Mercurial > repos > peterjc > mira_assembler
annotate test-data/tvc_contigs.fasta @ 23:83a94a5038a7 draft
planemo upload for repository https://github.com/peterjc/galaxy_mira/tree/master/tools/mira3/ commit fd979d17340cde155de176604744831d9597c6b6
| author | peterjc | 
|---|---|
| date | Thu, 18 May 2017 13:35:41 -0400 | 
| parents | e810e45bdad7 | 
| children | 
| rev | line source | 
|---|---|
| 7 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 1 >mira_c1 | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 2 ttagcgtggtcgcggccgaggtaccctctaccatgaaaccaggcttgggtccctctggct | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 3 gtctcttggtgctgataatcttaccttgtgccttggcctcagccttcaacttatcgttct | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 4 tcttgatcctctccatgatctcctcatggcaccttgatggctggacatgttccacacgaa | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 5 catgaatcctcttccttatgattctgtttccaacctgcttgttgacctcaacaccaacag | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 6 cacgcttggtgacgttccatacccgacccgtgcggccatgatagaacttgtggggcatac | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 7 ctttgtggatcgacccgttaaccttgacatcaacatagtcgccgactttgaagatacgaa | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 8 ggtaagttgtgagatgggtaggacccttcttcctgaatgcccgagcaaatagatctctgg | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 9 tgcgcgaccccaaaccgtgacccgccggcattttgcggtgtttttcagacctgcccgggc | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 10 ggccgctcgaaa | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 11 >mira_c2 | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 12 tttcgagcggycgcccggscgaggtaccctscaccatgaaaccaggcttgggtccctcwg | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 13 gctgyctcttggtgctgataatcttwccytgtgccttkgcctcagccttcaacttatcrt | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 14 tcttcttgatcctctccattatctcctcatggcamckagatggctggacatgttccacac | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 15 gaacatgaatcctcttccttatgattctgtttccaacctgyttgttgacctcaacaccaa | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 16 cagcgcgcttggtgacgttccatacccgacccgtgcggccatggtagaacttgtggggca | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 17 tacctttgtggatcgacccgttaaccttgacatcaacatagtcgccgactttgaagatac | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 18 gaaggtaagttgtgagatgggtaggacccttcttcctgaatgcccgagcaaatagatccc | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 19 tggtgcgtgacctcaaaccgtgacccgccggcattttgaggtgtttttcagacctgcccg | 
| 
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
 peterjc parents: diff
changeset | 20 ggcggccgctcgaaa | 
