# HG changeset patch
# User petrn
# Date 1576843385 0
# Node ID 75db56b21a228ec8b029e2ed68b6a28f9f9fabad
# Parent  0b505bb0a4b096a6dc2ccdcad18b158ddc040c35
Uploaded

diff -r 0b505bb0a4b0 -r 75db56b21a22 repex_tarean.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/repex_tarean.xml	Fri Dec 20 12:03:05 2019 +0000
@@ -0,0 +1,234 @@
+<tool id="tarean" name="Tandem Repeat Analyzer"  version="2.3.6" >
+    <stdio>
+      <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" />
+      <regex match="error" source="stderr" level="fatal" description="Unknown error" />
+      <regex match="warning" source="stderr" level="warning" description="Unknown warning" />
+      <exit_code range="1:" level="fatal" description="Error" />
+    </stdio>
+    <description>Identification of genomic tandem repeats from NGS data</description>
+    <requirements>
+      <requirement type="package" version="3.7">python</requirement>
+      <requirement type="package" version="0.9.1" >pyrserve</requirement>
+      <requirement type="package" version=">956" >last</requirement>
+      <requirement type="package">mafft</requirement>
+      <requirement type="package">imagemagick</requirement>
+      <requirement type="package">blast</requirement>
+      <requirement type="package">diamond</requirement>
+      <requirement type="package">blast-legacy</requirement>
+      <requirement type="package">r-igraph</requirement>
+      <requirement type="package">r-data.tree</requirement>
+      <requirement type="package">r-stringr</requirement>
+      <requirement type="package">r-r2html</requirement>
+      <requirement type="package">r-hwriter</requirement>
+      <requirement type="package">r-dt</requirement>
+      <requirement type="package">r-scales</requirement>
+      <requirement type="package">r-plotrix</requirement>
+      <requirement type="package">r-png</requirement>
+      <requirement type="package">r-plyr</requirement>
+      <requirement type="package">r-dplyr</requirement>
+      <requirement type="package">r-optparse</requirement>
+      <requirement type="package">r-dbi</requirement>
+      <requirement type="package">r-rsqlite</requirement>
+      <requirement type="package">r-rserve</requirement>
+      <requirement type="package">bioconductor-biostrings</requirement>
+    </requirements>
+
+  <command detect_errors="exit_code">
+    export PYTHONHASHSEED=0;
+    ${__tool_directory__}/seqclust --paired --sample ${sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode
+    #if $advanced_options.advanced:
+      --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging
+      #if $advanced_options.custom_library.options_custom_library :
+     	  -d $advanced_options.custom_library.library extra_database
+      #end if
+      #if $advanced_options.options.options:
+        -opt $advanced_options.options.options
+      #end if   
+    #else:
+      -M 0.2
+
+    #end if
+    ${FastaFile} >stdout.log 2> stderr.log ;
+    echo "STDOUT CONTENT:" >> ${log} ;
+    cat stdout.log >> ${log} ;
+    echo "STDERR CONTENT:" >> ${log} ;
+    cat stderr.log >> ${log} &amp;&amp;
+    ${__tool_directory__}/stderr_filter.py stderr.log &amp;&amp;
+    cd tarean_output &amp;&amp;
+    zip -r  ${ReportArchive}.zip * &amp;&amp;
+    mv ${ReportArchive}.zip ${ReportArchive} &amp;&amp;
+    cp index.html ${ReportFile} &amp;&amp;
+    mkdir ${ReportFile.files_path} &amp;&amp;
+    cp -r --parents libdir ${ReportFile.files_path} &amp;&amp;
+    cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} &amp;&amp;
+    cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} &amp;&amp;
+    cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls &amp;&amp;
+    cp *.png ${ReportFile.files_path}/ &amp;&amp;
+    cp *.csv ${ReportFile.files_path}/ &amp;&amp;
+    cp *.html ${ReportFile.files_path}/  &amp;&amp;
+    cp *.css ${ReportFile.files_path}/  &amp;&amp;
+    cp *.fasta ${ReportFile.files_path}/ 2>>$log  &amp;&amp; rm -r ../tarean_output || :
+
+    
+  </command>
+
+  <inputs>
+	  <param name="FastaFile" label="paired-end NGS reads" type="data" format="fasta"
+	         help="Input file must contain fasta-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of input data format is provided in the help below."/>
+	  <param name="sample" label="Sample size" type="integer" value="500000" min="10000"/>
+
+    <conditional name="advanced_options">
+      <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" />
+      <when value="false">
+        <!-- pass -->
+      </when>
+      <when value="true">
+        <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/>
+        <conditional name="custom_library">
+	        <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/>
+	        <when value="false">
+            <!-- do nothing here -->
+          </when>
+          <when value="true">
+	          <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/>
+          </when>
+        </conditional>
+        <param name="size_threshold" label="Cluster size threshold  for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed, cluster with less than 20 reads are not considered at all."/>
+        <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/>
+        <param name="keep_names" label="Keep original sequences names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default sequence are relabeled using  integers. If you want to keep original names, use this option."/>
+         <conditional name="options">
+           <param name="options" type="select" label="Similarity search options" help="Different similarity search parameters are used depending on the used input data to adjust search to differences in length and error rate">
+             <option value="ILLUMINA" selected="true">Illumina reads, read length 100nt or more </option>
+             <option value="ILLUMINA_SHORT" selected="false">Illumina reads, shorter than 100nt (Do not use reads shorter than 50nt!) </option>
+             <option value="ILLUMINA_DUST_OFF" selected="false">Illumina reads, no masking of low complexity repeats  </option>
+           </param>
+         </conditional>
+      </when>
+    </conditional>
+
+  </inputs>
+  <outputs>
+	  <data name="log" format="txt" label="TAREAN log file"/> 
+	  <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/> 
+	  <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/> 
+  </outputs>
+
+  <help>
+    **HELP**
+    
+    TAREAN - TAndem REpeat ANalyzer is a computational pipeline for
+    **unsupervised identification of satellite repeats** from unassembled
+    sequence reads. The pipeline uses low-pass paired-end whole genome
+    sequence reads and performs graph-based clustering. The resulting
+    clusters, representing all types of repeats present in the genome, are
+    then examined to identify those containing circular structures indicative
+    of tandem repeats. A poster summarizing TAREAN principles and
+    implementation can be found `here.`__
+
+
+    .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312
+
+    **Input data**
+    
+ 
+    The analysis requires **paired-end reads** generated by whole genome
+    shotgun sequencing. The data should be provided as a single input file in
+    fasta format with the reads interlaced (see example below). All the pairs
+    must be complete, i.e. both "forward" and "reverse" sequence reads must be
+    present. The reads should all be trimmed to the same length. The optimal
+    size range is between 100 and 200 nucleotides. The number of reads to be
+    analyzed should not exceed 1x coverage of the genome. Genome coverage
+    between 0.01 and 0.5x is recommended. The reads should be filtered for
+    quality. The recommended quality filtering is as follows: each read should
+    have a quality score >=10 for 95% of the bases, i.e. if your reads are 100
+    base pairs long, then a read only passes this quality threshold if 95
+    bases have a quality of 10 or higher. Additionally, any reads containing
+    indeterminate base pairs (indicated as N in the reads) should be removed.
+    Finally, if either one of the reads in a pair fails to meet the
+    aforementioned thresholds, **both** sequences should be removed.
+    example of interlaced input format::
+    
+      >0001_f
+      CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
+      >0001_r
+      GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
+      >0002_f
+      ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
+      >0002_r
+      TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
+      >0003_f
+      TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
+      >0003_r
+      TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
+      ...
+
+
+    To perform the quality filtering on your fastQ formatted data as described
+    above, and to interlace your paired-end sequence reads,
+    please use the `Preprocessing of paired-reads`__  tool.
+
+    .. __: tool_runner?tool_id=paired_fastq_filtering
+
+
+    **Additional parameters**
+
+    **Sample size** defines how many reads will be used during the computation.
+    The default setting of 500,000 reads will enable detection of high copy
+    number satellites within several hours. For higher
+    sensitivity the sample size can be increased. Since the sample size affects
+    memory usage, this parameter may be automatically adjusted to a lower value
+    during the run. The maximum sample size which can be processed depends on the
+    repetitiveness of the analyzed genome. This significantly limits the number of reads
+    that can be analyzed with the TAREAN pipeline.
+
+    **Perform cluster merging**. Families of repetitive elements are
+    frequently split into multiple clusters rather than being represented as a
+    single one. If you do not want to merge clusters based on the presence
+    of broken read pairs, disable this option. 
+    
+    **Use custom repeat database**. This option allows users to perform similarity
+    comparison of identified repeats to their custom databases. The repeat class should
+    be encoded in FASTA headers of database entries in order to allow correct 
+    parsing of similarity hits.
+
+    **Similarity search options** By default sequence reads are compared using
+    mgblast program. Default threshold is explicitly set to 90% sequence
+    similarity spanning at least 55% of the read length (in the case of reads
+    differing in length it applies to the longer one). Additionally, sequence
+    overlap must be at least 55 nt. If you select option for shorter reads
+    than 100 nt,  minimum overlap 55 nt is not required.
+    
+    By default,
+    mgblast search use DUST program to filter out
+    low-complexity sequences. If you want
+    to increase sensitivity of detection of satellites with shorter monomer
+    use option with '*no masking of low complexity repeats*'. Note that omitting
+    DUST filtering will significantly increase running times
+    
+    **Output**
+
+    A list of clusters identified as putative satellite repeats, their genomic
+    abundance and various cluster characteristics are provided. Length and
+    consensus sequences of reconstructed monomers are also shown and
+    accompanied by a detailed output from kmer-based reconstruction including
+    sequences and sequence logos of alternative variants of monomer sequences.
+
+    The output includes an **HTML summary** with a table listing all analyzed
+    clusters. More detailed information about clusters is provided in
+    additional files and directories. All results are also provided as a
+    downloadable **zip archive**. Since read clustering results in
+    thousands of clusters, the search for satellite repeats is limited to
+    a subset of the largest ones corresponding to the most abundant genomic
+    repeats. The default setting of the pipeline is to analyze all clusters containing at least
+    0.01% of the input reads. Besides the satellite repeats, three other
+    groups of clusters are reported in the output (1) LTR-retrotransposons,
+    (2) 45S and 5S rDNA and (3) all remaining clusters passing the size
+    threshold. As (1) and (2) contain sequences with circular
+    graphs, their consensus is calculated in the same way as for satellite
+    repeats. Additionally a **log file** reporting the progress of the
+    computational pipeline is provided.
+
+    
+  </help>
+
+</tool>