Mercurial > repos > peterjc > mira_assembler
annotate test-data/tvc_contigs.fasta @ 25:56dede4f0735 draft
planemo upload for repository https://github.com/peterjc/galaxy_mira/tree/master/tools/mira3/ commit 9526de68e38a82bb84b2d9267a8c290c6adcaa65
| author | peterjc |
|---|---|
| date | Fri, 15 Sep 2017 10:08:39 -0400 |
| parents | e810e45bdad7 |
| children |
| rev | line source |
|---|---|
|
7
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
1 >mira_c1 |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
2 ttagcgtggtcgcggccgaggtaccctctaccatgaaaccaggcttgggtccctctggct |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
3 gtctcttggtgctgataatcttaccttgtgccttggcctcagccttcaacttatcgttct |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
4 tcttgatcctctccatgatctcctcatggcaccttgatggctggacatgttccacacgaa |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
5 catgaatcctcttccttatgattctgtttccaacctgcttgttgacctcaacaccaacag |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
6 cacgcttggtgacgttccatacccgacccgtgcggccatgatagaacttgtggggcatac |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
7 ctttgtggatcgacccgttaaccttgacatcaacatagtcgccgactttgaagatacgaa |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
8 ggtaagttgtgagatgggtaggacccttcttcctgaatgcccgagcaaatagatctctgg |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
9 tgcgcgaccccaaaccgtgacccgccggcattttgcggtgtttttcagacctgcccgggc |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
10 ggccgctcgaaa |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
11 >mira_c2 |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
12 tttcgagcggycgcccggscgaggtaccctscaccatgaaaccaggcttgggtccctcwg |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
13 gctgyctcttggtgctgataatcttwccytgtgccttkgcctcagccttcaacttatcrt |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
14 tcttcttgatcctctccattatctcctcatggcamckagatggctggacatgttccacac |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
15 gaacatgaatcctcttccttatgattctgtttccaacctgyttgttgacctcaacaccaa |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
16 cagcgcgcttggtgacgttccatacccgacccgtgcggccatggtagaacttgtggggca |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
17 tacctttgtggatcgacccgttaaccttgacatcaacatagtcgccgactttgaagatac |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
18 gaaggtaagttgtgagatgggtaggacccttcttcctgaatgcccgagcaaatagatccc |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
19 tggtgcgtgacctcaaaccgtgacccgccggcattttgaggtgtttttcagacctgcccg |
|
e810e45bdad7
Uploaded v0.0.8, first attempt at unit test. Known to fail on local Galaxy install, suspected to be a test framework limitation.
peterjc
parents:
diff
changeset
|
20 ggcggccgctcgaaa |
