Mercurial > repos > petrn > repeat_annotation_pipeline
diff format_repeat_library.xml @ 0:d14182506989 draft default tip
"planemo upload commit d7966a292ed4209f4058e77ab8c0e49a67847b16-dirty"
| author | petrn |
|---|---|
| date | Tue, 15 Feb 2022 16:44:31 +0000 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/format_repeat_library.xml Tue Feb 15 16:44:31 2022 +0000 @@ -0,0 +1,95 @@ +<tool id="annotate_contigs" name="Format Repeat Library" version="0.1.0" python_template_version="3.5"> + <requirements> + <requirement type="package" version="2.60.0">bioconductor-biostrings</requirement> + </requirements> + <command detect_errors="exit_code"><![CDATA[ + $__tool_directory__/annotate_contigs.R '$contigs' '$cluster_table' '$annotated_contigs' + ]]></command> + <inputs> + <param type="data" name="contigs" format="fasta" label="Contigs - Library of Repeats from TAREAN/RepeatExplorer pipeline" /> + <param type="data" name="cluster_table" format="txt" label="CLUSTER_TABLE from RepeatExplorer pipeline" help="CLUSTER_TABLE which contain annotation of clusters from RepeatExplorer pipeline"/> + </inputs> + <outputs> + <data name="annotated_contigs" format="fasta" label="Annotated Repeat Library based on ${contigs.hid} and ${cluster_table.hid}" /> + </outputs> + <help><![CDATA[ + **What this tool does** + +Contigs from RepeatExplorer archive are annotated based on the classification of repeats from cluster_table. + +Preformated CLUSTER_TABLE can be extracted from RepeatExplorer archive and modified accordingly. By default, "Final_annotation" column is used to append annotation to contigs in repeat library (based on the cluster id). If "Final_annotation" column is incomplete, "Automatic_annotation" column is used instead. + +Example of tab delimited CLUSTER_TABLE:: + + + "Number_of_reads_in_clusters" 3886 + "Number_of_clusters" 822 + "Number_of_superclusters" 821 + "Number_of_singlets" 6114 + "Number_of_analyzed_reads" 10000 + + "Cluster" "Supercluster" "Size" "Size_adjusted" "Automatic_annotation" "TAREAN_annotation" "Final_annotation" + 1 1 260 260 "All/repeat/satellite" "Putative satellites (low confidence)" "" + 2 2 157 157 "All/repeat/satellite" "Putative satellites (low confidence)" "" + 3 4 100 100 "All" "Other" "" + 4 5 83 83 "All" "Other" "" + 5 3 77 77 "All" "Other" "" + 6 3 65 65 "All" "Other" "" + 7 6 61 61 "All" "Other" "" + 8 7 58 58 "All" "Other" "" + 9 8 53 53 "All" "Other" "" + 10 9 53 53 "All" "Other" "" + 11 10 51 51 "All" "Other" "" + 12 11 45 45 "All" "Other" "" + 13 12 44 44 "All" "Other" "" + 14 13 44 44 "All" "Other" "" + 15 14 39 39 "All" "Other" "" + 16 15 37 37 "All" "Other" "" + 17 16 30 30 "All/repeat/satellite" "Putative satellites (low confidence)" "" + 18 17 28 28 "All/repeat/satellite" "Putative satellites (low confidence)" "" + 19 18 26 26 "All/repeat/satellite" "Putative satellites (high confidence)" "" + 20 19 23 23 "All/repeat/../CRM" "Other" "" + 21 20 21 21 "All" "Other" "" + 22 21 21 21 "All" "Other" "" + 23 22 21 21 "All" "Other" "" + 24 23 21 21 "All" "Other" "" + 25 24 20 20 "All/repeat/../Ogre" "Other" "" + + +Only Cluster, Automatic_annotation/Final_annnotation are mandatory" + +Clusters with higher number than those in CLUSTER_TABLE are removed from Repeat library + +Contigs are provided in followinf format:: + + + >CL25Contig1 + AGATCAAGATGGCGCCGGAGGACATGGAGAAAACGACGTTTATCACTCCCTGGGGAACATTTTGCTACAAGGTAATGCCT + TTCGGTCTGAAGAACGCAGGGGCCACTTACCAACGAGCAATGGTAACTT + >CL1Contig4#All/repeat/satellite + ACCCGAAGGCCGGCTCAACCCGAAGTTGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGA + A + >CL1Contig5 + TGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACCCGAAGT + TGATAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACACGAAGT + TGAGAGGAACATCTGACCTCGCCGTCAGGCATCTGTTAAA + + +Resulting repeat library will have following format:: + + >CL25Contig1#All/repeat/mobile_element/Class_I/LTR/Ty3_gypsy/non-chromovirus/OTA/Tat/Ogre + AGATCAAGATGGCGCCGGAGGACATGGAGAAAACGACGTTTATCACTCCCTGGGGAACATTTTGCTACAAGGTAATGCCT + TTCGGTCTGAAGAACGCAGGGGCCACTTACCAACGAGCAATGGTAACTT + >CL1Contig4#All/repeat/satellite + ACCCGAAGGCCGGCTCAACCCGAAGTTGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGA + A + >CL1Contig5#All/repeat/satellite + TGAGAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACCCGAAGT + TGATAAGAACATCTGACCTCGCCGTCAGGCATCTGTTAAACAAACAGGCATCGAACCCGAAGGCCGGCTCAACACGAAGT + TGAGAGGAACATCTGACCTCGCCGTCAGGCATCTGTTAAA + + + + + ]]></help> +</tool>
