--- a/data_manager/dada2_fetcher.xml	Fri Mar 08 05:38:44 2019 -0500
+++ b/data_manager/dada2_fetcher.xml	Tue Apr 09 07:18:57 2019 -0400
@@ -1,90 +1,174 @@
 <?xml version="1.0"?>
-<tool id="dada_fetcher" name="dada2 dada manager" tool_type="manage_data" version="0.0.5">
-    <description>Download reference data sets</description>
-    <command detect_errors="exit_code">
-    <![CDATA[
-    python '$__tool_directory__/data_manager.py' 
+<tool id="dada_fetcher" name="dada2 data manager" version="0.0.5">
+    <description>Download reference databases</description>
+    <command detect_errors="exit_code"><![CDATA[
+    python '$__tool_directory__/data_manager.py'
     --out '${out_file}'
-    --dataset '$database_name'
+    --dataset '$db_cond.db_select'_'$db_cond.version_select'
     ]]>
     </command>
     <inputs>
-        <param name="database_name" type="select" label="mapping data">
-            <option value="silva132">Silva version 132</option>
-            <option value="silva128">Silva version 128</option>
-            <option value="rdp16">RDP trainset 16</option>
-            <option value="rdp14">RDP trainset 14</option>
-            <option value="gg13.84">GreenGenes version 13.84</option>
-            <option value="unite8.0_fungi">UNITE: General Fasta release 8.0 for Fungi</option>
-            <option value="unite8.0_fungi_singletons">UNITE: General Fasta release 8.0 for Fungi including global and 97% singletons</option>
-            <option value="unite8.0_euka">UNITE: General Fasta release 8.0 for all Eukaryotes</option>
-            <option value="unite8.0_euka_singletons">UNITE: General Fasta release 8.0 for all Eukaryotes including global and 97% singletons</option>
-            <option value="RefSeq_RDP_2018_05">NCBI RefSeq 16S rRNA database supplemented by RDP (05/2018)</option>
-            <option value="gtdb_2018_11_20">GTDB: Genome Taxonomy Database (Bacteria &amp; Archaea) (11/2018)</option>
-            <option value="hitdb1">HitDB version 1 (Human InTestinal 16S)</option>
-            <option value="silva132_euk_18S">Silva version 132 Eukaryotic 18S</option>
-            <option value="PR2v4.11.1">Protist Ribosomal Reference database (PR2) 4.11.1</option>
-        </param>
+        <conditional name="db_cond">
+            <param name="db_select" type="select" label="Taxonomic database">
+                <option value="silva">Silva</option>
+                <option value="rdp">RDP</option>
+                <option value="greengenes">GreenGenes</option>
+                <option value="unite">UNITE: General Fasta</option>
+                <option value="RefSeq_RDP">NCBI RefSeq 16S rRNA database supplemented by RDP</option>
+                <option value="gtdb">GTDB: Genome Taxonomy Database (Bacteria &amp; Archaea)</option>
+                <option value="hitdb">HitDB (Human InTestinal 16S)</option>
+                <option value="silva_euk_18S">Silva Eukaryotic 18S</option>
+                <option value="PR2">Protist Ribosomal Reference database (PR2)</option>
+            </param>
+            <when value="silva">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="132">132</option>
+                    <option value="128">128</option>
+                </param>
+            </when>
+            <when value="rdp">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="16">16</option>
+                    <option value="14">14</option>
+                </param>
+            </when>
+            <when value="greengenes">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="13.84">13.84</option>
+                </param>
+            </when>
+            <when value="unite">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="8.0_fungi">release 8.0 for Fungi</option>
+                    <option value="8.0_fungi_singleton">release 8.0 for Fungi including global and 97% singletons</option>
+                </param>
+            </when>
+            <when value="RefSeq_RDP">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="2018_05">05/2018</option>
+                </param>
+            </when>
+            <when value="gtdb">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="2018_11">11/2018</option>
+                </param>
+            </when>
+            <when value="hitdb">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="1">1</option>
+                </param>
+            </when>
+            <when value="silva_euk_18S">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="132">132</option>
+                </param>
+            </when>
+            <when value="PR2">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="4.11.1">4.11.1</option>
+                </param>
+            </when>
+        </conditional>
     </inputs>
     <outputs>
         <data name="out_file" format="data_manager_json" />
     </outputs>
     <tests>
         <test>
-            <param name="database_name" value="silva132"/>
+            <param name="db_cond|db_select" value="silva"/>
+            <param name="db_cond|db_version" value="132"/>
             <output name="out_file" file="silva132_json"/>
         </test>
+        <test>
+            <param name="db_cond|db_select" value="rdp"/>
+            <param name="db_cond|db_version" value="16"/>
+            <output name="out_file" file="rdp16_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="greengenes"/>
+            <param name="db_cond|db_version" value="13.84"/>
+            <output name="out_file" file="greengenes13.84_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="unite"/>
+            <param name="db_cond|db_version" value="8.0_fungi"/>
+            <output name="out_file" file="unite8fungi_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="RefSeq_RDP"/>
+            <param name="db_cond|db_version" value="2018_05"/>
+            <output name="out_file" file="RefSeq_RDP2018_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="gtdb"/>
+            <param name="db_cond|db_version" value="2018_11"/>
+            <output name="out_file" file="gtdb2018_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="hitdb"/>
+            <param name="db_cond|db_version" value="1"/>
+            <output name="out_file" file="hitdb1_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="silva_euk_18S"/>
+            <param name="db_cond|db_version" value="132"/>
+            <output name="out_file" file="silvaeuk132_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="PR2"/>
+            <param name="db_cond|db_version" value="4.11.1"/>
+            <output name="out_file" file="PR24.11.1_json"/>
+        </test>
     </tests>
     <help><![CDATA[
-Public Reference data sets
---------------------------
+Public Reference databases maintained by the DADA2 project
+..........................................................
 
-The following 16S data sets are taken from the list of data sets maintained by the DADA2 project (https://benjjneb.github.io/dada2/training.html)
+The following refrence databases which are describes as maintained by the DADA2 project (https://benjjneb.github.io/dada2/training.html) are available
 
-- Silva version 132
-- Silva version 128
-- RDP trainset 16 + RDP database release 11.5</option>
-- RDP trainset 14
-- GreenGenes version 13.8
+- Silva (https://www.arb-silva.de/)
+- RDP (http://rdp.cme.msu.edu/)
+- GreenGenes (http://greengenes.secondgenome.com/)
+- UNITE general FASTA (https://unite.ut.ee/repository.php)
 
-While the Silva and RDP data sets contain reference data bases for taxonomy and species assignment, the greengenes data set only contains a reference data base for taxonomy assignment.
+While Silva and RDP contain reference databases for taxonomy and species assignment, the greengenes and UNITE databases only contains a reference database for taxonomy assignment.
 
-For the Silva data sets consider to check the license information: http://www.arb-silva.de/silva-license-information.
+For the Silva databases check the license information: http://www.arb-silva.de/silva-license-information.
 
-
+Except for UNITE all reference databases are downloaded from the corresponding zenodo links that are listed on the DADA2 website. The UNITE databases are taken from the links provided on the UNITE website
 
-(More info: http://gtdb.ecogenomic.org/)
-
-https://github.com/pr2database/pr2database
+More detailed informations in the reference data bases can be found on the DADA2 website and contained links: https://benjjneb.github.io/dada2/training.html.
 
+Further public Reference databases listed by the DADA2 project
+..............................................................
 
-Custom Reference data sets
---------------------------
+Several contributed reference databases are listed of the DADA2 project website (https://benjjneb.github.io/dada2/training.html):
 
-For ** taxonomy assignment ** the following is needed: 
+- RefSeq + RDP (NCBI RefSeq 16S rRNA database supplemented by RDP)
+- GTDB: Genome Taxonomy Database (More info: http://gtdb.ecogenomic.org/)
+- HitDB version 1 (Human InTestinal 16S rRNA) (https://github.com/microbiome/HITdb)
+- RDP fungi LSU
+- Silva Eukaryotic 18S
+- PR2 (https://github.com/pr2database/pr2database)
 
-- a reference fasta data base 
-- a comma separated list of taxonomic ranks present in the reference data base 
-
-The reference fasta data base for taxonomic assignment (fasta or compressed fasta) needs to encode the taxonomy corresponding to each sequence in the fasta header lines in the following fashion (note, the second sequence is not assigned down to level 6):
-
-::
+Except for PR2, all reference databases are downloaded from the corresponding zenodo links that are listed on the DADA2 website. The PR2 database is taken from their github page.
 
->Level1;Level2;Level3;Level4;Level5;Level6;
-ACCTAGAAAGTCGTAGATCGAAGTTGAAGCATCGCCCGATGATCGTCTGAAGCTGTAGCATGAGTCGATTTTCACATTCAGGGATACCATAGGATAC
->Level1;Level2;Level3;Level4;Level5;
-CGCTAGAAAGTCGTAGAAGGCTCGGAGGTTTGAAGCATCGCCCGATGGGATCTCGTTGCTGTAGCATGAGTACGGACATTCAGGGATCATAGGATAC
-
-The list of required taxonomic ranks could be for instance: "Kingdom,Phylum,Class,Order,Family,Genus"
-
-The reference data base for ** species assignment ** is a fasta file (or compressed fasta file), with the id line formatted as follows:
-
-::
-
->ID Genus species
-ACCTAGAAAGTCGTAGATCGAAGTTGAAGCATCGCCCGATGATCGTCTGAAGCTGTAGCATGAGTCGATTTTCACATTCAGGGATACCATAGGATAC
->ID Genus species
-CGCTAGAAAGTCGTAGAAGGCTCGGAGGTTTGAAGCATCGCCCGATGGGATCTCGTTGCTGTAGCATGAGTACGGACATTCAGGGATCATAGGATAC
+More detailed informations in the reference data bases can be found on the DADA2 website and contained links: https://benjjneb.github.io/dada2/training.html.
     ]]></help>
+    <citations>
+        <!-- silva -->
+         <citation type="doi">10.1093/nar/gks1219</citation>
+        <!-- rdp -->>
+        <citation type="doi">10.1093/nar/gkt1244</citation>
+        <!-- greengenes -->
+        <citation type="doi">10.1128/AEM.03006-05</citation>
+        <!-- unite -->
+        <citation type="doi">10.15156/BIO/786343</citation>
+        <!-- TODO gtdb ??? -->
+        <!-- hitdb -->
+        <citation type="doi">10.1186/s12864-015-2265-y</citation>
+        <!-- PR2 -->
+        <citation type="doi">10.1093/nar/gks1160</citation>
+    </citations>
 </tool>