Mercurial > repos > petrn > repeatexplorer_test

comparison repex_tarean.xml @ 1:75db56b21a22 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author petrn
date Fri, 20 Dec 2019 12:03:05 +0000
parents
children
comparison
equal deleted inserted replaced
0:0b505bb0a4b0 1:75db56b21a22
1 <tool id="tarean" name="Tandem Repeat Analyzer" version="2.3.6" >
2 <stdio>
3 <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" />
4 <regex match="error" source="stderr" level="fatal" description="Unknown error" />
5 <regex match="warning" source="stderr" level="warning" description="Unknown warning" />
6 <exit_code range="1:" level="fatal" description="Error" />
7 </stdio>
8 <description>Identification of genomic tandem repeats from NGS data</description>
9 <requirements>
10 <requirement type="package" version="3.7">python</requirement>
11 <requirement type="package" version="0.9.1" >pyrserve</requirement>
12 <requirement type="package" version=">956" >last</requirement>
13 <requirement type="package">mafft</requirement>
14 <requirement type="package">imagemagick</requirement>
15 <requirement type="package">blast</requirement>
16 <requirement type="package">diamond</requirement>
17 <requirement type="package">blast-legacy</requirement>
18 <requirement type="package">r-igraph</requirement>
19 <requirement type="package">r-data.tree</requirement>
20 <requirement type="package">r-stringr</requirement>
21 <requirement type="package">r-r2html</requirement>
22 <requirement type="package">r-hwriter</requirement>
23 <requirement type="package">r-dt</requirement>
24 <requirement type="package">r-scales</requirement>
25 <requirement type="package">r-plotrix</requirement>
26 <requirement type="package">r-png</requirement>
27 <requirement type="package">r-plyr</requirement>
28 <requirement type="package">r-dplyr</requirement>
29 <requirement type="package">r-optparse</requirement>
30 <requirement type="package">r-dbi</requirement>
31 <requirement type="package">r-rsqlite</requirement>
32 <requirement type="package">r-rserve</requirement>
33 <requirement type="package">bioconductor-biostrings</requirement>
34 </requirements>
35
36 <command detect_errors="exit_code">
37 export PYTHONHASHSEED=0;
38 ${__tool_directory__}/seqclust --paired --sample ${sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode
39 #if $advanced_options.advanced:
40 --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging
41 #if $advanced_options.custom_library.options_custom_library :
42 -d $advanced_options.custom_library.library extra_database
43 #end if
44 #if $advanced_options.options.options:
45 -opt $advanced_options.options.options
46 #end if
47 #else:
48 -M 0.2
49
50 #end if
51 ${FastaFile} >stdout.log 2> stderr.log ;
52 echo "STDOUT CONTENT:" >> ${log} ;
53 cat stdout.log >> ${log} ;
54 echo "STDERR CONTENT:" >> ${log} ;
55 cat stderr.log >> ${log} &amp;&amp;
56 ${__tool_directory__}/stderr_filter.py stderr.log &amp;&amp;
57 cd tarean_output &amp;&amp;
58 zip -r ${ReportArchive}.zip * &amp;&amp;
59 mv ${ReportArchive}.zip ${ReportArchive} &amp;&amp;
60 cp index.html ${ReportFile} &amp;&amp;
61 mkdir ${ReportFile.files_path} &amp;&amp;
62 cp -r --parents libdir ${ReportFile.files_path} &amp;&amp;
63 cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} &amp;&amp;
64 cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} &amp;&amp;
65 cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls &amp;&amp;
66 cp *.png ${ReportFile.files_path}/ &amp;&amp;
67 cp *.csv ${ReportFile.files_path}/ &amp;&amp;
68 cp *.html ${ReportFile.files_path}/ &amp;&amp;
69 cp *.css ${ReportFile.files_path}/ &amp;&amp;
70 cp *.fasta ${ReportFile.files_path}/ 2>>$log &amp;&amp; rm -r ../tarean_output || :
71
72
73 </command>
74
75 <inputs>
76 <param name="FastaFile" label="paired-end NGS reads" type="data" format="fasta"
77 help="Input file must contain fasta-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of input data format is provided in the help below."/>
78 <param name="sample" label="Sample size" type="integer" value="500000" min="10000"/>
79
80 <conditional name="advanced_options">
81 <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" />
82 <when value="false">
83 <!-- pass -->
84 </when>
85 <when value="true">
86 <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/>
87 <conditional name="custom_library">
88 <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/>
89 <when value="false">
90 <!-- do nothing here -->
91 </when>
92 <when value="true">
93 <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/>
94 </when>
95 </conditional>
96 <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed, cluster with less than 20 reads are not considered at all."/>
97 <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/>
98 <param name="keep_names" label="Keep original sequences names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default sequence are relabeled using integers. If you want to keep original names, use this option."/>
99 <conditional name="options">
100 <param name="options" type="select" label="Similarity search options" help="Different similarity search parameters are used depending on the used input data to adjust search to differences in length and error rate">
101 <option value="ILLUMINA" selected="true">Illumina reads, read length 100nt or more </option>
102 <option value="ILLUMINA_SHORT" selected="false">Illumina reads, shorter than 100nt (Do not use reads shorter than 50nt!) </option>
103 <option value="ILLUMINA_DUST_OFF" selected="false">Illumina reads, no masking of low complexity repeats </option>
104 </param>
105 </conditional>
106 </when>
107 </conditional>
108
109 </inputs>
110 <outputs>
111 <data name="log" format="txt" label="TAREAN log file"/>
112 <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/>
113 <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/>
114 </outputs>
115
116 <help>
117 **HELP**
118
119 TAREAN - TAndem REpeat ANalyzer is a computational pipeline for
120 **unsupervised identification of satellite repeats** from unassembled
121 sequence reads. The pipeline uses low-pass paired-end whole genome
122 sequence reads and performs graph-based clustering. The resulting
123 clusters, representing all types of repeats present in the genome, are
124 then examined to identify those containing circular structures indicative
125 of tandem repeats. A poster summarizing TAREAN principles and
126 implementation can be found `here.`__
127
128
129 .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312
130
131 **Input data**
132
133
134 The analysis requires **paired-end reads** generated by whole genome
135 shotgun sequencing. The data should be provided as a single input file in
136 fasta format with the reads interlaced (see example below). All the pairs
137 must be complete, i.e. both "forward" and "reverse" sequence reads must be
138 present. The reads should all be trimmed to the same length. The optimal
139 size range is between 100 and 200 nucleotides. The number of reads to be
140 analyzed should not exceed 1x coverage of the genome. Genome coverage
141 between 0.01 and 0.5x is recommended. The reads should be filtered for
142 quality. The recommended quality filtering is as follows: each read should
143 have a quality score >=10 for 95% of the bases, i.e. if your reads are 100
144 base pairs long, then a read only passes this quality threshold if 95
145 bases have a quality of 10 or higher. Additionally, any reads containing
146 indeterminate base pairs (indicated as N in the reads) should be removed.
147 Finally, if either one of the reads in a pair fails to meet the
148 aforementioned thresholds, **both** sequences should be removed.
149 example of interlaced input format::
150
151 >0001_f
152 CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
153 >0001_r
154 GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
155 >0002_f
156 ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
157 >0002_r
158 TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
159 >0003_f
160 TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
161 >0003_r
162 TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
163 ...
164
165
166 To perform the quality filtering on your fastQ formatted data as described
167 above, and to interlace your paired-end sequence reads,
168 please use the `Preprocessing of paired-reads`__ tool.
169
170 .. __: tool_runner?tool_id=paired_fastq_filtering
171
172
173 **Additional parameters**
174
175 **Sample size** defines how many reads will be used during the computation.
176 The default setting of 500,000 reads will enable detection of high copy
177 number satellites within several hours. For higher
178 sensitivity the sample size can be increased. Since the sample size affects
179 memory usage, this parameter may be automatically adjusted to a lower value
180 during the run. The maximum sample size which can be processed depends on the
181 repetitiveness of the analyzed genome. This significantly limits the number of reads
182 that can be analyzed with the TAREAN pipeline.
183
184 **Perform cluster merging**. Families of repetitive elements are
185 frequently split into multiple clusters rather than being represented as a
186 single one. If you do not want to merge clusters based on the presence
187 of broken read pairs, disable this option.
188
189 **Use custom repeat database**. This option allows users to perform similarity
190 comparison of identified repeats to their custom databases. The repeat class should
191 be encoded in FASTA headers of database entries in order to allow correct
192 parsing of similarity hits.
193
194 **Similarity search options** By default sequence reads are compared using
195 mgblast program. Default threshold is explicitly set to 90% sequence
196 similarity spanning at least 55% of the read length (in the case of reads
197 differing in length it applies to the longer one). Additionally, sequence
198 overlap must be at least 55 nt. If you select option for shorter reads
199 than 100 nt, minimum overlap 55 nt is not required.
200
201 By default,
202 mgblast search use DUST program to filter out
203 low-complexity sequences. If you want
204 to increase sensitivity of detection of satellites with shorter monomer
205 use option with '*no masking of low complexity repeats*'. Note that omitting
206 DUST filtering will significantly increase running times
207
208 **Output**
209
210 A list of clusters identified as putative satellite repeats, their genomic
211 abundance and various cluster characteristics are provided. Length and
212 consensus sequences of reconstructed monomers are also shown and
213 accompanied by a detailed output from kmer-based reconstruction including
214 sequences and sequence logos of alternative variants of monomer sequences.
215
216 The output includes an **HTML summary** with a table listing all analyzed
217 clusters. More detailed information about clusters is provided in
218 additional files and directories. All results are also provided as a
219 downloadable **zip archive**. Since read clustering results in
220 thousands of clusters, the search for satellite repeats is limited to
221 a subset of the largest ones corresponding to the most abundant genomic
222 repeats. The default setting of the pipeline is to analyze all clusters containing at least
223 0.01% of the input reads. Besides the satellite repeats, three other
224 groups of clusters are reported in the output (1) LTR-retrotransposons,
225 (2) 45S and 5S rDNA and (3) all remaining clusters passing the size
226 threshold. As (1) and (2) contain sequences with circular
227 graphs, their consensus is calculated in the same way as for satellite
228 repeats. Additionally a **log file** reporting the progress of the
229 computational pipeline is provided.
230
231
232 </help>
233
234 </tool>