Mercurial > repos > jjohnson > trinityrnaseq

comparison transcriptsToOrfs.xml @ 2:5eb99d21ef0d

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Add trinityrnaseq_norm and transcriptsToOrfs tools
author Jim Johnson <jj@umn.edu>
date Thu, 05 Sep 2013 08:08:21 -0500
parents
children
comparison
equal deleted inserted replaced
1:a34ce2b18877 2:5eb99d21ef0d
1 <tool id="transcriptsToOrfs" name="transcriptsToOrfs" version="0.0.2">
2 <description>Trinity Transcripts to Candidate Peptides</description>
3 <requirements>
4 <requirement type="package" version="2013_08_14">trinityrnaseq</requirement>
5 <requirement type="package" version="3.0">hmmer</requirement>
6 </requirements>
7 <command>
8 \$TRINITY_HOME/trinity-plugins/transdecoder/transcripts_to_best_scoring_ORFs.pl
9 -t $transcripts
10 #if $min_prot_length:
11 -m $min_prot_length
12 #end if
13 #if $retain_long_orfs:
14 --retain_long_orfs $retain_long_orfs
15 #end if
16 #if $training_count:
17 -T $training_count
18 #end if
19 #if str($strand_specificity) == 'SS':
20 -S
21 #end if
22 #if $genetic_code.__str__ != '':
23 -G $genetic_code
24 #end if
25 #if $search.use_pfam == 'yes':
26 --search_pfam "${ filter( lambda x: str( x[0] ) == str( $search.pfam_db ), $__app__.tool_data_tables[ 'pfam_databases' ].get_fields() )[0][-1] }"
27 --CPU $search.CPU
28 #end if
29 </command>
30 <inputs>
31 <param format="fasta" name="transcripts" type="data" label="Transcripts sequences in fastA format" help="" />
32 <param name="min_prot_length" type="integer" value="" optional="true" label="Minimum peptide length (in amino acids)" help="default: 100">
33 <validator type="in_range" message="Minimum peptide length should be at least 50" min="50" />
34 </param>
35 <param name="retain_long_orfs" type="integer" value="" optional="true" label="Retain all ORFs found that are of minimum length in nucleotides" help="default: 900" >
36 <validator type="in_range" message="ORF length should be at least 50" min="50" />
37 </param>
38 <param name="training_count" type="integer" value="" optional="true" label="Number of top longest ORFs to train Markov Model (hexamer stats)" help="default: 500" >
39 <validator type="in_range" message="ORF count should be at least 50" min="50" />
40 </param>
41 <param name="strand_specificity" type="select" label="Strand specificity type">
42 <option value="DS">NOT strand specific, examine both strands</option>
43 <option value="SS">Strand specific, examine only top strand</option>
44 </param>
45 <param name="genetic_code" type="select" label="Genetic Code">
46 <option value="">use default(universal)</option>
47 <option value="universal">universal</option>
48 <option value="Euplotes">Euplotes</option>
49 <option value="Tetrahymena">Tetrahymena</option>
50 <option value="Candida">Candida</option>
51 <option value="Acetabularia">Acetabularia</option>
52 </param>
53 <conditional name="search">
54 <param name="use_pfam" type="select" label="Search PFAM database">
55 <option value="no">NO</option>
56 <option value="yes">YES</option>
57 </param>
58 <when value="no"/>
59 <when value="yes">
60 <param name="pfam_db" type="select" label="Pfam database">
61 <options from_data_table="pfam_databases" />
62 </param>
63 <param name="CPU" type="integer" value="2" min="1" label="CPU" help="Number of CPUs to use by hmmscan" />
64 </when>
65 </conditional>
66 </inputs>
67 <stdio>
68 <exit_code range="1:" level="fatal" description="Failed" />
69 <regex match="Error"
70 source="stderr"
71 level="fatal"
72 description="Failed" />
73 </stdio>
74 <outputs>
75 <data format="txt" name="trinity_pep_pfam" label="${tool.name} on ${on_string}: Pfam matches to Candidate Peptide Sequences" from_work_dir="longest_orfs.pep.pfam.dat">
76 <filter>search['use_pfam'] == 'yes'</filter>
77 </data>
78 <data format="gff3" name="trinity_pep_gff3" label="${tool.name} on ${on_string} Candidate Peptide Features" from_work_dir="best_candidates.eclipsed_orfs_removed.gff3" />
79 <data format="bed" name="trinity_pep_bed" label="${tool.name} on ${on_string} Candidate Peptide Coordinates" from_work_dir="best_candidates.eclipsed_orfs_removed.bed" />
80 <data format="fasta" name="trinity_pep_cds" label="${tool.name} on ${on_string}: Candidate Peptide CDS Sequences" from_work_dir="best_candidates.eclipsed_orfs_removed.cds"/>
81 <data format="fasta" name="trinity_pep_seqs" label="${tool.name} on ${on_string}: Candidate Peptide Sequences" from_work_dir="best_candidates.eclipsed_orfs_removed.pep"/>
82 </outputs>
83 <tests>
84 <test>
85 <param name="transcripts" ftype="fasta" value="TrinitySingle.fasta"/>
86 <param name="min_prot_length" value="100"/>
87 <param name="use_pfam" value="no"/>
88 <output name="trinity_pep_seqs">
89 <assert_contents>
90 <has_text text="WAAKAWLITARSLYPADF" />
91 </assert_contents>
92 </output>
93 <output name="trinity_pep_cds">
94 <assert_contents>
95 <has_text text="TGGGCAGCCAAGGCATGGCTGATCACGGCCCGCA" />
96 </assert_contents>
97 </output>
98 <output name="trinity_pep_bed">
99 <assert_contents>
100 <has_text text="comp10_c0_seq1" />
101 </assert_contents>
102 </output>
103 <output name="trinity_pep_gff3">
104 <assert_contents>
105 <has_text text="comp10_c0_seq1" />
106 </assert_contents>
107 </output>
108 </test>
109 </tests>
110 <help>
111 ** transcriptsToOrfs **
112 Trinity_ is a de novo transcript assembler that uses RNA-seq data as input.
113 This tool searches for open reading frames in the assembled transcripts.
114
115 .. _Trinity: http://trinityrnaseq.sourceforge.net
116 </help>
117 </tool>