Mercurial > repos > mvdbeek > yac_clipper
view yac.xml @ 0:4e7e60666d9f draft default tip
Uploaded
author | mvdbeek |
---|---|
date | Sun, 29 Mar 2015 09:39:35 -0400 |
parents | |
children |
line wrap: on
line source
<tool id="yac" name="Clip adapter" version="1.3.2"> <description /> <command interpreter="python">yac.py --input $input --output $output --output_format "$out_format" --adapter_to_clip $clip_source.clip_sequence --min $min --max $max --Nmode $Nmode </command> <inputs> <param format="fastq" label="Source file" name="input" type="data" /> <param label="min size" name="min" size="4" type="integer" value="15" /> <param label="max size" name="max" size="4" type="integer" value="36" /> <param label="Select output format" name="out_format" type="select"> <option selected="true" value="fasta">Fasta format</option> <option value="fastq">Fastq format</option> </param> <param label="Accept reads containing N?" name="Nmode" type="select"> <option selected="True" value="accept">accept</option> <option value="reject">reject</option> </param> <conditional name="clip_source"> <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select"> <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option> <option value="user">Use custom sequence</option> </param> <when value="prebuilt"> <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select"> <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option> <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option> <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option> <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option> </param> </when> <when value="user"> <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" /> </when> </conditional> </inputs> <outputs> <data format="fasta" metadata="input" name="output" /> <change_format> <when format="fastq" input="out_format" value="fastq" /> </change_format> </outputs> <tests> <test> <param ftype="fastqsanger" name="input" value="yac.fastq" /> <param name="min" value="18" /> <param name="max" value="29" /> <param name="clip_source_list" value="prebuilt" /> <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" /> <param name="Nmode" value="accept" /> <output file="yac.out" name="output" /> </test> <test> <param ftype="fastqsanger" name="input" value="yac.fastq" /> <param name="min" value="18" /> <param name="max" value="29" /> <param name="clip_source_list" value="prebuilt" /> <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" /> <param name="Nmode" value="accept" /> <param name="out_format" value="fastq" /> <output file="yac_fastq.out" name="output" /> </test> </tests> <help> This tool clips adapter sequences from a fastq file and fasta file of clipped reads with renumbered fasta headers. Clipped sequences with Ns can be discarded. Min size and max size filter clipped reads on their size. Note that unclipped reads that satisfy the min and max size conditions are kept. </help> </tool>