# HG changeset patch
# User mvdbeek
# Date 1489489873 14400
# Node ID c7ee722e48adfdf3f4574b4b6230e405b61102e8
# Parent  ddd06bee6a927ff7adf4071a7339910256a73784
planemo upload for repository https://github.com/bardin-lab/readtagger/tree/master/galaxy commit 13fe863ca4079d83d897fdf7e394a7474eea6117

diff -r ddd06bee6a92 -r c7ee722e48ad add_matesequence.xml
--- a/add_matesequence.xml	Thu Mar 09 12:25:18 2017 -0500
+++ b/add_matesequence.xml	Tue Mar 14 07:11:13 2017 -0400
@@ -1,7 +1,7 @@
-<tool id="add_matesequence" name="Add matesequence" version="0.3.6">
+<tool id="add_matesequence" name="Add matesequence" version="0.3.7">
     <description>into tag field</description>
     <requirements>
-        <requirement type="package" version="0.3.6">readtagger</requirement>
+        <requirement type="package" version="0.3.7">readtagger</requirement>
     </requirements>
     <version_command>add_matesequence --version</version_command>
     <command detect_errors="aggressive"><![CDATA[
diff -r ddd06bee6a92 -r c7ee722e48ad allow_dovetailing.xml
--- a/allow_dovetailing.xml	Thu Mar 09 12:25:18 2017 -0500
+++ b/allow_dovetailing.xml	Tue Mar 14 07:11:13 2017 -0400
@@ -1,7 +1,7 @@
-<tool id="allow_dovetailing" name="Allow dovetailing" version="0.3.6">
+<tool id="allow_dovetailing" name="Allow dovetailing" version="0.3.7">
     <description>modifies proper_pair flag in bam files</description>
     <requirements>
-        <requirement type="package" version="0.3.6">readtagger</requirement>
+        <requirement type="package" version="0.3.7">readtagger</requirement>
     </requirements>
     <command detect_errors="aggressive"><![CDATA[
         allow_dovetailing -i '$input' -o '$output'
diff -r ddd06bee6a92 -r c7ee722e48ad bam_readtagger.xml
--- a/bam_readtagger.xml	Thu Mar 09 12:25:18 2017 -0500
+++ b/bam_readtagger.xml	Tue Mar 14 07:11:13 2017 -0400
@@ -1,10 +1,10 @@
-<tool id="bam_readtagger" name="Tag alignment files" version="0.3.6">
+<tool id="bam_readtagger" name="Tag alignment files" version="0.3.7">
     <description>from multiple bam files</description>
     <macros>
         <import>macros.xml</import>
     </macros>
     <requirements>
-        <requirement type="package" version="0.3.6">readtagger</requirement>
+        <requirement type="package" version="0.3.7">readtagger</requirement>
     </requirements>
     <command detect_errors="aggressive"><![CDATA[
         readtagger -t '$tag_file' -a
diff -r ddd06bee6a92 -r c7ee722e48ad findcluster.xml
--- a/findcluster.xml	Thu Mar 09 12:25:18 2017 -0500
+++ b/findcluster.xml	Tue Mar 14 07:11:13 2017 -0400
@@ -1,12 +1,15 @@
-<tool id="findcluster" name="Find clusters of reads" version="0.3.6">
+<tool id="findcluster" name="Find clusters of reads" version="0.3.7">
     <description>in bam files</description>
     <requirements>
-        <requirement type="package" version="0.3.6">readtagger</requirement>
+        <requirement type="package" version="0.3.7">readtagger</requirement>
     </requirements>
     <version_command>findcluster --version</version_command>
     <command detect_errors="aggressive"><![CDATA[
         findcluster
         --input_path '$input'
+        #if $reference_fasta:
+            --reference_fasta '$reference_fasta'
+        #end if
         --output_bam '$output_bam'
         --output_gff '$output_gff'
         --sample_name '$input.element_identifier'
@@ -14,6 +17,7 @@
     ]]></command>
     <inputs>
         <param name="input" argument="--input_path" type="data" format="bam"/>
+        <param argument="--reference_fasta" label="Reference Fasta" help="Reconstructed contigs at clusters will be blasted against this sequence." type="data" format="fasta" optional="True"/>
     </inputs>
     <outputs>
         <data name="output_bam" format="bam" label="findcluster BAM on $on_string"/>
@@ -25,24 +29,45 @@
             <output name="output_bam" file="three_cluster_out.bam" ftype="bam" lines_diff="2"/>
             <output name="output_gff" file="three_cluster_out.gff" ftype="gff3" lines_diff="0"/>
         </test>
+        <test>
+            <param name="input" value="extended_and_annotated_roi.bam" ftype="bam"/>
+            <param name="reference_fasta" value="reference.fasta" ftype="fasta"/>
+            <output name="output_bam" file="three_cluster_out.bam" ftype="bam" lines_diff="2"/>
+            <output name="output_gff">
+                <assert_contents>
+                    <has_text text="FBti0019066_rover_Gypsy" />
+                </assert_contents>
+            </output>
+        </test>
     </tests>
     <help><![CDATA[
 .. code-block::
 
-    Find clusters of reads that support a TE insertion.
+    Usage: findcluster [OPTIONS]
+
+      Find clusters of reads that support a TE insertion.
 
-    optional arguments:
-      -h, --help            show this help message and exit
-      --input_path INPUT_PATH
-                            Find cluster in this BAM file. (default: None)
-      --output_bam OUTPUT_BAM
-                            Write out BAM file with cluster information to this
-                            path. Reads will have an additional "CD" tag to
-                            indicate the cluster number (default: None)
-      --output_gff OUTPUT_GFF
-                            Write out GFF file with cluster information to this
-                            path. (default: None)
-      --version             show program's version number and exit
+        Options:
+      --input_path PATH               Find cluster in this BAM file.
+      --output_bam PATH               Write out BAM file with cluster information
+                                      to this path. Reads will have an additional
+                                      "CD" tag to indicate the cluster number
+      --output_gff PATH               Write out GFF file with cluster information
+                                      to this path.
+      --sample_name TEXT              Sample name to use when writing out clusters
+                                      in GFF file. Default is to infer the name
+                                      from the input filename.
+      --include_duplicates / --no-include_duplicates
+                                      Include reads marked as duplicates when
+                                      finding clusters.
+      --reference_fasta TEXT          Blast cluster contigs against this fasta
+                                      file
+      --blastdb TEXT                  Blast cluster contigs against this blast
+                                      database
+      --threads INTEGER RANGE         Threads to use for cap3 assembly step
+      --version                       Show the version and exit.
+      --help                          Show this message and exit.
+
 
 ]]></help>
 </tool>
diff -r ddd06bee6a92 -r c7ee722e48ad test-data/reference.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/reference.fasta	Tue Mar 14 07:11:13 2017 -0400
@@ -0,0 +1,2 @@
+>FBti0019066_rover_Gypsy
+AGTAACATAATATGCTTCTCATATTACGTTTACATACTTACACTAATTGTACATACAATCTTGCACATGCATAAACACATGAAACCAGTTTACATTTTTACTTACACTTAAGCGCATAATTTGTTGTGCATCCATACCGTTATTTTTCCGTTCTTTTTTGTACACATATACTGATTAGACATTCCCGTTTCTCGCGACTCACTTCGAGCCGATCAAAAACTCTGTACAGTCAGTCTTAAGCCGACAACGAAGAAATAAAGATCTAAACTAAAAAATACCTCGTGTTGATTCTTTCAAATCCGAAACTTCTTTAAAGGCGTTGATCTTAGTCAAACGACGGATCATTTGTTCGACTCGAAAAGTAAAATACGTAAGT
diff -r ddd06bee6a92 -r c7ee722e48ad update_mapq.xml
--- a/update_mapq.xml	Thu Mar 09 12:25:18 2017 -0500
+++ b/update_mapq.xml	Tue Mar 14 07:11:13 2017 -0400
@@ -1,7 +1,7 @@
-<tool id="update_mapq" name="Update MAPQ score" version="0.3.6">
+<tool id="update_mapq" name="Update MAPQ score" version="0.3.7">
     <description>of supplementary alignments</description>
     <requirements>
-        <requirement type="package" version="0.3.6">readtagger</requirement>
+        <requirement type="package" version="0.3.7">readtagger</requirement>
     </requirements>
     <version_command>update_mapq --version</version_command>
     <command detect_errors="aggressive"><![CDATA[
@@ -9,7 +9,7 @@
     ]]></command>
     <inputs>
         <param argument="--source_path" label="Update supplementary MAPQ scores in this BAM file" type="data" format="bam"/>
-        <param argument="--remapped_path" label="Extarct MAPQ scores for secondary alignments from this BAM file." type="data" format="bam"/>
+        <param argument="--remapped_path" label="Extract MAPQ scores for secondary alignments from this BAM file." type="data" format="bam"/>
     </inputs>
     <outputs>
         <data name="output_path" format="bam"/>
diff -r ddd06bee6a92 -r c7ee722e48ad write_supplementary_fastq.xml
--- a/write_supplementary_fastq.xml	Thu Mar 09 12:25:18 2017 -0500
+++ b/write_supplementary_fastq.xml	Tue Mar 14 07:11:13 2017 -0400
@@ -1,7 +1,7 @@
-<tool id="write_supplementary_fastq" name="Extract supplementary alignments" version="0.3.6">
+<tool id="write_supplementary_fastq" name="Extract supplementary alignments" version="0.3.7">
     <description>from SAM/BAM alignment files as FASTQ</description>
     <requirements>
-        <requirement type="package" version="0.3.6">readtagger</requirement>
+        <requirement type="package" version="0.3.7">readtagger</requirement>
     </requirements>
     <version_command>write_supplementary_fastq --version</version_command>
     <command detect_errors="aggressive"><![CDATA[