name=hypothetical protein;locus_tag=BALIOE_23955;product=hypothetical protein;Parent=BALIOE_23955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9595 c1 Prodigal gene 4787524 4787844 . - . ID=BALIOE_23960_gene;locus_tag=BALIOE_23960 | |
| 9596 c1 Prodigal CDS 4787524 4787844 . - 0 ID=BALIOE_23960;Name=hypothetical protein;locus_tag=BALIOE_23960;product=hypothetical protein;Parent=BALIOE_23960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9597 c1 Prodigal gene 4788307 4788510 . + . ID=BALIOE_23965_gene;locus_tag=BALIOE_23965 | |
| 9598 c1 Prodigal CDS 4788307 4788510 . + 0 ID=BALIOE_23965;Name=hypothetical protein;locus_tag=BALIOE_23965;product=hypothetical protein;Parent=BALIOE_23965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9599 c1 Prodigal gene 4788547 4789371 . + . ID=BALIOE_23970_gene;locus_tag=BALIOE_23970 | |
| 9600 c1 Prodigal CDS 4788547 4789371 . + 0 ID=BALIOE_23970;Name=hypothetical protein;locus_tag=BALIOE_23970;product=hypothetical protein;Parent=BALIOE_23970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9601 c1 Prodigal gene 4789368 4790075 . + . ID=BALIOE_23975_gene;locus_tag=BALIOE_23975 | |
| 9602 c1 Prodigal CDS 4789368 4790075 . + 0 ID=BALIOE_23975;Name=hypothetical protein;locus_tag=BALIOE_23975;product=hypothetical protein;Parent=BALIOE_23975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9603 c1 Prodigal gene 4790072 4790968 . + . ID=BALIOE_23980_gene;locus_tag=BALIOE_23980 | |
| 9604 c1 Prodigal CDS 4790072 4790968 . + 0 ID=BALIOE_23980;Name=hypothetical protein;locus_tag=BALIOE_23980;product=hypothetical protein;Parent=BALIOE_23980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9605 c1 Prodigal gene 4790968 4791684 . + . ID=BALIOE_23985_gene;locus_tag=BALIOE_23985 | |
| 9606 c1 Prodigal CDS 4790968 4791684 . + 0 ID=BALIOE_23985;Name=hypothetical protein;locus_tag=BALIOE_23985;product=hypothetical protein;Parent=BALIOE_23985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9607 c1 Prodigal gene 4791768 4793930 . + . ID=BALIOE_23990_gene;locus_tag=BALIOE_23990 | |
| 9608 c1 Prodigal CDS 4791768 4793930 . + 0 ID=BALIOE_23990;Name=hypothetical protein;locus_tag=BALIOE_23990;product=hypothetical protein;Parent=BALIOE_23990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9609 c1 Prodigal gene 4793975 4794877 . - . ID=BALIOE_23995_gene;locus_tag=BALIOE_23995 | |
| 9610 c1 Prodigal CDS 4793975 4794877 . - 0 ID=BALIOE_23995;Name=hypothetical protein;locus_tag=BALIOE_23995;product=hypothetical protein;Parent=BALIOE_23995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9611 c1 Prodigal gene 4794960 4795724 . - . ID=BALIOE_24000_gene;locus_tag=BALIOE_24000 | |
| 9612 c1 Prodigal CDS 4794960 4795724 . - 0 ID=BALIOE_24000;Name=hypothetical protein;locus_tag=BALIOE_24000;product=hypothetical protein;Parent=BALIOE_24000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9613 c1 Prodigal gene 4796094 4797044 . + . ID=BALIOE_24005_gene;locus_tag=BALIOE_24005 | |
| 9614 c1 Prodigal CDS 4796094 4797044 . + 0 ID=BALIOE_24005;Name=hypothetical protein;locus_tag=BALIOE_24005;product=hypothetical protein;Parent=BALIOE_24005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9615 c1 Prodigal gene 4797086 4797577 . - . ID=BALIOE_24010_gene;locus_tag=BALIOE_24010 | |
| 9616 c1 Prodigal CDS 4797086 4797577 . - 0 ID=BALIOE_24010;Name=hypothetical protein;locus_tag=BALIOE_24010;product=hypothetical protein;Parent=BALIOE_24010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9617 c1 Prodigal gene 4797574 4798422 . - . ID=BALIOE_24015_gene;locus_tag=BALIOE_24015 | |
| 9618 c1 Prodigal CDS 4797574 4798422 . - 0 ID=BALIOE_24015;Name=hypothetical protein;locus_tag=BALIOE_24015;product=hypothetical protein;Parent=BALIOE_24015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9619 c1 Prodigal gene 4799382 4799681 . + . ID=BALIOE_24020_gene;locus_tag=BALIOE_24020 | |
| 9620 c1 Prodigal CDS 4799382 4799681 . + 0 ID=BALIOE_24020;Name=hypothetical protein;locus_tag=BALIOE_24020;product=hypothetical protein;Parent=BALIOE_24020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9621 c1 Prodigal gene 4799728 4800615 . - . ID=BALIOE_24025_gene;locus_tag=BALIOE_24025 | |
| 9622 c1 Prodigal CDS 4799728 4800615 . - 0 ID=BALIOE_24025;Name=hypothetical protein;locus_tag=BALIOE_24025;product=hypothetical protein;Parent=BALIOE_24025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9623 c1 Prodigal gene 4800667 4801134 . - . ID=BALIOE_24030_gene;locus_tag=BALIOE_24030 | |
| 9624 c1 Prodigal CDS 4800667 4801134 . - 0 ID=BALIOE_24030;Name=hypothetical protein;locus_tag=BALIOE_24030;product=hypothetical protein;Parent=BALIOE_24030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9625 c1 Prodigal gene 4801299 4802168 . + . ID=BALIOE_24035_gene;locus_tag=BALIOE_24035 | |
| 9626 c1 Prodigal CDS 4801299 4802168 . + 0 ID=BALIOE_24035;Name=hypothetical protein;locus_tag=BALIOE_24035;product=hypothetical protein;Parent=BALIOE_24035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9627 c1 Prodigal gene 4802295 4804130 . + . ID=BALIOE_24040_gene;locus_tag=BALIOE_24040 | |
| 9628 c1 Prodigal CDS 4802295 4804130 . + 0 ID=BALIOE_24040;Name=hypothetical protein;locus_tag=BALIOE_24040;product=hypothetical protein;Parent=BALIOE_24040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9629 c1 Prodigal gene 4804194 4804814 . + . ID=BALIOE_24045_gene;locus_tag=BALIOE_24045 | |
| 9630 c1 Prodigal CDS 4804194 4804814 . + 0 ID=BALIOE_24045;Name=hypothetical protein;locus_tag=BALIOE_24045;product=hypothetical protein;Parent=BALIOE_24045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9631 c1 Prodigal gene 4804876 4805496 . - . ID=BALIOE_24050_gene;locus_tag=BALIOE_24050 | |
| 9632 c1 Prodigal CDS 4804876 4805496 . - 0 ID=BALIOE_24050;Name=hypothetical protein;locus_tag=BALIOE_24050;product=hypothetical protein;Parent=BALIOE_24050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9633 c1 Prodigal gene 4805607 4806629 . + . ID=BALIOE_24055_gene;locus_tag=BALIOE_24055 | |
| 9634 c1 Prodigal CDS 4805607 4806629 . + 0 ID=BALIOE_24055;Name=hypothetical protein;locus_tag=BALIOE_24055;product=hypothetical protein;Parent=BALIOE_24055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9635 c1 Prodigal gene 4806637 4807437 . + . ID=BALIOE_24060_gene;locus_tag=BALIOE_24060 | |
| 9636 c1 Prodigal CDS 4806637 4807437 . + 0 ID=BALIOE_24060;Name=hypothetical protein;locus_tag=BALIOE_24060;product=hypothetical protein;Parent=BALIOE_24060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9637 c1 Prodigal gene 4807513 4808412 . + . ID=BALIOE_24065_gene;locus_tag=BALIOE_24065 | |
| 9638 c1 Prodigal CDS 4807513 4808412 . + 0 ID=BALIOE_24065;Name=hypothetical protein;locus_tag=BALIOE_24065;product=hypothetical protein;Parent=BALIOE_24065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9639 c1 Prodigal gene 4808300 4809253 . - . ID=BALIOE_24070_gene;locus_tag=BALIOE_24070 | |
| 9640 c1 Prodigal CDS 4808300 4809253 . - 0 ID=BALIOE_24070;Name=hypothetical protein;locus_tag=BALIOE_24070;product=hypothetical protein;Parent=BALIOE_24070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9641 c1 Prodigal gene 4809489 4811750 . + . ID=BALIOE_24075_gene;locus_tag=BALIOE_24075 | |
| 9642 c1 Prodigal CDS 4809489 4811750 . + 0 ID=BALIOE_24075;Name=hypothetical protein;locus_tag=BALIOE_24075;product=hypothetical protein;Parent=BALIOE_24075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9643 c1 Prodigal gene 4811790 4812605 . - . ID=BALIOE_24080_gene;locus_tag=BALIOE_24080 | |
| 9644 c1 Prodigal CDS 4811790 4812605 . - 0 ID=BALIOE_24080;Name=hypothetical protein;locus_tag=BALIOE_24080;product=hypothetical protein;Parent=BALIOE_24080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9645 c1 Prodigal gene 4812867 4813628 . + . ID=BALIOE_24085_gene;locus_tag=BALIOE_24085 | |
| 9646 c1 Prodigal CDS 4812867 4813628 . + 0 ID=BALIOE_24085;Name=hypothetical protein;locus_tag=BALIOE_24085;product=hypothetical protein;Parent=BALIOE_24085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9647 c1 Prodigal gene 4813769 4815196 . + . ID=BALIOE_24090_gene;locus_tag=BALIOE_24090 | |
| 9648 c1 Prodigal CDS 4813769 4815196 . + 0 ID=BALIOE_24090;Name=hypothetical protein;locus_tag=BALIOE_24090;product=hypothetical protein;Parent=BALIOE_24090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9649 c1 Prodigal gene 4815291 4816046 . + . ID=BALIOE_24095_gene;locus_tag=BALIOE_24095 | |
| 9650 c1 Prodigal CDS 4815291 4816046 . + 0 ID=BALIOE_24095;Name=hypothetical protein;locus_tag=BALIOE_24095;product=hypothetical protein;Parent=BALIOE_24095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9651 c1 Prodigal gene 4816060 4816665 . + . ID=BALIOE_24100_gene;locus_tag=BALIOE_24100 | |
| 9652 c1 Prodigal CDS 4816060 4816665 . + 0 ID=BALIOE_24100;Name=hypothetical protein;locus_tag=BALIOE_24100;product=hypothetical protein;Parent=BALIOE_24100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9653 c1 Prodigal gene 4816662 4818302 . + . ID=BALIOE_24105_gene;locus_tag=BALIOE_24105 | |
| 9654 c1 Prodigal CDS 4816662 4818302 . + 0 ID=BALIOE_24105;Name=hypothetical protein;locus_tag=BALIOE_24105;product=hypothetical protein;Parent=BALIOE_24105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9655 c1 Prodigal gene 4818381 4818650 . + . ID=BALIOE_24110_gene;locus_tag=BALIOE_24110 | |
| 9656 c1 Prodigal CDS 4818381 4818650 . + 0 ID=BALIOE_24110;Name=hypothetical protein;locus_tag=BALIOE_24110;product=hypothetical protein;Parent=BALIOE_24110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9657 c1 Prodigal gene 4818654 4819169 . + . ID=BALIOE_24115_gene;locus_tag=BALIOE_24115 | |
| 9658 c1 Prodigal CDS 4818654 4819169 . + 0 ID=BALIOE_24115;Name=hypothetical protein;locus_tag=BALIOE_24115;product=hypothetical protein;Parent=BALIOE_24115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9659 c1 Prodigal gene 4819172 4819948 . + . ID=BALIOE_24120_gene;locus_tag=BALIOE_24120 | |
| 9660 c1 Prodigal CDS 4819172 4819948 . + 0 ID=BALIOE_24120;Name=hypothetical protein;locus_tag=BALIOE_24120;product=hypothetical protein;Parent=BALIOE_24120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9661 c1 Prodigal gene 4819990 4820772 . + . ID=BALIOE_24125_gene;locus_tag=BALIOE_24125 | |
| 9662 c1 Prodigal CDS 4819990 4820772 . + 0 ID=BALIOE_24125;Name=hypothetical protein;locus_tag=BALIOE_24125;product=hypothetical protein;Parent=BALIOE_24125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9663 c1 Prodigal gene 4820769 4821257 . - . ID=BALIOE_24130_gene;locus_tag=BALIOE_24130 | |
| 9664 c1 Prodigal CDS 4820769 4821257 . - 0 ID=BALIOE_24130;Name=hypothetical protein;locus_tag=BALIOE_24130;product=hypothetical protein;Parent=BALIOE_24130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9665 c1 Prodigal gene 4821424 4822917 . + . ID=BALIOE_24135_gene;locus_tag=BALIOE_24135 | |
| 9666 c1 Prodigal CDS 4821424 4822917 . + 0 ID=BALIOE_24135;Name=hypothetical protein;locus_tag=BALIOE_24135;product=hypothetical protein;Parent=BALIOE_24135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9667 c1 Prodigal gene 4822963 4823664 . + . ID=BALIOE_24140_gene;locus_tag=BALIOE_24140 | |
| 9668 c1 Prodigal CDS 4822963 4823664 . + 0 ID=BALIOE_24140;Name=hypothetical protein;locus_tag=BALIOE_24140;product=hypothetical protein;Parent=BALIOE_24140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9669 c1 Prodigal gene 4823856 4825019 . - . ID=BALIOE_24145_gene;locus_tag=BALIOE_24145 | |
| 9670 c1 Prodigal CDS 4823856 4825019 . - 0 ID=BALIOE_24145;Name=hypothetical protein;locus_tag=BALIOE_24145;product=hypothetical protein;Parent=BALIOE_24145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9671 c1 Prodigal gene 4825029 4827218 . - . ID=BALIOE_24150_gene;locus_tag=BALIOE_24150 | |
| 9672 c1 Prodigal CDS 4825029 4827218 . - 0 ID=BALIOE_24150;Name=hypothetical protein;locus_tag=BALIOE_24150;product=hypothetical protein;Parent=BALIOE_24150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9673 c1 Prodigal gene 4827408 4828739 . + . ID=BALIOE_24155_gene;locus_tag=BALIOE_24155 | |
| 9674 c1 Prodigal CDS 4827408 4828739 . + 0 ID=BALIOE_24155;Name=hypothetical protein;locus_tag=BALIOE_24155;product=hypothetical protein;Parent=BALIOE_24155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9675 c1 Prodigal gene 4828739 4829353 . + . ID=BALIOE_24160_gene;locus_tag=BALIOE_24160 | |
| 9676 c1 Prodigal CDS 4828739 4829353 . + 0 ID=BALIOE_24160;Name=hypothetical protein;locus_tag=BALIOE_24160;product=hypothetical protein;Parent=BALIOE_24160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9677 c1 Prodigal gene 4829392 4830843 . + . ID=BALIOE_24165_gene;locus_tag=BALIOE_24165 | |
| 9678 c1 Prodigal CDS 4829392 4830843 . + 0 ID=BALIOE_24165;Name=hypothetical protein;locus_tag=BALIOE_24165;product=hypothetical protein;Parent=BALIOE_24165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9679 c1 Prodigal gene 4830855 4831400 . + . ID=BALIOE_24170_gene;locus_tag=BALIOE_24170 | |
| 9680 c1 Prodigal CDS 4830855 4831400 . + 0 ID=BALIOE_24170;Name=hypothetical protein;locus_tag=BALIOE_24170;product=hypothetical protein;Parent=BALIOE_24170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9681 c1 Infernal gene 4831781 4833322 . + . ID=BALIOE_24175_gene;locus_tag=BALIOE_24175;gene=16S_rrna | |
| 9682 c1 Infernal rRNA 4831781 4833322 8.5e-49 + . ID=BALIOE_24175;Name=16S ribosomal RNA;locus_tag=BALIOE_24175;gene=16S_rrna;product=16S ribosomal RNA;Dbxref=GO:0005840,GO:0003735,RFAM:RF00177;Parent=BALIOE_24175_gene;inference=profile:Rfam:RF00177;Note=SO:0001000 | |
| 9683 c1 tRNAscan-SE gene 4833391 4833467 . + . ID=BALIOE_24180_gene;locus_tag=BALIOE_24180;gene=Ile_trna | |
| 9684 c1 tRNAscan-SE tRNA 4833391 4833467 . + . ID=BALIOE_24180;Name=tRNA-Ile;locus_tag=BALIOE_24180;product=tRNA-Ile;gene=Ile_trna;Parent=BALIOE_24180_gene;inference=profile:tRNAscan:2.0;Note=SO:0000263 | |
| 9685 c1 tRNAscan-SE gene 4833510 4833585 . + . ID=BALIOE_24185_gene;locus_tag=BALIOE_24185;gene=Ala_trna | |
| 9686 c1 tRNAscan-SE tRNA 4833510 4833585 . + . ID=BALIOE_24185;Name=tRNA-Ala;locus_tag=BALIOE_24185;product=tRNA-Ala;gene=Ala_trna;Parent=BALIOE_24185_gene;inference=profile:tRNAscan:2.0;Note=SO:0000254 | |
| 9687 c1 Prodigal gene 4836985 4837512 . - . ID=BALIOE_24190_gene;locus_tag=BALIOE_24190 | |
| 9688 c1 Prodigal CDS 4836985 4837512 . - 0 ID=BALIOE_24190;Name=hypothetical protein;locus_tag=BALIOE_24190;product=hypothetical protein;Parent=BALIOE_24190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9689 c1 Prodigal gene 4837494 4838078 . - . ID=BALIOE_24195_gene;locus_tag=BALIOE_24195 | |
| 9690 c1 Prodigal CDS 4837494 4838078 . - 0 ID=BALIOE_24195;Name=hypothetical protein;locus_tag=BALIOE_24195;product=hypothetical protein;Parent=BALIOE_24195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9691 c1 Prodigal gene 4838148 4838417 . + . ID=BALIOE_24200_gene;locus_tag=BALIOE_24200 | |
| 9692 c1 Prodigal CDS 4838148 4838417 . + 0 ID=BALIOE_24200;Name=hypothetical protein;locus_tag=BALIOE_24200;product=hypothetical protein;Parent=BALIOE_24200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9693 c1 Prodigal gene 4838494 4839480 . + . ID=BALIOE_24205_gene;locus_tag=BALIOE_24205 | |
| 9694 c1 Prodigal CDS 4838494 4839480 . + 0 ID=BALIOE_24205;Name=hypothetical protein;locus_tag=BALIOE_24205;product=hypothetical protein;Parent=BALIOE_24205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9695 c1 Prodigal gene 4839497 4840123 . + . ID=BALIOE_24210_gene;locus_tag=BALIOE_24210 | |
| 9696 c1 Prodigal CDS 4839497 4840123 . + 0 ID=BALIOE_24210;Name=hypothetical protein;locus_tag=BALIOE_24210;product=hypothetical protein;Parent=BALIOE_24210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9697 c1 Prodigal gene 4840278 4841708 . + . ID=BALIOE_24215_gene;locus_tag=BALIOE_24215 | |
| 9698 c1 Prodigal CDS 4840278 4841708 . + 0 ID=BALIOE_24215;Name=hypothetical protein;locus_tag=BALIOE_24215;product=hypothetical protein;Parent=BALIOE_24215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9699 c1 Prodigal gene 4841749 4842681 . - . ID=BALIOE_24220_gene;locus_tag=BALIOE_24220 | |
| 9700 c1 Prodigal CDS 4841749 4842681 . - 0 ID=BALIOE_24220;Name=hypothetical protein;locus_tag=BALIOE_24220;product=hypothetical protein;Parent=BALIOE_24220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9701 c1 Prodigal gene 4842801 4842986 . - . ID=BALIOE_24225_gene;locus_tag=BALIOE_24225 | |
| 9702 c1 Prodigal CDS 4842801 4842986 . - 0 ID=BALIOE_24225;Name=hypothetical protein;locus_tag=BALIOE_24225;product=hypothetical protein;Parent=BALIOE_24225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9703 c1 Prodigal gene 4843045 4845831 . + . ID=BALIOE_24230_gene;locus_tag=BALIOE_24230 | |
| 9704 c1 Prodigal CDS 4843045 4845831 . + 0 ID=BALIOE_24230;Name=hypothetical protein;locus_tag=BALIOE_24230;product=hypothetical protein;Parent=BALIOE_24230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9705 c1 Prodigal gene 4846213 4846845 . - . ID=BALIOE_24235_gene;locus_tag=BALIOE_24235 | |
| 9706 c1 Prodigal CDS 4846213 4846845 . - 0 ID=BALIOE_24235;Name=hypothetical protein;locus_tag=BALIOE_24235;product=hypothetical protein;Parent=BALIOE_24235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9707 c1 Prodigal gene 4847427 4847933 . + . ID=BALIOE_24240_gene;locus_tag=BALIOE_24240 | |
| 9708 c1 Prodigal CDS 4847427 4847933 . + 0 ID=BALIOE_24240;Name=hypothetical protein;locus_tag=BALIOE_24240;product=hypothetical protein;Parent=BALIOE_24240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9709 c1 Prodigal gene 4848122 4849495 . + . ID=BALIOE_24245_gene;locus_tag=BALIOE_24245 | |
| 9710 c1 Prodigal CDS 4848122 4849495 . + 0 ID=BALIOE_24245;Name=hypothetical protein;locus_tag=BALIOE_24245;product=hypothetical protein;Parent=BALIOE_24245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9711 c1 Prodigal gene 4849685 4849795 . - . ID=BALIOE_24250_gene;locus_tag=BALIOE_24250 | |
| 9712 c1 Prodigal CDS 4849685 4849795 . - 0 ID=BALIOE_24250;Name=hypothetical protein;locus_tag=BALIOE_24250;product=hypothetical protein;Parent=BALIOE_24250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9713 c1 Prodigal gene 4849907 4851316 . - . ID=BALIOE_24255_gene;locus_tag=BALIOE_24255 | |
| 9714 c1 Prodigal CDS 4849907 4851316 . - 0 ID=BALIOE_24255;Name=hypothetical protein;locus_tag=BALIOE_24255;product=hypothetical protein;Parent=BALIOE_24255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9715 c1 Prodigal gene 4851328 4852377 . - . ID=BALIOE_24260_gene;locus_tag=BALIOE_24260 | |
| 9716 c1 Prodigal CDS 4851328 4852377 . - 0 ID=BALIOE_24260;Name=hypothetical protein;locus_tag=BALIOE_24260;product=hypothetical protein;Parent=BALIOE_24260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9717 c1 Prodigal gene 4852551 4853960 . - . ID=BALIOE_24265_gene;locus_tag=BALIOE_24265 | |
| 9718 c1 Prodigal CDS 4852551 4853960 . - 0 ID=BALIOE_24265;Name=hypothetical protein;locus_tag=BALIOE_24265;product=hypothetical protein;Parent=BALIOE_24265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9719 c1 Prodigal gene 4854333 4856156 . + . ID=BALIOE_24270_gene;locus_tag=BALIOE_24270 | |
| 9720 c1 Prodigal CDS 4854333 4856156 . + 0 ID=BALIOE_24270;Name=hypothetical protein;locus_tag=BALIOE_24270;product=hypothetical protein;Parent=BALIOE_24270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9721 c1 Prodigal gene 4856373 4857083 . + . ID=BALIOE_24275_gene;locus_tag=BALIOE_24275 | |
| 9722 c1 Prodigal CDS 4856373 4857083 . + 0 ID=BALIOE_24275;Name=hypothetical protein;locus_tag=BALIOE_24275;product=hypothetical protein;Parent=BALIOE_24275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9723 c1 Prodigal gene 4857091 4858071 . + . ID=BALIOE_24280_gene;locus_tag=BALIOE_24280 | |
| 9724 c1 Prodigal CDS 4857091 4858071 . + 0 ID=BALIOE_24280;Name=hypothetical protein;locus_tag=BALIOE_24280;product=hypothetical protein;Parent=BALIOE_24280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9725 c1 Prodigal gene 4858173 4859438 . + . ID=BALIOE_24285_gene;locus_tag=BALIOE_24285 | |
| 9726 c1 Prodigal CDS 4858173 4859438 . + 0 ID=BALIOE_24285;Name=hypothetical protein;locus_tag=BALIOE_24285;product=hypothetical protein;Parent=BALIOE_24285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9727 c1 Prodigal gene 4859529 4860287 . - . ID=BALIOE_24290_gene;locus_tag=BALIOE_24290 | |
| 9728 c1 Prodigal CDS 4859529 4860287 . - 0 ID=BALIOE_24290;Name=hypothetical protein;locus_tag=BALIOE_24290;product=hypothetical protein;Parent=BALIOE_24290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9729 c1 Prodigal gene 4860288 4861691 . - . ID=BALIOE_24295_gene;locus_tag=BALIOE_24295 | |
| 9730 c1 Prodigal CDS 4860288 4861691 . - 0 ID=BALIOE_24295;Name=hypothetical protein;locus_tag=BALIOE_24295;product=hypothetical protein;Parent=BALIOE_24295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9731 c1 Prodigal gene 4861734 4863119 . - . ID=BALIOE_24300_gene;locus_tag=BALIOE_24300 | |
| 9732 c1 Prodigal CDS 4861734 4863119 . - 0 ID=BALIOE_24300;Name=hypothetical protein;locus_tag=BALIOE_24300;product=hypothetical protein;Parent=BALIOE_24300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9733 c1 Prodigal gene 4863165 4865201 . - . ID=BALIOE_24305_gene;locus_tag=BALIOE_24305 | |
| 9734 c1 Prodigal CDS 4863165 4865201 . - 0 ID=BALIOE_24305;Name=hypothetical protein;locus_tag=BALIOE_24305;product=hypothetical protein;Parent=BALIOE_24305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9735 c1 Prodigal gene 4865309 4866184 . - . ID=BALIOE_24310_gene;locus_tag=BALIOE_24310 | |
| 9736 c1 Prodigal CDS 4865309 4866184 . - 0 ID=BALIOE_24310;Name=hypothetical protein;locus_tag=BALIOE_24310;product=hypothetical protein;Parent=BALIOE_24310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9737 c1 Prodigal gene 4866245 4867147 . - . ID=BALIOE_24315_gene;locus_tag=BALIOE_24315 | |
| 9738 c1 Prodigal CDS 4866245 4867147 . - 0 ID=BALIOE_24315;Name=hypothetical protein;locus_tag=BALIOE_24315;product=hypothetical protein;Parent=BALIOE_24315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9739 c1 Prodigal gene 4867214 4868455 . - . ID=BALIOE_24320_gene;locus_tag=BALIOE_24320 | |
| 9740 c1 Prodigal CDS 4867214 4868455 . - 0 ID=BALIOE_24320;Name=hypothetical protein;locus_tag=BALIOE_24320;product=hypothetical protein;Parent=BALIOE_24320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9741 c1 Prodigal gene 4868471 4869349 . - . ID=BALIOE_24325_gene;locus_tag=BALIOE_24325 | |
| 9742 c1 Prodigal CDS 4868471 4869349 . - 0 ID=BALIOE_24325;Name=hypothetical protein;locus_tag=BALIOE_24325;product=hypothetical protein;Parent=BALIOE_24325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9743 c1 Prodigal gene 4869373 4870269 . - . ID=BALIOE_24330_gene;locus_tag=BALIOE_24330 | |
| 9744 c1 Prodigal CDS 4869373 4870269 . - 0 ID=BALIOE_24330;Name=hypothetical protein;locus_tag=BALIOE_24330;product=hypothetical protein;Parent=BALIOE_24330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9745 c1 Prodigal gene 4870437 4871333 . + . ID=BALIOE_24335_gene;locus_tag=BALIOE_24335 | |
| 9746 c1 Prodigal CDS 4870437 4871333 . + 0 ID=BALIOE_24335;Name=hypothetical protein;locus_tag=BALIOE_24335;product=hypothetical protein;Parent=BALIOE_24335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9747 c1 Prodigal gene 4871367 4872152 . + . ID=BALIOE_24340_gene;locus_tag=BALIOE_24340 | |
| 9748 c1 Prodigal CDS 4871367 4872152 . + 0 ID=BALIOE_24340;Name=hypothetical protein;locus_tag=BALIOE_24340;product=hypothetical protein;Parent=BALIOE_24340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9749 c1 Prodigal gene 4872251 4872850 . + . ID=BALIOE_24345_gene;locus_tag=BALIOE_24345 | |
| 9750 c1 Prodigal CDS 4872251 4872850 . + 0 ID=BALIOE_24345;Name=hypothetical protein;locus_tag=BALIOE_24345;product=hypothetical protein;Parent=BALIOE_24345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9751 c1 Prodigal gene 4872844 4873716 . + . ID=BALIOE_24350_gene;locus_tag=BALIOE_24350 | |
| 9752 c1 Prodigal CDS 4872844 4873716 . + 0 ID=BALIOE_24350;Name=hypothetical protein;locus_tag=BALIOE_24350;product=hypothetical protein;Parent=BALIOE_24350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9753 c1 Prodigal gene 4873713 4874150 . + . ID=BALIOE_24355_gene;locus_tag=BALIOE_24355 | |
| 9754 c1 Prodigal CDS 4873713 4874150 . + 0 ID=BALIOE_24355;Name=hypothetical protein;locus_tag=BALIOE_24355;product=hypothetical protein;Parent=BALIOE_24355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9755 c1 Prodigal gene 4874195 4875136 . + . ID=BALIOE_24360_gene;locus_tag=BALIOE_24360 | |
| 9756 c1 Prodigal CDS 4874195 4875136 . + 0 ID=BALIOE_24360;Name=hypothetical protein;locus_tag=BALIOE_24360;product=hypothetical protein;Parent=BALIOE_24360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9757 c1 Prodigal gene 4875547 4876440 . + . ID=BALIOE_24365_gene;locus_tag=BALIOE_24365 | |
| 9758 c1 Prodigal CDS 4875547 4876440 . + 0 ID=BALIOE_24365;Name=hypothetical protein;locus_tag=BALIOE_24365;product=hypothetical protein;Parent=BALIOE_24365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9759 c1 Prodigal gene 4876447 4877361 . + . ID=BALIOE_24370_gene;locus_tag=BALIOE_24370 | |
| 9760 c1 Prodigal CDS 4876447 4877361 . + 0 ID=BALIOE_24370;Name=hypothetical protein;locus_tag=BALIOE_24370;product=hypothetical protein;Parent=BALIOE_24370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9761 c1 Prodigal gene 4878055 4878273 . + . ID=BALIOE_24375_gene;locus_tag=BALIOE_24375 | |
| 9762 c1 Prodigal CDS 4878055 4878273 . + 0 ID=BALIOE_24375;Name=hypothetical protein;locus_tag=BALIOE_24375;product=hypothetical protein;Parent=BALIOE_24375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9763 c1 Prodigal gene 4878490 4878732 . + . ID=BALIOE_24380_gene;locus_tag=BALIOE_24380 | |
| 9764 c1 Prodigal CDS 4878490 4878732 . + 0 ID=BALIOE_24380;Name=hypothetical protein;locus_tag=BALIOE_24380;product=hypothetical protein;Parent=BALIOE_24380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9765 c1 Prodigal gene 4878732 4878914 . + . ID=BALIOE_24385_gene;locus_tag=BALIOE_24385 | |
| 9766 c1 Prodigal CDS 4878732 4878914 . + 0 ID=BALIOE_24385;Name=hypothetical protein;locus_tag=BALIOE_24385;product=hypothetical protein;Parent=BALIOE_24385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9767 c1 Prodigal gene 4879062 4879991 . - . ID=BALIOE_24390_gene;locus_tag=BALIOE_24390 | |
| 9768 c1 Prodigal CDS 4879062 4879991 . - 0 ID=BALIOE_24390;Name=hypothetical protein;locus_tag=BALIOE_24390;product=hypothetical protein;Parent=BALIOE_24390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9769 c1 Prodigal gene 4879988 4880623 . - . ID=BALIOE_24395_gene;locus_tag=BALIOE_24395 | |
| 9770 c1 Prodigal CDS 4879988 4880623 . - 0 ID=BALIOE_24395;Name=hypothetical protein;locus_tag=BALIOE_24395;product=hypothetical protein;Parent=BALIOE_24395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9771 c1 Prodigal gene 4880620 4881522 . - . ID=BALIOE_24400_gene;locus_tag=BALIOE_24400 | |
| 9772 c1 Prodigal CDS 4880620 4881522 . - 0 ID=BALIOE_24400;Name=hypothetical protein;locus_tag=BALIOE_24400;product=hypothetical protein;Parent=BALIOE_24400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9773 c1 Prodigal gene 4881535 4883949 . - . ID=BALIOE_24405_gene;locus_tag=BALIOE_24405 | |
| 9774 c1 Prodigal CDS 4881535 4883949 . - 0 ID=BALIOE_24405;Name=hypothetical protein;locus_tag=BALIOE_24405;product=hypothetical protein;Parent=BALIOE_24405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9775 c1 Prodigal gene 4883998 4884585 . - . ID=BALIOE_24410_gene;locus_tag=BALIOE_24410 | |
| 9776 c1 Prodigal CDS 4883998 4884585 . - 0 ID=BALIOE_24410;Name=hypothetical protein;locus_tag=BALIOE_24410;product=hypothetical protein;Parent=BALIOE_24410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9777 c1 Prodigal gene 4884779 4885612 . + . ID=BALIOE_24415_gene;locus_tag=BALIOE_24415 | |
| 9778 c1 Prodigal CDS 4884779 4885612 . + 0 ID=BALIOE_24415;Name=hypothetical protein;locus_tag=BALIOE_24415;product=hypothetical protein;Parent=BALIOE_24415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9779 c1 Prodigal gene 4885765 4886820 . + . ID=BALIOE_24420_gene;locus_tag=BALIOE_24420 | |
| 9780 c1 Prodigal CDS 4885765 4886820 . + 0 ID=BALIOE_24420;Name=hypothetical protein;locus_tag=BALIOE_24420;product=hypothetical protein;Parent=BALIOE_24420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9781 c1 Prodigal gene 4886870 4888618 . - . ID=BALIOE_24425_gene;locus_tag=BALIOE_24425 | |
| 9782 c1 Prodigal CDS 4886870 4888618 . - 0 ID=BALIOE_24425;Name=hypothetical protein;locus_tag=BALIOE_24425;product=hypothetical protein;Parent=BALIOE_24425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9783 c1 Prodigal gene 4888618 4889688 . - . ID=BALIOE_24430_gene;locus_tag=BALIOE_24430 | |
| 9784 c1 Prodigal CDS 4888618 4889688 . - 0 ID=BALIOE_24430;Name=hypothetical protein;locus_tag=BALIOE_24430;product=hypothetical protein;Parent=BALIOE_24430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9785 c1 Prodigal gene 4889678 4891117 . - . ID=BALIOE_24435_gene;locus_tag=BALIOE_24435 | |
| 9786 c1 Prodigal CDS 4889678 4891117 . - 0 ID=BALIOE_24435;Name=hypothetical protein;locus_tag=BALIOE_24435;product=hypothetical protein;Parent=BALIOE_24435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9787 c1 Prodigal gene 4891128 4891574 . - . ID=BALIOE_24440_gene;locus_tag=BALIOE_24440 | |
| 9788 c1 Prodigal CDS 4891128 4891574 . - 0 ID=BALIOE_24440;Name=hypothetical protein;locus_tag=BALIOE_24440;product=hypothetical protein;Parent=BALIOE_24440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9789 c1 Prodigal gene 4892052 4893446 . + . ID=BALIOE_24445_gene;locus_tag=BALIOE_24445 | |
| 9790 c1 Prodigal CDS 4892052 4893446 . + 0 ID=BALIOE_24445;Name=hypothetical protein;locus_tag=BALIOE_24445;product=hypothetical protein;Parent=BALIOE_24445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9791 c1 Prodigal gene 4893487 4893801 . - . ID=BALIOE_24450_gene;locus_tag=BALIOE_24450 | |
| 9792 c1 Prodigal CDS 4893487 4893801 . - 0 ID=BALIOE_24450;Name=hypothetical protein;locus_tag=BALIOE_24450;product=hypothetical protein;Parent=BALIOE_24450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9793 c1 Prodigal gene 4893811 4894635 . - . ID=BALIOE_24455_gene;locus_tag=BALIOE_24455 | |
| 9794 c1 Prodigal CDS 4893811 4894635 . - 0 ID=BALIOE_24455;Name=hypothetical protein;locus_tag=BALIOE_24455;product=hypothetical protein;Parent=BALIOE_24455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9795 c1 Infernal gene 4894682 4894752 . + . ID=BALIOE_24460_gene;locus_tag=BALIOE_24460;gene=naRNA4 | |
| 9796 c1 Infernal ncRNA 4894682 4894752 1.2e-10 + . ID=BALIOE_24460;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_24460;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_24460_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 9797 c1 Prodigal gene 4894810 4896069 . - . ID=BALIOE_24465_gene;locus_tag=BALIOE_24465 | |
| 9798 c1 Prodigal CDS 4894810 4896069 . - 0 ID=BALIOE_24465;Name=hypothetical protein;locus_tag=BALIOE_24465;product=hypothetical protein;Parent=BALIOE_24465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9799 c1 Prodigal gene 4896066 4897535 . - . ID=BALIOE_24470_gene;locus_tag=BALIOE_24470 | |
| 9800 c1 Prodigal CDS 4896066 4897535 . - 0 ID=BALIOE_24470;Name=hypothetical protein;locus_tag=BALIOE_24470;product=hypothetical protein;Parent=BALIOE_24470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9801 c1 Prodigal gene 4897823 4898659 . + . ID=BALIOE_24475_gene;locus_tag=BALIOE_24475 | |
| 9802 c1 Prodigal CDS 4897823 4898659 . + 0 ID=BALIOE_24475;Name=hypothetical protein;locus_tag=BALIOE_24475;product=hypothetical protein;Parent=BALIOE_24475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9803 c1 Prodigal gene 4898643 4899581 . + . ID=BALIOE_24480_gene;locus_tag=BALIOE_24480 | |
| 9804 c1 Prodigal CDS 4898643 4899581 . + 0 ID=BALIOE_24480;Name=hypothetical protein;locus_tag=BALIOE_24480;product=hypothetical protein;Parent=BALIOE_24480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9805 c1 Prodigal gene 4899578 4900369 . - . ID=BALIOE_24485_gene;locus_tag=BALIOE_24485 | |
| 9806 c1 Prodigal CDS 4899578 4900369 . - 0 ID=BALIOE_24485;Name=hypothetical protein;locus_tag=BALIOE_24485;product=hypothetical protein;Parent=BALIOE_24485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9807 c1 Prodigal gene 4900460 4900612 . - . ID=BALIOE_24490_gene;locus_tag=BALIOE_24490 | |
| 9808 c1 Prodigal CDS 4900460 4900612 . - 0 ID=BALIOE_24490;Name=hypothetical protein;locus_tag=BALIOE_24490;product=hypothetical protein;Parent=BALIOE_24490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9809 c1 Prodigal gene 4900897 4901517 . + . ID=BALIOE_24495_gene;locus_tag=BALIOE_24495 | |
| 9810 c1 Prodigal CDS 4900897 4901517 . + 0 ID=BALIOE_24495;Name=hypothetical protein;locus_tag=BALIOE_24495;product=hypothetical protein;Parent=BALIOE_24495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9811 c1 Prodigal gene 4901777 4902760 . + . ID=BALIOE_24500_gene;locus_tag=BALIOE_24500 | |
| 9812 c1 Prodigal CDS 4901777 4902760 . + 0 ID=BALIOE_24500;Name=hypothetical protein;locus_tag=BALIOE_24500;product=hypothetical protein;Parent=BALIOE_24500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9813 c1 Prodigal gene 4902909 4903583 . + . ID=BALIOE_24505_gene;locus_tag=BALIOE_24505 | |
| 9814 c1 Prodigal CDS 4902909 4903583 . + 0 ID=BALIOE_24505;Name=hypothetical protein;locus_tag=BALIOE_24505;product=hypothetical protein;Parent=BALIOE_24505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9815 c1 Infernal gene 4903597 4903674 . - . ID=BALIOE_24510_gene;locus_tag=BALIOE_24510;gene=naRNA4 | |
| 9816 c1 Infernal ncRNA 4903597 4903674 1.7e-11 - . ID=BALIOE_24510;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_24510;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_24510_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 9817 c1 Prodigal gene 4903689 4905062 . - . ID=BALIOE_24515_gene;locus_tag=BALIOE_24515 | |
| 9818 c1 Prodigal CDS 4903689 4905062 . - 0 ID=BALIOE_24515;Name=hypothetical protein;locus_tag=BALIOE_24515;product=hypothetical protein;Parent=BALIOE_24515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9819 c1 Prodigal gene 4905059 4905757 . - . ID=BALIOE_24520_gene;locus_tag=BALIOE_24520 | |
| 9820 c1 Prodigal CDS 4905059 4905757 . - 0 ID=BALIOE_24520;Name=hypothetical protein;locus_tag=BALIOE_24520;product=hypothetical protein;Parent=BALIOE_24520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9821 c1 Prodigal gene 4905907 4906407 . + . ID=BALIOE_24525_gene;locus_tag=BALIOE_24525 | |
| 9822 c1 Prodigal CDS 4905907 4906407 . + 0 ID=BALIOE_24525;Name=hypothetical protein;locus_tag=BALIOE_24525;product=hypothetical protein;Parent=BALIOE_24525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9823 c1 Prodigal gene 4906556 4907458 . + . ID=BALIOE_24530_gene;locus_tag=BALIOE_24530 | |
| 9824 c1 Prodigal CDS 4906556 4907458 . + 0 ID=BALIOE_24530;Name=hypothetical protein;locus_tag=BALIOE_24530;product=hypothetical protein;Parent=BALIOE_24530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9825 c1 Prodigal gene 4907404 4907508 . - . ID=BALIOE_24535_gene;locus_tag=BALIOE_24535 | |
| 9826 c1 Prodigal CDS 4907404 4907508 . - 0 ID=BALIOE_24535;Name=hypothetical protein;locus_tag=BALIOE_24535;product=hypothetical protein;Parent=BALIOE_24535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9827 c1 Prodigal gene 4907639 4908601 . + . ID=BALIOE_24540_gene;locus_tag=BALIOE_24540 | |
| 9828 c1 Prodigal CDS 4907639 4908601 . + 0 ID=BALIOE_24540;Name=hypothetical protein;locus_tag=BALIOE_24540;product=hypothetical protein;Parent=BALIOE_24540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9829 c1 Prodigal gene 4908920 4909909 . + . ID=BALIOE_24545_gene;locus_tag=BALIOE_24545 | |
| 9830 c1 Prodigal CDS 4908920 4909909 . + 0 ID=BALIOE_24545;Name=hypothetical protein;locus_tag=BALIOE_24545;product=hypothetical protein;Parent=BALIOE_24545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9831 c1 Prodigal gene 4910016 4910771 . + . ID=BALIOE_24550_gene;locus_tag=BALIOE_24550 | |
| 9832 c1 Prodigal CDS 4910016 4910771 . + 0 ID=BALIOE_24550;Name=hypothetical protein;locus_tag=BALIOE_24550;product=hypothetical protein;Parent=BALIOE_24550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9833 c1 Prodigal gene 4910826 4911593 . - . ID=BALIOE_24555_gene;locus_tag=BALIOE_24555 | |
| 9834 c1 Prodigal CDS 4910826 4911593 . - 0 ID=BALIOE_24555;Name=hypothetical protein;locus_tag=BALIOE_24555;product=hypothetical protein;Parent=BALIOE_24555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9835 c1 Prodigal gene 4911701 4912300 . - . ID=BALIOE_24560_gene;locus_tag=BALIOE_24560 | |
| 9836 c1 Prodigal CDS 4911701 4912300 . - 0 ID=BALIOE_24560;Name=hypothetical protein;locus_tag=BALIOE_24560;product=hypothetical protein;Parent=BALIOE_24560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9837 c1 Prodigal gene 4912401 4912841 . + . ID=BALIOE_24565_gene;locus_tag=BALIOE_24565 | |
| 9838 c1 Prodigal CDS 4912401 4912841 . + 0 ID=BALIOE_24565;Name=hypothetical protein;locus_tag=BALIOE_24565;product=hypothetical protein;Parent=BALIOE_24565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9839 c1 Prodigal gene 4913053 4913352 . + . ID=BALIOE_24570_gene;locus_tag=BALIOE_24570 | |
| 9840 c1 Prodigal CDS 4913053 4913352 . + 0 ID=BALIOE_24570;Name=hypothetical protein;locus_tag=BALIOE_24570;product=hypothetical protein;Parent=BALIOE_24570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9841 c1 Prodigal gene 4913379 4913807 . + . ID=BALIOE_24575_gene;locus_tag=BALIOE_24575 | |
| 9842 c1 Prodigal CDS 4913379 4913807 . + 0 ID=BALIOE_24575;Name=hypothetical protein;locus_tag=BALIOE_24575;product=hypothetical protein;Parent=BALIOE_24575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9843 c1 Prodigal gene 4913812 4914558 . - . ID=BALIOE_24580_gene;locus_tag=BALIOE_24580 | |
| 9844 c1 Prodigal CDS 4913812 4914558 . - 0 ID=BALIOE_24580;Name=hypothetical protein;locus_tag=BALIOE_24580;product=hypothetical protein;Parent=BALIOE_24580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9845 c1 Prodigal gene 4914655 4915665 . - . ID=BALIOE_24585_gene;locus_tag=BALIOE_24585 | |
| 9846 c1 Prodigal CDS 4914655 4915665 . - 0 ID=BALIOE_24585;Name=hypothetical protein;locus_tag=BALIOE_24585;product=hypothetical protein;Parent=BALIOE_24585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9847 c1 Prodigal gene 4915895 4917403 . - . ID=BALIOE_24590_gene;locus_tag=BALIOE_24590 | |
| 9848 c1 Prodigal CDS 4915895 4917403 . - 0 ID=BALIOE_24590;Name=hypothetical protein;locus_tag=BALIOE_24590;product=hypothetical protein;Parent=BALIOE_24590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9849 c1 Prodigal gene 4917426 4918271 . - . ID=BALIOE_24595_gene;locus_tag=BALIOE_24595 | |
| 9850 c1 Prodigal CDS 4917426 4918271 . - 0 ID=BALIOE_24595;Name=hypothetical protein;locus_tag=BALIOE_24595;product=hypothetical protein;Parent=BALIOE_24595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9851 c1 Prodigal gene 4918703 4918942 . + . ID=BALIOE_24600_gene;locus_tag=BALIOE_24600 | |
| 9852 c1 Prodigal CDS 4918703 4918942 . + 0 ID=BALIOE_24600;Name=hypothetical protein;locus_tag=BALIOE_24600;product=hypothetical protein;Parent=BALIOE_24600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9853 c1 Prodigal gene 4918981 4919607 . - . ID=BALIOE_24605_gene;locus_tag=BALIOE_24605 | |
| 9854 c1 Prodigal CDS 4918981 4919607 . - 0 ID=BALIOE_24605;Name=hypothetical protein;locus_tag=BALIOE_24605;product=hypothetical protein;Parent=BALIOE_24605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9855 c1 Prodigal gene 4919730 4920404 . - . ID=BALIOE_24610_gene;locus_tag=BALIOE_24610 | |
| 9856 c1 Prodigal CDS 4919730 4920404 . - 0 ID=BALIOE_24610;Name=hypothetical protein;locus_tag=BALIOE_24610;product=hypothetical protein;Parent=BALIOE_24610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9857 c1 Prodigal gene 4920464 4920949 . - . ID=BALIOE_24615_gene;locus_tag=BALIOE_24615 | |
| 9858 c1 Prodigal CDS 4920464 4920949 . - 0 ID=BALIOE_24615;Name=hypothetical protein;locus_tag=BALIOE_24615;product=hypothetical protein;Parent=BALIOE_24615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9859 c1 Prodigal gene 4921042 4921968 . - . ID=BALIOE_24620_gene;locus_tag=BALIOE_24620 | |
| 9860 c1 Prodigal CDS 4921042 4921968 . - 0 ID=BALIOE_24620;Name=hypothetical protein;locus_tag=BALIOE_24620;product=hypothetical protein;Parent=BALIOE_24620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9861 c1 Prodigal gene 4922035 4923366 . - . ID=BALIOE_24625_gene;locus_tag=BALIOE_24625 | |
| 9862 c1 Prodigal CDS 4922035 4923366 . - 0 ID=BALIOE_24625;Name=hypothetical protein;locus_tag=BALIOE_24625;product=hypothetical protein;Parent=BALIOE_24625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9863 c1 Prodigal gene 4923376 4923906 . - . ID=BALIOE_24630_gene;locus_tag=BALIOE_24630 | |
| 9864 c1 Prodigal CDS 4923376 4923906 . - 0 ID=BALIOE_24630;Name=hypothetical protein;locus_tag=BALIOE_24630;product=hypothetical protein;Parent=BALIOE_24630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9865 c1 Prodigal gene 4923999 4924853 . - . ID=BALIOE_24635_gene;locus_tag=BALIOE_24635 | |
| 9866 c1 Prodigal CDS 4923999 4924853 . - 0 ID=BALIOE_24635;Name=hypothetical protein;locus_tag=BALIOE_24635;product=hypothetical protein;Parent=BALIOE_24635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9867 c1 Prodigal gene 4925050 4926075 . - . ID=BALIOE_24640_gene;locus_tag=BALIOE_24640 | |
| 9868 c1 Prodigal CDS 4925050 4926075 . - 0 ID=BALIOE_24640;Name=hypothetical protein;locus_tag=BALIOE_24640;product=hypothetical protein;Parent=BALIOE_24640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9869 c1 Prodigal gene 4926231 4928429 . - . ID=BALIOE_24645_gene;locus_tag=BALIOE_24645 | |
| 9870 c1 Prodigal CDS 4926231 4928429 . - 0 ID=BALIOE_24645;Name=hypothetical protein;locus_tag=BALIOE_24645;product=hypothetical protein;Parent=BALIOE_24645_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9871 c1 Prodigal gene 4928632 4928844 . + . ID=BALIOE_24650_gene;locus_tag=BALIOE_24650 | |
| 9872 c1 Prodigal CDS 4928632 4928844 . + 0 ID=BALIOE_24650;Name=hypothetical protein;locus_tag=BALIOE_24650;product=hypothetical protein;Parent=BALIOE_24650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9873 c1 Prodigal gene 4929004 4933188 . + . ID=BALIOE_24655_gene;locus_tag=BALIOE_24655 | |
| 9874 c1 Prodigal CDS 4929004 4933188 . + 0 ID=BALIOE_24655;Name=hypothetical protein;locus_tag=BALIOE_24655;product=hypothetical protein;Parent=BALIOE_24655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9875 c1 Prodigal gene 4933190 4933426 . + . ID=BALIOE_24660_gene;locus_tag=BALIOE_24660 | |
| 9876 c1 Prodigal CDS 4933190 4933426 . + 0 ID=BALIOE_24660;Name=hypothetical protein;locus_tag=BALIOE_24660;product=hypothetical protein;Parent=BALIOE_24660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9877 c1 Prodigal gene 4933479 4933757 . + . ID=BALIOE_24665_gene;locus_tag=BALIOE_24665 | |
| 9878 c1 Prodigal CDS 4933479 4933757 . + 0 ID=BALIOE_24665;Name=hypothetical protein;locus_tag=BALIOE_24665;product=hypothetical protein;Parent=BALIOE_24665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9879 c1 Prodigal gene 4934002 4934274 . - . ID=BALIOE_24670_gene;locus_tag=BALIOE_24670 | |
| 9880 c1 Prodigal CDS 4934002 4934274 . - 0 ID=BALIOE_24670;Name=hypothetical protein;locus_tag=BALIOE_24670;product=hypothetical protein;Parent=BALIOE_24670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9881 c1 Prodigal gene 4934419 4935027 . - . ID=BALIOE_24675_gene;locus_tag=BALIOE_24675 | |
| 9882 c1 Prodigal CDS 4934419 4935027 . - 0 ID=BALIOE_24675;Name=hypothetical protein;locus_tag=BALIOE_24675;product=hypothetical protein;Parent=BALIOE_24675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9883 c1 Prodigal gene 4935087 4935404 . - . ID=BALIOE_24680_gene;locus_tag=BALIOE_24680 | |
| 9884 c1 Prodigal CDS 4935087 4935404 . - 0 ID=BALIOE_24680;Name=hypothetical protein;locus_tag=BALIOE_24680;product=hypothetical protein;Parent=BALIOE_24680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9885 c1 Prodigal gene 4935681 4936841 . + . ID=BALIOE_24685_gene;locus_tag=BALIOE_24685 | |
| 9886 c1 Prodigal CDS 4935681 4936841 . + 0 ID=BALIOE_24685;Name=hypothetical protein;locus_tag=BALIOE_24685;product=hypothetical protein;Parent=BALIOE_24685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9887 c1 Prodigal gene 4936844 4939276 . + . ID=BALIOE_24690_gene;locus_tag=BALIOE_24690 | |
| 9888 c1 Prodigal CDS 4936844 4939276 . + 0 ID=BALIOE_24690;Name=hypothetical protein;locus_tag=BALIOE_24690;product=hypothetical protein;Parent=BALIOE_24690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9889 c1 Prodigal gene 4939625 4940515 . + . ID=BALIOE_24695_gene;locus_tag=BALIOE_24695 | |
| 9890 c1 Prodigal CDS 4939625 4940515 . + 0 ID=BALIOE_24695;Name=hypothetical protein;locus_tag=BALIOE_24695;product=hypothetical protein;Parent=BALIOE_24695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9891 c1 Prodigal gene 4940844 4943024 . + . ID=BALIOE_24700_gene;locus_tag=BALIOE_24700 | |
| 9892 c1 Prodigal CDS 4940844 4943024 . + 0 ID=BALIOE_24700;Name=hypothetical protein;locus_tag=BALIOE_24700;product=hypothetical protein;Parent=BALIOE_24700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9893 c1 Prodigal gene 4943118 4944023 . + . ID=BALIOE_24705_gene;locus_tag=BALIOE_24705 | |
| 9894 c1 Prodigal CDS 4943118 4944023 . + 0 ID=BALIOE_24705;Name=hypothetical protein;locus_tag=BALIOE_24705;product=hypothetical protein;Parent=BALIOE_24705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9895 c1 Prodigal gene 4944050 4944667 . - . ID=BALIOE_24710_gene;locus_tag=BALIOE_24710 | |
| 9896 c1 Prodigal CDS 4944050 4944667 . - 0 ID=BALIOE_24710;Name=hypothetical protein;locus_tag=BALIOE_24710;product=hypothetical protein;Parent=BALIOE_24710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9897 c1 Prodigal gene 4944941 4946044 . - . ID=BALIOE_24715_gene;locus_tag=BALIOE_24715 | |
| 9898 c1 Prodigal CDS 4944941 4946044 . - 0 ID=BALIOE_24715;Name=hypothetical protein;locus_tag=BALIOE_24715;product=hypothetical protein;Parent=BALIOE_24715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9899 c1 Prodigal gene 4946055 4946717 . - . ID=BALIOE_24720_gene;locus_tag=BALIOE_24720 | |
| 9900 c1 Prodigal CDS 4946055 4946717 . - 0 ID=BALIOE_24720;Name=hypothetical protein;locus_tag=BALIOE_24720;product=hypothetical protein;Parent=BALIOE_24720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9901 c1 Prodigal gene 4946729 4949230 . - . ID=BALIOE_24725_gene;locus_tag=BALIOE_24725 | |
| 9902 c1 Prodigal CDS 4946729 4949230 . - 0 ID=BALIOE_24725;Name=hypothetical protein;locus_tag=BALIOE_24725;product=hypothetical protein;Parent=BALIOE_24725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9903 c1 Prodigal gene 4949539 4950279 . + . ID=BALIOE_24730_gene;locus_tag=BALIOE_24730 | |
| 9904 c1 Prodigal CDS 4949539 4950279 . + 0 ID=BALIOE_24730;Name=hypothetical protein;locus_tag=BALIOE_24730;product=hypothetical protein;Parent=BALIOE_24730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9905 c1 Prodigal gene 4950301 4950618 . + . ID=BALIOE_24735_gene;locus_tag=BALIOE_24735 | |
| 9906 c1 Prodigal CDS 4950301 4950618 . + 0 ID=BALIOE_24735;Name=hypothetical protein;locus_tag=BALIOE_24735;product=hypothetical protein;Parent=BALIOE_24735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9907 c1 Prodigal gene 4950633 4950953 . + . ID=BALIOE_24740_gene;locus_tag=BALIOE_24740 | |
| 9908 c1 Prodigal CDS 4950633 4950953 . + 0 ID=BALIOE_24740;Name=hypothetical protein;locus_tag=BALIOE_24740;product=hypothetical protein;Parent=BALIOE_24740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9909 c1 Prodigal gene 4951004 4953301 . + . ID=BALIOE_24745_gene;locus_tag=BALIOE_24745 | |
| 9910 c1 Prodigal CDS 4951004 4953301 . + 0 ID=BALIOE_24745;Name=hypothetical protein;locus_tag=BALIOE_24745;product=hypothetical protein;Parent=BALIOE_24745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9911 c1 Prodigal gene 4953267 4954145 . + . ID=BALIOE_24750_gene;locus_tag=BALIOE_24750 | |
| 9912 c1 Prodigal CDS 4953267 4954145 . + 0 ID=BALIOE_24750;Name=hypothetical protein;locus_tag=BALIOE_24750;product=hypothetical protein;Parent=BALIOE_24750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9913 c1 Prodigal gene 4954147 4954488 . + . ID=BALIOE_24755_gene;locus_tag=BALIOE_24755 | |
| 9914 c1 Prodigal CDS 4954147 4954488 . + 0 ID=BALIOE_24755;Name=hypothetical protein;locus_tag=BALIOE_24755;product=hypothetical protein;Parent=BALIOE_24755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9915 c1 Prodigal gene 4954475 4955326 . - . ID=BALIOE_24760_gene;locus_tag=BALIOE_24760 | |
| 9916 c1 Prodigal CDS 4954475 4955326 . - 0 ID=BALIOE_24760;Name=hypothetical protein;locus_tag=BALIOE_24760;product=hypothetical protein;Parent=BALIOE_24760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9917 c1 Prodigal gene 4955541 4957274 . - . ID=BALIOE_24765_gene;locus_tag=BALIOE_24765 | |
| 9918 c1 Prodigal CDS 4955541 4957274 . - 0 ID=BALIOE_24765;Name=hypothetical protein;locus_tag=BALIOE_24765;product=hypothetical protein;Parent=BALIOE_24765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9919 c1 Prodigal gene 4957457 4960108 . - . ID=BALIOE_24770_gene;locus_tag=BALIOE_24770 | |
| 9920 c1 Prodigal CDS 4957457 4960108 . - 0 ID=BALIOE_24770;Name=hypothetical protein;locus_tag=BALIOE_24770;product=hypothetical protein;Parent=BALIOE_24770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9921 c1 Prodigal gene 4960460 4961611 . - . ID=BALIOE_24775_gene;locus_tag=BALIOE_24775 | |
| 9922 c1 Prodigal CDS 4960460 4961611 . - 0 ID=BALIOE_24775;Name=hypothetical protein;locus_tag=BALIOE_24775;product=hypothetical protein;Parent=BALIOE_24775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9923 c1 Prodigal gene 4961765 4962769 . + . ID=BALIOE_24780_gene;locus_tag=BALIOE_24780 | |
| 9924 c1 Prodigal CDS 4961765 4962769 . + 0 ID=BALIOE_24780;Name=hypothetical protein;locus_tag=BALIOE_24780;product=hypothetical protein;Parent=BALIOE_24780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9925 c1 Prodigal gene 4962780 4963553 . + . ID=BALIOE_24785_gene;locus_tag=BALIOE_24785 | |
| 9926 c1 Prodigal CDS 4962780 4963553 . + 0 ID=BALIOE_24785;Name=hypothetical protein;locus_tag=BALIOE_24785;product=hypothetical protein;Parent=BALIOE_24785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9927 c1 Prodigal gene 4963614 4964987 . + . ID=BALIOE_24790_gene;locus_tag=BALIOE_24790 | |
| 9928 c1 Prodigal CDS 4963614 4964987 . + 0 ID=BALIOE_24790;Name=hypothetical protein;locus_tag=BALIOE_24790;product=hypothetical protein;Parent=BALIOE_24790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9929 c1 Prodigal gene 4965254 4966171 . + . ID=BALIOE_24795_gene;locus_tag=BALIOE_24795 | |
| 9930 c1 Prodigal CDS 4965254 4966171 . + 0 ID=BALIOE_24795;Name=hypothetical protein;locus_tag=BALIOE_24795;product=hypothetical protein;Parent=BALIOE_24795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9931 c1 Prodigal gene 4966154 4967554 . - . ID=BALIOE_24800_gene;locus_tag=BALIOE_24800 | |
| 9932 c1 Prodigal CDS 4966154 4967554 . - 0 ID=BALIOE_24800;Name=hypothetical protein;locus_tag=BALIOE_24800;product=hypothetical protein;Parent=BALIOE_24800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9933 c1 Prodigal gene 4967884 4969050 . + . ID=BALIOE_24805_gene;locus_tag=BALIOE_24805 | |
| 9934 c1 Prodigal CDS 4967884 4969050 . + 0 ID=BALIOE_24805;Name=hypothetical protein;locus_tag=BALIOE_24805;product=hypothetical protein;Parent=BALIOE_24805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9935 c1 Prodigal gene 4969093 4970409 . + . ID=BALIOE_24810_gene;locus_tag=BALIOE_24810 | |
| 9936 c1 Prodigal CDS 4969093 4970409 . + 0 ID=BALIOE_24810;Name=hypothetical protein;locus_tag=BALIOE_24810;product=hypothetical protein;Parent=BALIOE_24810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9937 c1 Prodigal gene 4970459 4971163 . + . ID=BALIOE_24815_gene;locus_tag=BALIOE_24815 | |
| 9938 c1 Prodigal CDS 4970459 4971163 . + 0 ID=BALIOE_24815;Name=hypothetical protein;locus_tag=BALIOE_24815;product=hypothetical protein;Parent=BALIOE_24815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9939 c1 Prodigal gene 4971163 4971522 . + . ID=BALIOE_24820_gene;locus_tag=BALIOE_24820 | |
| 9940 c1 Prodigal CDS 4971163 4971522 . + 0 ID=BALIOE_24820;Name=hypothetical protein;locus_tag=BALIOE_24820;product=hypothetical protein;Parent=BALIOE_24820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9941 c1 Prodigal gene 4971562 4972662 . - . ID=BALIOE_24825_gene;locus_tag=BALIOE_24825 | |
| 9942 c1 Prodigal CDS 4971562 4972662 . - 0 ID=BALIOE_24825;Name=hypothetical protein;locus_tag=BALIOE_24825;product=hypothetical protein;Parent=BALIOE_24825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9943 c1 Prodigal gene 4973031 4974875 . + . ID=BALIOE_24830_gene;locus_tag=BALIOE_24830 | |
| 9944 c1 Prodigal CDS 4973031 4974875 . + 0 ID=BALIOE_24830;Name=hypothetical protein;locus_tag=BALIOE_24830;product=hypothetical protein;Parent=BALIOE_24830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9945 c1 Prodigal gene 4974820 4975677 . + . ID=BALIOE_24835_gene;locus_tag=BALIOE_24835 | |
| 9946 c1 Prodigal CDS 4974820 4975677 . + 0 ID=BALIOE_24835;Name=hypothetical protein;locus_tag=BALIOE_24835;product=hypothetical protein;Parent=BALIOE_24835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9947 c1 Infernal gene 4976054 4977595 . + . ID=BALIOE_24840_gene;locus_tag=BALIOE_24840;gene=16S_rrna | |
| 9948 c1 Infernal rRNA 4976054 4977595 8.5e-49 + . ID=BALIOE_24840;Name=16S ribosomal RNA;locus_tag=BALIOE_24840;gene=16S_rrna;product=16S ribosomal RNA;Dbxref=GO:0005840,GO:0003735,RFAM:RF00177;Parent=BALIOE_24840_gene;inference=profile:Rfam:RF00177;Note=SO:0001000 | |
| 9949 c1 tRNAscan-SE gene 4977681 4977756 . + . ID=BALIOE_24845_gene;locus_tag=BALIOE_24845;gene=Glu_trna | |
| 9950 c1 tRNAscan-SE tRNA 4977681 4977756 . + . ID=BALIOE_24845;Name=tRNA-Glu;locus_tag=BALIOE_24845;product=tRNA-Glu;gene=Glu_trna;Parent=BALIOE_24845_gene;inference=profile:tRNAscan:2.0;Note=SO:0000259 | |
| 9951 c1 Prodigal gene 4981201 4982229 . + . ID=BALIOE_24850_gene;locus_tag=BALIOE_24850 | |
| 9952 c1 Prodigal CDS 4981201 4982229 . + 0 ID=BALIOE_24850;Name=hypothetical protein;locus_tag=BALIOE_24850;product=hypothetical protein;Parent=BALIOE_24850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9953 c1 Prodigal gene 4982226 4983191 . + . ID=BALIOE_24855_gene;locus_tag=BALIOE_24855 | |
| 9954 c1 Prodigal CDS 4982226 4983191 . + 0 ID=BALIOE_24855;Name=hypothetical protein;locus_tag=BALIOE_24855;product=hypothetical protein;Parent=BALIOE_24855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9955 c1 Prodigal gene 4983220 4984146 . - . ID=BALIOE_24860_gene;locus_tag=BALIOE_24860 | |
| 9956 c1 Prodigal CDS 4983220 4984146 . - 0 ID=BALIOE_24860;Name=hypothetical protein;locus_tag=BALIOE_24860;product=hypothetical protein;Parent=BALIOE_24860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9957 c1 tRNAscan-SE gene 4984532 4984607 . + . ID=BALIOE_24865_gene;locus_tag=BALIOE_24865;gene=Thr_trna | |
| 9958 c1 tRNAscan-SE tRNA 4984532 4984607 . + . ID=BALIOE_24865;Name=tRNA-Thr;locus_tag=BALIOE_24865;product=tRNA-Thr;gene=Thr_trna;Parent=BALIOE_24865_gene;inference=profile:tRNAscan:2.0;Note=SO:0000270 | |
| 9959 c1 tRNAscan-SE gene 4984616 4984700 . + . ID=BALIOE_24870_gene;locus_tag=BALIOE_24870;gene=Tyr_trna | |
| 9960 c1 tRNAscan-SE tRNA 4984616 4984700 . + . ID=BALIOE_24870;Name=tRNA-Tyr;locus_tag=BALIOE_24870;product=tRNA-Tyr;gene=Tyr_trna;Parent=BALIOE_24870_gene;inference=profile:tRNAscan:2.0;Note=SO:0000272 | |
| 9961 c1 tRNAscan-SE gene 4984817 4984891 . + . ID=BALIOE_24875_gene;locus_tag=BALIOE_24875;gene=Gly_trna | |
| 9962 c1 tRNAscan-SE tRNA 4984817 4984891 . + . ID=BALIOE_24875;Name=tRNA-Gly;locus_tag=BALIOE_24875;product=tRNA-Gly;gene=Gly_trna;Parent=BALIOE_24875_gene;inference=profile:tRNAscan:2.0;Note=SO:0000260 | |
| 9963 c1 tRNAscan-SE gene 4984898 4984973 . + . ID=BALIOE_24880_gene;locus_tag=BALIOE_24880;gene=Thr_trna | |
| 9964 c1 tRNAscan-SE tRNA 4984898 4984973 . + . ID=BALIOE_24880;Name=tRNA-Thr;locus_tag=BALIOE_24880;product=tRNA-Thr;gene=Thr_trna;Parent=BALIOE_24880_gene;inference=profile:tRNAscan:2.0;Note=SO:0000270 | |
| 9965 c1 Prodigal gene 4985088 4986272 . + . ID=BALIOE_24885_gene;locus_tag=BALIOE_24885 | |
| 9966 c1 Prodigal CDS 4985088 4986272 . + 0 ID=BALIOE_24885;Name=hypothetical protein;locus_tag=BALIOE_24885;product=hypothetical protein;Parent=BALIOE_24885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9967 c1 Prodigal gene 4986502 4986885 . + . ID=BALIOE_24890_gene;locus_tag=BALIOE_24890 | |
| 9968 c1 Prodigal CDS 4986502 4986885 . + 0 ID=BALIOE_24890;Name=hypothetical protein;locus_tag=BALIOE_24890;product=hypothetical protein;Parent=BALIOE_24890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9969 c1 Prodigal gene 4986887 4987432 . + . ID=BALIOE_24895_gene;locus_tag=BALIOE_24895 | |
| 9970 c1 Prodigal CDS 4986887 4987432 . + 0 ID=BALIOE_24895;Name=hypothetical protein;locus_tag=BALIOE_24895;product=hypothetical protein;Parent=BALIOE_24895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9971 c1 Prodigal gene 4987591 4988019 . + . ID=BALIOE_24900_gene;locus_tag=BALIOE_24900 | |
| 9972 c1 Prodigal CDS 4987591 4988019 . + 0 ID=BALIOE_24900;Name=hypothetical protein;locus_tag=BALIOE_24900;product=hypothetical protein;Parent=BALIOE_24900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9973 c1 Prodigal gene 4988023 4988727 . + . ID=BALIOE_24905_gene;locus_tag=BALIOE_24905 | |
| 9974 c1 Prodigal CDS 4988023 4988727 . + 0 ID=BALIOE_24905;Name=hypothetical protein;locus_tag=BALIOE_24905;product=hypothetical protein;Parent=BALIOE_24905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9975 c1 Prodigal gene 4989019 4989516 . + . ID=BALIOE_24910_gene;locus_tag=BALIOE_24910 | |
| 9976 c1 Prodigal CDS 4989019 4989516 . + 0 ID=BALIOE_24910;Name=hypothetical protein;locus_tag=BALIOE_24910;product=hypothetical protein;Parent=BALIOE_24910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9977 c1 Prodigal gene 4989583 4989948 . + . ID=BALIOE_24915_gene;locus_tag=BALIOE_24915 | |
| 9978 c1 Prodigal CDS 4989583 4989948 . + 0 ID=BALIOE_24915;Name=hypothetical protein;locus_tag=BALIOE_24915;product=hypothetical protein;Parent=BALIOE_24915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9979 c1 Prodigal gene 4990268 4994296 . + . ID=BALIOE_24920_gene;locus_tag=BALIOE_24920 | |
| 9980 c1 Prodigal CDS 4990268 4994296 . + 0 ID=BALIOE_24920;Name=hypothetical protein;locus_tag=BALIOE_24920;product=hypothetical protein;Parent=BALIOE_24920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9981 c1 Prodigal gene 4994373 4998596 . + . ID=BALIOE_24925_gene;locus_tag=BALIOE_24925 | |
| 9982 c1 Prodigal CDS 4994373 4998596 . + 0 ID=BALIOE_24925;Name=hypothetical protein;locus_tag=BALIOE_24925;product=hypothetical protein;Parent=BALIOE_24925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9983 c1 Prodigal gene 4998809 4999252 . + . ID=BALIOE_24930_gene;locus_tag=BALIOE_24930 | |
| 9984 c1 Prodigal CDS 4998809 4999252 . + 0 ID=BALIOE_24930;Name=hypothetical protein;locus_tag=BALIOE_24930;product=hypothetical protein;Parent=BALIOE_24930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9985 c1 Prodigal gene 4999687 5000820 . - . ID=BALIOE_24935_gene;locus_tag=BALIOE_24935 | |
| 9986 c1 Prodigal CDS 4999687 5000820 . - 0 ID=BALIOE_24935;Name=hypothetical protein;locus_tag=BALIOE_24935;product=hypothetical protein;Parent=BALIOE_24935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9987 c1 Prodigal gene 5000817 5001587 . - . ID=BALIOE_24940_gene;locus_tag=BALIOE_24940 | |
| 9988 c1 Prodigal CDS 5000817 5001587 . - 0 ID=BALIOE_24940;Name=hypothetical protein;locus_tag=BALIOE_24940;product=hypothetical protein;Parent=BALIOE_24940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9989 c1 Prodigal gene 5001589 5001789 . - . ID=BALIOE_24945_gene;locus_tag=BALIOE_24945 | |
| 9990 c1 Prodigal CDS 5001589 5001789 . - 0 ID=BALIOE_24945;Name=hypothetical protein;locus_tag=BALIOE_24945;product=hypothetical protein;Parent=BALIOE_24945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9991 c1 Prodigal gene 5001773 5002528 . - . ID=BALIOE_24950_gene;locus_tag=BALIOE_24950 | |
| 9992 c1 Prodigal CDS 5001773 5002528 . - 0 ID=BALIOE_24950;Name=hypothetical protein;locus_tag=BALIOE_24950;product=hypothetical protein;Parent=BALIOE_24950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9993 c1 Prodigal gene 5002521 5003156 . - . ID=BALIOE_24955_gene;locus_tag=BALIOE_24955 | |
| 9994 c1 Prodigal CDS 5002521 5003156 . - 0 ID=BALIOE_24955;Name=hypothetical protein;locus_tag=BALIOE_24955;product=hypothetical protein;Parent=BALIOE_24955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9995 c1 Prodigal gene 5003156 5005051 . - . ID=BALIOE_24960_gene;locus_tag=BALIOE_24960 | |
| 9996 c1 Prodigal CDS 5003156 5005051 . - 0 ID=BALIOE_24960;Name=hypothetical protein;locus_tag=BALIOE_24960;product=hypothetical protein;Parent=BALIOE_24960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9997 c1 Prodigal gene 5005284 5005760 . - . ID=BALIOE_24965_gene;locus_tag=BALIOE_24965 | |
| 9998 c1 Prodigal CDS 5005284 5005760 . - 0 ID=BALIOE_24965;Name=hypothetical protein;locus_tag=BALIOE_24965;product=hypothetical protein;Parent=BALIOE_24965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 9999 c1 Prodigal gene 5005855 5006628 . + . ID=BALIOE_24970_gene;locus_tag=BALIOE_24970 | |
| 10000 c1 Prodigal CDS 5005855 5006628 . + 0 ID=BALIOE_24970;Name=hypothetical protein;locus_tag=BALIOE_24970;product=hypothetical protein;Parent=BALIOE_24970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10001 c1 Prodigal gene 5006668 5007732 . + . ID=BALIOE_24975_gene;locus_tag=BALIOE_24975 | |
| 10002 c1 Prodigal CDS 5006668 5007732 . + 0 ID=BALIOE_24975;Name=hypothetical protein;locus_tag=BALIOE_24975;product=hypothetical protein;Parent=BALIOE_24975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10003 c1 Prodigal gene 5007742 5008413 . + . ID=BALIOE_24980_gene;locus_tag=BALIOE_24980 | |
| 10004 c1 Prodigal CDS 5007742 5008413 . + 0 ID=BALIOE_24980;Name=hypothetical protein;locus_tag=BALIOE_24980;product=hypothetical protein;Parent=BALIOE_24980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10005 c1 Prodigal gene 5008456 5009046 . + . ID=BALIOE_24985_gene;locus_tag=BALIOE_24985 | |
| 10006 c1 Prodigal CDS 5008456 5009046 . + 0 ID=BALIOE_24985;Name=hypothetical protein;locus_tag=BALIOE_24985;product=hypothetical protein;Parent=BALIOE_24985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10007 c1 Prodigal gene 5009233 5009505 . + . ID=BALIOE_24990_gene;locus_tag=BALIOE_24990 | |
| 10008 c1 Prodigal CDS 5009233 5009505 . + 0 ID=BALIOE_24990;Name=hypothetical protein;locus_tag=BALIOE_24990;product=hypothetical protein;Parent=BALIOE_24990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10009 c1 Prodigal gene 5009578 5010213 . + . ID=BALIOE_24995_gene;locus_tag=BALIOE_24995 | |
| 10010 c1 Prodigal CDS 5009578 5010213 . + 0 ID=BALIOE_24995;Name=hypothetical protein;locus_tag=BALIOE_24995;product=hypothetical protein;Parent=BALIOE_24995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10011 c1 Prodigal gene 5010215 5010640 . - . ID=BALIOE_25000_gene;locus_tag=BALIOE_25000 | |
| 10012 c1 Prodigal CDS 5010215 5010640 . - 0 ID=BALIOE_25000;Name=hypothetical protein;locus_tag=BALIOE_25000;product=hypothetical protein;Parent=BALIOE_25000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10013 c1 Prodigal gene 5010643 5010771 . - . ID=BALIOE_25005_gene;locus_tag=BALIOE_25005 | |
| 10014 c1 Prodigal CDS 5010643 5010771 . - 0 ID=BALIOE_25005;Name=hypothetical protein;locus_tag=BALIOE_25005;product=hypothetical protein;Parent=BALIOE_25005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10015 c1 Prodigal gene 5010878 5012254 . + . ID=BALIOE_25010_gene;locus_tag=BALIOE_25010 | |
| 10016 c1 Prodigal CDS 5010878 5012254 . + 0 ID=BALIOE_25010;Name=hypothetical protein;locus_tag=BALIOE_25010;product=hypothetical protein;Parent=BALIOE_25010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10017 c1 Prodigal gene 5012251 5013576 . + . ID=BALIOE_25015_gene;locus_tag=BALIOE_25015 | |
| 10018 c1 Prodigal CDS 5012251 5013576 . + 0 ID=BALIOE_25015;Name=hypothetical protein;locus_tag=BALIOE_25015;product=hypothetical protein;Parent=BALIOE_25015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10019 c1 Prodigal gene 5013573 5014862 . - . ID=BALIOE_25020_gene;locus_tag=BALIOE_25020 | |
| 10020 c1 Prodigal CDS 5013573 5014862 . - 0 ID=BALIOE_25020;Name=hypothetical protein;locus_tag=BALIOE_25020;product=hypothetical protein;Parent=BALIOE_25020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10021 c1 Prodigal gene 5014874 5016463 . - . ID=BALIOE_25025_gene;locus_tag=BALIOE_25025 | |
| 10022 c1 Prodigal CDS 5014874 5016463 . - 0 ID=BALIOE_25025;Name=hypothetical protein;locus_tag=BALIOE_25025;product=hypothetical protein;Parent=BALIOE_25025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10023 c1 Infernal gene 5017080 5018621 . + . ID=BALIOE_25030_gene;locus_tag=BALIOE_25030;gene=16S_rrna | |
| 10024 c1 Infernal rRNA 5017080 5018621 8.5e-49 + . ID=BALIOE_25030;Name=16S ribosomal RNA;locus_tag=BALIOE_25030;gene=16S_rrna;product=16S ribosomal RNA;Dbxref=GO:0005840,GO:0003735,RFAM:RF00177;Parent=BALIOE_25030_gene;inference=profile:Rfam:RF00177;Note=SO:0001000 | |
| 10025 c1 tRNAscan-SE gene 5018707 5018782 . + . ID=BALIOE_25035_gene;locus_tag=BALIOE_25035;gene=Glu_trna | |
| 10026 c1 tRNAscan-SE tRNA 5018707 5018782 . + . ID=BALIOE_25035;Name=tRNA-Glu;locus_tag=BALIOE_25035;product=tRNA-Glu;gene=Glu_trna;Parent=BALIOE_25035_gene;inference=profile:tRNAscan:2.0;Note=SO:0000259 | |
| 10027 c1 Prodigal gene 5022207 5022650 . - . ID=BALIOE_25040_gene;locus_tag=BALIOE_25040 | |
| 10028 c1 Prodigal CDS 5022207 5022650 . - 0 ID=BALIOE_25040;Name=hypothetical protein;locus_tag=BALIOE_25040;product=hypothetical protein;Parent=BALIOE_25040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10029 c1 Prodigal gene 5022807 5023736 . + . ID=BALIOE_25045_gene;locus_tag=BALIOE_25045 | |
| 10030 c1 Prodigal CDS 5022807 5023736 . + 0 ID=BALIOE_25045;Name=hypothetical protein;locus_tag=BALIOE_25045;product=hypothetical protein;Parent=BALIOE_25045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10031 c1 Prodigal gene 5024005 5025606 . + . ID=BALIOE_25050_gene;locus_tag=BALIOE_25050 | |
| 10032 c1 Prodigal CDS 5024005 5025606 . + 0 ID=BALIOE_25050;Name=hypothetical protein;locus_tag=BALIOE_25050;product=hypothetical protein;Parent=BALIOE_25050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10033 c1 Prodigal gene 5025636 5026940 . + . ID=BALIOE_25055_gene;locus_tag=BALIOE_25055 | |
| 10034 c1 Prodigal CDS 5025636 5026940 . + 0 ID=BALIOE_25055;Name=hypothetical protein;locus_tag=BALIOE_25055;product=hypothetical protein;Parent=BALIOE_25055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10035 c1 Infernal gene 5026967 5027044 . + . ID=BALIOE_25060_gene;locus_tag=BALIOE_25060;gene=naRNA4 | |
| 10036 c1 Infernal ncRNA 5026967 5027044 8.2e-12 + . ID=BALIOE_25060;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_25060;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_25060_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10037 c1 Prodigal gene 5027124 5028860 . + . ID=BALIOE_25065_gene;locus_tag=BALIOE_25065 | |
| 10038 c1 Prodigal CDS 5027124 5028860 . + 0 ID=BALIOE_25065;Name=hypothetical protein;locus_tag=BALIOE_25065;product=hypothetical protein;Parent=BALIOE_25065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10039 c1 Prodigal gene 5028829 5031015 . - . ID=BALIOE_25070_gene;locus_tag=BALIOE_25070 | |
| 10040 c1 Prodigal CDS 5028829 5031015 . - 0 ID=BALIOE_25070;Name=hypothetical protein;locus_tag=BALIOE_25070;product=hypothetical protein;Parent=BALIOE_25070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10041 c1 Prodigal gene 5031332 5032156 . - . ID=BALIOE_25075_gene;locus_tag=BALIOE_25075 | |
| 10042 c1 Prodigal CDS 5031332 5032156 . - 0 ID=BALIOE_25075;Name=hypothetical protein;locus_tag=BALIOE_25075;product=hypothetical protein;Parent=BALIOE_25075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10043 c1 Prodigal gene 5032356 5036039 . + . ID=BALIOE_25080_gene;locus_tag=BALIOE_25080 | |
| 10044 c1 Prodigal CDS 5032356 5036039 . + 0 ID=BALIOE_25080;Name=hypothetical protein;locus_tag=BALIOE_25080;product=hypothetical protein;Parent=BALIOE_25080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10045 c1 Prodigal gene 5036259 5037890 . + . ID=BALIOE_25085_gene;locus_tag=BALIOE_25085 | |
| 10046 c1 Prodigal CDS 5036259 5037890 . + 0 ID=BALIOE_25085;Name=hypothetical protein;locus_tag=BALIOE_25085;product=hypothetical protein;Parent=BALIOE_25085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10047 c1 Prodigal gene 5037981 5038670 . - . ID=BALIOE_25090_gene;locus_tag=BALIOE_25090 | |
| 10048 c1 Prodigal CDS 5037981 5038670 . - 0 ID=BALIOE_25090;Name=hypothetical protein;locus_tag=BALIOE_25090;product=hypothetical protein;Parent=BALIOE_25090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10049 c1 Prodigal gene 5039053 5040282 . - . ID=BALIOE_25095_gene;locus_tag=BALIOE_25095 | |
| 10050 c1 Prodigal CDS 5039053 5040282 . - 0 ID=BALIOE_25095;Name=hypothetical protein;locus_tag=BALIOE_25095;product=hypothetical protein;Parent=BALIOE_25095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10051 c1 Prodigal gene 5040334 5040987 . - . ID=BALIOE_25100_gene;locus_tag=BALIOE_25100 | |
| 10052 c1 Prodigal CDS 5040334 5040987 . - 0 ID=BALIOE_25100;Name=hypothetical protein;locus_tag=BALIOE_25100;product=hypothetical protein;Parent=BALIOE_25100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10053 c1 Prodigal gene 5041220 5041750 . - . ID=BALIOE_25105_gene;locus_tag=BALIOE_25105 | |
| 10054 c1 Prodigal CDS 5041220 5041750 . - 0 ID=BALIOE_25105;Name=hypothetical protein;locus_tag=BALIOE_25105;product=hypothetical protein;Parent=BALIOE_25105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10055 c1 Prodigal gene 5042191 5044281 . + . ID=BALIOE_25110_gene;locus_tag=BALIOE_25110 | |
| 10056 c1 Prodigal CDS 5042191 5044281 . + 0 ID=BALIOE_25110;Name=hypothetical protein;locus_tag=BALIOE_25110;product=hypothetical protein;Parent=BALIOE_25110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10057 c1 Prodigal gene 5044352 5045284 . + . ID=BALIOE_25115_gene;locus_tag=BALIOE_25115 | |
| 10058 c1 Prodigal CDS 5044352 5045284 . + 0 ID=BALIOE_25115;Name=hypothetical protein;locus_tag=BALIOE_25115;product=hypothetical protein;Parent=BALIOE_25115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10059 c1 Prodigal gene 5045287 5045508 . + . ID=BALIOE_25120_gene;locus_tag=BALIOE_25120 | |
| 10060 c1 Prodigal CDS 5045287 5045508 . + 0 ID=BALIOE_25120;Name=hypothetical protein;locus_tag=BALIOE_25120;product=hypothetical protein;Parent=BALIOE_25120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10061 c1 Prodigal gene 5045521 5045775 . + . ID=BALIOE_25125_gene;locus_tag=BALIOE_25125 | |
| 10062 c1 Prodigal CDS 5045521 5045775 . + 0 ID=BALIOE_25125;Name=hypothetical protein;locus_tag=BALIOE_25125;product=hypothetical protein;Parent=BALIOE_25125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10063 c1 Prodigal gene 5045777 5046058 . + . ID=BALIOE_25130_gene;locus_tag=BALIOE_25130 | |
| 10064 c1 Prodigal CDS 5045777 5046058 . + 0 ID=BALIOE_25130;Name=hypothetical protein;locus_tag=BALIOE_25130;product=hypothetical protein;Parent=BALIOE_25130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10065 c1 Prodigal gene 5046055 5046327 . + . ID=BALIOE_25135_gene;locus_tag=BALIOE_25135 | |
| 10066 c1 Prodigal CDS 5046055 5046327 . + 0 ID=BALIOE_25135;Name=hypothetical protein;locus_tag=BALIOE_25135;product=hypothetical protein;Parent=BALIOE_25135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10067 c1 Prodigal gene 5046332 5046625 . + . ID=BALIOE_25140_gene;locus_tag=BALIOE_25140 | |
| 10068 c1 Prodigal CDS 5046332 5046625 . + 0 ID=BALIOE_25140;Name=hypothetical protein;locus_tag=BALIOE_25140;product=hypothetical protein;Parent=BALIOE_25140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10069 c1 Prodigal gene 5046637 5047167 . + . ID=BALIOE_25145_gene;locus_tag=BALIOE_25145 | |
| 10070 c1 Prodigal CDS 5046637 5047167 . + 0 ID=BALIOE_25145;Name=hypothetical protein;locus_tag=BALIOE_25145;product=hypothetical protein;Parent=BALIOE_25145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10071 c1 Prodigal gene 5047265 5047807 . + . ID=BALIOE_25150_gene;locus_tag=BALIOE_25150 | |
| 10072 c1 Prodigal CDS 5047265 5047807 . + 0 ID=BALIOE_25150;Name=hypothetical protein;locus_tag=BALIOE_25150;product=hypothetical protein;Parent=BALIOE_25150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10073 c1 Prodigal gene 5047811 5048344 . + . ID=BALIOE_25155_gene;locus_tag=BALIOE_25155 | |
| 10074 c1 Prodigal CDS 5047811 5048344 . + 0 ID=BALIOE_25155;Name=hypothetical protein;locus_tag=BALIOE_25155;product=hypothetical protein;Parent=BALIOE_25155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10075 c1 Prodigal gene 5048344 5048859 . + . ID=BALIOE_25160_gene;locus_tag=BALIOE_25160 | |
| 10076 c1 Prodigal CDS 5048344 5048859 . + 0 ID=BALIOE_25160;Name=hypothetical protein;locus_tag=BALIOE_25160;product=hypothetical protein;Parent=BALIOE_25160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10077 c1 Prodigal gene 5048863 5049414 . + . ID=BALIOE_25165_gene;locus_tag=BALIOE_25165 | |
| 10078 c1 Prodigal CDS 5048863 5049414 . + 0 ID=BALIOE_25165;Name=hypothetical protein;locus_tag=BALIOE_25165;product=hypothetical protein;Parent=BALIOE_25165_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10079 c1 Prodigal gene 5049411 5049596 . + . ID=BALIOE_25170_gene;locus_tag=BALIOE_25170 | |
| 10080 c1 Prodigal CDS 5049411 5049596 . + 0 ID=BALIOE_25170;Name=hypothetical protein;locus_tag=BALIOE_25170;product=hypothetical protein;Parent=BALIOE_25170_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10081 c1 Prodigal gene 5049635 5049967 . + . ID=BALIOE_25175_gene;locus_tag=BALIOE_25175 | |
| 10082 c1 Prodigal CDS 5049635 5049967 . + 0 ID=BALIOE_25175;Name=hypothetical protein;locus_tag=BALIOE_25175;product=hypothetical protein;Parent=BALIOE_25175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10083 c1 Prodigal gene 5049960 5050157 . + . ID=BALIOE_25180_gene;locus_tag=BALIOE_25180 | |
| 10084 c1 Prodigal CDS 5049960 5050157 . + 0 ID=BALIOE_25180;Name=hypothetical protein;locus_tag=BALIOE_25180;product=hypothetical protein;Parent=BALIOE_25180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10085 c1 Prodigal gene 5050147 5050443 . + . ID=BALIOE_25185_gene;locus_tag=BALIOE_25185 | |
| 10086 c1 Prodigal CDS 5050147 5050443 . + 0 ID=BALIOE_25185;Name=hypothetical protein;locus_tag=BALIOE_25185;product=hypothetical protein;Parent=BALIOE_25185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10087 c1 Prodigal gene 5050440 5050949 . + . ID=BALIOE_25190_gene;locus_tag=BALIOE_25190 | |
| 10088 c1 Prodigal CDS 5050440 5050949 . + 0 ID=BALIOE_25190;Name=hypothetical protein;locus_tag=BALIOE_25190;product=hypothetical protein;Parent=BALIOE_25190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10089 c1 Prodigal gene 5051019 5051444 . + . ID=BALIOE_25195_gene;locus_tag=BALIOE_25195 | |
| 10090 c1 Prodigal CDS 5051019 5051444 . + 0 ID=BALIOE_25195;Name=hypothetical protein;locus_tag=BALIOE_25195;product=hypothetical protein;Parent=BALIOE_25195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10091 c1 Prodigal gene 5051516 5052016 . + . ID=BALIOE_25200_gene;locus_tag=BALIOE_25200 | |
| 10092 c1 Prodigal CDS 5051516 5052016 . + 0 ID=BALIOE_25200;Name=hypothetical protein;locus_tag=BALIOE_25200;product=hypothetical protein;Parent=BALIOE_25200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10093 c1 Prodigal gene 5051979 5052479 . + . ID=BALIOE_25205_gene;locus_tag=BALIOE_25205 | |
| 10094 c1 Prodigal CDS 5051979 5052479 . + 0 ID=BALIOE_25205;Name=hypothetical protein;locus_tag=BALIOE_25205;product=hypothetical protein;Parent=BALIOE_25205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10095 c1 Prodigal gene 5052691 5052918 . + . ID=BALIOE_25210_gene;locus_tag=BALIOE_25210 | |
| 10096 c1 Prodigal CDS 5052691 5052918 . + 0 ID=BALIOE_25210;Name=hypothetical protein;locus_tag=BALIOE_25210;product=hypothetical protein;Parent=BALIOE_25210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10097 c1 Prodigal gene 5052899 5053207 . + . ID=BALIOE_25215_gene;locus_tag=BALIOE_25215 | |
| 10098 c1 Prodigal CDS 5052899 5053207 . + 0 ID=BALIOE_25215;Name=hypothetical protein;locus_tag=BALIOE_25215;product=hypothetical protein;Parent=BALIOE_25215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10099 c1 Prodigal gene 5053204 5053494 . + . ID=BALIOE_25220_gene;locus_tag=BALIOE_25220 | |
| 10100 c1 Prodigal CDS 5053204 5053494 . + 0 ID=BALIOE_25220;Name=hypothetical protein;locus_tag=BALIOE_25220;product=hypothetical protein;Parent=BALIOE_25220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10101 c1 Prodigal gene 5053497 5054078 . + . ID=BALIOE_25225_gene;locus_tag=BALIOE_25225 | |
| 10102 c1 Prodigal CDS 5053497 5054078 . + 0 ID=BALIOE_25225;Name=hypothetical protein;locus_tag=BALIOE_25225;product=hypothetical protein;Parent=BALIOE_25225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10103 c1 Prodigal gene 5054078 5055742 . + . ID=BALIOE_25230_gene;locus_tag=BALIOE_25230 | |
| 10104 c1 Prodigal CDS 5054078 5055742 . + 0 ID=BALIOE_25230;Name=hypothetical protein;locus_tag=BALIOE_25230;product=hypothetical protein;Parent=BALIOE_25230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10105 c1 Prodigal gene 5055742 5057331 . + . ID=BALIOE_25235_gene;locus_tag=BALIOE_25235 | |
| 10106 c1 Prodigal CDS 5055742 5057331 . + 0 ID=BALIOE_25235;Name=hypothetical protein;locus_tag=BALIOE_25235;product=hypothetical protein;Parent=BALIOE_25235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10107 c1 tRNAscan-SE gene 5058640 5058720 . - . ID=BALIOE_25240_gene;locus_tag=BALIOE_25240 | |
| 10108 c1 tRNAscan-SE tRNA 5058640 5058720 . - . ID=BALIOE_25240;Name=tRNA-Xxx;locus_tag=BALIOE_25240;product=tRNA-Xxx;Parent=BALIOE_25240_gene;inference=profile:tRNAscan:2.0 | |
| 10109 c1 Prodigal gene 5058759 5059232 . + . ID=BALIOE_25245_gene;locus_tag=BALIOE_25245 | |
| 10110 c1 Prodigal CDS 5058759 5059232 . + 0 ID=BALIOE_25245;Name=hypothetical protein;locus_tag=BALIOE_25245;product=hypothetical protein;Parent=BALIOE_25245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10111 c1 Prodigal gene 5059409 5060533 . + . ID=BALIOE_25250_gene;locus_tag=BALIOE_25250 | |
| 10112 c1 Prodigal CDS 5059409 5060533 . + 0 ID=BALIOE_25250;Name=hypothetical protein;locus_tag=BALIOE_25250;product=hypothetical protein;Parent=BALIOE_25250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10113 c1 Prodigal gene 5060533 5061480 . + . ID=BALIOE_25255_gene;locus_tag=BALIOE_25255 | |
| 10114 c1 Prodigal CDS 5060533 5061480 . + 0 ID=BALIOE_25255;Name=hypothetical protein;locus_tag=BALIOE_25255;product=hypothetical protein;Parent=BALIOE_25255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10115 c1 Prodigal gene 5061524 5061910 . + . ID=BALIOE_25260_gene;locus_tag=BALIOE_25260 | |
| 10116 c1 Prodigal CDS 5061524 5061910 . + 0 ID=BALIOE_25260;Name=hypothetical protein;locus_tag=BALIOE_25260;product=hypothetical protein;Parent=BALIOE_25260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10117 c1 Prodigal gene 5061907 5062326 . + . ID=BALIOE_25265_gene;locus_tag=BALIOE_25265 | |
| 10118 c1 Prodigal CDS 5061907 5062326 . + 0 ID=BALIOE_25265;Name=hypothetical protein;locus_tag=BALIOE_25265;product=hypothetical protein;Parent=BALIOE_25265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10119 c1 Prodigal gene 5062323 5062883 . + . ID=BALIOE_25270_gene;locus_tag=BALIOE_25270 | |
| 10120 c1 Prodigal CDS 5062323 5062883 . + 0 ID=BALIOE_25270;Name=hypothetical protein;locus_tag=BALIOE_25270;product=hypothetical protein;Parent=BALIOE_25270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10121 c1 Prodigal gene 5062884 5063129 . + . ID=BALIOE_25275_gene;locus_tag=BALIOE_25275 | |
| 10122 c1 Prodigal CDS 5062884 5063129 . + 0 ID=BALIOE_25275;Name=hypothetical protein;locus_tag=BALIOE_25275;product=hypothetical protein;Parent=BALIOE_25275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10123 c1 Prodigal gene 5063126 5064628 . + . ID=BALIOE_25280_gene;locus_tag=BALIOE_25280 | |
| 10124 c1 Prodigal CDS 5063126 5064628 . + 0 ID=BALIOE_25280;Name=hypothetical protein;locus_tag=BALIOE_25280;product=hypothetical protein;Parent=BALIOE_25280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10125 c1 Prodigal gene 5064637 5065002 . + . ID=BALIOE_25285_gene;locus_tag=BALIOE_25285 | |
| 10126 c1 Prodigal CDS 5064637 5065002 . + 0 ID=BALIOE_25285;Name=hypothetical protein;locus_tag=BALIOE_25285;product=hypothetical protein;Parent=BALIOE_25285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10127 c1 Prodigal gene 5065017 5065493 . + . ID=BALIOE_25290_gene;locus_tag=BALIOE_25290 | |
| 10128 c1 Prodigal CDS 5065017 5065493 . + 0 ID=BALIOE_25290;Name=hypothetical protein;locus_tag=BALIOE_25290;product=hypothetical protein;Parent=BALIOE_25290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10129 c1 Prodigal gene 5065620 5067695 . + . ID=BALIOE_25295_gene;locus_tag=BALIOE_25295 | |
| 10130 c1 Prodigal CDS 5065620 5067695 . + 0 ID=BALIOE_25295;Name=hypothetical protein;locus_tag=BALIOE_25295;product=hypothetical protein;Parent=BALIOE_25295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10131 c1 Prodigal gene 5067682 5069031 . + . ID=BALIOE_25300_gene;locus_tag=BALIOE_25300 | |
| 10132 c1 Prodigal CDS 5067682 5069031 . + 0 ID=BALIOE_25300;Name=hypothetical protein;locus_tag=BALIOE_25300;product=hypothetical protein;Parent=BALIOE_25300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10133 c1 Prodigal gene 5069015 5070139 . + . ID=BALIOE_25305_gene;locus_tag=BALIOE_25305 | |
| 10134 c1 Prodigal CDS 5069015 5070139 . + 0 ID=BALIOE_25305;Name=hypothetical protein;locus_tag=BALIOE_25305;product=hypothetical protein;Parent=BALIOE_25305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10135 c1 Prodigal gene 5070129 5070743 . + . ID=BALIOE_25310_gene;locus_tag=BALIOE_25310 | |
| 10136 c1 Prodigal CDS 5070129 5070743 . + 0 ID=BALIOE_25310;Name=hypothetical protein;locus_tag=BALIOE_25310;product=hypothetical protein;Parent=BALIOE_25310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10137 c1 Prodigal gene 5070736 5071173 . + . ID=BALIOE_25315_gene;locus_tag=BALIOE_25315 | |
| 10138 c1 Prodigal CDS 5070736 5071173 . + 0 ID=BALIOE_25315;Name=hypothetical protein;locus_tag=BALIOE_25315;product=hypothetical protein;Parent=BALIOE_25315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10139 c1 Prodigal gene 5071173 5072255 . + . ID=BALIOE_25320_gene;locus_tag=BALIOE_25320 | |
| 10140 c1 Prodigal CDS 5071173 5072255 . + 0 ID=BALIOE_25320;Name=hypothetical protein;locus_tag=BALIOE_25320;product=hypothetical protein;Parent=BALIOE_25320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10141 c1 Prodigal gene 5072246 5072806 . + . ID=BALIOE_25325_gene;locus_tag=BALIOE_25325 | |
| 10142 c1 Prodigal CDS 5072246 5072806 . + 0 ID=BALIOE_25325;Name=hypothetical protein;locus_tag=BALIOE_25325;product=hypothetical protein;Parent=BALIOE_25325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10143 c1 Prodigal gene 5072806 5073717 . + . ID=BALIOE_25330_gene;locus_tag=BALIOE_25330 | |
| 10144 c1 Prodigal CDS 5072806 5073717 . + 0 ID=BALIOE_25330;Name=hypothetical protein;locus_tag=BALIOE_25330;product=hypothetical protein;Parent=BALIOE_25330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10145 c1 Prodigal gene 5073752 5074273 . - . ID=BALIOE_25335_gene;locus_tag=BALIOE_25335 | |
| 10146 c1 Prodigal CDS 5073752 5074273 . - 0 ID=BALIOE_25335;Name=hypothetical protein;locus_tag=BALIOE_25335;product=hypothetical protein;Parent=BALIOE_25335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10147 c1 Prodigal gene 5074778 5075338 . + . ID=BALIOE_25340_gene;locus_tag=BALIOE_25340 | |
| 10148 c1 Prodigal CDS 5074778 5075338 . + 0 ID=BALIOE_25340;Name=hypothetical protein;locus_tag=BALIOE_25340;product=hypothetical protein;Parent=BALIOE_25340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10149 c1 Prodigal gene 5075438 5077477 . + . ID=BALIOE_25345_gene;locus_tag=BALIOE_25345 | |
| 10150 c1 Prodigal CDS 5075438 5077477 . + 0 ID=BALIOE_25345;Name=hypothetical protein;locus_tag=BALIOE_25345;product=hypothetical protein;Parent=BALIOE_25345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10151 c1 Prodigal gene 5077624 5077806 . + . ID=BALIOE_25350_gene;locus_tag=BALIOE_25350 | |
| 10152 c1 Prodigal CDS 5077624 5077806 . + 0 ID=BALIOE_25350;Name=hypothetical protein;locus_tag=BALIOE_25350;product=hypothetical protein;Parent=BALIOE_25350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10153 c1 Prodigal gene 5077842 5078087 . + . ID=BALIOE_25355_gene;locus_tag=BALIOE_25355 | |
| 10154 c1 Prodigal CDS 5077842 5078087 . + 0 ID=BALIOE_25355;Name=hypothetical protein;locus_tag=BALIOE_25355;product=hypothetical protein;Parent=BALIOE_25355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10155 c1 Prodigal gene 5078126 5078590 . - . ID=BALIOE_25360_gene;locus_tag=BALIOE_25360 | |
| 10156 c1 Prodigal CDS 5078126 5078590 . - 0 ID=BALIOE_25360;Name=hypothetical protein;locus_tag=BALIOE_25360;product=hypothetical protein;Parent=BALIOE_25360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10157 c1 Prodigal gene 5078859 5079596 . + . ID=BALIOE_25365_gene;locus_tag=BALIOE_25365 | |
| 10158 c1 Prodigal CDS 5078859 5079596 . + 0 ID=BALIOE_25365;Name=hypothetical protein;locus_tag=BALIOE_25365;product=hypothetical protein;Parent=BALIOE_25365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10159 c1 Prodigal gene 5079720 5079917 . - . ID=BALIOE_25370_gene;locus_tag=BALIOE_25370 | |
| 10160 c1 Prodigal CDS 5079720 5079917 . - 0 ID=BALIOE_25370;Name=hypothetical protein;locus_tag=BALIOE_25370;product=hypothetical protein;Parent=BALIOE_25370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10161 c1 Prodigal gene 5079928 5080725 . - . ID=BALIOE_25375_gene;locus_tag=BALIOE_25375 | |
| 10162 c1 Prodigal CDS 5079928 5080725 . - 0 ID=BALIOE_25375;Name=hypothetical protein;locus_tag=BALIOE_25375;product=hypothetical protein;Parent=BALIOE_25375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10163 c1 Prodigal gene 5080791 5081285 . - . ID=BALIOE_25380_gene;locus_tag=BALIOE_25380 | |
| 10164 c1 Prodigal CDS 5080791 5081285 . - 0 ID=BALIOE_25380;Name=hypothetical protein;locus_tag=BALIOE_25380;product=hypothetical protein;Parent=BALIOE_25380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10165 c1 Prodigal gene 5081285 5081692 . - . ID=BALIOE_25385_gene;locus_tag=BALIOE_25385 | |
| 10166 c1 Prodigal CDS 5081285 5081692 . - 0 ID=BALIOE_25385;Name=hypothetical protein;locus_tag=BALIOE_25385;product=hypothetical protein;Parent=BALIOE_25385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10167 c1 Prodigal gene 5081702 5082508 . - . ID=BALIOE_25390_gene;locus_tag=BALIOE_25390 | |
| 10168 c1 Prodigal CDS 5081702 5082508 . - 0 ID=BALIOE_25390;Name=hypothetical protein;locus_tag=BALIOE_25390;product=hypothetical protein;Parent=BALIOE_25390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10169 c1 Prodigal gene 5082578 5083525 . - . ID=BALIOE_25395_gene;locus_tag=BALIOE_25395 | |
| 10170 c1 Prodigal CDS 5082578 5083525 . - 0 ID=BALIOE_25395;Name=hypothetical protein;locus_tag=BALIOE_25395;product=hypothetical protein;Parent=BALIOE_25395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10171 c1 Prodigal gene 5083873 5084745 . + . ID=BALIOE_25400_gene;locus_tag=BALIOE_25400 | |
| 10172 c1 Prodigal CDS 5083873 5084745 . + 0 ID=BALIOE_25400;Name=hypothetical protein;locus_tag=BALIOE_25400;product=hypothetical protein;Parent=BALIOE_25400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10173 c1 Prodigal gene 5084746 5085018 . - . ID=BALIOE_25405_gene;locus_tag=BALIOE_25405 | |
| 10174 c1 Prodigal CDS 5084746 5085018 . - 0 ID=BALIOE_25405;Name=hypothetical protein;locus_tag=BALIOE_25405;product=hypothetical protein;Parent=BALIOE_25405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10175 c1 Prodigal gene 5085271 5086620 . - . ID=BALIOE_25410_gene;locus_tag=BALIOE_25410 | |
| 10176 c1 Prodigal CDS 5085271 5086620 . - 0 ID=BALIOE_25410;Name=hypothetical protein;locus_tag=BALIOE_25410;product=hypothetical protein;Parent=BALIOE_25410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10177 c1 Prodigal gene 5087145 5088794 . + . ID=BALIOE_25415_gene;locus_tag=BALIOE_25415 | |
| 10178 c1 Prodigal CDS 5087145 5088794 . + 0 ID=BALIOE_25415;Name=hypothetical protein;locus_tag=BALIOE_25415;product=hypothetical protein;Parent=BALIOE_25415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10179 c1 Infernal gene 5088824 5088895 . + . ID=BALIOE_25420_gene;locus_tag=BALIOE_25420;gene=naRNA4 | |
| 10180 c1 Infernal ncRNA 5088824 5088895 4.3e-12 + . ID=BALIOE_25420;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_25420;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_25420_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10181 c1 Prodigal gene 5089307 5089549 . + . ID=BALIOE_25425_gene;locus_tag=BALIOE_25425 | |
| 10182 c1 Prodigal CDS 5089307 5089549 . + 0 ID=BALIOE_25425;Name=hypothetical protein;locus_tag=BALIOE_25425;product=hypothetical protein;Parent=BALIOE_25425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10183 c1 Prodigal gene 5089663 5090301 . + . ID=BALIOE_25430_gene;locus_tag=BALIOE_25430 | |
| 10184 c1 Prodigal CDS 5089663 5090301 . + 0 ID=BALIOE_25430;Name=hypothetical protein;locus_tag=BALIOE_25430;product=hypothetical protein;Parent=BALIOE_25430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10185 c1 Prodigal gene 5090298 5091035 . + . ID=BALIOE_25435_gene;locus_tag=BALIOE_25435 | |
| 10186 c1 Prodigal CDS 5090298 5091035 . + 0 ID=BALIOE_25435;Name=hypothetical protein;locus_tag=BALIOE_25435;product=hypothetical protein;Parent=BALIOE_25435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10187 c1 Prodigal gene 5091035 5093131 . + . ID=BALIOE_25440_gene;locus_tag=BALIOE_25440 | |
| 10188 c1 Prodigal CDS 5091035 5093131 . + 0 ID=BALIOE_25440;Name=hypothetical protein;locus_tag=BALIOE_25440;product=hypothetical protein;Parent=BALIOE_25440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10189 c1 Prodigal gene 5093726 5094136 . + . ID=BALIOE_25445_gene;locus_tag=BALIOE_25445 | |
| 10190 c1 Prodigal CDS 5093726 5094136 . + 0 ID=BALIOE_25445;Name=hypothetical protein;locus_tag=BALIOE_25445;product=hypothetical protein;Parent=BALIOE_25445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10191 c1 Prodigal gene 5094180 5095655 . - . ID=BALIOE_25450_gene;locus_tag=BALIOE_25450 | |
| 10192 c1 Prodigal CDS 5094180 5095655 . - 0 ID=BALIOE_25450;Name=hypothetical protein;locus_tag=BALIOE_25450;product=hypothetical protein;Parent=BALIOE_25450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10193 c1 Prodigal gene 5096027 5096917 . - . ID=BALIOE_25455_gene;locus_tag=BALIOE_25455 | |
| 10194 c1 Prodigal CDS 5096027 5096917 . - 0 ID=BALIOE_25455;Name=hypothetical protein;locus_tag=BALIOE_25455;product=hypothetical protein;Parent=BALIOE_25455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10195 c1 Prodigal gene 5096932 5098476 . - . ID=BALIOE_25460_gene;locus_tag=BALIOE_25460 | |
| 10196 c1 Prodigal CDS 5096932 5098476 . - 0 ID=BALIOE_25460;Name=hypothetical protein;locus_tag=BALIOE_25460;product=hypothetical protein;Parent=BALIOE_25460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10197 c1 Infernal gene 5098496 5098566 . + . ID=BALIOE_25465_gene;locus_tag=BALIOE_25465;gene=naRNA4 | |
| 10198 c1 Infernal ncRNA 5098496 5098566 9.4e-10 + . ID=BALIOE_25465;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_25465;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_25465_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10199 c1 Prodigal gene 5098630 5099820 . - . ID=BALIOE_25470_gene;locus_tag=BALIOE_25470 | |
| 10200 c1 Prodigal CDS 5098630 5099820 . - 0 ID=BALIOE_25470;Name=hypothetical protein;locus_tag=BALIOE_25470;product=hypothetical protein;Parent=BALIOE_25470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10201 c1 Prodigal gene 5100185 5101300 . + . ID=BALIOE_25475_gene;locus_tag=BALIOE_25475 | |
| 10202 c1 Prodigal CDS 5100185 5101300 . + 0 ID=BALIOE_25475;Name=hypothetical protein;locus_tag=BALIOE_25475;product=hypothetical protein;Parent=BALIOE_25475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10203 c1 Prodigal gene 5101372 5102712 . + . ID=BALIOE_25480_gene;locus_tag=BALIOE_25480 | |
| 10204 c1 Prodigal CDS 5101372 5102712 . + 0 ID=BALIOE_25480;Name=hypothetical protein;locus_tag=BALIOE_25480;product=hypothetical protein;Parent=BALIOE_25480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10205 c1 Prodigal gene 5102863 5103783 . + . ID=BALIOE_25485_gene;locus_tag=BALIOE_25485 | |
| 10206 c1 Prodigal CDS 5102863 5103783 . + 0 ID=BALIOE_25485;Name=hypothetical protein;locus_tag=BALIOE_25485;product=hypothetical protein;Parent=BALIOE_25485_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10207 c1 Prodigal gene 5104012 5105592 . + . ID=BALIOE_25490_gene;locus_tag=BALIOE_25490 | |
| 10208 c1 Prodigal CDS 5104012 5105592 . + 0 ID=BALIOE_25490;Name=hypothetical protein;locus_tag=BALIOE_25490;product=hypothetical protein;Parent=BALIOE_25490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10209 c1 Prodigal gene 5105815 5106312 . + . ID=BALIOE_25495_gene;locus_tag=BALIOE_25495 | |
| 10210 c1 Prodigal CDS 5105815 5106312 . + 0 ID=BALIOE_25495;Name=hypothetical protein;locus_tag=BALIOE_25495;product=hypothetical protein;Parent=BALIOE_25495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10211 c1 Prodigal gene 5106325 5107197 . + . ID=BALIOE_25500_gene;locus_tag=BALIOE_25500 | |
| 10212 c1 Prodigal CDS 5106325 5107197 . + 0 ID=BALIOE_25500;Name=hypothetical protein;locus_tag=BALIOE_25500;product=hypothetical protein;Parent=BALIOE_25500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10213 c1 Prodigal gene 5107352 5109775 . - . ID=BALIOE_25505_gene;locus_tag=BALIOE_25505 | |
| 10214 c1 Prodigal CDS 5107352 5109775 . - 0 ID=BALIOE_25505;Name=hypothetical protein;locus_tag=BALIOE_25505;product=hypothetical protein;Parent=BALIOE_25505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10215 c1 Prodigal gene 5109946 5110314 . + . ID=BALIOE_25510_gene;locus_tag=BALIOE_25510 | |
| 10216 c1 Prodigal CDS 5109946 5110314 . + 0 ID=BALIOE_25510;Name=hypothetical protein;locus_tag=BALIOE_25510;product=hypothetical protein;Parent=BALIOE_25510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10217 c1 Prodigal gene 5110424 5111032 . + . ID=BALIOE_25515_gene;locus_tag=BALIOE_25515 | |
| 10218 c1 Prodigal CDS 5110424 5111032 . + 0 ID=BALIOE_25515;Name=hypothetical protein;locus_tag=BALIOE_25515;product=hypothetical protein;Parent=BALIOE_25515_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10219 c1 Prodigal gene 5111105 5112430 . + . ID=BALIOE_25520_gene;locus_tag=BALIOE_25520 | |
| 10220 c1 Prodigal CDS 5111105 5112430 . + 0 ID=BALIOE_25520;Name=hypothetical protein;locus_tag=BALIOE_25520;product=hypothetical protein;Parent=BALIOE_25520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10221 c1 Prodigal gene 5112546 5112755 . + . ID=BALIOE_25525_gene;locus_tag=BALIOE_25525 | |
| 10222 c1 Prodigal CDS 5112546 5112755 . + 0 ID=BALIOE_25525;Name=hypothetical protein;locus_tag=BALIOE_25525;product=hypothetical protein;Parent=BALIOE_25525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10223 c1 Prodigal gene 5112797 5113312 . - . ID=BALIOE_25530_gene;locus_tag=BALIOE_25530 | |
| 10224 c1 Prodigal CDS 5112797 5113312 . - 0 ID=BALIOE_25530;Name=hypothetical protein;locus_tag=BALIOE_25530;product=hypothetical protein;Parent=BALIOE_25530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10225 c1 Prodigal gene 5113631 5114527 . + . ID=BALIOE_25535_gene;locus_tag=BALIOE_25535 | |
| 10226 c1 Prodigal CDS 5113631 5114527 . + 0 ID=BALIOE_25535;Name=hypothetical protein;locus_tag=BALIOE_25535;product=hypothetical protein;Parent=BALIOE_25535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10227 c1 Prodigal gene 5114950 5115987 . + . ID=BALIOE_25540_gene;locus_tag=BALIOE_25540 | |
| 10228 c1 Prodigal CDS 5114950 5115987 . + 0 ID=BALIOE_25540;Name=hypothetical protein;locus_tag=BALIOE_25540;product=hypothetical protein;Parent=BALIOE_25540_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10229 c1 Prodigal gene 5116121 5116363 . + . ID=BALIOE_25545_gene;locus_tag=BALIOE_25545 | |
| 10230 c1 Prodigal CDS 5116121 5116363 . + 0 ID=BALIOE_25545;Name=hypothetical protein;locus_tag=BALIOE_25545;product=hypothetical protein;Parent=BALIOE_25545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10231 c1 Prodigal gene 5116529 5117512 . - . ID=BALIOE_25550_gene;locus_tag=BALIOE_25550 | |
| 10232 c1 Prodigal CDS 5116529 5117512 . - 0 ID=BALIOE_25550;Name=hypothetical protein;locus_tag=BALIOE_25550;product=hypothetical protein;Parent=BALIOE_25550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10233 c1 Prodigal gene 5117595 5119010 . + . ID=BALIOE_25555_gene;locus_tag=BALIOE_25555 | |
| 10234 c1 Prodigal CDS 5117595 5119010 . + 0 ID=BALIOE_25555;Name=hypothetical protein;locus_tag=BALIOE_25555;product=hypothetical protein;Parent=BALIOE_25555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10235 c1 Prodigal gene 5119063 5120142 . + . ID=BALIOE_25560_gene;locus_tag=BALIOE_25560 | |
| 10236 c1 Prodigal CDS 5119063 5120142 . + 0 ID=BALIOE_25560;Name=hypothetical protein;locus_tag=BALIOE_25560;product=hypothetical protein;Parent=BALIOE_25560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10237 c1 Prodigal gene 5120395 5121588 . + . ID=BALIOE_25565_gene;locus_tag=BALIOE_25565 | |
| 10238 c1 Prodigal CDS 5120395 5121588 . + 0 ID=BALIOE_25565;Name=hypothetical protein;locus_tag=BALIOE_25565;product=hypothetical protein;Parent=BALIOE_25565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10239 c1 Prodigal gene 5121927 5122286 . - . ID=BALIOE_25570_gene;locus_tag=BALIOE_25570 | |
| 10240 c1 Prodigal CDS 5121927 5122286 . - 0 ID=BALIOE_25570;Name=hypothetical protein;locus_tag=BALIOE_25570;product=hypothetical protein;Parent=BALIOE_25570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10241 c1 Prodigal gene 5122687 5123400 . + . ID=BALIOE_25575_gene;locus_tag=BALIOE_25575 | |
| 10242 c1 Prodigal CDS 5122687 5123400 . + 0 ID=BALIOE_25575;Name=hypothetical protein;locus_tag=BALIOE_25575;product=hypothetical protein;Parent=BALIOE_25575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10243 c1 Prodigal gene 5123511 5123927 . + . ID=BALIOE_25580_gene;locus_tag=BALIOE_25580 | |
| 10244 c1 Prodigal CDS 5123511 5123927 . + 0 ID=BALIOE_25580;Name=hypothetical protein;locus_tag=BALIOE_25580;product=hypothetical protein;Parent=BALIOE_25580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10245 c1 Prodigal gene 5123931 5124287 . + . ID=BALIOE_25585_gene;locus_tag=BALIOE_25585 | |
| 10246 c1 Prodigal CDS 5123931 5124287 . + 0 ID=BALIOE_25585;Name=hypothetical protein;locus_tag=BALIOE_25585;product=hypothetical protein;Parent=BALIOE_25585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10247 c1 Prodigal gene 5124322 5127144 . - . ID=BALIOE_25590_gene;locus_tag=BALIOE_25590 | |
| 10248 c1 Prodigal CDS 5124322 5127144 . - 0 ID=BALIOE_25590;Name=hypothetical protein;locus_tag=BALIOE_25590;product=hypothetical protein;Parent=BALIOE_25590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10249 c1 Prodigal gene 5127399 5127935 . + . ID=BALIOE_25595_gene;locus_tag=BALIOE_25595 | |
| 10250 c1 Prodigal CDS 5127399 5127935 . + 0 ID=BALIOE_25595;Name=hypothetical protein;locus_tag=BALIOE_25595;product=hypothetical protein;Parent=BALIOE_25595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10251 c1 Prodigal gene 5128034 5128315 . - . ID=BALIOE_25600_gene;locus_tag=BALIOE_25600 | |
| 10252 c1 Prodigal CDS 5128034 5128315 . - 0 ID=BALIOE_25600;Name=hypothetical protein;locus_tag=BALIOE_25600;product=hypothetical protein;Parent=BALIOE_25600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10253 c1 Prodigal gene 5128744 5130330 . + . ID=BALIOE_25605_gene;locus_tag=BALIOE_25605 | |
| 10254 c1 Prodigal CDS 5128744 5130330 . + 0 ID=BALIOE_25605;Name=hypothetical protein;locus_tag=BALIOE_25605;product=hypothetical protein;Parent=BALIOE_25605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10255 c1 Prodigal gene 5130333 5130656 . - . ID=BALIOE_25610_gene;locus_tag=BALIOE_25610 | |
| 10256 c1 Prodigal CDS 5130333 5130656 . - 0 ID=BALIOE_25610;Name=hypothetical protein;locus_tag=BALIOE_25610;product=hypothetical protein;Parent=BALIOE_25610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10257 c1 Prodigal gene 5130742 5131206 . + . ID=BALIOE_25615_gene;locus_tag=BALIOE_25615 | |
| 10258 c1 Prodigal CDS 5130742 5131206 . + 0 ID=BALIOE_25615;Name=hypothetical protein;locus_tag=BALIOE_25615;product=hypothetical protein;Parent=BALIOE_25615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10259 c1 Prodigal gene 5131752 5133101 . + . ID=BALIOE_25620_gene;locus_tag=BALIOE_25620 | |
| 10260 c1 Prodigal CDS 5131752 5133101 . + 0 ID=BALIOE_25620;Name=hypothetical protein;locus_tag=BALIOE_25620;product=hypothetical protein;Parent=BALIOE_25620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10261 c1 Prodigal gene 5133252 5134901 . + . ID=BALIOE_25625_gene;locus_tag=BALIOE_25625 | |
| 10262 c1 Prodigal CDS 5133252 5134901 . + 0 ID=BALIOE_25625;Name=hypothetical protein;locus_tag=BALIOE_25625;product=hypothetical protein;Parent=BALIOE_25625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10263 c1 Prodigal gene 5135055 5136347 . - . ID=BALIOE_25630_gene;locus_tag=BALIOE_25630 | |
| 10264 c1 Prodigal CDS 5135055 5136347 . - 0 ID=BALIOE_25630;Name=hypothetical protein;locus_tag=BALIOE_25630;product=hypothetical protein;Parent=BALIOE_25630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10265 c1 Prodigal gene 5136528 5138177 . - . ID=BALIOE_25635_gene;locus_tag=BALIOE_25635 | |
| 10266 c1 Prodigal CDS 5136528 5138177 . - 0 ID=BALIOE_25635;Name=hypothetical protein;locus_tag=BALIOE_25635;product=hypothetical protein;Parent=BALIOE_25635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10267 c1 Prodigal gene 5138174 5138488 . - . ID=BALIOE_25640_gene;locus_tag=BALIOE_25640 | |
| 10268 c1 Prodigal CDS 5138174 5138488 . - 0 ID=BALIOE_25640;Name=hypothetical protein;locus_tag=BALIOE_25640;product=hypothetical protein;Parent=BALIOE_25640_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10269 c1 Infernal gene 5138580 5138651 . + . ID=BALIOE_25645_gene;locus_tag=BALIOE_25645;gene=naRNA4 | |
| 10270 c1 Infernal ncRNA 5138580 5138651 2.8e-11 + . ID=BALIOE_25645;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_25645;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_25645_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10271 c1 Prodigal gene 5138689 5140647 . - . ID=BALIOE_25650_gene;locus_tag=BALIOE_25650 | |
| 10272 c1 Prodigal CDS 5138689 5140647 . - 0 ID=BALIOE_25650;Name=hypothetical protein;locus_tag=BALIOE_25650;product=hypothetical protein;Parent=BALIOE_25650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10273 c1 Prodigal gene 5141040 5142476 . + . ID=BALIOE_25655_gene;locus_tag=BALIOE_25655 | |
| 10274 c1 Prodigal CDS 5141040 5142476 . + 0 ID=BALIOE_25655;Name=hypothetical protein;locus_tag=BALIOE_25655;product=hypothetical protein;Parent=BALIOE_25655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10275 c1 Prodigal gene 5142521 5143087 . + . ID=BALIOE_25660_gene;locus_tag=BALIOE_25660 | |
| 10276 c1 Prodigal CDS 5142521 5143087 . + 0 ID=BALIOE_25660;Name=hypothetical protein;locus_tag=BALIOE_25660;product=hypothetical protein;Parent=BALIOE_25660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10277 c1 Prodigal gene 5143084 5143755 . + . ID=BALIOE_25665_gene;locus_tag=BALIOE_25665 | |
| 10278 c1 Prodigal CDS 5143084 5143755 . + 0 ID=BALIOE_25665;Name=hypothetical protein;locus_tag=BALIOE_25665;product=hypothetical protein;Parent=BALIOE_25665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10279 c1 Prodigal gene 5143752 5144708 . + . ID=BALIOE_25670_gene;locus_tag=BALIOE_25670 | |
| 10280 c1 Prodigal CDS 5143752 5144708 . + 0 ID=BALIOE_25670;Name=hypothetical protein;locus_tag=BALIOE_25670;product=hypothetical protein;Parent=BALIOE_25670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10281 c1 Prodigal gene 5144824 5146446 . + . ID=BALIOE_25675_gene;locus_tag=BALIOE_25675 | |
| 10282 c1 Prodigal CDS 5144824 5146446 . + 0 ID=BALIOE_25675;Name=hypothetical protein;locus_tag=BALIOE_25675;product=hypothetical protein;Parent=BALIOE_25675_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10283 c1 Prodigal gene 5146439 5146822 . + . ID=BALIOE_25680_gene;locus_tag=BALIOE_25680 | |
| 10284 c1 Prodigal CDS 5146439 5146822 . + 0 ID=BALIOE_25680;Name=hypothetical protein;locus_tag=BALIOE_25680;product=hypothetical protein;Parent=BALIOE_25680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10285 c1 Prodigal gene 5146819 5147415 . + . ID=BALIOE_25685_gene;locus_tag=BALIOE_25685 | |
| 10286 c1 Prodigal CDS 5146819 5147415 . + 0 ID=BALIOE_25685;Name=hypothetical protein;locus_tag=BALIOE_25685;product=hypothetical protein;Parent=BALIOE_25685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10287 c1 Prodigal gene 5147757 5149070 . + . ID=BALIOE_25690_gene;locus_tag=BALIOE_25690 | |
| 10288 c1 Prodigal CDS 5147757 5149070 . + 0 ID=BALIOE_25690;Name=hypothetical protein;locus_tag=BALIOE_25690;product=hypothetical protein;Parent=BALIOE_25690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10289 c1 Infernal gene 5149173 5149243 . + . ID=BALIOE_25695_gene;locus_tag=BALIOE_25695;gene=naRNA4 | |
| 10290 c1 Infernal ncRNA 5149173 5149243 6e-09 + . ID=BALIOE_25695;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_25695;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_25695_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10291 c1 Prodigal gene 5149248 5149937 . - . ID=BALIOE_25700_gene;locus_tag=BALIOE_25700 | |
| 10292 c1 Prodigal CDS 5149248 5149937 . - 0 ID=BALIOE_25700;Name=hypothetical protein;locus_tag=BALIOE_25700;product=hypothetical protein;Parent=BALIOE_25700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10293 c1 Prodigal gene 5150031 5151710 . - . ID=BALIOE_25705_gene;locus_tag=BALIOE_25705 | |
| 10294 c1 Prodigal CDS 5150031 5151710 . - 0 ID=BALIOE_25705;Name=hypothetical protein;locus_tag=BALIOE_25705;product=hypothetical protein;Parent=BALIOE_25705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10295 c1 Prodigal gene 5151759 5152178 . - . ID=BALIOE_25710_gene;locus_tag=BALIOE_25710 | |
| 10296 c1 Prodigal CDS 5151759 5152178 . - 0 ID=BALIOE_25710;Name=hypothetical protein;locus_tag=BALIOE_25710;product=hypothetical protein;Parent=BALIOE_25710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10297 c1 Prodigal gene 5152376 5153842 . - . ID=BALIOE_25715_gene;locus_tag=BALIOE_25715 | |
| 10298 c1 Prodigal CDS 5152376 5153842 . - 0 ID=BALIOE_25715;Name=hypothetical protein;locus_tag=BALIOE_25715;product=hypothetical protein;Parent=BALIOE_25715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10299 c1 Prodigal gene 5153839 5155890 . - . ID=BALIOE_25720_gene;locus_tag=BALIOE_25720 | |
| 10300 c1 Prodigal CDS 5153839 5155890 . - 0 ID=BALIOE_25720;Name=hypothetical protein;locus_tag=BALIOE_25720;product=hypothetical protein;Parent=BALIOE_25720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10301 c1 Prodigal gene 5155890 5156921 . - . ID=BALIOE_25725_gene;locus_tag=BALIOE_25725 | |
| 10302 c1 Prodigal CDS 5155890 5156921 . - 0 ID=BALIOE_25725;Name=hypothetical protein;locus_tag=BALIOE_25725;product=hypothetical protein;Parent=BALIOE_25725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10303 c1 Prodigal gene 5156940 5157215 . - . ID=BALIOE_25730_gene;locus_tag=BALIOE_25730 | |
| 10304 c1 Prodigal CDS 5156940 5157215 . - 0 ID=BALIOE_25730;Name=hypothetical protein;locus_tag=BALIOE_25730;product=hypothetical protein;Parent=BALIOE_25730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10305 c1 Prodigal gene 5157424 5159409 . - . ID=BALIOE_25735_gene;locus_tag=BALIOE_25735 | |
| 10306 c1 Prodigal CDS 5157424 5159409 . - 0 ID=BALIOE_25735;Name=hypothetical protein;locus_tag=BALIOE_25735;product=hypothetical protein;Parent=BALIOE_25735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10307 c1 Prodigal gene 5159700 5160407 . + . ID=BALIOE_25740_gene;locus_tag=BALIOE_25740 | |
| 10308 c1 Prodigal CDS 5159700 5160407 . + 0 ID=BALIOE_25740;Name=hypothetical protein;locus_tag=BALIOE_25740;product=hypothetical protein;Parent=BALIOE_25740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10309 c1 Prodigal gene 5160404 5161405 . - . ID=BALIOE_25745_gene;locus_tag=BALIOE_25745 | |
| 10310 c1 Prodigal CDS 5160404 5161405 . - 0 ID=BALIOE_25745;Name=hypothetical protein;locus_tag=BALIOE_25745;product=hypothetical protein;Parent=BALIOE_25745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10311 c1 Prodigal gene 5161402 5162262 . - . ID=BALIOE_25750_gene;locus_tag=BALIOE_25750 | |
| 10312 c1 Prodigal CDS 5161402 5162262 . - 0 ID=BALIOE_25750;Name=hypothetical protein;locus_tag=BALIOE_25750;product=hypothetical protein;Parent=BALIOE_25750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10313 c1 Prodigal gene 5162277 5162960 . - . ID=BALIOE_25755_gene;locus_tag=BALIOE_25755 | |
| 10314 c1 Prodigal CDS 5162277 5162960 . - 0 ID=BALIOE_25755;Name=hypothetical protein;locus_tag=BALIOE_25755;product=hypothetical protein;Parent=BALIOE_25755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10315 c1 Prodigal gene 5163015 5163956 . - . ID=BALIOE_25760_gene;locus_tag=BALIOE_25760 | |
| 10316 c1 Prodigal CDS 5163015 5163956 . - 0 ID=BALIOE_25760;Name=hypothetical protein;locus_tag=BALIOE_25760;product=hypothetical protein;Parent=BALIOE_25760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10317 c1 Prodigal gene 5163975 5164949 . - . ID=BALIOE_25765_gene;locus_tag=BALIOE_25765 | |
| 10318 c1 Prodigal CDS 5163975 5164949 . - 0 ID=BALIOE_25765;Name=hypothetical protein;locus_tag=BALIOE_25765;product=hypothetical protein;Parent=BALIOE_25765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10319 c1 Prodigal gene 5164946 5166466 . - . ID=BALIOE_25770_gene;locus_tag=BALIOE_25770 | |
| 10320 c1 Prodigal CDS 5164946 5166466 . - 0 ID=BALIOE_25770;Name=hypothetical protein;locus_tag=BALIOE_25770;product=hypothetical protein;Parent=BALIOE_25770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10321 c1 Prodigal gene 5166580 5168850 . + . ID=BALIOE_25775_gene;locus_tag=BALIOE_25775 | |
| 10322 c1 Prodigal CDS 5166580 5168850 . + 0 ID=BALIOE_25775;Name=hypothetical protein;locus_tag=BALIOE_25775;product=hypothetical protein;Parent=BALIOE_25775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10323 c1 Prodigal gene 5168919 5169248 . + . ID=BALIOE_25780_gene;locus_tag=BALIOE_25780 | |
| 10324 c1 Prodigal CDS 5168919 5169248 . + 0 ID=BALIOE_25780;Name=hypothetical protein;locus_tag=BALIOE_25780;product=hypothetical protein;Parent=BALIOE_25780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10325 c1 Prodigal gene 5169325 5170083 . - . ID=BALIOE_25785_gene;locus_tag=BALIOE_25785 | |
| 10326 c1 Prodigal CDS 5169325 5170083 . - 0 ID=BALIOE_25785;Name=hypothetical protein;locus_tag=BALIOE_25785;product=hypothetical protein;Parent=BALIOE_25785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10327 c1 Prodigal gene 5170085 5170510 . - . ID=BALIOE_25790_gene;locus_tag=BALIOE_25790 | |
| 10328 c1 Prodigal CDS 5170085 5170510 . - 0 ID=BALIOE_25790;Name=hypothetical protein;locus_tag=BALIOE_25790;product=hypothetical protein;Parent=BALIOE_25790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10329 c1 Prodigal gene 5170507 5171064 . - . ID=BALIOE_25795_gene;locus_tag=BALIOE_25795 | |
| 10330 c1 Prodigal CDS 5170507 5171064 . - 0 ID=BALIOE_25795;Name=hypothetical protein;locus_tag=BALIOE_25795;product=hypothetical protein;Parent=BALIOE_25795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10331 c1 Prodigal gene 5171064 5172200 . - . ID=BALIOE_25800_gene;locus_tag=BALIOE_25800 | |
| 10332 c1 Prodigal CDS 5171064 5172200 . - 0 ID=BALIOE_25800;Name=hypothetical protein;locus_tag=BALIOE_25800;product=hypothetical protein;Parent=BALIOE_25800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10333 c1 Prodigal gene 5172197 5172877 . - . ID=BALIOE_25805_gene;locus_tag=BALIOE_25805 | |
| 10334 c1 Prodigal CDS 5172197 5172877 . - 0 ID=BALIOE_25805;Name=hypothetical protein;locus_tag=BALIOE_25805;product=hypothetical protein;Parent=BALIOE_25805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10335 c1 Prodigal gene 5172988 5173746 . - . ID=BALIOE_25810_gene;locus_tag=BALIOE_25810 | |
| 10336 c1 Prodigal CDS 5172988 5173746 . - 0 ID=BALIOE_25810;Name=hypothetical protein;locus_tag=BALIOE_25810;product=hypothetical protein;Parent=BALIOE_25810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10337 c1 Prodigal gene 5173743 5174588 . - . ID=BALIOE_25815_gene;locus_tag=BALIOE_25815 | |
| 10338 c1 Prodigal CDS 5173743 5174588 . - 0 ID=BALIOE_25815;Name=hypothetical protein;locus_tag=BALIOE_25815;product=hypothetical protein;Parent=BALIOE_25815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10339 c1 Prodigal gene 5174581 5175645 . - . ID=BALIOE_25820_gene;locus_tag=BALIOE_25820 | |
| 10340 c1 Prodigal CDS 5174581 5175645 . - 0 ID=BALIOE_25820;Name=hypothetical protein;locus_tag=BALIOE_25820;product=hypothetical protein;Parent=BALIOE_25820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10341 c1 Prodigal gene 5175645 5176229 . - . ID=BALIOE_25825_gene;locus_tag=BALIOE_25825 | |
| 10342 c1 Prodigal CDS 5175645 5176229 . - 0 ID=BALIOE_25825;Name=hypothetical protein;locus_tag=BALIOE_25825;product=hypothetical protein;Parent=BALIOE_25825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10343 c1 Prodigal gene 5176226 5176678 . - . ID=BALIOE_25830_gene;locus_tag=BALIOE_25830 | |
| 10344 c1 Prodigal CDS 5176226 5176678 . - 0 ID=BALIOE_25830;Name=hypothetical protein;locus_tag=BALIOE_25830;product=hypothetical protein;Parent=BALIOE_25830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10345 c1 Prodigal gene 5176679 5177404 . - . ID=BALIOE_25835_gene;locus_tag=BALIOE_25835 | |
| 10346 c1 Prodigal CDS 5176679 5177404 . - 0 ID=BALIOE_25835;Name=hypothetical protein;locus_tag=BALIOE_25835;product=hypothetical protein;Parent=BALIOE_25835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10347 c1 Prodigal gene 5177425 5178204 . - . ID=BALIOE_25840_gene;locus_tag=BALIOE_25840 | |
| 10348 c1 Prodigal CDS 5177425 5178204 . - 0 ID=BALIOE_25840;Name=hypothetical protein;locus_tag=BALIOE_25840;product=hypothetical protein;Parent=BALIOE_25840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10349 c1 Infernal gene 5178223 5178303 . + . ID=BALIOE_25845_gene;locus_tag=BALIOE_25845;gene=naRNA4 | |
| 10350 c1 Infernal ncRNA 5178223 5178303 8.9e-09 + . ID=BALIOE_25845;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_25845;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_25845_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10351 c1 Prodigal gene 5178310 5179326 . - . ID=BALIOE_25850_gene;locus_tag=BALIOE_25850 | |
| 10352 c1 Prodigal CDS 5178310 5179326 . - 0 ID=BALIOE_25850;Name=hypothetical protein;locus_tag=BALIOE_25850;product=hypothetical protein;Parent=BALIOE_25850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10353 c1 Prodigal gene 5179351 5180139 . - . ID=BALIOE_25855_gene;locus_tag=BALIOE_25855 | |
| 10354 c1 Prodigal CDS 5179351 5180139 . - 0 ID=BALIOE_25855;Name=hypothetical protein;locus_tag=BALIOE_25855;product=hypothetical protein;Parent=BALIOE_25855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10355 c1 Prodigal gene 5180272 5180715 . - . ID=BALIOE_25860_gene;locus_tag=BALIOE_25860 | |
| 10356 c1 Prodigal CDS 5180272 5180715 . - 0 ID=BALIOE_25860;Name=hypothetical protein;locus_tag=BALIOE_25860;product=hypothetical protein;Parent=BALIOE_25860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10357 c1 Infernal gene 5180780 5180856 . - . ID=BALIOE_25865_gene;locus_tag=BALIOE_25865;gene=naRNA4 | |
| 10358 c1 Infernal ncRNA 5180780 5180856 2e-16 - . ID=BALIOE_25865;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_25865;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_25865_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10359 c1 Infernal gene 5180880 5180956 . - . ID=BALIOE_25870_gene;locus_tag=BALIOE_25870;gene=naRNA4 | |
| 10360 c1 Infernal ncRNA 5180880 5180956 4.1e-15 - . ID=BALIOE_25870;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_25870;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_25870_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10361 c1 Prodigal gene 5180974 5181309 . - . ID=BALIOE_25875_gene;locus_tag=BALIOE_25875 | |
| 10362 c1 Prodigal CDS 5180974 5181309 . - 0 ID=BALIOE_25875;Name=hypothetical protein;locus_tag=BALIOE_25875;product=hypothetical protein;Parent=BALIOE_25875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10363 c1 Prodigal gene 5181711 5183939 . + . ID=BALIOE_25880_gene;locus_tag=BALIOE_25880 | |
| 10364 c1 Prodigal CDS 5181711 5183939 . + 0 ID=BALIOE_25880;Name=hypothetical protein;locus_tag=BALIOE_25880;product=hypothetical protein;Parent=BALIOE_25880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10365 c1 Prodigal gene 5183936 5184814 . + . ID=BALIOE_25885_gene;locus_tag=BALIOE_25885 | |
| 10366 c1 Prodigal CDS 5183936 5184814 . + 0 ID=BALIOE_25885;Name=hypothetical protein;locus_tag=BALIOE_25885;product=hypothetical protein;Parent=BALIOE_25885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10367 c1 Prodigal gene 5185078 5186580 . + . ID=BALIOE_25890_gene;locus_tag=BALIOE_25890 | |
| 10368 c1 Prodigal CDS 5185078 5186580 . + 0 ID=BALIOE_25890;Name=hypothetical protein;locus_tag=BALIOE_25890;product=hypothetical protein;Parent=BALIOE_25890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10369 c1 Prodigal gene 5186692 5186781 . + . ID=BALIOE_25895_gene;locus_tag=BALIOE_25895 | |
| 10370 c1 Prodigal CDS 5186692 5186781 . + 0 ID=BALIOE_25895;Name=hypothetical protein;locus_tag=BALIOE_25895;product=hypothetical protein;Parent=BALIOE_25895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10371 c1 Prodigal gene 5186757 5187857 . - . ID=BALIOE_25900_gene;locus_tag=BALIOE_25900 | |
| 10372 c1 Prodigal CDS 5186757 5187857 . - 0 ID=BALIOE_25900;Name=hypothetical protein;locus_tag=BALIOE_25900;product=hypothetical protein;Parent=BALIOE_25900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10373 c1 Prodigal gene 5187858 5188526 . - . ID=BALIOE_25905_gene;locus_tag=BALIOE_25905 | |
| 10374 c1 Prodigal CDS 5187858 5188526 . - 0 ID=BALIOE_25905;Name=hypothetical protein;locus_tag=BALIOE_25905;product=hypothetical protein;Parent=BALIOE_25905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10375 c1 Prodigal gene 5188523 5190166 . - . ID=BALIOE_25910_gene;locus_tag=BALIOE_25910 | |
| 10376 c1 Prodigal CDS 5188523 5190166 . - 0 ID=BALIOE_25910;Name=hypothetical protein;locus_tag=BALIOE_25910;product=hypothetical protein;Parent=BALIOE_25910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10377 c1 Prodigal gene 5190270 5191607 . - . ID=BALIOE_25915_gene;locus_tag=BALIOE_25915 | |
| 10378 c1 Prodigal CDS 5190270 5191607 . - 0 ID=BALIOE_25915;Name=hypothetical protein;locus_tag=BALIOE_25915;product=hypothetical protein;Parent=BALIOE_25915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10379 c1 Prodigal gene 5191744 5192505 . - . ID=BALIOE_25920_gene;locus_tag=BALIOE_25920 | |
| 10380 c1 Prodigal CDS 5191744 5192505 . - 0 ID=BALIOE_25920;Name=hypothetical protein;locus_tag=BALIOE_25920;product=hypothetical protein;Parent=BALIOE_25920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10381 c1 Prodigal gene 5192830 5195100 . - . ID=BALIOE_25925_gene;locus_tag=BALIOE_25925 | |
| 10382 c1 Prodigal CDS 5192830 5195100 . - 0 ID=BALIOE_25925;Name=hypothetical protein;locus_tag=BALIOE_25925;product=hypothetical protein;Parent=BALIOE_25925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10383 c1 Prodigal gene 5195296 5196204 . - . ID=BALIOE_25930_gene;locus_tag=BALIOE_25930 | |
| 10384 c1 Prodigal CDS 5195296 5196204 . - 0 ID=BALIOE_25930;Name=hypothetical protein;locus_tag=BALIOE_25930;product=hypothetical protein;Parent=BALIOE_25930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10385 c1 Prodigal gene 5196487 5197842 . + . ID=BALIOE_25935_gene;locus_tag=BALIOE_25935 | |
| 10386 c1 Prodigal CDS 5196487 5197842 . + 0 ID=BALIOE_25935;Name=hypothetical protein;locus_tag=BALIOE_25935;product=hypothetical protein;Parent=BALIOE_25935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10387 c1 Prodigal gene 5197957 5199366 . + . ID=BALIOE_25940_gene;locus_tag=BALIOE_25940 | |
| 10388 c1 Prodigal CDS 5197957 5199366 . + 0 ID=BALIOE_25940;Name=hypothetical protein;locus_tag=BALIOE_25940;product=hypothetical protein;Parent=BALIOE_25940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10389 c1 Prodigal gene 5199505 5200134 . - . ID=BALIOE_25945_gene;locus_tag=BALIOE_25945 | |
| 10390 c1 Prodigal CDS 5199505 5200134 . - 0 ID=BALIOE_25945;Name=hypothetical protein;locus_tag=BALIOE_25945;product=hypothetical protein;Parent=BALIOE_25945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10391 c1 Prodigal gene 5200257 5201903 . - . ID=BALIOE_25950_gene;locus_tag=BALIOE_25950 | |
| 10392 c1 Prodigal CDS 5200257 5201903 . - 0 ID=BALIOE_25950;Name=hypothetical protein;locus_tag=BALIOE_25950;product=hypothetical protein;Parent=BALIOE_25950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10393 c1 Prodigal gene 5201981 5203321 . - . ID=BALIOE_25955_gene;locus_tag=BALIOE_25955 | |
| 10394 c1 Prodigal CDS 5201981 5203321 . - 0 ID=BALIOE_25955;Name=hypothetical protein;locus_tag=BALIOE_25955;product=hypothetical protein;Parent=BALIOE_25955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10395 c1 Prodigal gene 5203892 5204611 . - . ID=BALIOE_25960_gene;locus_tag=BALIOE_25960 | |
| 10396 c1 Prodigal CDS 5203892 5204611 . - 0 ID=BALIOE_25960;Name=hypothetical protein;locus_tag=BALIOE_25960;product=hypothetical protein;Parent=BALIOE_25960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10397 c1 Prodigal gene 5204608 5206239 . - . ID=BALIOE_25965_gene;locus_tag=BALIOE_25965 | |
| 10398 c1 Prodigal CDS 5204608 5206239 . - 0 ID=BALIOE_25965;Name=hypothetical protein;locus_tag=BALIOE_25965;product=hypothetical protein;Parent=BALIOE_25965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10399 c1 Prodigal gene 5206420 5206650 . + . ID=BALIOE_25970_gene;locus_tag=BALIOE_25970 | |
| 10400 c1 Prodigal CDS 5206420 5206650 . + 0 ID=BALIOE_25970;Name=hypothetical protein;locus_tag=BALIOE_25970;product=hypothetical protein;Parent=BALIOE_25970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10401 c1 Prodigal gene 5206662 5206934 . + . ID=BALIOE_25975_gene;locus_tag=BALIOE_25975 | |
| 10402 c1 Prodigal CDS 5206662 5206934 . + 0 ID=BALIOE_25975;Name=hypothetical protein;locus_tag=BALIOE_25975;product=hypothetical protein;Parent=BALIOE_25975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10403 c1 Prodigal gene 5207161 5207457 . + . ID=BALIOE_25980_gene;locus_tag=BALIOE_25980 | |
| 10404 c1 Prodigal CDS 5207161 5207457 . + 0 ID=BALIOE_25980;Name=hypothetical protein;locus_tag=BALIOE_25980;product=hypothetical protein;Parent=BALIOE_25980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10405 c1 Prodigal gene 5207485 5207658 . + . ID=BALIOE_25985_gene;locus_tag=BALIOE_25985 | |
| 10406 c1 Prodigal CDS 5207485 5207658 . + 0 ID=BALIOE_25985;Name=hypothetical protein;locus_tag=BALIOE_25985;product=hypothetical protein;Parent=BALIOE_25985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10407 c1 Prodigal gene 5207777 5209294 . - . ID=BALIOE_25990_gene;locus_tag=BALIOE_25990 | |
| 10408 c1 Prodigal CDS 5207777 5209294 . - 0 ID=BALIOE_25990;Name=hypothetical protein;locus_tag=BALIOE_25990;product=hypothetical protein;Parent=BALIOE_25990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10409 c1 Prodigal gene 5209531 5210988 . - . ID=BALIOE_25995_gene;locus_tag=BALIOE_25995 | |
| 10410 c1 Prodigal CDS 5209531 5210988 . - 0 ID=BALIOE_25995;Name=hypothetical protein;locus_tag=BALIOE_25995;product=hypothetical protein;Parent=BALIOE_25995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10411 c1 Prodigal gene 5211047 5213194 . - . ID=BALIOE_26000_gene;locus_tag=BALIOE_26000 | |
| 10412 c1 Prodigal CDS 5211047 5213194 . - 0 ID=BALIOE_26000;Name=hypothetical protein;locus_tag=BALIOE_26000;product=hypothetical protein;Parent=BALIOE_26000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10413 c1 Prodigal gene 5213274 5214608 . - . ID=BALIOE_26005_gene;locus_tag=BALIOE_26005 | |
| 10414 c1 Prodigal CDS 5213274 5214608 . - 0 ID=BALIOE_26005;Name=hypothetical protein;locus_tag=BALIOE_26005;product=hypothetical protein;Parent=BALIOE_26005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10415 c1 Prodigal gene 5214974 5216512 . - . ID=BALIOE_26010_gene;locus_tag=BALIOE_26010 | |
| 10416 c1 Prodigal CDS 5214974 5216512 . - 0 ID=BALIOE_26010;Name=hypothetical protein;locus_tag=BALIOE_26010;product=hypothetical protein;Parent=BALIOE_26010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10417 c1 tRNAscan-SE gene 5217129 5217204 . - . ID=BALIOE_26015_gene;locus_tag=BALIOE_26015;gene=Phe_trna | |
| 10418 c1 tRNAscan-SE tRNA 5217129 5217204 . - . ID=BALIOE_26015;Name=tRNA-Phe;locus_tag=BALIOE_26015;product=tRNA-Phe;gene=Phe_trna;Parent=BALIOE_26015_gene;inference=profile:tRNAscan:2.0;Note=SO:0000267 | |
| 10419 c1 Prodigal gene 5217311 5217886 . - . ID=BALIOE_26020_gene;locus_tag=BALIOE_26020 | |
| 10420 c1 Prodigal CDS 5217311 5217886 . - 0 ID=BALIOE_26020;Name=hypothetical protein;locus_tag=BALIOE_26020;product=hypothetical protein;Parent=BALIOE_26020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10421 c1 Prodigal gene 5217923 5219620 . - . ID=BALIOE_26025_gene;locus_tag=BALIOE_26025 | |
| 10422 c1 Prodigal CDS 5217923 5219620 . - 0 ID=BALIOE_26025;Name=hypothetical protein;locus_tag=BALIOE_26025;product=hypothetical protein;Parent=BALIOE_26025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10423 c1 Prodigal gene 5219596 5219934 . - . ID=BALIOE_26030_gene;locus_tag=BALIOE_26030 | |
| 10424 c1 Prodigal CDS 5219596 5219934 . - 0 ID=BALIOE_26030;Name=hypothetical protein;locus_tag=BALIOE_26030;product=hypothetical protein;Parent=BALIOE_26030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10425 c1 Prodigal gene 5220050 5221351 . - . ID=BALIOE_26035_gene;locus_tag=BALIOE_26035 | |
| 10426 c1 Prodigal CDS 5220050 5221351 . - 0 ID=BALIOE_26035;Name=hypothetical protein;locus_tag=BALIOE_26035;product=hypothetical protein;Parent=BALIOE_26035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10427 c1 Prodigal gene 5221469 5222905 . - . ID=BALIOE_26040_gene;locus_tag=BALIOE_26040 | |
| 10428 c1 Prodigal CDS 5221469 5222905 . - 0 ID=BALIOE_26040;Name=hypothetical protein;locus_tag=BALIOE_26040;product=hypothetical protein;Parent=BALIOE_26040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10429 c1 Prodigal gene 5223242 5223718 . + . ID=BALIOE_26045_gene;locus_tag=BALIOE_26045 | |
| 10430 c1 Prodigal CDS 5223242 5223718 . + 0 ID=BALIOE_26045;Name=hypothetical protein;locus_tag=BALIOE_26045;product=hypothetical protein;Parent=BALIOE_26045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10431 c1 Prodigal gene 5223734 5224990 . - . ID=BALIOE_26050_gene;locus_tag=BALIOE_26050 | |
| 10432 c1 Prodigal CDS 5223734 5224990 . - 0 ID=BALIOE_26050;Name=hypothetical protein;locus_tag=BALIOE_26050;product=hypothetical protein;Parent=BALIOE_26050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10433 c1 Prodigal gene 5225266 5225559 . + . ID=BALIOE_26055_gene;locus_tag=BALIOE_26055 | |
| 10434 c1 Prodigal CDS 5225266 5225559 . + 0 ID=BALIOE_26055;Name=hypothetical protein;locus_tag=BALIOE_26055;product=hypothetical protein;Parent=BALIOE_26055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10435 c1 Prodigal gene 5225603 5227249 . + . ID=BALIOE_26060_gene;locus_tag=BALIOE_26060 | |
| 10436 c1 Prodigal CDS 5225603 5227249 . + 0 ID=BALIOE_26060;Name=hypothetical protein;locus_tag=BALIOE_26060;product=hypothetical protein;Parent=BALIOE_26060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10437 c1 Prodigal gene 5227387 5227740 . + . ID=BALIOE_26065_gene;locus_tag=BALIOE_26065 | |
| 10438 c1 Prodigal CDS 5227387 5227740 . + 0 ID=BALIOE_26065;Name=hypothetical protein;locus_tag=BALIOE_26065;product=hypothetical protein;Parent=BALIOE_26065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10439 c1 Prodigal gene 5227933 5228802 . - . ID=BALIOE_26070_gene;locus_tag=BALIOE_26070 | |
| 10440 c1 Prodigal CDS 5227933 5228802 . - 0 ID=BALIOE_26070;Name=hypothetical protein;locus_tag=BALIOE_26070;product=hypothetical protein;Parent=BALIOE_26070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10441 c1 Prodigal gene 5229037 5230065 . - . ID=BALIOE_26075_gene;locus_tag=BALIOE_26075 | |
| 10442 c1 Prodigal CDS 5229037 5230065 . - 0 ID=BALIOE_26075;Name=hypothetical protein;locus_tag=BALIOE_26075;product=hypothetical protein;Parent=BALIOE_26075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10443 c1 Prodigal gene 5230107 5230673 . + . ID=BALIOE_26080_gene;locus_tag=BALIOE_26080 | |
| 10444 c1 Prodigal CDS 5230107 5230673 . + 0 ID=BALIOE_26080;Name=hypothetical protein;locus_tag=BALIOE_26080;product=hypothetical protein;Parent=BALIOE_26080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10445 c1 Prodigal gene 5230725 5230850 . + . ID=BALIOE_26085_gene;locus_tag=BALIOE_26085 | |
| 10446 c1 Prodigal CDS 5230725 5230850 . + 0 ID=BALIOE_26085;Name=hypothetical protein;locus_tag=BALIOE_26085;product=hypothetical protein;Parent=BALIOE_26085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10447 c1 Prodigal gene 5230961 5231107 . + . ID=BALIOE_26090_gene;locus_tag=BALIOE_26090 | |
| 10448 c1 Prodigal CDS 5230961 5231107 . + 0 ID=BALIOE_26090;Name=hypothetical protein;locus_tag=BALIOE_26090;product=hypothetical protein;Parent=BALIOE_26090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10449 c1 Prodigal gene 5231283 5231600 . + . ID=BALIOE_26095_gene;locus_tag=BALIOE_26095 | |
| 10450 c1 Prodigal CDS 5231283 5231600 . + 0 ID=BALIOE_26095;Name=hypothetical protein;locus_tag=BALIOE_26095;product=hypothetical protein;Parent=BALIOE_26095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10451 c1 Prodigal gene 5231597 5232130 . - . ID=BALIOE_26100_gene;locus_tag=BALIOE_26100 | |
| 10452 c1 Prodigal CDS 5231597 5232130 . - 0 ID=BALIOE_26100;Name=hypothetical protein;locus_tag=BALIOE_26100;product=hypothetical protein;Parent=BALIOE_26100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10453 c1 Prodigal gene 5232218 5233351 . - . ID=BALIOE_26105_gene;locus_tag=BALIOE_26105 | |
| 10454 c1 Prodigal CDS 5232218 5233351 . - 0 ID=BALIOE_26105;Name=hypothetical protein;locus_tag=BALIOE_26105;product=hypothetical protein;Parent=BALIOE_26105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10455 c1 Prodigal gene 5233414 5233773 . - . ID=BALIOE_26110_gene;locus_tag=BALIOE_26110 | |
| 10456 c1 Prodigal CDS 5233414 5233773 . - 0 ID=BALIOE_26110;Name=hypothetical protein;locus_tag=BALIOE_26110;product=hypothetical protein;Parent=BALIOE_26110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10457 c1 Prodigal gene 5233784 5234179 . - . ID=BALIOE_26115_gene;locus_tag=BALIOE_26115 | |
| 10458 c1 Prodigal CDS 5233784 5234179 . - 0 ID=BALIOE_26115;Name=hypothetical protein;locus_tag=BALIOE_26115;product=hypothetical protein;Parent=BALIOE_26115_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10459 c1 Prodigal gene 5234190 5234924 . - . ID=BALIOE_26120_gene;locus_tag=BALIOE_26120 | |
| 10460 c1 Prodigal CDS 5234190 5234924 . - 0 ID=BALIOE_26120;Name=hypothetical protein;locus_tag=BALIOE_26120;product=hypothetical protein;Parent=BALIOE_26120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10461 c1 Prodigal gene 5234917 5236725 . - . ID=BALIOE_26125_gene;locus_tag=BALIOE_26125 | |
| 10462 c1 Prodigal CDS 5234917 5236725 . - 0 ID=BALIOE_26125;Name=hypothetical protein;locus_tag=BALIOE_26125;product=hypothetical protein;Parent=BALIOE_26125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10463 c1 Prodigal gene 5237050 5238027 . + . ID=BALIOE_26130_gene;locus_tag=BALIOE_26130 | |
| 10464 c1 Prodigal CDS 5237050 5238027 . + 0 ID=BALIOE_26130;Name=hypothetical protein;locus_tag=BALIOE_26130;product=hypothetical protein;Parent=BALIOE_26130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10465 c1 Prodigal gene 5238291 5239748 . + . ID=BALIOE_26135_gene;locus_tag=BALIOE_26135 | |
| 10466 c1 Prodigal CDS 5238291 5239748 . + 0 ID=BALIOE_26135;Name=hypothetical protein;locus_tag=BALIOE_26135;product=hypothetical protein;Parent=BALIOE_26135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10467 c1 Prodigal gene 5239899 5243222 . - . ID=BALIOE_26140_gene;locus_tag=BALIOE_26140 | |
| 10468 c1 Prodigal CDS 5239899 5243222 . - 0 ID=BALIOE_26140;Name=hypothetical protein;locus_tag=BALIOE_26140;product=hypothetical protein;Parent=BALIOE_26140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10469 c1 Prodigal gene 5243244 5244212 . - . ID=BALIOE_26145_gene;locus_tag=BALIOE_26145 | |
| 10470 c1 Prodigal CDS 5243244 5244212 . - 0 ID=BALIOE_26145;Name=hypothetical protein;locus_tag=BALIOE_26145;product=hypothetical protein;Parent=BALIOE_26145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10471 c1 Prodigal gene 5244309 5245361 . - . ID=BALIOE_26150_gene;locus_tag=BALIOE_26150 | |
| 10472 c1 Prodigal CDS 5244309 5245361 . - 0 ID=BALIOE_26150;Name=hypothetical protein;locus_tag=BALIOE_26150;product=hypothetical protein;Parent=BALIOE_26150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10473 c1 Prodigal gene 5245456 5246001 . + . ID=BALIOE_26155_gene;locus_tag=BALIOE_26155 | |
| 10474 c1 Prodigal CDS 5245456 5246001 . + 0 ID=BALIOE_26155;Name=hypothetical protein;locus_tag=BALIOE_26155;product=hypothetical protein;Parent=BALIOE_26155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10475 c1 tRNAscan-SE gene 5246212 5246287 . + . ID=BALIOE_26160_gene;locus_tag=BALIOE_26160;gene=Gly_trna | |
| 10476 c1 tRNAscan-SE tRNA 5246212 5246287 . + . ID=BALIOE_26160;Name=tRNA-Gly;locus_tag=BALIOE_26160;product=tRNA-Gly;gene=Gly_trna;Parent=BALIOE_26160_gene;inference=profile:tRNAscan:2.0;Note=SO:0000260 | |
| 10477 c1 tRNAscan-SE gene 5246324 5246399 . + . ID=BALIOE_26165_gene;locus_tag=BALIOE_26165;gene=Gly_trna | |
| 10478 c1 tRNAscan-SE tRNA 5246324 5246399 . + . ID=BALIOE_26165;Name=tRNA-Gly;locus_tag=BALIOE_26165;product=tRNA-Gly;gene=Gly_trna;Parent=BALIOE_26165_gene;inference=profile:tRNAscan:2.0;Note=SO:0000260 | |
| 10479 c1 tRNAscan-SE gene 5246435 5246510 . + . ID=BALIOE_26170_gene;locus_tag=BALIOE_26170;gene=Gly_trna | |
| 10480 c1 tRNAscan-SE tRNA 5246435 5246510 . + . ID=BALIOE_26170;Name=tRNA-Gly;locus_tag=BALIOE_26170;product=tRNA-Gly;gene=Gly_trna;Parent=BALIOE_26170_gene;inference=profile:tRNAscan:2.0;Note=SO:0000260 | |
| 10481 c1 Prodigal gene 5246780 5247919 . - . ID=BALIOE_26175_gene;locus_tag=BALIOE_26175 | |
| 10482 c1 Prodigal CDS 5246780 5247919 . - 0 ID=BALIOE_26175;Name=hypothetical protein;locus_tag=BALIOE_26175;product=hypothetical protein;Parent=BALIOE_26175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10483 c1 Prodigal gene 5247933 5249465 . + . ID=BALIOE_26180_gene;locus_tag=BALIOE_26180 | |
| 10484 c1 Prodigal CDS 5247933 5249465 . + 0 ID=BALIOE_26180;Name=hypothetical protein;locus_tag=BALIOE_26180;product=hypothetical protein;Parent=BALIOE_26180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10485 c1 Prodigal gene 5249437 5249898 . + . ID=BALIOE_26185_gene;locus_tag=BALIOE_26185 | |
| 10486 c1 Prodigal CDS 5249437 5249898 . + 0 ID=BALIOE_26185;Name=hypothetical protein;locus_tag=BALIOE_26185;product=hypothetical protein;Parent=BALIOE_26185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10487 c1 Prodigal gene 5249917 5251254 . + . ID=BALIOE_26190_gene;locus_tag=BALIOE_26190 | |
| 10488 c1 Prodigal CDS 5249917 5251254 . + 0 ID=BALIOE_26190;Name=hypothetical protein;locus_tag=BALIOE_26190;product=hypothetical protein;Parent=BALIOE_26190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10489 c1 Prodigal gene 5251264 5253111 . + . ID=BALIOE_26195_gene;locus_tag=BALIOE_26195 | |
| 10490 c1 Prodigal CDS 5251264 5253111 . + 0 ID=BALIOE_26195;Name=hypothetical protein;locus_tag=BALIOE_26195;product=hypothetical protein;Parent=BALIOE_26195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10491 c1 Prodigal gene 5253104 5254054 . + . ID=BALIOE_26200_gene;locus_tag=BALIOE_26200 | |
| 10492 c1 Prodigal CDS 5253104 5254054 . + 0 ID=BALIOE_26200;Name=hypothetical protein;locus_tag=BALIOE_26200;product=hypothetical protein;Parent=BALIOE_26200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10493 c1 Prodigal gene 5254140 5254448 . + . ID=BALIOE_26205_gene;locus_tag=BALIOE_26205 | |
| 10494 c1 Prodigal CDS 5254140 5254448 . + 0 ID=BALIOE_26205;Name=hypothetical protein;locus_tag=BALIOE_26205;product=hypothetical protein;Parent=BALIOE_26205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10495 c1 Prodigal gene 5254525 5255805 . + . ID=BALIOE_26210_gene;locus_tag=BALIOE_26210 | |
| 10496 c1 Prodigal CDS 5254525 5255805 . + 0 ID=BALIOE_26210;Name=hypothetical protein;locus_tag=BALIOE_26210;product=hypothetical protein;Parent=BALIOE_26210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10497 c1 Prodigal gene 5255891 5257150 . + . ID=BALIOE_26215_gene;locus_tag=BALIOE_26215 | |
| 10498 c1 Prodigal CDS 5255891 5257150 . + 0 ID=BALIOE_26215;Name=hypothetical protein;locus_tag=BALIOE_26215;product=hypothetical protein;Parent=BALIOE_26215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10499 c1 Prodigal gene 5257153 5258157 . + . ID=BALIOE_26220_gene;locus_tag=BALIOE_26220 | |
| 10500 c1 Prodigal CDS 5257153 5258157 . + 0 ID=BALIOE_26220;Name=hypothetical protein;locus_tag=BALIOE_26220;product=hypothetical protein;Parent=BALIOE_26220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10501 c1 Prodigal gene 5258239 5258436 . + . ID=BALIOE_26225_gene;locus_tag=BALIOE_26225 | |
| 10502 c1 Prodigal CDS 5258239 5258436 . + 0 ID=BALIOE_26225;Name=hypothetical protein;locus_tag=BALIOE_26225;product=hypothetical protein;Parent=BALIOE_26225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10503 c1 Prodigal gene 5258540 5259838 . + . ID=BALIOE_26230_gene;locus_tag=BALIOE_26230 | |
| 10504 c1 Prodigal CDS 5258540 5259838 . + 0 ID=BALIOE_26230;Name=hypothetical protein;locus_tag=BALIOE_26230;product=hypothetical protein;Parent=BALIOE_26230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10505 c1 Prodigal gene 5260043 5260468 . + . ID=BALIOE_26235_gene;locus_tag=BALIOE_26235 | |
| 10506 c1 Prodigal CDS 5260043 5260468 . + 0 ID=BALIOE_26235;Name=hypothetical protein;locus_tag=BALIOE_26235;product=hypothetical protein;Parent=BALIOE_26235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10507 c1 Prodigal gene 5260507 5262948 . + . ID=BALIOE_26240_gene;locus_tag=BALIOE_26240 | |
| 10508 c1 Prodigal CDS 5260507 5262948 . + 0 ID=BALIOE_26240;Name=hypothetical protein;locus_tag=BALIOE_26240;product=hypothetical protein;Parent=BALIOE_26240_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10509 c1 Prodigal gene 5263129 5263860 . + . ID=BALIOE_26245_gene;locus_tag=BALIOE_26245 | |
| 10510 c1 Prodigal CDS 5263129 5263860 . + 0 ID=BALIOE_26245;Name=hypothetical protein;locus_tag=BALIOE_26245;product=hypothetical protein;Parent=BALIOE_26245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10511 c1 Prodigal gene 5263987 5264388 . + . ID=BALIOE_26250_gene;locus_tag=BALIOE_26250 | |
| 10512 c1 Prodigal CDS 5263987 5264388 . + 0 ID=BALIOE_26250;Name=hypothetical protein;locus_tag=BALIOE_26250;product=hypothetical protein;Parent=BALIOE_26250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10513 c1 Prodigal gene 5264407 5265105 . + . ID=BALIOE_26255_gene;locus_tag=BALIOE_26255 | |
| 10514 c1 Prodigal CDS 5264407 5265105 . + 0 ID=BALIOE_26255;Name=hypothetical protein;locus_tag=BALIOE_26255;product=hypothetical protein;Parent=BALIOE_26255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10515 c1 Prodigal gene 5265156 5265815 . + . ID=BALIOE_26260_gene;locus_tag=BALIOE_26260 | |
| 10516 c1 Prodigal CDS 5265156 5265815 . + 0 ID=BALIOE_26260;Name=hypothetical protein;locus_tag=BALIOE_26260;product=hypothetical protein;Parent=BALIOE_26260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10517 c1 Prodigal gene 5265833 5266231 . + . ID=BALIOE_26265_gene;locus_tag=BALIOE_26265 | |
| 10518 c1 Prodigal CDS 5265833 5266231 . + 0 ID=BALIOE_26265;Name=hypothetical protein;locus_tag=BALIOE_26265;product=hypothetical protein;Parent=BALIOE_26265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10519 c1 Prodigal gene 5266241 5266879 . + . ID=BALIOE_26270_gene;locus_tag=BALIOE_26270 | |
| 10520 c1 Prodigal CDS 5266241 5266879 . + 0 ID=BALIOE_26270;Name=hypothetical protein;locus_tag=BALIOE_26270;product=hypothetical protein;Parent=BALIOE_26270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10521 c1 Prodigal gene 5266882 5268045 . + . ID=BALIOE_26275_gene;locus_tag=BALIOE_26275 | |
| 10522 c1 Prodigal CDS 5266882 5268045 . + 0 ID=BALIOE_26275;Name=hypothetical protein;locus_tag=BALIOE_26275;product=hypothetical protein;Parent=BALIOE_26275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10523 c1 Prodigal gene 5268129 5269754 . + . ID=BALIOE_26280_gene;locus_tag=BALIOE_26280 | |
| 10524 c1 Prodigal CDS 5268129 5269754 . + 0 ID=BALIOE_26280;Name=hypothetical protein;locus_tag=BALIOE_26280;product=hypothetical protein;Parent=BALIOE_26280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10525 c1 Prodigal gene 5269871 5270146 . - . ID=BALIOE_26285_gene;locus_tag=BALIOE_26285 | |
| 10526 c1 Prodigal CDS 5269871 5270146 . - 0 ID=BALIOE_26285;Name=hypothetical protein;locus_tag=BALIOE_26285;product=hypothetical protein;Parent=BALIOE_26285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10527 c1 Prodigal gene 5270295 5270624 . - . ID=BALIOE_26290_gene;locus_tag=BALIOE_26290 | |
| 10528 c1 Prodigal CDS 5270295 5270624 . - 0 ID=BALIOE_26290;Name=hypothetical protein;locus_tag=BALIOE_26290;product=hypothetical protein;Parent=BALIOE_26290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10529 c1 Prodigal gene 5270806 5271555 . + . ID=BALIOE_26295_gene;locus_tag=BALIOE_26295 | |
| 10530 c1 Prodigal CDS 5270806 5271555 . + 0 ID=BALIOE_26295;Name=hypothetical protein;locus_tag=BALIOE_26295;product=hypothetical protein;Parent=BALIOE_26295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10531 c1 Prodigal gene 5271552 5272307 . - . ID=BALIOE_26300_gene;locus_tag=BALIOE_26300 | |
| 10532 c1 Prodigal CDS 5271552 5272307 . - 0 ID=BALIOE_26300;Name=hypothetical protein;locus_tag=BALIOE_26300;product=hypothetical protein;Parent=BALIOE_26300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10533 c1 Prodigal gene 5272415 5273479 . - . ID=BALIOE_26305_gene;locus_tag=BALIOE_26305 | |
| 10534 c1 Prodigal CDS 5272415 5273479 . - 0 ID=BALIOE_26305;Name=hypothetical protein;locus_tag=BALIOE_26305;product=hypothetical protein;Parent=BALIOE_26305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10535 c1 Prodigal gene 5273834 5275231 . + . ID=BALIOE_26310_gene;locus_tag=BALIOE_26310 | |
| 10536 c1 Prodigal CDS 5273834 5275231 . + 0 ID=BALIOE_26310;Name=hypothetical protein;locus_tag=BALIOE_26310;product=hypothetical protein;Parent=BALIOE_26310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10537 c1 Prodigal gene 5275247 5275552 . + . ID=BALIOE_26315_gene;locus_tag=BALIOE_26315 | |
| 10538 c1 Prodigal CDS 5275247 5275552 . + 0 ID=BALIOE_26315;Name=hypothetical protein;locus_tag=BALIOE_26315;product=hypothetical protein;Parent=BALIOE_26315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10539 c1 Prodigal gene 5275562 5276026 . + . ID=BALIOE_26320_gene;locus_tag=BALIOE_26320 | |
| 10540 c1 Prodigal CDS 5275562 5276026 . + 0 ID=BALIOE_26320;Name=hypothetical protein;locus_tag=BALIOE_26320;product=hypothetical protein;Parent=BALIOE_26320_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10541 c1 Prodigal gene 5276040 5276690 . + . ID=BALIOE_26325_gene;locus_tag=BALIOE_26325 | |
| 10542 c1 Prodigal CDS 5276040 5276690 . + 0 ID=BALIOE_26325;Name=hypothetical protein;locus_tag=BALIOE_26325;product=hypothetical protein;Parent=BALIOE_26325_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10543 c1 Prodigal gene 5276700 5277554 . + . ID=BALIOE_26330_gene;locus_tag=BALIOE_26330 | |
| 10544 c1 Prodigal CDS 5276700 5277554 . + 0 ID=BALIOE_26330;Name=hypothetical protein;locus_tag=BALIOE_26330;product=hypothetical protein;Parent=BALIOE_26330_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10545 c1 Prodigal gene 5277554 5278240 . + . ID=BALIOE_26335_gene;locus_tag=BALIOE_26335 | |
| 10546 c1 Prodigal CDS 5277554 5278240 . + 0 ID=BALIOE_26335;Name=hypothetical protein;locus_tag=BALIOE_26335;product=hypothetical protein;Parent=BALIOE_26335_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10547 c1 Prodigal gene 5278369 5278644 . - . ID=BALIOE_26340_gene;locus_tag=BALIOE_26340 | |
| 10548 c1 Prodigal CDS 5278369 5278644 . - 0 ID=BALIOE_26340;Name=hypothetical protein;locus_tag=BALIOE_26340;product=hypothetical protein;Parent=BALIOE_26340_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10549 c1 Prodigal gene 5278971 5279366 . + . ID=BALIOE_26345_gene;locus_tag=BALIOE_26345 | |
| 10550 c1 Prodigal CDS 5278971 5279366 . + 0 ID=BALIOE_26345;Name=hypothetical protein;locus_tag=BALIOE_26345;product=hypothetical protein;Parent=BALIOE_26345_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10551 c1 Prodigal gene 5279373 5279687 . + . ID=BALIOE_26350_gene;locus_tag=BALIOE_26350 | |
| 10552 c1 Prodigal CDS 5279373 5279687 . + 0 ID=BALIOE_26350;Name=hypothetical protein;locus_tag=BALIOE_26350;product=hypothetical protein;Parent=BALIOE_26350_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10553 c1 Prodigal gene 5279692 5279919 . + . ID=BALIOE_26355_gene;locus_tag=BALIOE_26355 | |
| 10554 c1 Prodigal CDS 5279692 5279919 . + 0 ID=BALIOE_26355;Name=hypothetical protein;locus_tag=BALIOE_26355;product=hypothetical protein;Parent=BALIOE_26355_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10555 c1 Prodigal gene 5279961 5280410 . + . ID=BALIOE_26360_gene;locus_tag=BALIOE_26360 | |
| 10556 c1 Prodigal CDS 5279961 5280410 . + 0 ID=BALIOE_26360;Name=hypothetical protein;locus_tag=BALIOE_26360;product=hypothetical protein;Parent=BALIOE_26360_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10557 c1 Prodigal gene 5280481 5281038 . - . ID=BALIOE_26365_gene;locus_tag=BALIOE_26365 | |
| 10558 c1 Prodigal CDS 5280481 5281038 . - 0 ID=BALIOE_26365;Name=hypothetical protein;locus_tag=BALIOE_26365;product=hypothetical protein;Parent=BALIOE_26365_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10559 c1 Prodigal gene 5281898 5282329 . - . ID=BALIOE_26370_gene;locus_tag=BALIOE_26370 | |
| 10560 c1 Prodigal CDS 5281898 5282329 . - 0 ID=BALIOE_26370;Name=hypothetical protein;locus_tag=BALIOE_26370;product=hypothetical protein;Parent=BALIOE_26370_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10561 c1 Prodigal gene 5282397 5283545 . + . ID=BALIOE_26375_gene;locus_tag=BALIOE_26375 | |
| 10562 c1 Prodigal CDS 5282397 5283545 . + 0 ID=BALIOE_26375;Name=hypothetical protein;locus_tag=BALIOE_26375;product=hypothetical protein;Parent=BALIOE_26375_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10563 c1 Prodigal gene 5283680 5284318 . - . ID=BALIOE_26380_gene;locus_tag=BALIOE_26380 | |
| 10564 c1 Prodigal CDS 5283680 5284318 . - 0 ID=BALIOE_26380;Name=hypothetical protein;locus_tag=BALIOE_26380;product=hypothetical protein;Parent=BALIOE_26380_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10565 c1 Prodigal gene 5284536 5285156 . + . ID=BALIOE_26385_gene;locus_tag=BALIOE_26385 | |
| 10566 c1 Prodigal CDS 5284536 5285156 . + 0 ID=BALIOE_26385;Name=hypothetical protein;locus_tag=BALIOE_26385;product=hypothetical protein;Parent=BALIOE_26385_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10567 c1 Prodigal gene 5285465 5286877 . + . ID=BALIOE_26390_gene;locus_tag=BALIOE_26390 | |
| 10568 c1 Prodigal CDS 5285465 5286877 . + 0 ID=BALIOE_26390;Name=hypothetical protein;locus_tag=BALIOE_26390;product=hypothetical protein;Parent=BALIOE_26390_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10569 c1 Prodigal gene 5286922 5287584 . - . ID=BALIOE_26395_gene;locus_tag=BALIOE_26395 | |
| 10570 c1 Prodigal CDS 5286922 5287584 . - 0 ID=BALIOE_26395;Name=hypothetical protein;locus_tag=BALIOE_26395;product=hypothetical protein;Parent=BALIOE_26395_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10571 c1 Prodigal gene 5287692 5288657 . - . ID=BALIOE_26400_gene;locus_tag=BALIOE_26400 | |
| 10572 c1 Prodigal CDS 5287692 5288657 . - 0 ID=BALIOE_26400;Name=hypothetical protein;locus_tag=BALIOE_26400;product=hypothetical protein;Parent=BALIOE_26400_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10573 c1 Prodigal gene 5288765 5289625 . - . ID=BALIOE_26405_gene;locus_tag=BALIOE_26405 | |
| 10574 c1 Prodigal CDS 5288765 5289625 . - 0 ID=BALIOE_26405;Name=hypothetical protein;locus_tag=BALIOE_26405;product=hypothetical protein;Parent=BALIOE_26405_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10575 c1 Prodigal gene 5289714 5290094 . + . ID=BALIOE_26410_gene;locus_tag=BALIOE_26410 | |
| 10576 c1 Prodigal CDS 5289714 5290094 . + 0 ID=BALIOE_26410;Name=hypothetical protein;locus_tag=BALIOE_26410;product=hypothetical protein;Parent=BALIOE_26410_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10577 c1 Prodigal gene 5290212 5292155 . - . ID=BALIOE_26415_gene;locus_tag=BALIOE_26415 | |
| 10578 c1 Prodigal CDS 5290212 5292155 . - 0 ID=BALIOE_26415;Name=hypothetical protein;locus_tag=BALIOE_26415;product=hypothetical protein;Parent=BALIOE_26415_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10579 c1 Prodigal gene 5292345 5293085 . + . ID=BALIOE_26420_gene;locus_tag=BALIOE_26420 | |
| 10580 c1 Prodigal CDS 5292345 5293085 . + 0 ID=BALIOE_26420;Name=hypothetical protein;locus_tag=BALIOE_26420;product=hypothetical protein;Parent=BALIOE_26420_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10581 c1 Prodigal gene 5293297 5294235 . + . ID=BALIOE_26425_gene;locus_tag=BALIOE_26425 | |
| 10582 c1 Prodigal CDS 5293297 5294235 . + 0 ID=BALIOE_26425;Name=hypothetical protein;locus_tag=BALIOE_26425;product=hypothetical protein;Parent=BALIOE_26425_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10583 c1 Prodigal gene 5294298 5294852 . - . ID=BALIOE_26430_gene;locus_tag=BALIOE_26430 | |
| 10584 c1 Prodigal CDS 5294298 5294852 . - 0 ID=BALIOE_26430;Name=hypothetical protein;locus_tag=BALIOE_26430;product=hypothetical protein;Parent=BALIOE_26430_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10585 c1 Prodigal gene 5295177 5295383 . + . ID=BALIOE_26435_gene;locus_tag=BALIOE_26435 | |
| 10586 c1 Prodigal CDS 5295177 5295383 . + 0 ID=BALIOE_26435;Name=hypothetical protein;locus_tag=BALIOE_26435;product=hypothetical protein;Parent=BALIOE_26435_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10587 c1 Prodigal gene 5295479 5296822 . - . ID=BALIOE_26440_gene;locus_tag=BALIOE_26440 | |
| 10588 c1 Prodigal CDS 5295479 5296822 . - 0 ID=BALIOE_26440;Name=hypothetical protein;locus_tag=BALIOE_26440;product=hypothetical protein;Parent=BALIOE_26440_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10589 c1 Prodigal gene 5297145 5297783 . - . ID=BALIOE_26445_gene;locus_tag=BALIOE_26445 | |
| 10590 c1 Prodigal CDS 5297145 5297783 . - 0 ID=BALIOE_26445;Name=hypothetical protein;locus_tag=BALIOE_26445;product=hypothetical protein;Parent=BALIOE_26445_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10591 c1 Prodigal gene 5297989 5299722 . + . ID=BALIOE_26450_gene;locus_tag=BALIOE_26450 | |
| 10592 c1 Prodigal CDS 5297989 5299722 . + 0 ID=BALIOE_26450;Name=hypothetical protein;locus_tag=BALIOE_26450;product=hypothetical protein;Parent=BALIOE_26450_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10593 c1 Prodigal gene 5299719 5303498 . + . ID=BALIOE_26455_gene;locus_tag=BALIOE_26455 | |
| 10594 c1 Prodigal CDS 5299719 5303498 . + 0 ID=BALIOE_26455;Name=hypothetical protein;locus_tag=BALIOE_26455;product=hypothetical protein;Parent=BALIOE_26455_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10595 c1 Prodigal gene 5303501 5303842 . + . ID=BALIOE_26460_gene;locus_tag=BALIOE_26460 | |
| 10596 c1 Prodigal CDS 5303501 5303842 . + 0 ID=BALIOE_26460;Name=hypothetical protein;locus_tag=BALIOE_26460;product=hypothetical protein;Parent=BALIOE_26460_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10597 c1 Prodigal gene 5304054 5304305 . + . ID=BALIOE_26465_gene;locus_tag=BALIOE_26465 | |
| 10598 c1 Prodigal CDS 5304054 5304305 . + 0 ID=BALIOE_26465;Name=hypothetical protein;locus_tag=BALIOE_26465;product=hypothetical protein;Parent=BALIOE_26465_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10599 c1 Prodigal gene 5304335 5304649 . + . ID=BALIOE_26470_gene;locus_tag=BALIOE_26470 | |
| 10600 c1 Prodigal CDS 5304335 5304649 . + 0 ID=BALIOE_26470;Name=hypothetical protein;locus_tag=BALIOE_26470;product=hypothetical protein;Parent=BALIOE_26470_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10601 c1 Prodigal gene 5304729 5305259 . - . ID=BALIOE_26475_gene;locus_tag=BALIOE_26475 | |
| 10602 c1 Prodigal CDS 5304729 5305259 . - 0 ID=BALIOE_26475;Name=hypothetical protein;locus_tag=BALIOE_26475;product=hypothetical protein;Parent=BALIOE_26475_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10603 c1 Prodigal gene 5305569 5306525 . + . ID=BALIOE_26480_gene;locus_tag=BALIOE_26480 | |
| 10604 c1 Prodigal CDS 5305569 5306525 . + 0 ID=BALIOE_26480;Name=hypothetical protein;locus_tag=BALIOE_26480;product=hypothetical protein;Parent=BALIOE_26480_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10605 c1 Infernal gene 5306554 5306632 . + . ID=BALIOE_26485_gene;locus_tag=BALIOE_26485;gene=naRNA4 | |
| 10606 c1 Infernal ncRNA 5306554 5306632 4.6e-10 + . ID=BALIOE_26485;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_26485;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_26485_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10607 c1 Prodigal gene 5306665 5308167 . + . ID=BALIOE_26490_gene;locus_tag=BALIOE_26490 | |
| 10608 c1 Prodigal CDS 5306665 5308167 . + 0 ID=BALIOE_26490;Name=hypothetical protein;locus_tag=BALIOE_26490;product=hypothetical protein;Parent=BALIOE_26490_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10609 c1 Prodigal gene 5308181 5309203 . + . ID=BALIOE_26495_gene;locus_tag=BALIOE_26495 | |
| 10610 c1 Prodigal CDS 5308181 5309203 . + 0 ID=BALIOE_26495;Name=hypothetical protein;locus_tag=BALIOE_26495;product=hypothetical protein;Parent=BALIOE_26495_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10611 c1 Prodigal gene 5309190 5310185 . + . ID=BALIOE_26500_gene;locus_tag=BALIOE_26500 | |
| 10612 c1 Prodigal CDS 5309190 5310185 . + 0 ID=BALIOE_26500;Name=hypothetical protein;locus_tag=BALIOE_26500;product=hypothetical protein;Parent=BALIOE_26500_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10613 c1 Prodigal gene 5310218 5311216 . - . ID=BALIOE_26505_gene;locus_tag=BALIOE_26505 | |
| 10614 c1 Prodigal CDS 5310218 5311216 . - 0 ID=BALIOE_26505;Name=hypothetical protein;locus_tag=BALIOE_26505;product=hypothetical protein;Parent=BALIOE_26505_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10615 c1 Prodigal gene 5311392 5312765 . + . ID=BALIOE_26510_gene;locus_tag=BALIOE_26510 | |
| 10616 c1 Prodigal CDS 5311392 5312765 . + 0 ID=BALIOE_26510;Name=hypothetical protein;locus_tag=BALIOE_26510;product=hypothetical protein;Parent=BALIOE_26510_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10617 c1 Infernal gene 5312795 5312872 . + . ID=BALIOE_26515_gene;locus_tag=BALIOE_26515;gene=naRNA4 | |
| 10618 c1 Infernal ncRNA 5312795 5312872 6e-13 + . ID=BALIOE_26515;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_26515;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_26515_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10619 c1 Prodigal gene 5312921 5313472 . - . ID=BALIOE_26520_gene;locus_tag=BALIOE_26520 | |
| 10620 c1 Prodigal CDS 5312921 5313472 . - 0 ID=BALIOE_26520;Name=hypothetical protein;locus_tag=BALIOE_26520;product=hypothetical protein;Parent=BALIOE_26520_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10621 c1 Prodigal gene 5313566 5314918 . + . ID=BALIOE_26525_gene;locus_tag=BALIOE_26525 | |
| 10622 c1 Prodigal CDS 5313566 5314918 . + 0 ID=BALIOE_26525;Name=hypothetical protein;locus_tag=BALIOE_26525;product=hypothetical protein;Parent=BALIOE_26525_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10623 c1 Prodigal gene 5315102 5315488 . + . ID=BALIOE_26530_gene;locus_tag=BALIOE_26530 | |
| 10624 c1 Prodigal CDS 5315102 5315488 . + 0 ID=BALIOE_26530;Name=hypothetical protein;locus_tag=BALIOE_26530;product=hypothetical protein;Parent=BALIOE_26530_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10625 c1 Prodigal gene 5315533 5315997 . - . ID=BALIOE_26535_gene;locus_tag=BALIOE_26535 | |
| 10626 c1 Prodigal CDS 5315533 5315997 . - 0 ID=BALIOE_26535;Name=hypothetical protein;locus_tag=BALIOE_26535;product=hypothetical protein;Parent=BALIOE_26535_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10627 c1 Infernal gene 5316101 5316171 . + . ID=BALIOE_26540_gene;locus_tag=BALIOE_26540;gene=naRNA4 | |
| 10628 c1 Infernal ncRNA 5316101 5316171 2.9e-08 + . ID=BALIOE_26540;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_26540;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_26540_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10629 c1 Prodigal gene 5316187 5318325 . - . ID=BALIOE_26545_gene;locus_tag=BALIOE_26545 | |
| 10630 c1 Prodigal CDS 5316187 5318325 . - 0 ID=BALIOE_26545;Name=hypothetical protein;locus_tag=BALIOE_26545;product=hypothetical protein;Parent=BALIOE_26545_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10631 c1 Prodigal gene 5318719 5320374 . - . ID=BALIOE_26550_gene;locus_tag=BALIOE_26550 | |
| 10632 c1 Prodigal CDS 5318719 5320374 . - 0 ID=BALIOE_26550;Name=hypothetical protein;locus_tag=BALIOE_26550;product=hypothetical protein;Parent=BALIOE_26550_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10633 c1 Prodigal gene 5320424 5321845 . - . ID=BALIOE_26555_gene;locus_tag=BALIOE_26555 | |
| 10634 c1 Prodigal CDS 5320424 5321845 . - 0 ID=BALIOE_26555;Name=hypothetical protein;locus_tag=BALIOE_26555;product=hypothetical protein;Parent=BALIOE_26555_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10635 c1 Prodigal gene 5321964 5322911 . - . ID=BALIOE_26560_gene;locus_tag=BALIOE_26560 | |
| 10636 c1 Prodigal CDS 5321964 5322911 . - 0 ID=BALIOE_26560;Name=hypothetical protein;locus_tag=BALIOE_26560;product=hypothetical protein;Parent=BALIOE_26560_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10637 c1 Prodigal gene 5323290 5325986 . + . ID=BALIOE_26565_gene;locus_tag=BALIOE_26565 | |
| 10638 c1 Prodigal CDS 5323290 5325986 . + 0 ID=BALIOE_26565;Name=hypothetical protein;locus_tag=BALIOE_26565;product=hypothetical protein;Parent=BALIOE_26565_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10639 c1 Prodigal gene 5326192 5326578 . - . ID=BALIOE_26570_gene;locus_tag=BALIOE_26570 | |
| 10640 c1 Prodigal CDS 5326192 5326578 . - 0 ID=BALIOE_26570;Name=hypothetical protein;locus_tag=BALIOE_26570;product=hypothetical protein;Parent=BALIOE_26570_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10641 c1 Prodigal gene 5326651 5327112 . - . ID=BALIOE_26575_gene;locus_tag=BALIOE_26575 | |
| 10642 c1 Prodigal CDS 5326651 5327112 . - 0 ID=BALIOE_26575;Name=hypothetical protein;locus_tag=BALIOE_26575;product=hypothetical protein;Parent=BALIOE_26575_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10643 c1 Prodigal gene 5327125 5328060 . - . ID=BALIOE_26580_gene;locus_tag=BALIOE_26580 | |
| 10644 c1 Prodigal CDS 5327125 5328060 . - 0 ID=BALIOE_26580;Name=hypothetical protein;locus_tag=BALIOE_26580;product=hypothetical protein;Parent=BALIOE_26580_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10645 c1 Prodigal gene 5328479 5328874 . - . ID=BALIOE_26585_gene;locus_tag=BALIOE_26585 | |
| 10646 c1 Prodigal CDS 5328479 5328874 . - 0 ID=BALIOE_26585;Name=hypothetical protein;locus_tag=BALIOE_26585;product=hypothetical protein;Parent=BALIOE_26585_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10647 c1 Prodigal gene 5329005 5329718 . - . ID=BALIOE_26590_gene;locus_tag=BALIOE_26590 | |
| 10648 c1 Prodigal CDS 5329005 5329718 . - 0 ID=BALIOE_26590;Name=hypothetical protein;locus_tag=BALIOE_26590;product=hypothetical protein;Parent=BALIOE_26590_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10649 c1 Prodigal gene 5329789 5330382 . + . ID=BALIOE_26595_gene;locus_tag=BALIOE_26595 | |
| 10650 c1 Prodigal CDS 5329789 5330382 . + 0 ID=BALIOE_26595;Name=hypothetical protein;locus_tag=BALIOE_26595;product=hypothetical protein;Parent=BALIOE_26595_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10651 c1 Prodigal gene 5330527 5330979 . + . ID=BALIOE_26600_gene;locus_tag=BALIOE_26600 | |
| 10652 c1 Prodigal CDS 5330527 5330979 . + 0 ID=BALIOE_26600;Name=hypothetical protein;locus_tag=BALIOE_26600;product=hypothetical protein;Parent=BALIOE_26600_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10653 c1 Prodigal gene 5331102 5332874 . + . ID=BALIOE_26605_gene;locus_tag=BALIOE_26605 | |
| 10654 c1 Prodigal CDS 5331102 5332874 . + 0 ID=BALIOE_26605;Name=hypothetical protein;locus_tag=BALIOE_26605;product=hypothetical protein;Parent=BALIOE_26605_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10655 c1 Prodigal gene 5332931 5333935 . - . ID=BALIOE_26610_gene;locus_tag=BALIOE_26610 | |
| 10656 c1 Prodigal CDS 5332931 5333935 . - 0 ID=BALIOE_26610;Name=hypothetical protein;locus_tag=BALIOE_26610;product=hypothetical protein;Parent=BALIOE_26610_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10657 c1 Prodigal gene 5334097 5334513 . + . ID=BALIOE_26615_gene;locus_tag=BALIOE_26615 | |
| 10658 c1 Prodigal CDS 5334097 5334513 . + 0 ID=BALIOE_26615;Name=hypothetical protein;locus_tag=BALIOE_26615;product=hypothetical protein;Parent=BALIOE_26615_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10659 c1 Prodigal gene 5334559 5335062 . - . ID=BALIOE_26620_gene;locus_tag=BALIOE_26620 | |
| 10660 c1 Prodigal CDS 5334559 5335062 . - 0 ID=BALIOE_26620;Name=hypothetical protein;locus_tag=BALIOE_26620;product=hypothetical protein;Parent=BALIOE_26620_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10661 c1 Prodigal gene 5335255 5336451 . + . ID=BALIOE_26625_gene;locus_tag=BALIOE_26625 | |
| 10662 c1 Prodigal CDS 5335255 5336451 . + 0 ID=BALIOE_26625;Name=hypothetical protein;locus_tag=BALIOE_26625;product=hypothetical protein;Parent=BALIOE_26625_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10663 c1 Prodigal gene 5336506 5339361 . - . ID=BALIOE_26630_gene;locus_tag=BALIOE_26630 | |
| 10664 c1 Prodigal CDS 5336506 5339361 . - 0 ID=BALIOE_26630;Name=hypothetical protein;locus_tag=BALIOE_26630;product=hypothetical protein;Parent=BALIOE_26630_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10665 c1 Prodigal gene 5339361 5339804 . - . ID=BALIOE_26635_gene;locus_tag=BALIOE_26635 | |
| 10666 c1 Prodigal CDS 5339361 5339804 . - 0 ID=BALIOE_26635;Name=hypothetical protein;locus_tag=BALIOE_26635;product=hypothetical protein;Parent=BALIOE_26635_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10667 c1 Infernal gene 5339912 5339987 . + . ID=BALIOE_26640_gene;locus_tag=BALIOE_26640;gene=naRNA4 | |
| 10668 c1 Infernal ncRNA 5339912 5339987 1.8e-11 + . ID=BALIOE_26640;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_26640;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_26640_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10669 c1 Infernal gene 5340008 5340083 . + . ID=BALIOE_26645_gene;locus_tag=BALIOE_26645;gene=naRNA4 | |
| 10670 c1 Infernal ncRNA 5340008 5340083 2.9e-12 + . ID=BALIOE_26645;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_26645;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_26645_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10671 c1 Prodigal gene 5340158 5341669 . - . ID=BALIOE_26650_gene;locus_tag=BALIOE_26650 | |
| 10672 c1 Prodigal CDS 5340158 5341669 . - 0 ID=BALIOE_26650;Name=hypothetical protein;locus_tag=BALIOE_26650;product=hypothetical protein;Parent=BALIOE_26650_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10673 c1 Prodigal gene 5341936 5343036 . + . ID=BALIOE_26655_gene;locus_tag=BALIOE_26655 | |
| 10674 c1 Prodigal CDS 5341936 5343036 . + 0 ID=BALIOE_26655;Name=hypothetical protein;locus_tag=BALIOE_26655;product=hypothetical protein;Parent=BALIOE_26655_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10675 c1 Prodigal gene 5343036 5344118 . + . ID=BALIOE_26660_gene;locus_tag=BALIOE_26660 | |
| 10676 c1 Prodigal CDS 5343036 5344118 . + 0 ID=BALIOE_26660;Name=hypothetical protein;locus_tag=BALIOE_26660;product=hypothetical protein;Parent=BALIOE_26660_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10677 c1 Prodigal gene 5344279 5345781 . - . ID=BALIOE_26665_gene;locus_tag=BALIOE_26665 | |
| 10678 c1 Prodigal CDS 5344279 5345781 . - 0 ID=BALIOE_26665;Name=hypothetical protein;locus_tag=BALIOE_26665;product=hypothetical protein;Parent=BALIOE_26665_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10679 c1 Prodigal gene 5345911 5346930 . - . ID=BALIOE_26670_gene;locus_tag=BALIOE_26670 | |
| 10680 c1 Prodigal CDS 5345911 5346930 . - 0 ID=BALIOE_26670;Name=hypothetical protein;locus_tag=BALIOE_26670;product=hypothetical protein;Parent=BALIOE_26670_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10681 c1 tRNAscan-SE gene 5347126 5347210 . + . ID=BALIOE_26675_gene;locus_tag=BALIOE_26675;gene=Leu_trna | |
| 10682 c1 tRNAscan-SE tRNA 5347126 5347210 . + . ID=BALIOE_26675;Name=tRNA-Leu;locus_tag=BALIOE_26675;product=tRNA-Leu;gene=Leu_trna;Parent=BALIOE_26675_gene;inference=profile:tRNAscan:2.0;Note=SO:0000264 | |
| 10683 c1 Prodigal gene 5347301 5349250 . + . ID=BALIOE_26680_gene;locus_tag=BALIOE_26680 | |
| 10684 c1 Prodigal CDS 5347301 5349250 . + 0 ID=BALIOE_26680;Name=hypothetical protein;locus_tag=BALIOE_26680;product=hypothetical protein;Parent=BALIOE_26680_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10685 c1 Prodigal gene 5349450 5349776 . + . ID=BALIOE_26685_gene;locus_tag=BALIOE_26685 | |
| 10686 c1 Prodigal CDS 5349450 5349776 . + 0 ID=BALIOE_26685;Name=hypothetical protein;locus_tag=BALIOE_26685;product=hypothetical protein;Parent=BALIOE_26685_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10687 c1 Prodigal gene 5349776 5350663 . + . ID=BALIOE_26690_gene;locus_tag=BALIOE_26690 | |
| 10688 c1 Prodigal CDS 5349776 5350663 . + 0 ID=BALIOE_26690;Name=hypothetical protein;locus_tag=BALIOE_26690;product=hypothetical protein;Parent=BALIOE_26690_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10689 c1 Prodigal gene 5350846 5351223 . - . ID=BALIOE_26695_gene;locus_tag=BALIOE_26695 | |
| 10690 c1 Prodigal CDS 5350846 5351223 . - 0 ID=BALIOE_26695;Name=hypothetical protein;locus_tag=BALIOE_26695;product=hypothetical protein;Parent=BALIOE_26695_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10691 c1 Prodigal gene 5351345 5351677 . - . ID=BALIOE_26700_gene;locus_tag=BALIOE_26700 | |
| 10692 c1 Prodigal CDS 5351345 5351677 . - 0 ID=BALIOE_26700;Name=hypothetical protein;locus_tag=BALIOE_26700;product=hypothetical protein;Parent=BALIOE_26700_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10693 c1 Prodigal gene 5352681 5353148 . - . ID=BALIOE_26705_gene;locus_tag=BALIOE_26705 | |
| 10694 c1 Prodigal CDS 5352681 5353148 . - 0 ID=BALIOE_26705;Name=hypothetical protein;locus_tag=BALIOE_26705;product=hypothetical protein;Parent=BALIOE_26705_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10695 c1 Prodigal gene 5353341 5353910 . + . ID=BALIOE_26710_gene;locus_tag=BALIOE_26710 | |
| 10696 c1 Prodigal CDS 5353341 5353910 . + 0 ID=BALIOE_26710;Name=hypothetical protein;locus_tag=BALIOE_26710;product=hypothetical protein;Parent=BALIOE_26710_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10697 c1 Prodigal gene 5354109 5355425 . - . ID=BALIOE_26715_gene;locus_tag=BALIOE_26715 | |
| 10698 c1 Prodigal CDS 5354109 5355425 . - 0 ID=BALIOE_26715;Name=hypothetical protein;locus_tag=BALIOE_26715;product=hypothetical protein;Parent=BALIOE_26715_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10699 c1 Prodigal gene 5355577 5356350 . - . ID=BALIOE_26720_gene;locus_tag=BALIOE_26720 | |
| 10700 c1 Prodigal CDS 5355577 5356350 . - 0 ID=BALIOE_26720;Name=hypothetical protein;locus_tag=BALIOE_26720;product=hypothetical protein;Parent=BALIOE_26720_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10701 c1 Prodigal gene 5356473 5356931 . + . ID=BALIOE_26725_gene;locus_tag=BALIOE_26725 | |
| 10702 c1 Prodigal CDS 5356473 5356931 . + 0 ID=BALIOE_26725;Name=hypothetical protein;locus_tag=BALIOE_26725;product=hypothetical protein;Parent=BALIOE_26725_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10703 c1 Prodigal gene 5357647 5358474 . + . ID=BALIOE_26730_gene;locus_tag=BALIOE_26730 | |
| 10704 c1 Prodigal CDS 5357647 5358474 . + 0 ID=BALIOE_26730;Name=hypothetical protein;locus_tag=BALIOE_26730;product=hypothetical protein;Parent=BALIOE_26730_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10705 c1 Prodigal gene 5358934 5359785 . - . ID=BALIOE_26735_gene;locus_tag=BALIOE_26735 | |
| 10706 c1 Prodigal CDS 5358934 5359785 . - 0 ID=BALIOE_26735;Name=hypothetical protein;locus_tag=BALIOE_26735;product=hypothetical protein;Parent=BALIOE_26735_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10707 c1 Prodigal gene 5359772 5360080 . - . ID=BALIOE_26740_gene;locus_tag=BALIOE_26740 | |
| 10708 c1 Prodigal CDS 5359772 5360080 . - 0 ID=BALIOE_26740;Name=hypothetical protein;locus_tag=BALIOE_26740;product=hypothetical protein;Parent=BALIOE_26740_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10709 c1 Prodigal gene 5360326 5361429 . - . ID=BALIOE_26745_gene;locus_tag=BALIOE_26745 | |
| 10710 c1 Prodigal CDS 5360326 5361429 . - 0 ID=BALIOE_26745;Name=hypothetical protein;locus_tag=BALIOE_26745;product=hypothetical protein;Parent=BALIOE_26745_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10711 c1 Prodigal gene 5361433 5362140 . - . ID=BALIOE_26750_gene;locus_tag=BALIOE_26750 | |
| 10712 c1 Prodigal CDS 5361433 5362140 . - 0 ID=BALIOE_26750;Name=hypothetical protein;locus_tag=BALIOE_26750;product=hypothetical protein;Parent=BALIOE_26750_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10713 c1 Prodigal gene 5362147 5363799 . - . ID=BALIOE_26755_gene;locus_tag=BALIOE_26755 | |
| 10714 c1 Prodigal CDS 5362147 5363799 . - 0 ID=BALIOE_26755;Name=hypothetical protein;locus_tag=BALIOE_26755;product=hypothetical protein;Parent=BALIOE_26755_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10715 c1 Prodigal gene 5364011 5367370 . + . ID=BALIOE_26760_gene;locus_tag=BALIOE_26760 | |
| 10716 c1 Prodigal CDS 5364011 5367370 . + 0 ID=BALIOE_26760;Name=hypothetical protein;locus_tag=BALIOE_26760;product=hypothetical protein;Parent=BALIOE_26760_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10717 c1 Prodigal gene 5367370 5373684 . + . ID=BALIOE_26765_gene;locus_tag=BALIOE_26765 | |
| 10718 c1 Prodigal CDS 5367370 5373684 . + 0 ID=BALIOE_26765;Name=hypothetical protein;locus_tag=BALIOE_26765;product=hypothetical protein;Parent=BALIOE_26765_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10719 c1 Prodigal gene 5373908 5376766 . + . ID=BALIOE_26770_gene;locus_tag=BALIOE_26770 | |
| 10720 c1 Prodigal CDS 5373908 5376766 . + 0 ID=BALIOE_26770;Name=hypothetical protein;locus_tag=BALIOE_26770;product=hypothetical protein;Parent=BALIOE_26770_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10721 c1 Prodigal gene 5376769 5381703 . + . ID=BALIOE_26775_gene;locus_tag=BALIOE_26775 | |
| 10722 c1 Prodigal CDS 5376769 5381703 . + 0 ID=BALIOE_26775;Name=hypothetical protein;locus_tag=BALIOE_26775;product=hypothetical protein;Parent=BALIOE_26775_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10723 c1 Prodigal gene 5381703 5388044 . + . ID=BALIOE_26780_gene;locus_tag=BALIOE_26780 | |
| 10724 c1 Prodigal CDS 5381703 5388044 . + 0 ID=BALIOE_26780;Name=hypothetical protein;locus_tag=BALIOE_26780;product=hypothetical protein;Parent=BALIOE_26780_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10725 c1 Prodigal gene 5388041 5390155 . + . ID=BALIOE_26785_gene;locus_tag=BALIOE_26785 | |
| 10726 c1 Prodigal CDS 5388041 5390155 . + 0 ID=BALIOE_26785;Name=hypothetical protein;locus_tag=BALIOE_26785;product=hypothetical protein;Parent=BALIOE_26785_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10727 c1 Prodigal gene 5391108 5391353 . - . ID=BALIOE_26790_gene;locus_tag=BALIOE_26790 | |
| 10728 c1 Prodigal CDS 5391108 5391353 . - 0 ID=BALIOE_26790;Name=hypothetical protein;locus_tag=BALIOE_26790;product=hypothetical protein;Parent=BALIOE_26790_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10729 c1 Prodigal gene 5391649 5392629 . - . ID=BALIOE_26795_gene;locus_tag=BALIOE_26795 | |
| 10730 c1 Prodigal CDS 5391649 5392629 . - 0 ID=BALIOE_26795;Name=hypothetical protein;locus_tag=BALIOE_26795;product=hypothetical protein;Parent=BALIOE_26795_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10731 c1 Prodigal gene 5392694 5393800 . - . ID=BALIOE_26800_gene;locus_tag=BALIOE_26800 | |
| 10732 c1 Prodigal CDS 5392694 5393800 . - 0 ID=BALIOE_26800;Name=hypothetical protein;locus_tag=BALIOE_26800;product=hypothetical protein;Parent=BALIOE_26800_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10733 c1 Prodigal gene 5393820 5394536 . - . ID=BALIOE_26805_gene;locus_tag=BALIOE_26805 | |
| 10734 c1 Prodigal CDS 5393820 5394536 . - 0 ID=BALIOE_26805;Name=hypothetical protein;locus_tag=BALIOE_26805;product=hypothetical protein;Parent=BALIOE_26805_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10735 c1 Prodigal gene 5395992 5396594 . + . ID=BALIOE_26810_gene;locus_tag=BALIOE_26810 | |
| 10736 c1 Prodigal CDS 5395992 5396594 . + 0 ID=BALIOE_26810;Name=hypothetical protein;locus_tag=BALIOE_26810;product=hypothetical protein;Parent=BALIOE_26810_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10737 c1 Prodigal gene 5397072 5397668 . + . ID=BALIOE_26815_gene;locus_tag=BALIOE_26815 | |
| 10738 c1 Prodigal CDS 5397072 5397668 . + 0 ID=BALIOE_26815;Name=hypothetical protein;locus_tag=BALIOE_26815;product=hypothetical protein;Parent=BALIOE_26815_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10739 c1 Prodigal gene 5398133 5398681 . + . ID=BALIOE_26820_gene;locus_tag=BALIOE_26820 | |
| 10740 c1 Prodigal CDS 5398133 5398681 . + 0 ID=BALIOE_26820;Name=hypothetical protein;locus_tag=BALIOE_26820;product=hypothetical protein;Parent=BALIOE_26820_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10741 c1 Prodigal gene 5398788 5399285 . + . ID=BALIOE_26825_gene;locus_tag=BALIOE_26825 | |
| 10742 c1 Prodigal CDS 5398788 5399285 . + 0 ID=BALIOE_26825;Name=hypothetical protein;locus_tag=BALIOE_26825;product=hypothetical protein;Parent=BALIOE_26825_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10743 c1 Prodigal gene 5399322 5400047 . + . ID=BALIOE_26830_gene;locus_tag=BALIOE_26830 | |
| 10744 c1 Prodigal CDS 5399322 5400047 . + 0 ID=BALIOE_26830;Name=hypothetical protein;locus_tag=BALIOE_26830;product=hypothetical protein;Parent=BALIOE_26830_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10745 c1 Prodigal gene 5400114 5402750 . + . ID=BALIOE_26835_gene;locus_tag=BALIOE_26835 | |
| 10746 c1 Prodigal CDS 5400114 5402750 . + 0 ID=BALIOE_26835;Name=hypothetical protein;locus_tag=BALIOE_26835;product=hypothetical protein;Parent=BALIOE_26835_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10747 c1 Prodigal gene 5402760 5403290 . + . ID=BALIOE_26840_gene;locus_tag=BALIOE_26840 | |
| 10748 c1 Prodigal CDS 5402760 5403290 . + 0 ID=BALIOE_26840;Name=hypothetical protein;locus_tag=BALIOE_26840;product=hypothetical protein;Parent=BALIOE_26840_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10749 c1 Prodigal gene 5403303 5403806 . + . ID=BALIOE_26845_gene;locus_tag=BALIOE_26845 | |
| 10750 c1 Prodigal CDS 5403303 5403806 . + 0 ID=BALIOE_26845;Name=hypothetical protein;locus_tag=BALIOE_26845;product=hypothetical protein;Parent=BALIOE_26845_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10751 c1 Prodigal gene 5403826 5404728 . + . ID=BALIOE_26850_gene;locus_tag=BALIOE_26850 | |
| 10752 c1 Prodigal CDS 5403826 5404728 . + 0 ID=BALIOE_26850;Name=hypothetical protein;locus_tag=BALIOE_26850;product=hypothetical protein;Parent=BALIOE_26850_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10753 c1 Prodigal gene 5404902 5406245 . - . ID=BALIOE_26855_gene;locus_tag=BALIOE_26855 | |
| 10754 c1 Prodigal CDS 5404902 5406245 . - 0 ID=BALIOE_26855;Name=hypothetical protein;locus_tag=BALIOE_26855;product=hypothetical protein;Parent=BALIOE_26855_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10755 c1 Prodigal gene 5406585 5407769 . + . ID=BALIOE_26860_gene;locus_tag=BALIOE_26860 | |
| 10756 c1 Prodigal CDS 5406585 5407769 . + 0 ID=BALIOE_26860;Name=hypothetical protein;locus_tag=BALIOE_26860;product=hypothetical protein;Parent=BALIOE_26860_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10757 c1 Prodigal gene 5407850 5409310 . + . ID=BALIOE_26865_gene;locus_tag=BALIOE_26865 | |
| 10758 c1 Prodigal CDS 5407850 5409310 . + 0 ID=BALIOE_26865;Name=hypothetical protein;locus_tag=BALIOE_26865;product=hypothetical protein;Parent=BALIOE_26865_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10759 c1 Prodigal gene 5409332 5409526 . - . ID=BALIOE_26870_gene;locus_tag=BALIOE_26870 | |
| 10760 c1 Prodigal CDS 5409332 5409526 . - 0 ID=BALIOE_26870;Name=hypothetical protein;locus_tag=BALIOE_26870;product=hypothetical protein;Parent=BALIOE_26870_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10761 c1 Prodigal gene 5409573 5410298 . + . ID=BALIOE_26875_gene;locus_tag=BALIOE_26875 | |
| 10762 c1 Prodigal CDS 5409573 5410298 . + 0 ID=BALIOE_26875;Name=hypothetical protein;locus_tag=BALIOE_26875;product=hypothetical protein;Parent=BALIOE_26875_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10763 c1 Prodigal gene 5410439 5411269 . - . ID=BALIOE_26880_gene;locus_tag=BALIOE_26880 | |
| 10764 c1 Prodigal CDS 5410439 5411269 . - 0 ID=BALIOE_26880;Name=hypothetical protein;locus_tag=BALIOE_26880;product=hypothetical protein;Parent=BALIOE_26880_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10765 c1 Prodigal gene 5411523 5411624 . + . ID=BALIOE_26885_gene;locus_tag=BALIOE_26885 | |
| 10766 c1 Prodigal CDS 5411523 5411624 . + 0 ID=BALIOE_26885;Name=hypothetical protein;locus_tag=BALIOE_26885;product=hypothetical protein;Parent=BALIOE_26885_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10767 c1 Prodigal gene 5411942 5412334 . + . ID=BALIOE_26890_gene;locus_tag=BALIOE_26890 | |
| 10768 c1 Prodigal CDS 5411942 5412334 . + 0 ID=BALIOE_26890;Name=hypothetical protein;locus_tag=BALIOE_26890;product=hypothetical protein;Parent=BALIOE_26890_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10769 c1 Prodigal gene 5412327 5413055 . - . ID=BALIOE_26895_gene;locus_tag=BALIOE_26895 | |
| 10770 c1 Prodigal CDS 5412327 5413055 . - 0 ID=BALIOE_26895;Name=hypothetical protein;locus_tag=BALIOE_26895;product=hypothetical protein;Parent=BALIOE_26895_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10771 c1 Prodigal gene 5413303 5414475 . - . ID=BALIOE_26900_gene;locus_tag=BALIOE_26900 | |
| 10772 c1 Prodigal CDS 5413303 5414475 . - 0 ID=BALIOE_26900;Name=hypothetical protein;locus_tag=BALIOE_26900;product=hypothetical protein;Parent=BALIOE_26900_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10773 c1 Prodigal gene 5414488 5414949 . - . ID=BALIOE_26905_gene;locus_tag=BALIOE_26905 | |
| 10774 c1 Prodigal CDS 5414488 5414949 . - 0 ID=BALIOE_26905;Name=hypothetical protein;locus_tag=BALIOE_26905;product=hypothetical protein;Parent=BALIOE_26905_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10775 c1 Prodigal gene 5414946 5415629 . - . ID=BALIOE_26910_gene;locus_tag=BALIOE_26910 | |
| 10776 c1 Prodigal CDS 5414946 5415629 . - 0 ID=BALIOE_26910;Name=hypothetical protein;locus_tag=BALIOE_26910;product=hypothetical protein;Parent=BALIOE_26910_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10777 c1 Prodigal gene 5415770 5416255 . - . ID=BALIOE_26915_gene;locus_tag=BALIOE_26915 | |
| 10778 c1 Prodigal CDS 5415770 5416255 . - 0 ID=BALIOE_26915;Name=hypothetical protein;locus_tag=BALIOE_26915;product=hypothetical protein;Parent=BALIOE_26915_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10779 c1 Prodigal gene 5416586 5421688 . - . ID=BALIOE_26920_gene;locus_tag=BALIOE_26920 | |
| 10780 c1 Prodigal CDS 5416586 5421688 . - 0 ID=BALIOE_26920;Name=hypothetical protein;locus_tag=BALIOE_26920;product=hypothetical protein;Parent=BALIOE_26920_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10781 c1 Prodigal gene 5422038 5423216 . - . ID=BALIOE_26925_gene;locus_tag=BALIOE_26925 | |
| 10782 c1 Prodigal CDS 5422038 5423216 . - 0 ID=BALIOE_26925;Name=hypothetical protein;locus_tag=BALIOE_26925;product=hypothetical protein;Parent=BALIOE_26925_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10783 c1 Prodigal gene 5423284 5424126 . - . ID=BALIOE_26930_gene;locus_tag=BALIOE_26930 | |
| 10784 c1 Prodigal CDS 5423284 5424126 . - 0 ID=BALIOE_26930;Name=hypothetical protein;locus_tag=BALIOE_26930;product=hypothetical protein;Parent=BALIOE_26930_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10785 c1 Prodigal gene 5424392 5426599 . - . ID=BALIOE_26935_gene;locus_tag=BALIOE_26935 | |
| 10786 c1 Prodigal CDS 5424392 5426599 . - 0 ID=BALIOE_26935;Name=hypothetical protein;locus_tag=BALIOE_26935;product=hypothetical protein;Parent=BALIOE_26935_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10787 c1 Prodigal gene 5426911 5427177 . - . ID=BALIOE_26940_gene;locus_tag=BALIOE_26940 | |
| 10788 c1 Prodigal CDS 5426911 5427177 . - 0 ID=BALIOE_26940;Name=hypothetical protein;locus_tag=BALIOE_26940;product=hypothetical protein;Parent=BALIOE_26940_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10789 c1 Prodigal gene 5427174 5427941 . - . ID=BALIOE_26945_gene;locus_tag=BALIOE_26945 | |
| 10790 c1 Prodigal CDS 5427174 5427941 . - 0 ID=BALIOE_26945;Name=hypothetical protein;locus_tag=BALIOE_26945;product=hypothetical protein;Parent=BALIOE_26945_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10791 c1 Prodigal gene 5427951 5429102 . - . ID=BALIOE_26950_gene;locus_tag=BALIOE_26950 | |
| 10792 c1 Prodigal CDS 5427951 5429102 . - 0 ID=BALIOE_26950;Name=hypothetical protein;locus_tag=BALIOE_26950;product=hypothetical protein;Parent=BALIOE_26950_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10793 c1 Prodigal gene 5429218 5430489 . - . ID=BALIOE_26955_gene;locus_tag=BALIOE_26955 | |
| 10794 c1 Prodigal CDS 5429218 5430489 . - 0 ID=BALIOE_26955;Name=hypothetical protein;locus_tag=BALIOE_26955;product=hypothetical protein;Parent=BALIOE_26955_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10795 c1 Prodigal gene 5430530 5431762 . - . ID=BALIOE_26960_gene;locus_tag=BALIOE_26960 | |
| 10796 c1 Prodigal CDS 5430530 5431762 . - 0 ID=BALIOE_26960;Name=hypothetical protein;locus_tag=BALIOE_26960;product=hypothetical protein;Parent=BALIOE_26960_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10797 c1 Prodigal gene 5432229 5433011 . + . ID=BALIOE_26965_gene;locus_tag=BALIOE_26965 | |
| 10798 c1 Prodigal CDS 5432229 5433011 . + 0 ID=BALIOE_26965;Name=hypothetical protein;locus_tag=BALIOE_26965;product=hypothetical protein;Parent=BALIOE_26965_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10799 c1 Prodigal gene 5432986 5433186 . + . ID=BALIOE_26970_gene;locus_tag=BALIOE_26970 | |
| 10800 c1 Prodigal CDS 5432986 5433186 . + 0 ID=BALIOE_26970;Name=hypothetical protein;locus_tag=BALIOE_26970;product=hypothetical protein;Parent=BALIOE_26970_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10801 c1 Prodigal gene 5433429 5434841 . - . ID=BALIOE_26975_gene;locus_tag=BALIOE_26975 | |
| 10802 c1 Prodigal CDS 5433429 5434841 . - 0 ID=BALIOE_26975;Name=hypothetical protein;locus_tag=BALIOE_26975;product=hypothetical protein;Parent=BALIOE_26975_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10803 c1 Prodigal gene 5435018 5435182 . + . ID=BALIOE_26980_gene;locus_tag=BALIOE_26980 | |
| 10804 c1 Prodigal CDS 5435018 5435182 . + 0 ID=BALIOE_26980;Name=hypothetical protein;locus_tag=BALIOE_26980;product=hypothetical protein;Parent=BALIOE_26980_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10805 c1 Prodigal gene 5435279 5436160 . + . ID=BALIOE_26985_gene;locus_tag=BALIOE_26985 | |
| 10806 c1 Prodigal CDS 5435279 5436160 . + 0 ID=BALIOE_26985;Name=hypothetical protein;locus_tag=BALIOE_26985;product=hypothetical protein;Parent=BALIOE_26985_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10807 c1 Prodigal gene 5436208 5437371 . + . ID=BALIOE_26990_gene;locus_tag=BALIOE_26990 | |
| 10808 c1 Prodigal CDS 5436208 5437371 . + 0 ID=BALIOE_26990;Name=hypothetical protein;locus_tag=BALIOE_26990;product=hypothetical protein;Parent=BALIOE_26990_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10809 c1 Prodigal gene 5437418 5437759 . - . ID=BALIOE_26995_gene;locus_tag=BALIOE_26995 | |
| 10810 c1 Prodigal CDS 5437418 5437759 . - 0 ID=BALIOE_26995;Name=hypothetical protein;locus_tag=BALIOE_26995;product=hypothetical protein;Parent=BALIOE_26995_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10811 c1 Prodigal gene 5437980 5439734 . - . ID=BALIOE_27000_gene;locus_tag=BALIOE_27000 | |
| 10812 c1 Prodigal CDS 5437980 5439734 . - 0 ID=BALIOE_27000;Name=hypothetical protein;locus_tag=BALIOE_27000;product=hypothetical protein;Parent=BALIOE_27000_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10813 c1 Prodigal gene 5439734 5441203 . - . ID=BALIOE_27005_gene;locus_tag=BALIOE_27005 | |
| 10814 c1 Prodigal CDS 5439734 5441203 . - 0 ID=BALIOE_27005;Name=hypothetical protein;locus_tag=BALIOE_27005;product=hypothetical protein;Parent=BALIOE_27005_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10815 c1 Prodigal gene 5441270 5443702 . - . ID=BALIOE_27010_gene;locus_tag=BALIOE_27010 | |
| 10816 c1 Prodigal CDS 5441270 5443702 . - 0 ID=BALIOE_27010;Name=hypothetical protein;locus_tag=BALIOE_27010;product=hypothetical protein;Parent=BALIOE_27010_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10817 c1 Prodigal gene 5443980 5444264 . + . ID=BALIOE_27015_gene;locus_tag=BALIOE_27015 | |
| 10818 c1 Prodigal CDS 5443980 5444264 . + 0 ID=BALIOE_27015;Name=hypothetical protein;locus_tag=BALIOE_27015;product=hypothetical protein;Parent=BALIOE_27015_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10819 c1 Prodigal gene 5444273 5445631 . + . ID=BALIOE_27020_gene;locus_tag=BALIOE_27020 | |
| 10820 c1 Prodigal CDS 5444273 5445631 . + 0 ID=BALIOE_27020;Name=hypothetical protein;locus_tag=BALIOE_27020;product=hypothetical protein;Parent=BALIOE_27020_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10821 c1 Prodigal gene 5445700 5446656 . - . ID=BALIOE_27025_gene;locus_tag=BALIOE_27025 | |
| 10822 c1 Prodigal CDS 5445700 5446656 . - 0 ID=BALIOE_27025;Name=hypothetical protein;locus_tag=BALIOE_27025;product=hypothetical protein;Parent=BALIOE_27025_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10823 c1 Prodigal gene 5446667 5446870 . - . ID=BALIOE_27030_gene;locus_tag=BALIOE_27030 | |
| 10824 c1 Prodigal CDS 5446667 5446870 . - 0 ID=BALIOE_27030;Name=hypothetical protein;locus_tag=BALIOE_27030;product=hypothetical protein;Parent=BALIOE_27030_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10825 c1 Prodigal gene 5446920 5449070 . - . ID=BALIOE_27035_gene;locus_tag=BALIOE_27035 | |
| 10826 c1 Prodigal CDS 5446920 5449070 . - 0 ID=BALIOE_27035;Name=hypothetical protein;locus_tag=BALIOE_27035;product=hypothetical protein;Parent=BALIOE_27035_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10827 c1 Prodigal gene 5449363 5449905 . - . ID=BALIOE_27040_gene;locus_tag=BALIOE_27040 | |
| 10828 c1 Prodigal CDS 5449363 5449905 . - 0 ID=BALIOE_27040;Name=hypothetical protein;locus_tag=BALIOE_27040;product=hypothetical protein;Parent=BALIOE_27040_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10829 c1 Prodigal gene 5450134 5451798 . + . ID=BALIOE_27045_gene;locus_tag=BALIOE_27045 | |
| 10830 c1 Prodigal CDS 5450134 5451798 . + 0 ID=BALIOE_27045;Name=hypothetical protein;locus_tag=BALIOE_27045;product=hypothetical protein;Parent=BALIOE_27045_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10831 c1 Prodigal gene 5451847 5453208 . - . ID=BALIOE_27050_gene;locus_tag=BALIOE_27050 | |
| 10832 c1 Prodigal CDS 5451847 5453208 . - 0 ID=BALIOE_27050;Name=hypothetical protein;locus_tag=BALIOE_27050;product=hypothetical protein;Parent=BALIOE_27050_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10833 c1 Prodigal gene 5453423 5454337 . - . ID=BALIOE_27055_gene;locus_tag=BALIOE_27055 | |
| 10834 c1 Prodigal CDS 5453423 5454337 . - 0 ID=BALIOE_27055;Name=hypothetical protein;locus_tag=BALIOE_27055;product=hypothetical protein;Parent=BALIOE_27055_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10835 c1 Prodigal gene 5454476 5455498 . + . ID=BALIOE_27060_gene;locus_tag=BALIOE_27060 | |
| 10836 c1 Prodigal CDS 5454476 5455498 . + 0 ID=BALIOE_27060;Name=hypothetical protein;locus_tag=BALIOE_27060;product=hypothetical protein;Parent=BALIOE_27060_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10837 c1 Prodigal gene 5455635 5457926 . - . ID=BALIOE_27065_gene;locus_tag=BALIOE_27065 | |
| 10838 c1 Prodigal CDS 5455635 5457926 . - 0 ID=BALIOE_27065;Name=hypothetical protein;locus_tag=BALIOE_27065;product=hypothetical protein;Parent=BALIOE_27065_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10839 c1 Prodigal gene 5458180 5458674 . - . ID=BALIOE_27070_gene;locus_tag=BALIOE_27070 | |
| 10840 c1 Prodigal CDS 5458180 5458674 . - 0 ID=BALIOE_27070;Name=hypothetical protein;locus_tag=BALIOE_27070;product=hypothetical protein;Parent=BALIOE_27070_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10841 c1 Prodigal gene 5458723 5459460 . - . ID=BALIOE_27075_gene;locus_tag=BALIOE_27075 | |
| 10842 c1 Prodigal CDS 5458723 5459460 . - 0 ID=BALIOE_27075;Name=hypothetical protein;locus_tag=BALIOE_27075;product=hypothetical protein;Parent=BALIOE_27075_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10843 c1 Prodigal gene 5459463 5460002 . - . ID=BALIOE_27080_gene;locus_tag=BALIOE_27080 | |
| 10844 c1 Prodigal CDS 5459463 5460002 . - 0 ID=BALIOE_27080;Name=hypothetical protein;locus_tag=BALIOE_27080;product=hypothetical protein;Parent=BALIOE_27080_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10845 c1 Prodigal gene 5460109 5460582 . - . ID=BALIOE_27085_gene;locus_tag=BALIOE_27085 | |
| 10846 c1 Prodigal CDS 5460109 5460582 . - 0 ID=BALIOE_27085;Name=hypothetical protein;locus_tag=BALIOE_27085;product=hypothetical protein;Parent=BALIOE_27085_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10847 c1 Prodigal gene 5460573 5461343 . - . ID=BALIOE_27090_gene;locus_tag=BALIOE_27090 | |
| 10848 c1 Prodigal CDS 5460573 5461343 . - 0 ID=BALIOE_27090;Name=hypothetical protein;locus_tag=BALIOE_27090;product=hypothetical protein;Parent=BALIOE_27090_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10849 c1 Prodigal gene 5461964 5462689 . + . ID=BALIOE_27095_gene;locus_tag=BALIOE_27095 | |
| 10850 c1 Prodigal CDS 5461964 5462689 . + 0 ID=BALIOE_27095;Name=hypothetical protein;locus_tag=BALIOE_27095;product=hypothetical protein;Parent=BALIOE_27095_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10851 c1 Prodigal gene 5462647 5463324 . + . ID=BALIOE_27100_gene;locus_tag=BALIOE_27100 | |
| 10852 c1 Prodigal CDS 5462647 5463324 . + 0 ID=BALIOE_27100;Name=hypothetical protein;locus_tag=BALIOE_27100;product=hypothetical protein;Parent=BALIOE_27100_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10853 c1 Prodigal gene 5463362 5464150 . - . ID=BALIOE_27105_gene;locus_tag=BALIOE_27105 | |
| 10854 c1 Prodigal CDS 5463362 5464150 . - 0 ID=BALIOE_27105;Name=hypothetical protein;locus_tag=BALIOE_27105;product=hypothetical protein;Parent=BALIOE_27105_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10855 c1 Prodigal gene 5464291 5464527 . + . ID=BALIOE_27110_gene;locus_tag=BALIOE_27110 | |
| 10856 c1 Prodigal CDS 5464291 5464527 . + 0 ID=BALIOE_27110;Name=hypothetical protein;locus_tag=BALIOE_27110;product=hypothetical protein;Parent=BALIOE_27110_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10857 c1 tRNAscan-SE gene 5464566 5464652 . - . ID=BALIOE_27115_gene;locus_tag=BALIOE_27115;gene=Leu_trna | |
| 10858 c1 tRNAscan-SE tRNA 5464566 5464652 . - . ID=BALIOE_27115;Name=tRNA-Leu;locus_tag=BALIOE_27115;product=tRNA-Leu;gene=Leu_trna;Parent=BALIOE_27115_gene;inference=profile:tRNAscan:2.0;Note=SO:0000264 | |
| 10859 c1 Prodigal gene 5464842 5465873 . - . ID=BALIOE_27120_gene;locus_tag=BALIOE_27120 | |
| 10860 c1 Prodigal CDS 5464842 5465873 . - 0 ID=BALIOE_27120;Name=hypothetical protein;locus_tag=BALIOE_27120;product=hypothetical protein;Parent=BALIOE_27120_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10861 c1 Prodigal gene 5465976 5466389 . + . ID=BALIOE_27125_gene;locus_tag=BALIOE_27125 | |
| 10862 c1 Prodigal CDS 5465976 5466389 . + 0 ID=BALIOE_27125;Name=hypothetical protein;locus_tag=BALIOE_27125;product=hypothetical protein;Parent=BALIOE_27125_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10863 c1 Prodigal gene 5466358 5466804 . + . ID=BALIOE_27130_gene;locus_tag=BALIOE_27130 | |
| 10864 c1 Prodigal CDS 5466358 5466804 . + 0 ID=BALIOE_27130;Name=hypothetical protein;locus_tag=BALIOE_27130;product=hypothetical protein;Parent=BALIOE_27130_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10865 c1 Prodigal gene 5466819 5467496 . + . ID=BALIOE_27135_gene;locus_tag=BALIOE_27135 | |
| 10866 c1 Prodigal CDS 5466819 5467496 . + 0 ID=BALIOE_27135;Name=hypothetical protein;locus_tag=BALIOE_27135;product=hypothetical protein;Parent=BALIOE_27135_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10867 c1 Prodigal gene 5467587 5469176 . + . ID=BALIOE_27140_gene;locus_tag=BALIOE_27140 | |
| 10868 c1 Prodigal CDS 5467587 5469176 . + 0 ID=BALIOE_27140;Name=hypothetical protein;locus_tag=BALIOE_27140;product=hypothetical protein;Parent=BALIOE_27140_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10869 c1 Prodigal gene 5469569 5470174 . + . ID=BALIOE_27145_gene;locus_tag=BALIOE_27145 | |
| 10870 c1 Prodigal CDS 5469569 5470174 . + 0 ID=BALIOE_27145;Name=hypothetical protein;locus_tag=BALIOE_27145;product=hypothetical protein;Parent=BALIOE_27145_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10871 c1 Prodigal gene 5470301 5470462 . + . ID=BALIOE_27150_gene;locus_tag=BALIOE_27150 | |
| 10872 c1 Prodigal CDS 5470301 5470462 . + 0 ID=BALIOE_27150;Name=hypothetical protein;locus_tag=BALIOE_27150;product=hypothetical protein;Parent=BALIOE_27150_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10873 c1 Prodigal gene 5470584 5471657 . + . ID=BALIOE_27155_gene;locus_tag=BALIOE_27155 | |
| 10874 c1 Prodigal CDS 5470584 5471657 . + 0 ID=BALIOE_27155;Name=hypothetical protein;locus_tag=BALIOE_27155;product=hypothetical protein;Parent=BALIOE_27155_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10875 c1 Prodigal gene 5471654 5472436 . + . ID=BALIOE_27160_gene;locus_tag=BALIOE_27160 | |
| 10876 c1 Prodigal CDS 5471654 5472436 . + 0 ID=BALIOE_27160;Name=hypothetical protein;locus_tag=BALIOE_27160;product=hypothetical protein;Parent=BALIOE_27160_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10877 c1 Infernal gene 5472533 5472611 . + . ID=BALIOE_27165_gene;locus_tag=BALIOE_27165;gene=naRNA4 | |
| 10878 c1 Infernal ncRNA 5472533 5472611 2.1e-12 + . ID=BALIOE_27165;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_27165;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_27165_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10879 c1 Infernal gene 5472533 5472611 . - . ID=BALIOE_27170_gene;locus_tag=BALIOE_27170;gene=naRNA4 | |
| 10880 c1 Infernal ncRNA 5472533 5472611 3.3e-08 - . ID=BALIOE_27170;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_27170;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_27170_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10881 c1 Prodigal gene 5472650 5473513 . - . ID=BALIOE_27175_gene;locus_tag=BALIOE_27175 | |
| 10882 c1 Prodigal CDS 5472650 5473513 . - 0 ID=BALIOE_27175;Name=hypothetical protein;locus_tag=BALIOE_27175;product=hypothetical protein;Parent=BALIOE_27175_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10883 c1 Prodigal gene 5473485 5473730 . - . ID=BALIOE_27180_gene;locus_tag=BALIOE_27180 | |
| 10884 c1 Prodigal CDS 5473485 5473730 . - 0 ID=BALIOE_27180;Name=hypothetical protein;locus_tag=BALIOE_27180;product=hypothetical protein;Parent=BALIOE_27180_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10885 c1 Prodigal gene 5473766 5475034 . - . ID=BALIOE_27185_gene;locus_tag=BALIOE_27185 | |
| 10886 c1 Prodigal CDS 5473766 5475034 . - 0 ID=BALIOE_27185;Name=hypothetical protein;locus_tag=BALIOE_27185;product=hypothetical protein;Parent=BALIOE_27185_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10887 c1 Prodigal gene 5475292 5476071 . + . ID=BALIOE_27190_gene;locus_tag=BALIOE_27190 | |
| 10888 c1 Prodigal CDS 5475292 5476071 . + 0 ID=BALIOE_27190;Name=hypothetical protein;locus_tag=BALIOE_27190;product=hypothetical protein;Parent=BALIOE_27190_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10889 c1 Prodigal gene 5476198 5477520 . + . ID=BALIOE_27195_gene;locus_tag=BALIOE_27195 | |
| 10890 c1 Prodigal CDS 5476198 5477520 . + 0 ID=BALIOE_27195;Name=hypothetical protein;locus_tag=BALIOE_27195;product=hypothetical protein;Parent=BALIOE_27195_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10891 c1 Prodigal gene 5477572 5478795 . + . ID=BALIOE_27200_gene;locus_tag=BALIOE_27200 | |
| 10892 c1 Prodigal CDS 5477572 5478795 . + 0 ID=BALIOE_27200;Name=hypothetical protein;locus_tag=BALIOE_27200;product=hypothetical protein;Parent=BALIOE_27200_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10893 c1 Prodigal gene 5478852 5479571 . + . ID=BALIOE_27205_gene;locus_tag=BALIOE_27205 | |
| 10894 c1 Prodigal CDS 5478852 5479571 . + 0 ID=BALIOE_27205;Name=hypothetical protein;locus_tag=BALIOE_27205;product=hypothetical protein;Parent=BALIOE_27205_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10895 c1 Prodigal gene 5479732 5479995 . - . ID=BALIOE_27210_gene;locus_tag=BALIOE_27210 | |
| 10896 c1 Prodigal CDS 5479732 5479995 . - 0 ID=BALIOE_27210;Name=hypothetical protein;locus_tag=BALIOE_27210;product=hypothetical protein;Parent=BALIOE_27210_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10897 c1 Prodigal gene 5480027 5481715 . - . ID=BALIOE_27215_gene;locus_tag=BALIOE_27215 | |
| 10898 c1 Prodigal CDS 5480027 5481715 . - 0 ID=BALIOE_27215;Name=hypothetical protein;locus_tag=BALIOE_27215;product=hypothetical protein;Parent=BALIOE_27215_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10899 c1 Prodigal gene 5481821 5482789 . + . ID=BALIOE_27220_gene;locus_tag=BALIOE_27220 | |
| 10900 c1 Prodigal CDS 5481821 5482789 . + 0 ID=BALIOE_27220;Name=hypothetical protein;locus_tag=BALIOE_27220;product=hypothetical protein;Parent=BALIOE_27220_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10901 c1 Prodigal gene 5482838 5484220 . + . ID=BALIOE_27225_gene;locus_tag=BALIOE_27225 | |
| 10902 c1 Prodigal CDS 5482838 5484220 . + 0 ID=BALIOE_27225;Name=hypothetical protein;locus_tag=BALIOE_27225;product=hypothetical protein;Parent=BALIOE_27225_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10903 c1 Prodigal gene 5484241 5485473 . + . ID=BALIOE_27230_gene;locus_tag=BALIOE_27230 | |
| 10904 c1 Prodigal CDS 5484241 5485473 . + 0 ID=BALIOE_27230;Name=hypothetical protein;locus_tag=BALIOE_27230;product=hypothetical protein;Parent=BALIOE_27230_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10905 c1 Prodigal gene 5485507 5485674 . + . ID=BALIOE_27235_gene;locus_tag=BALIOE_27235 | |
| 10906 c1 Prodigal CDS 5485507 5485674 . + 0 ID=BALIOE_27235;Name=hypothetical protein;locus_tag=BALIOE_27235;product=hypothetical protein;Parent=BALIOE_27235_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10907 c1 Infernal gene 5485624 5485702 . + . ID=BALIOE_27240_gene;locus_tag=BALIOE_27240;gene=naRNA4 | |
| 10908 c1 Infernal ncRNA 5485624 5485702 3.6e-09 + . ID=BALIOE_27240;Name=Nucleoid-associated noncoding RNA 4 (CssrE);locus_tag=BALIOE_27240;gene=naRNA4;product=Nucleoid-associated noncoding RNA 4 (CssrE);Dbxref=RFAM:RF02564;Parent=BALIOE_27240_gene;inference=profile:Rfam:RF02564;Note=SO:0000655;ncRNA_class=other | |
| 10909 c1 Prodigal gene 5485781 5487448 . - . ID=BALIOE_27245_gene;locus_tag=BALIOE_27245 | |
| 10910 c1 Prodigal CDS 5485781 5487448 . - 0 ID=BALIOE_27245;Name=hypothetical protein;locus_tag=BALIOE_27245;product=hypothetical protein;Parent=BALIOE_27245_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10911 c1 Prodigal gene 5487659 5489596 . + . ID=BALIOE_27250_gene;locus_tag=BALIOE_27250 | |
| 10912 c1 Prodigal CDS 5487659 5489596 . + 0 ID=BALIOE_27250;Name=hypothetical protein;locus_tag=BALIOE_27250;product=hypothetical protein;Parent=BALIOE_27250_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10913 c1 Prodigal gene 5489716 5490012 . + . ID=BALIOE_27255_gene;locus_tag=BALIOE_27255 | |
| 10914 c1 Prodigal CDS 5489716 5490012 . + 0 ID=BALIOE_27255;Name=hypothetical protein;locus_tag=BALIOE_27255;product=hypothetical protein;Parent=BALIOE_27255_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10915 c1 Prodigal gene 5490159 5490671 . - . ID=BALIOE_27260_gene;locus_tag=BALIOE_27260 | |
| 10916 c1 Prodigal CDS 5490159 5490671 . - 0 ID=BALIOE_27260;Name=hypothetical protein;locus_tag=BALIOE_27260;product=hypothetical protein;Parent=BALIOE_27260_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10917 c1 Prodigal gene 5490723 5491370 . + . ID=BALIOE_27265_gene;locus_tag=BALIOE_27265 | |
| 10918 c1 Prodigal CDS 5490723 5491370 . + 0 ID=BALIOE_27265;Name=hypothetical protein;locus_tag=BALIOE_27265;product=hypothetical protein;Parent=BALIOE_27265_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10919 c1 Prodigal gene 5491367 5492236 . - . ID=BALIOE_27270_gene;locus_tag=BALIOE_27270 | |
| 10920 c1 Prodigal CDS 5491367 5492236 . - 0 ID=BALIOE_27270;Name=hypothetical protein;locus_tag=BALIOE_27270;product=hypothetical protein;Parent=BALIOE_27270_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10921 c1 Prodigal gene 5492447 5492920 . + . ID=BALIOE_27275_gene;locus_tag=BALIOE_27275 | |
| 10922 c1 Prodigal CDS 5492447 5492920 . + 0 ID=BALIOE_27275;Name=hypothetical protein;locus_tag=BALIOE_27275;product=hypothetical protein;Parent=BALIOE_27275_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10923 c1 Prodigal gene 5492933 5493622 . + . ID=BALIOE_27280_gene;locus_tag=BALIOE_27280 | |
| 10924 c1 Prodigal CDS 5492933 5493622 . + 0 ID=BALIOE_27280;Name=hypothetical protein;locus_tag=BALIOE_27280;product=hypothetical protein;Parent=BALIOE_27280_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10925 c1 Prodigal gene 5493622 5495046 . + . ID=BALIOE_27285_gene;locus_tag=BALIOE_27285 | |
| 10926 c1 Prodigal CDS 5493622 5495046 . + 0 ID=BALIOE_27285;Name=hypothetical protein;locus_tag=BALIOE_27285;product=hypothetical protein;Parent=BALIOE_27285_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10927 c1 Prodigal gene 5495104 5496456 . + . ID=BALIOE_27290_gene;locus_tag=BALIOE_27290 | |
| 10928 c1 Prodigal CDS 5495104 5496456 . + 0 ID=BALIOE_27290;Name=hypothetical protein;locus_tag=BALIOE_27290;product=hypothetical protein;Parent=BALIOE_27290_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10929 c1 Prodigal gene 5496516 5497232 . - . ID=BALIOE_27295_gene;locus_tag=BALIOE_27295 | |
| 10930 c1 Prodigal CDS 5496516 5497232 . - 0 ID=BALIOE_27295;Name=hypothetical protein;locus_tag=BALIOE_27295;product=hypothetical protein;Parent=BALIOE_27295_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10931 c1 Prodigal gene 5497868 5498554 . + . ID=BALIOE_27300_gene;locus_tag=BALIOE_27300 | |
| 10932 c1 Prodigal CDS 5497868 5498554 . + 0 ID=BALIOE_27300;Name=hypothetical protein;locus_tag=BALIOE_27300;product=hypothetical protein;Parent=BALIOE_27300_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10933 ##sequence-region p2 1 3306 | |
| 10934 p2 Bakta region 1 3306 . + . ID=p2;Name=p2;Is_circular=true | |
| 10935 p2 Prodigal gene 1 141 . - . ID=BALIOE_27305_gene;locus_tag=BALIOE_27305 | |
| 10936 p2 Prodigal CDS 1 141 . - 0 ID=BALIOE_27305;Name=hypothetical protein;locus_tag=BALIOE_27305;product=hypothetical protein;Parent=BALIOE_27305_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10937 p2 Prodigal gene 413 736 . + . ID=BALIOE_27310_gene;locus_tag=BALIOE_27310 | |
| 10938 p2 Prodigal CDS 413 736 . + 0 ID=BALIOE_27310;Name=hypothetical protein;locus_tag=BALIOE_27310;product=hypothetical protein;Parent=BALIOE_27310_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10939 p2 Prodigal gene 971 1351 . - . ID=BALIOE_27315_gene;locus_tag=BALIOE_27315 | |
| 10940 p2 Prodigal CDS 971 1351 . - 0 ID=BALIOE_27315;Name=hypothetical protein;locus_tag=BALIOE_27315;product=hypothetical protein;Parent=BALIOE_27315_gene;inference=ab initio prediction:Prodigal:2.6 | |
| 10941 p2 Prodigal gene 1348 2388 . - . ID=BALIOE_27320_gene;locus_tag=BALIOE_27320;gene=mock1 | |
| 10942 p2 Prodigal CDS 1348 2388 . - 0 ID=BALIOE_27320;Name=mock hypothetical user protein 1;locus_tag=BALIOE_27320;product=mock hypothetical user protein 1;gene=mock1;Parent=BALIOE_27320_gene;inference=ab initio prediction:Prodigal:2.6;Note=USERDB:MOCK1;ec_number=0.0.0.0 |