Mercurial > repos > jjohnson > gmap

comparison gsnap.xml @ 5:14561eb803a5 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded v3.0.1b (still working on this prior to main Tool Shed release)
author peterjc
date Fri, 21 Oct 2016 10:55:40 -0400
parents 488e9d642566
children
comparison
equal deleted inserted replaced
4:a88571642c6e 5:14561eb803a5
2 <description>Genomic Short-read Nucleotide Alignment Program</description> 2 <description>Genomic Short-read Nucleotide Alignment Program</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="2013-05-09">gmap</requirement> 4 <requirement type="package" version="2013-05-09">gmap</requirement>
5 </requirements> 5 </requirements>
6 <version_command>gsnap --version</version_command> 6 <version_command>gsnap --version</version_command>
7 <command> 7 <command detect_errors="exit_code"><![CDATA[
8 #import os.path, re 8 #import os.path, re
9 gsnap 9 gsnap
10 --nthreads="4" --ordered 10 --nthreads="4" --ordered
11 #if $refGenomeSource.genomeSource == "gmapdb": 11 #if $refGenomeSource.genomeSource == "gmapdb":
12 --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name 12 --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name
232 2> $gsnap_stderr > $gsnap_fq 232 2> $gsnap_stderr > $gsnap_fq
233 #else 233 #else
234 2> $gsnap_stderr > $gsnap_out 234 2> $gsnap_stderr > $gsnap_out
235 #end if 235 #end if
236 #end if 236 #end if
237 237 ]]></command>
238 </command>
239 <inputs> 238 <inputs>
240 <!-- Input data --> 239 <!-- Input data -->
241 <conditional name="seq"> 240 <conditional name="seq">
242 <param name="format" type="select" label="&lt;H2&gt;Input Sequences&lt;/H2&gt;Select the input format" help=""> 241 <param name="format" type="select" label="&lt;H2&gt;Input Sequences&lt;/H2&gt;Select the input format" help="">
243 <option value="fastq">Fastq</option> 242 <option value="fastq">Fastq</option>
317 <option value="indexed">Use a built-in index</option> 316 <option value="indexed">Use a built-in index</option>
318 <option value="gmapdb">Use a gmapdb from your history</option> 317 <option value="gmapdb">Use a gmapdb from your history</option>
319 </param> 318 </param>
320 <when value="indexed"> 319 <when value="indexed">
321 <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> 320 <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
322 <options from_file="gmap_indices.loc"> 321 <options from_data_table="gmap_indices">
323 <column name="uid" index="0" /> 322 <column name="uid" index="0" />
324 <column name="dbkey" index="1" /> 323 <column name="dbkey" index="1" />
325 <column name="name" index="2" /> 324 <column name="name" index="2" />
326 <column name="kmers" index="3" /> 325 <column name="kmers" index="3" />
327 <column name="maps" index="4" /> 326 <column name="maps" index="4" />
329 <column name="value" index="6" /> 328 <column name="value" index="6" />
330 </options> 329 </options>
331 </param> 330 </param>
332 331
333 <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size"> 332 <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size">
334 <options from_file="gmap_indices.loc"> 333 <options from_data_table="gmap_indices">
335 <column name="name" index="3"/> 334 <column name="name" index="3"/>
336 <column name="value" index="3"/> 335 <column name="value" index="3"/>
337 <filter type="param_value" ref="gmapindex" column="6"/> 336 <filter type="param_value" ref="gmapindex" column="6"/>
338 <filter type="multiple_splitter" column="3" separator=","/> 337 <filter type="multiple_splitter" column="3" separator=","/>
339 <filter type="add_value" name="" value=""/> 338 <filter type="add_value" name="" value=""/>
362 <param name="splicemap" type="data" format="splicesites.iit,introns.iit" label="Select a splicesite map" 361 <param name="splicemap" type="data" format="splicesites.iit,introns.iit" label="Select a splicesite map"
363 help="built with GMAP IIT"/> 362 help="built with GMAP IIT"/>
364 </when> 363 </when>
365 <when value="gmapdb"> 364 <when value="gmapdb">
366 <param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help=""> 365 <param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help="">
367 <options from_file="gmap_indices.loc"> 366 <options from_data_table="gmap_indices">
368 <column name="name" index="4"/> 367 <column name="name" index="4"/>
369 <column name="value" index="4"/> 368 <column name="value" index="4"/>
370 <filter type="param_value" ref="gmapindex" column="6"/> 369 <filter type="param_value" ref="gmapindex" column="6"/>
371 <filter type="multiple_splitter" column="4" separator=","/> 370 <filter type="multiple_splitter" column="4" separator=","/>
372 <filter type="add_value" name="" value=""/> 371 <filter type="add_value" name="" value=""/>
387 <param name="snpindex" type="data" format="gmapsnpindex" label="Select a snpindex" 386 <param name="snpindex" type="data" format="gmapsnpindex" label="Select a snpindex"
388 help="built with GMAP SNP Index"/> 387 help="built with GMAP SNP Index"/>
389 </when> 388 </when>
390 <when value="gmapdb"> 389 <when value="gmapdb">
391 <param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help=""> 390 <param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help="">
392 <options from_file="gmap_indices.loc"> 391 <options from_data_table="gmap_indices">
393 <column name="name" index="5"/> 392 <column name="name" index="5"/>
394 <column name="value" index="5"/> 393 <column name="value" index="5"/>
395 <filter type="param_value" ref="gmapindex" column="6"/> 394 <filter type="param_value" ref="gmapindex" column="6"/>
396 <filter type="multiple_splitter" column="5" separator=","/> 395 <filter type="multiple_splitter" column="5" separator=","/>
397 <filter type="add_value" name="" value=""/> 396 <filter type="add_value" name="" value=""/>
808 807
809 </outputs> 808 </outputs>
810 <tests> 809 <tests>
811 </tests> 810 </tests>
812 811
813 <help> 812 <help><![CDATA[
814 813
815 **What it does** 814 **What it does**
816 815
817 GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc. 816 GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc.
818 Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10. 817 Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10.
842 841
843 For FASTA format, you should include one line per read (or end of a 842 For FASTA format, you should include one line per read (or end of a
844 paired-end read). The same FASTA file can have a mixture of 843 paired-end read). The same FASTA file can have a mixture of
845 single-end and paired-end reads of varying lengths, if desired. 844 single-end and paired-end reads of varying lengths, if desired.
846 845
847 Single-end reads: 846 *Single-end reads*:
848 847
849 Each FASTA entry should contain one short read per line, like this 848 Each FASTA entry should contain one short read per line, like this::
850 849
851 >Header information 850 >Header information
852 AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA 851 AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
853 852
854 Each short read can have a different length. However, the entire read 853 Each short read can have a different length. However, the entire read
855 needs to be on a single line, and may not wrap around multiple lines. 854 needs to be on a single line, and may not wrap around multiple lines.
856 If it extends to a second line, GSNAP will think that the read is 855 If it extends to a second line, GSNAP will think that the read is
857 paired-end. 856 paired-end.
858 857
859 858
860 Paired-end reads: 859 *Paired-end reads*:
861 860
862 Each FASTA entry should contain two short reads, one per line, like 861 Each FASTA entry should contain two short reads, one per line, like
863 this 862 this::
864 863
865 >Header information 864 >Header information
866 AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA 865 AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
867 GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG 866 GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG
868 867
869 By default, the program assumes that the second end is in the reverse 868 By default, the program assumes that the second end is in the reverse
870 complement direction compared with the first end. If they are in the 869 complement direction compared with the first end. If they are in the
871 same direction, you may need to use the --circular-input (or -c) flag. 870 same direction, you may need to use the --circular-input (or -c) flag.
872 871
877 **Output formats in GSNAP** 876 **Output formats in GSNAP**
878 877
879 SAM output format 878 SAM output format
880 879
881 Default GSNAP format 880 Default GSNAP format
882 See the README_ 881
883 </help> 882 See the README_
883
884 ]]></help>
884 <citations> 885 <citations>
885 <citation type="doi">10.1093/bioinformatics/btq057</citation> 886 <citation type="doi">10.1093/bioinformatics/btq057</citation>
886 </citations> 887 </citations>
887 </tool> 888 </tool>
888 889