gmap: gsnap.xml comparison

comparison gsnap.xml @ 0:10e3476429b5 draft

Uploaded

author	jjohnson
date	Fri, 05 Oct 2012 13:51:49 -0400
parents
children	74391fc6e3f2

comparison

equal deleted inserted replaced

--1:000000000000
+:10e3476429b5
+<tool id="gsnap" name="GSNAP" version="2.0.1">
+<description>Genomic Short-read Nucleotide Alignment Program</description>
+<requirements>
+<requirement type="binary">gsnap</requirement>
+</requirements>
+<version_string>gsnap --version</version_string>
+<command>
+#import os.path, re
+gsnap
+--nthreads="4" --ordered
+#if $refGenomeSource.genomeSource == "gmapdb":
+#set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0]
+--dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name
+#else:
+--dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value)
+#end if
+#if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:
+--kmer=$refGenomeSource.kmer
+#end if
+#if $refGenomeSource.use_splicing.src == 'gmapdb':
+#if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:
+-s $refGenomeSource.use_splicing.splicemap.value
+#if $computation.trim_mismatch_score.__str__ == '0':
+$ambig_splice_noclip
+#end if
+#end if
+#elif $refGenomeSource.use_splicing.src == 'history':
+#if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:
+-S $os.path.dirname($refGenomeSource.use_splicing.splicemap) -s $os.path.basename($refGenomeSource.use_splicing.splicemap)
+#if $computation.trim_mismatch_score.__str__ == '0':
+$ambig_splice_noclip
+#end if
+#end if
+#end if
+#if $refGenomeSource.use_snps.src == 'gmapdb':
+#if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:
+-v $refGenomeSource.use_snps.snpindex.value
+#end if
+#elif $refGenomeSource.use_snps.src == 'history':
+#if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:
+-V $refGenomeSource.use_snps.snpindex.extra_files_path -v $refGenomeSource.use_snps.snpindex.metadata.snps_name
+#end if
+#end if
+#if $refGenomeSource.mode.__str__ != '':
+--mode=$refGenomeSource.mode
+#end if
+#* ## No longer in options as of version 2011-11-30
+#if $mapq_unique_score.__str__ != '':
+--mapq-unique-score=$mapq_unique_score
+#end if
+*#
+#if $computation.options == "advanced":
+#if $computation.max_mismatches.__str__ != '':
+--max-mismatches=$computation.max_mismatches
+#end if
+$computation.query_unk_mismatch
+$computation.genome_unk_mismatch
+#if $computation.terminal_threshold.__str__ != '':
+--terminal-threshold=$computation.terminal_threshold
+#end if
+#if $computation.indel_penalty.__str__ != '':
+--indel-penalty=$computation.indel_penalty
+#end if
+#if $computation.indel_endlength.__str__ != '':
+--indel-endlength=$computation.indel_endlength
+#end if
+#if $computation.max_middle_insertions.__str__ != '':
+--max-middle-insertions=$computation.max_middle_insertions
+#end if
+#if $computation.max_middle_deletions.__str__ != '':
+--max-middle-deletions=$computation.max_middle_deletions
+#end if
+#if $computation.max_end_insertions.__str__ != '':
+--max-end-insertions=$computation.max_end_insertions
+#end if
+#if $computation.max_end_deletions.__str__ != '':
+--max-end-deletions=$computation.max_end_deletions
+#end if
+#if $computation.suboptimal_levels.__str__ != '':
+--suboptimal-levels=$computation.suboptimal_levels
+#end if
+#if $computation.adapter_strip.__str__ != '':
+--adapter-strip=$computation.adapter_strip
+#end if
+#if $computation.trim_mismatch_score.__str__ != '':
+--trim-mismatch-score=$computation.trim_mismatch_score
+#end if
+#if $computation.trim_indel_score.__str__ != '':
+--trim-indel-score=$computation.trim_indel_score
+#end if
+## TODO - do we need these options (Is it tally XOR runlength?):
+## --tallydir=  --use-tally=tally
+## --runlengthdir  --use-runlength=runlength
+#if $computation.use_tally != None and len($computation.use_tally.__str__) > 0:
+##--tallydir $os.path.dirname($computation.use_tally) --use-tally $os.path.basename($computation.use_tally)
+--use-tally=$computation.use_tally
+#end if
+## gmap options
+#if $computation.gmap_mode.__str__ != '' and  $computation.gmap_mode.__str__ != 'None':
+--gmap-mode='$computation.gmap_mode'
+#end if
+#if $computation.trigger_score_for_gmap.__str__ != '':
+--trigger-score-for-gmap=$computation.trigger_score_for_gmap
+#end if
+#if $computation.max_gmap_pairsearch.__str__ != '' and $re.search("pairsearch",$computation.gmap_mode):
+--max-gmap-pairsearch=$computation.max_gmap_pairsearch
+#end if
+#if $computation.max_gmap_terminal.__str__ != '' and $re.search("terminal",$computation.gmap_mode):
+--max-gmap-terminal=$computation.max_gmap_terminal
+#end if
+#if $computation.max_gmap_improvement.__str__ != '' and $re.search("improv",$computation.gmap_mode):
+--max-gmap-improvement=$computation.max_gmap_improvement
+#end if
+#if $computation.microexon_spliceprob.__str__ != '':
+--microexon-spliceprob=$computation.microexon_spliceprob
+#end if
+#end if
+#if $splicing.options == "advanced":
+$splicing.novelsplicing
+#if $splicing.localsplicedist.__str__ != '':
+--localsplicedist=$splicing.localsplicedist
+#end if
+#if $splicing.local_splice_penalty.__str__ != '':
+--local-splice-penalty=$splicing.local_splice_penalty
+#end if
+#if $splicing.distant_splice_penalty.__str__ != '':
+--distant-splice-penalty=$splicing.distant_splice_penalty
+#end if
+#if $splicing.local_splice_endlength.__str__ != '':
+--local-splice-endlength=$splicing.local_splice_endlength
+#end if
+#if $splicing.distant_splice_endlength.__str__ != '':
+--distant-splice-endlength=$splicing.distant_splice_endlength
+#end if
+#if $splicing.distant_splice_identity.__str__ != '':
+--distant-splice-identity=$splicing.distant_splice_identity
+#end if
+#end if
+#if $output.options == "advanced":
+#if $output.npath.__str__ != '':
+--npath=$output.npath
+#end if
+$output.quiet_if_excessive
+$output.show_refdiff
+$output.clip_overlap
+#end if
+#if $result.format == "sam":
+--format=sam
+$result.no_sam_headers
+#if $result.read_group_id.__str__.strip != '':
+--read-group-id='$result.read_group_id'
+#end if
+#if $result.read_group_name.__str__ != '':
+--read-group-name='$result.read_group_name'
+#end if
+#if $result.read_group_library.__str__ != '':
+--read-group-library='$result.read_group_library'
+#end if
+#if $result.read_group_platform.__str__ != '':
+--read-group-platform='$result.read_group_platform'
+#end if
+#if $result.quality_shift.__str__ != '':
+--quality-shift=$result.quality_shift
+#end if
+#elif $result.format == "goby":
+#if $result.goby_output.__str__ != '':
+--goby-output='$result.goby_output'
+#end if
+#if $result.creads_window_start.__str__ != '':
+--creads-window-start=$result.creads_window_start
+#end if
+#if $result.creads_window_end.__str__ != '':
+--creads-window-end=$result.creads_window_end
+#end if
+$result.creads_complement
+#end if
+#if $results.split_output == 'yes':
+--split-output=gsnap_out
+#if $results.fails.choice == 'nofails':
+--nofails
+#elif $results.fails.choice == 'failsonly':
+--failsonly
+#end if
+$results.fails_as_input
+#else
+#if $results.fails.choice == 'nofails':
+--nofails
+#elif $results.fails.choice == 'failsonly':
+--failsonly
+$results.fails.fails_as_input
+#end if
+#end if
+#if $seq.format == "gsnap_fasta":
+$seq.circularinput $seq.gsnap
+#else if $seq.format == "fastq":
+#if $seq.barcode_length.__str__ != '':
+--barcode-length=$seq.barcode_length
+#end if
+#if $seq.fastq_id_start.__str__ != '':
+--fastq-id-start=$seq.fastq_id_start
+#end if
+#if $seq.fastq_id_end.__str__ != '':
+--fastq-id-end=$seq.fastq_id_end
+#end if
+#if $seq.filter_chastity.__str__ != 'off':
+--filter-chastity=$seq.filter_chastity
+#end if
+#if $seq.paired.ispaired.__str__ == 'yes':
+#if $seq.paired.pairmax_dna.__str__ != '':
+--pairmax-dna=$seq.paired.pairmax_dna
+#end if
+#if $seq.paired.pairmax_rna.__str__ != '':
+--pairmax-rna=$seq.paired.pairmax_rna
+#end if
+#if $seq.paired.pairexpect.__str__ != '':
+--pairexpect=$seq.paired.pairexpect
+#end if
+#if $seq.paired.pairdev.__str__ != '':
+--pairdev=$seq.paired.pairdev
+#end if
+$seq.fastq $seq.paired.fastq
+#else
+$seq.fastq
+#end if
+#end if
+#if $results.split_output == 'yes':
+2> $gsnap_stderr
+#else:
+#if $results.fails.choice.__str__ == 'failsonly' and $results.fails.fails_as_input.__str__ != '':
+2> $gsnap_stderr > $gsnap_fq
+#else
+2> $gsnap_stderr > $gsnap_out
+#end if
+#end if
+</command>
+<inputs>
+<!-- Input data -->
+<conditional name="seq">
+<param name="format" type="select" label="&lt;H2&gt;Input Sequences&lt;/H2&gt;Select the input format" help="">
+<option value="fastq">Fastq</option>
+<!--
+<option value="goby">Goby compact-reads</option>
+-->
+<option value="gsnap_fasta">GNSAP fasta</option>
+</param>
+<when value="fastq">
+<param name="fastq" type="data" format="fastq" label="Select a fastq dataset" />
+<conditional name="paired">
+<param name="ispaired" type="boolean" truevalue="yes" falsevalue="no" checked="false" label="Use Paired Reads?"/>
+<when value="no"/>
+<when value="yes">
+<param name="fastq" type="data" format="fastq" label="Select the paired reads reverse dataset" />
+<param name="orientation" type="select" label="Orientation of paired-end reads" help="">
+<option value="FR">fwd-rev, typical Illumina default</option>
+<option value="RF">rev-fwd, for circularized inserts</option>
+<option value="FF">fwd-fwd, same strand</option>
+</param>
+<param name="pairmax_dna"  type="integer" value="" optional="true" label="Max total genomic length for DNA-Seq paired reads, or other reads without splicing (default 1000)." help="Used if no splice file is provided and novelsplicing is off."/>
+<param name="pairmax_rna"  type="integer" value="" optional="true" label="Max total genomic length for RNA-Seq paired reads, or other reads that could have a splice (default 200000)." help="Used when novel splicing is specified or a splice file is provided.  Should probably match the value for localsplicedist."/>
+<param name="pairexpect"  type="integer" value="" optional="true" label="Expected paired-end length"
+help="Used for calling splices in medial part of paired-end reads (default 200)"/>
+<param name="pairdev"  type="integer" value="" optional="true" label="Allowable deviation from expected paired-end length"
+help="Used for calling splices in medial part of paired-end reads (default 25)"/>
+</when>
+</conditional>
+<param name="barcode_length" type="integer" value="" optional="true"  label="Amount of barcode to remove from start of read (default 0)" />
+<param name="fastq_id_start" type="integer" value="" optional="true"  label="Starting field  of identifier in FASTQ header, whitespace-delimited, starting from 1" />
+<param name="fastq_id_end" type="integer" value="" optional="true"  label="Ending field  of identifier in FASTQ header, whitespace-delimited, starting from 1"
+help="Examples:
+&lt;br&gt;@HWUSI-EAS100R:6:73:941:1973#0/1
+&lt;br&gt; . start=1, end=1 (default)  => identifier is HWUSI-EAS100R:6:73:941:1973#0/1
+&lt;br&gt;@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
+&lt;br&gt; . start=1, end=1  => identifier is SRR001666.1
+&lt;br&gt; . start=2, end=2  => identifier is 071112_SLXA-EAS1_s_7:5:1:817:345
+&lt;br&gt; . start=1, end=2  => identifier is SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345"
+/>
+<param name="filter_chastity" type="select" label="Skip reads marked by the Illumina chastity program"
+help="String after the accession having a  'Y'  after the first colon, like this:
+&lt;br&gt;@accession 1:Y:0:CTTGTA
+&lt;br&gt;where the  'Y'  signifies filtering by chastity.
+&lt;br&gt; For 'either', a  'Y'  on either end of a paired-end read will be filtered.
+&lt;br&gt;  For 'both', a  'Y'  is required on both ends of a paired-end read (or on the only end of a single-end read)"
+>
+<option value="off">off - no filtering</option>
+<option value="either">either - a 'Y' on either end of a paired-end read</option>
+<option value="both">both - a 'Y' is required on both ends of a paired-end read or the only end of a single-end read</option>
+</param>
+</when>
+<!--
+<when value="goby">
+</when>
+-->
+<when value="gsnap_fasta">
+<param name="gsnap" type="data" format="fasta" label="Select a single-end dataset" help="GSNAP fasta must have the sequence entirely on one line, a second line is interpreted as the paired-end sequence"/>
+<param name="circularinput" type="boolean" checked="false" truevalue="--circular-input=true" falsevalue="" label="Circular-end data (paired reads are on same strand)"/>
+</when>
+</conditional>
+<!-- No longer in options as of version 2011-11-30
+<param name="mapq_unique_score"  type="integer" value="" optional="true" label="MAPQ score threshold"
+help="For multiple results, consider as a unique result if only one of the results has a MAPQ score equal or greater than this
+(if not selected, then reports all multiple results, up to npaths)" />
+-->
+<!-- GMAPDB for alignment -->
+<conditional name="refGenomeSource">
+<param name="genomeSource" type="select" label="&lt;HR&gt;&lt;H2&gt;Align To&lt;/H2&gt;Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+<option value="indexed">Use a built-in index</option>
+<option value="gmapdb">Use a gmapdb from your history</option>
+</param>
+<when value="indexed">
+<param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
+<options from_file="gmap_indices.loc">
+<column name="uid" index="0" />
+<column name="dbkey" index="1" />
+<column name="name" index="2" />
+<column name="kmers" index="3" />
+<column name="maps" index="4" />
+<column name="snps" index="5" />
+<column name="value" index="6" />
+</options>
+</param>
+<param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size">
+<options from_file="gmap_indices.loc">
+<column name="name" index="3"/>
+<column name="value" index="3"/>
+<filter type="param_value" ref="gmapindex" column="6"/>
+<filter type="multiple_splitter" column="3" separator=","/>
+<filter type="add_value" name="" value=""/>
+<filter type="sort_by" column="3"/>
+</options>
+</param>
+<param name="mode" type="select" label="Alignment mode" help="Assumes cmetindex and atoiindex were run on the gmap datatbase.">
+<option value="">standard</option>
+<option value="cmet-stranded">cmet-stranded   for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option>
+<option value="cmet-nonstranded">cmet-nonstranded   for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option>
+<option value="atoi-stranded">atoi-stranded   for RNA-editing tolerance (A-to-G changes)</option>
+<option value="atoi-nonstranded">atoi-nonstranded   for RNA-editing tolerance (A-to-G changes)</option>
+</param>
+<conditional name="use_splicing">
+<param name="src" type="select" label="&lt;HR&gt;Known Splicesite and Introns"
+help="Look for splicing involving known sites or known introns at short or long distances
+See README instructions for the distinction between known sites and known introns">
+<option value="none" selected="true">None</option>
+<option value="gmapdb">From the GMAP Database</option>
+<option value="history">A Map in your history</option>
+</param>
+<when value="none"/>
+<when value="history">
+<param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map"
+help="built with GMAP IIT"/>
+</when>
+<when value="gmapdb">
+<param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help="">
+<options from_file="gmap_indices.loc">
+<column name="name" index="4"/>
+<column name="value" index="4"/>
+<filter type="param_value" ref="gmapindex" column="6"/>
+<filter type="multiple_splitter" column="4" separator=","/>
+<filter type="add_value" name="" value=""/>
+<filter type="sort_by" column="4"/>
+</options>
+</param>
+</when>
+</conditional>
+<conditional name="use_snps">
+<param name="src" type="select" label="&lt;HR&gt;Known SNPs" help="for SNP tolerant alignments">
+<option value="none" selected="true">None</option>
+<option value="gmapdb">From the GMAP Database</option>
+<option value="history">A SNP Index in your history</option>
+</param>
+<when value="none"/>
+<when value="history">
+<param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex"
+help="built with GMAP SNP Index"/>
+</when>
+<when value="gmapdb">
+<param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help="">
+<options from_file="gmap_indices.loc">
+<column name="name" index="5"/>
+<column name="value" index="5"/>
+<filter type="param_value" ref="gmapindex" column="6"/>
+<filter type="multiple_splitter" column="5" separator=","/>
+<filter type="add_value" name="" value=""/>
+<filter type="sort_by" column="5"/>
+</options>
+</param>
+</when>
+</conditional>
+</when>
+<when value="gmapdb">
+<param name="gmapdb" type="data" format="gmapdb" metadata_name="dbkey" label="Select a gmapdb"
+help="A GMAP database built with GMAP Build"/>
+<param name="kmer" type="select" data_ref="gmapdb" label="kmer size" help="Defaults to highest available kmer size">
+<options>
+<filter type="data_meta" ref="gmapdb" key="kmers" multiple="True" separator=","/>
+</options>
+</param>
+<param name="mode" type="select" label="Alignment mode" help="Assumes cmetindex and atoiindex were run on the gmap datatbase.">
+<option value="">standard</option>
+<option value="cmet-stranded">cmet-stranded   for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option>
+<option value="cmet-nonstranded">cmet-nonstranded   for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option>
+<option value="atoi-stranded">atoi-stranded   for RNA-editing tolerance (A-to-G changes)</option>
+<option value="atoi-nonstranded">atoi-nonstranded   for RNA-editing tolerance (A-to-G changes)</option>
+</param>
+<conditional name="use_splicing">
+<param name="src" type="select" label="&lt;HR&gt;Known Splicesite and Introns"
+help="Look for splicing involving known sites or known introns at short or long distances
+See README instructions for the distinction between known sites and known introns">
+<option value="none" selected="true">None</option>
+<option value="gmapdb">From the GMAP Database</option>
+<option value="history">A Map in your history</option>
+</param>
+<when value="none"/>
+<when value="history">
+<param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map"
+help="built with GMAP IIT"/>
+<param name="ambig_splice_noclip"  type="boolean" checked="false" truevalue="--ambig-splice-noclip" falsevalue="" label="Do not clip at ambiguous splice sites"
+help="For ambiguous known splicing at ends of the read, do not clip at the splice site, but extend instead into the intron.
+This flag makes sense only if you are trying to eliminate all soft clipping with --trim-mismatch-score=0"/>
+</when>
+<when value="gmapdb">
+<param name="splicemap" type="select"  data_ref="gmapdb" label="Use map for splicing involving known sites or known introns" help="">
+<options>
+<filter type="data_meta" ref="gmapdb" key="maps" multiple="True"/>
+</options>
+</param>
+<param name="ambig_splice_noclip"  type="boolean" checked="false" truevalue="--ambig-splice-noclip" falsevalue="" label="Do not clip at ambiguous splice sites"
+help="For ambiguous known splicing at ends of the read, do not clip at the splice site, but extend instead into the intron.
+This flag makes sense only if you are trying to eliminate all soft clipping with --trim-mismatch-score=0"/>
+</when>
+</conditional>
+<conditional name="use_snps">
+<param name="src" type="select" label="&lt;HR&gt;Known SNPs" help="for SNP tolerant alignments">
+<option value="none" selected="true">None</option>
+<option value="gmapdb">From the GMAP Database</option>
+<option value="history">A SNP Index in your history</option>
+</param>
+<when value="none"/>
+<when value="history">
+<param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex"
+help="built with GMAP SNP Index"/>
+</when>
+<when value="gmapdb">
+<param name="snpindex" type="select"  data_ref="gmapdb" label="Use database containing known SNPs" help="">
+<options>
+<filter type="data_meta" ref="gmapdb" key="snps" multiple="True" separator=","/>
+</options>
+</param>
+</when>
+</conditional>
+</when>
+</conditional>
+<!-- Computation options -->
+<conditional name="computation">
+<param name="options" type="select" label="&lt;HR&gt;Computational Settings" help="">
+<option value="default">Use default settings</option>
+<option value="advanced">Set Computation Options</option>
+</param>
+<when value="default"/>
+<when value="advanced">
+<param name="max_mismatches" type="float" value="" optional="true" label="Maximum number of mismatches allowed (uses default when negative)"
+help="Defaults to the ultrafast level of ((readlength+2)/12 - 2)).
+If specified between 0.0 and 1.0, then treated as a fraction
+of each read length.  Otherwise, treated as an integral number
+of mismatches (including indel and splicing penalties)
+For RNA-Seq, you may need to increase this value slightly
+to align reads extending past the ends of an exon.">
+<validator type="in_range" message="The mismatches must >= 0." min="0."/>
+</param>
+<param name="query_unk_mismatch" type="boolean" checked="false" truevalue="--query-unk-mismatch=1" falsevalue="" label="Count unknown (N) characters in the query as a mismatch"/>
+<param name="genome_unk_mismatch" type="boolean" checked="true" truevalue="" falsevalue="--genome-unk-mismatch=0" label="Count unknown (N) characters in the genome as a mismatch"/>
+<param name="terminal_threshold"  type="integer" value="" optional="true" label="Threshold for searching for a terminal alignment (default 2)"
+help="(from one end of the read to the best possible position at the other end).   For example, if this value is 2, then if GSNAP finds an exact or
+1-mismatch alignment, it will not try to find a terminal alignment.
+Note that this default value may not be low enough if you want to
+obtain terminal alignments for very short reads, although such reads
+probably don't have enough specificity for terminal alignments anyway." />
+<param name="indel_penalty"  type="integer" value="" optional="true" label="Penalty for an indel (default 2)"
+help="Counts against mismatches allowed.  To find indels, make indel-penalty less than or equal to max-mismatches.  A value &lt; 2 can lead to false positives at read ends" />
+<param name="indel_endlength"  type="integer" value="" optional="true" label="Minimum length at end required for indel alignments (default 4)" />
+<param name="max_middle_insertions"  type="integer" value="" optional="true" label="Maximum number of middle insertions allowed (default 9)" />
+<param name="max_middle_deletions"  type="integer" value="" optional="true" label="Maximum number of middle deletions allowed (default 30)" />
+<param name="max_end_insertions"  type="integer" value="" optional="true" label="Maximum number of end insertions allowed (default 3)" />
+<param name="max_end_deletions"  type="integer" value="" optional="true" label="Maximum number of end deletions allowed (default 6)" />
+<param name="suboptimal_levels"  type="integer" value="" optional="true" label="Report suboptimal hits beyond best hit (default 0)"
+help="All hits with best score plus suboptimal-levels are reported" />
+<param name="adapter_strip"  type="select" label="Method for removing adapters from reads"
+help="paired removes adapters from paired-end reads if a concordant or paired alignment cannot be found from the original read">
+<option value="paired" selected="true">paired</option>
+<option value="off">off</option>
+</param>
+<param name="trim_mismatch_score" type="integer" value="" optional="true" label="Score to use for mismatches when trimming at ends (default is -3)"
+help="to turn off trimming, specify 0 (Warning: turning trimming off will give false positive mismatches at the ends of reads)"/>
+<param name="trim_indel_score" type="integer" value="" optional="true" label="Score to use for indels when trimming at ends (default is -4)"
+help="to turn off trimming, specify 0 (Warning: turning trimming off will give false positive indels at the ends of reads)"/>
+<param name="use_tally" type="data" format="tally.iit" optional="true" metadata_name="dbkey" label="Select a tally IIT file to resolve concordant multiple results"
+help="generated by gsnap_tally and iit_store"/>
+<!--
+tallydir=STRING              Directory for tally IIT file to resolve concordant multiple results (default is
+location of genome index files specified using -D and -d).  Note: can
+just give full path name to use-tally instead.
+use-tally=STRING             Use this tally IIT file to resolve concordant multiple results
+runlengthdir=STRING          Directory for runlength IIT file to resolve concordant multiple results (default is
+location of genome index files specified using -D and -d).  Note: can
+just give full path name to use-runlength instead.
+use-runlength=STRING         Use this runlength IIT file to resolve concordant multiple results
+-->
+<!-- Options for GMAP alignment within GSNAP -->
+<param name="gmap_mode" type="select" multiple="true" optional="true" display="checkboxes" label="Cases to use GMAP for complex alignments containing multiple splices or indels"
+help="Default: pairsearch,terminal,improve">
+<option value="pairsearch" selected="true">pairsearch</option>
+<option value="terminal" selected="true">terminal</option>
+<option value="improve" selected="true">improve</option>
+</param>
+<param name="trigger_score_for_gmap" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 5)"
+help="Try GMAP pairsearch on nearby genomic regions if best score (the total of both ends if paired-end) exceeds this value (default 5)" />
+<param name="max_gmap_pairsearch" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 3)"
+help="Perform GMAP pairsearch on nearby genomic regions up to this many candidate ends (default 3)." />
+<param name="max_gmap_terminal" type="integer" value="" optional="true" label="GMAP terminal threshold (default 3)"
+help="Perform GMAP terminal on nearby genomic regions up to this many candidate ends (default 3)." />
+<param name="max_gmap_improvement" type="integer" value="" optional="true" label="GMAP improvement threshold (default 3)"
+help="Perform GMAP improvement on nearby genomic regions up to this many candidate ends (default 3)." />
+<param name="microexon_spliceprob"  type="float" value="" optional="true" label="GMAP microexons threshold (default .90)"
+help="Allow microexons only if one of the splice site probabilities is greater than this value." >
+<validator type="in_range" message="The microexons  probability must be between 0. and 1." min="0." max="1."/>
+</param>
+</when>
+</conditional>
+<conditional name="splicing">
+<param name="options" type="select" label="&lt;HR&gt;Splicing options for RNA-Seq" help="">
+<option value="default">Use default settings</option>
+<option value="advanced">Set Splicing Options</option>
+</param>
+<when value="default"/>
+<when value="advanced">
+<!-- Splicing options for RNA-Seq -->
+<!-- use-splicing This should be either a select list from the gmapdb maps or a data type using splicesdir and use-splicing -->
+<!-- Neither novel splicing (-N) nor known splicing (-s) turned on => assume reads are DNA-Seq (genomic) -->
+<param name="novelsplicing" type="boolean" checked="false" truevalue="--novelsplicing=1" falsevalue="" label="Look for novel splicing "/>
+<param name="localsplicedist"  type="integer" value="" optional="true" label="Definition of local novel splicing event (default 200000)"/>
+<param name="local_splice_penalty"  type="integer" value="" optional="true" label="Penalty for a local splice (default 0).  Counts against mismatches allowed"/>
+<param name="distant_splice_penalty"  type="integer" value="" optional="true" label="Penalty for a distant splice (default 3).  Counts against mismatches allowed"
+help="A distant splice is one where the intron length exceeds the value of localsplicedist or is an
+inversion, scramble, or translocation between two different chromosomes. Counts against mismatches allowed"/>
+<param name="distant_splice_endlength"  type="integer" value="" optional="true" label="Minimum length at end required for distant spliced alignments"
+help="(default 16, min is the kmer length)"/>
+<param name="shortend_splice_endlength"  type="integer" value="" optional="true" label="Minimum length at end required for short-end spliced alignments"
+help="(default 2, but unless known splice sites are provided,  GSNAP may still need the end length to be the value of kmer size to find a given splice"/>
+<param name="distant_splice_identity"  type="float" value="" optional="true" label="Minimum identity at end required for distant spliced alignments (default 0.95)"/>
+<param name="antistranded_penalty"  type="integer" value="" optional="true" label="Penalty for antistranded splicing when using stranded RNA-Seq protocols"
+help="A positive value, such as 1, expects antisense on the first read and sense on the second read.
+Default is 0, which treats sense and antisense equally well"/>
+</when>
+</conditional>
+<!-- Output data -->
+<conditional name="output">
+<param name="options" type="select" label="&lt;HR&gt;&lt;H2&gt;Output&lt;/H2&gt;Output options for RNA-Seq" help="">
+<option value="default">Use default settings</option>
+<option value="advanced">Set Output Options</option>
+</param>
+<when value="default"/>
+<when value="advanced">
+<param name="npath"  type="integer" value="" optional="true" label="Maximum number of paths to print (default 100)"/>
+<param name="quiet_if_excessive" type="boolean" checked="false" truevalue="--quiet-if-excessive" falsevalue="" label="Quiet if Excessive"
+help="If more than maximum number of paths are found, then nothing is printed."/>
+<param name="show_refdiff" type="boolean" checked="false" truevalue="--show-refdiff" falsevalue="" label="Show SNP-tolerant alignment"
+help="For GSNAP output in SNP-tolerant alignment, shows all differences relative to the reference genome as lower case (otherwise, it shows all differences relative to both the reference and alternate genome)"/>
+<param name="clip_overlap" type="boolean" checked="false" truevalue="--clip-overlap" falsevalue="" label="Clip Overlap"
+help="For paired-end reads whose alignments overlap, clip the overlapping region."/>
+</when>
+</conditional>
+<conditional name="result">
+<param name="format" type="select" label="Select the output format" help="">
+<option value="sam">SAM</option>
+<!--  goby should only be an option if the input is in goby format
+<option value="goby">Goby</option>
+-->
+<option value="gsnap">GSNAP default output</option>
+</param>
+<when value="gsnap">
+</when>
+<when value="sam">
+<param name="no_sam_headers" type="boolean" truevalue="--no-sam-headers" falsevalue="" checked="false" label="Do not print headers beginning with '@'"/>
+<param name="read_group_id" type="text" value="" optional="true" label="Value to put into read-group id (RG-ID) field"/>
+<param name="read_group_name" type="text" value="" optional="true" label="Value to put into read-group name (RG-SM) field"/>
+<param name="read_group_library" type="text" value="" optional="true" label="Value to put into read-group library (RG-LB) field"/>
+<param name="read_group_platform" type="text" value="" optional="true" label="Value to put into read-group library platform (RG-PL) field"/>
+<param name="quality_shift"  type="integer" value="" optional="true" label="Shift FASTQ quality scores by this amount in SAM output (default -31)"/>
+</when>
+<!--
+<when value="goby">
+<param name="goby_output" type="text" value="" label="Basename for Goby output files"/>
+<param name="creads_window_start"  type="integer" value="" optional="true" label="Compact reads window start (default: 0=start of file)"/>
+<param name="creads_window_end"  type="integer" value="" optional="true" label="Compact reads window end (default: 0=end of file)"/>
+<param name="creads_complement" type="boolean" truevalue="-\-creads-complement" falsevalue="" checked="false" label="Complement read sequences (without reversing)"/>
+</when>
+-->
+</conditional>
+<!-- TODO combine fails and split_output -->
+<conditional name="results">
+<param name="split_output" type="select" label="&lt;HR&gt;Split outputs"
+help="Separate outputs for: nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, and concordant_mult results">
+<option value="no">no</option>
+<option value="yes">yes</option>
+</param>
+<when value="no">
+<conditional name="fails">
+<param name="choice" type="select" label="How to deal with fails" help="">
+<option value="default">default - include them in results</option>
+<option value="nofails">nofails - exclude fails from results</option>
+<option value="failsonly">failsonly - only output failing results</option>
+</param>
+<when value="default"/>
+<when value="nofails"/>
+<when value="failsonly">
+<param name="fails_as_input" type="boolean" truevalue="--fails-as-input" falsevalue="" checked="false" label="Print completely failed alignments as input FASTA or FASTQ format"
+help=""/>
+</when>
+</conditional>
+</when>
+<when value="yes">
+<conditional name="fails">
+<param name="choice" type="select" label="How to deal with fails" help="">
+<option value="default">default - include them in results</option>
+<option value="nofails">nofails - exclude fails from results</option>
+<option value="failsonly">failsonly - only output failing results</option>
+</param>
+<when value="default"/>
+<when value="nofails"/>
+<when value="failsonly"/>
+</conditional>
+<param name="fails_as_input" type="boolean" truevalue="--fails-as-input" falsevalue="" checked="false" label="Print completely failed alignments as input FASTA or FASTQ format"
+help=""/>
+</when>
+</conditional>
+</inputs>
+<outputs>
+<data format="txt" name="gsnap_stderr" label="${tool.name} on ${on_string}: gsnap.log"/>
+<data format="txt" name="gsnap_out" label="${tool.name} on ${on_string} ${result.format}" >
+<filter>(results['split_output'] == 'no' and (results['fails']['choice'] != 'failsonly' or results['fails']['fails_as_input'] == False))</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="fastq" name="gsnap_fq" label="${tool.name} on ${on_string} fails.fq" >
+<filter>(results['split_output'] == 'no' and results['fails']['choice'] == 'failsonly' and results['fails']['fails_as_input'] == True)</filter>
+</data>
+<!-- nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, concordant_mult -->
+<data format="txt" name="unpaired_mult" label="${tool.name} on ${on_string} unpaired_mult.${result.format}"  from_work_dir="gsnap_out.unpaired_mult">
+<filter>(results['split_output'] == 'yes')</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="unpaired_uniq" label="${tool.name} on ${on_string} unpaired_uniq.${result.format}"  from_work_dir="gsnap_out.unpaired_uniq">
+<filter>(results['split_output'] == 'yes')</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="unpaired_transloc" label="${tool.name} on ${on_string} unpaired_transloc.${result.format}"  from_work_dir="gsnap_out.unpaired_transloc">
+<filter>(results['split_output'] == 'yes')</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="halfmapping_mult" label="${tool.name} on ${on_string} halfmapping_mult.${result.format}"  from_work_dir="gsnap_out.halfmapping_mult">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="halfmapping_uniq" label="${tool.name} on ${on_string} halfmapping_uniq.${result.format}"  from_work_dir="gsnap_out.halfmapping_uniq">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="halfmapping_transloc" label="${tool.name} on ${on_string} halfmapping_transloc.${result.format}"  from_work_dir="gsnap_out.halfmapping_transloc">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="paired_mult" label="${tool.name} on ${on_string} paired_mult.${result.format}"  from_work_dir="gsnap_out.paired_mult">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="paired_uniq" label="${tool.name} on ${on_string} paired_uniq.${result.format}"  from_work_dir="gsnap_out.paired_uniq">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="paired_transloc" label="${tool.name} on ${on_string} paired_transloc.${result.format}"  from_work_dir="gsnap_out.paired_transloc">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="concordant_mult" label="${tool.name} on ${on_string} concordant_mult.${result.format}"  from_work_dir="gsnap_out.concordant_mult">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="concordant_uniq" label="${tool.name} on ${on_string} concordant_uniq.${result.format}"  from_work_dir="gsnap_out.concordant_uniq">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="concordant_transloc" label="${tool.name} on ${on_string} concordant_transloc.${result.format}"  from_work_dir="gsnap_out.concordant_transloc">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="txt" name="nomapping" label="${tool.name} on ${on_string} nomapping.${result.format}"  from_work_dir="gsnap_out.nomapping">
+<filter>(results['split_output'] == 'yes' and results['fails_as_input'] == False)</filter>
+<change_format>
+<when input="result['format']" value="sam" format="sam"/>
+<when input="result['format']" value="gsnap" format="gsnap"/>
+</change_format>
+</data>
+<data format="fastq" name="nomapping_fq" label="${tool.name} on ${on_string} nomapping.fq"  from_work_dir="gsnap_out.nomapping.fq">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == False)</filter>
+</data>
+<data format="fastq" name="nomapping_1_fq" label="${tool.name} on ${on_string} nomapping.1.fq"  from_work_dir="gsnap_out.nomapping.1.fq">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+</data>
+<data format="fastq" name="nomapping_2_fq" label="${tool.name} on ${on_string} nomapping.2.fq"  from_work_dir="gsnap_out.nomapping.2.fq">
+<filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter>
+</data>
+<!-- Will problay need wrapper code to generate composite datatype for goby alignment
+<data format="gobyalignment" name="goby_alignment" label="${tool.name} on ${on_string} uniq.${result.format}"  from_work_dir="gsnap_out.nomapping">
+<filter>result['format'] == 'goby'</filter>
+</data>
+-->
+</outputs>
+<tests>
+</tests>
+<help>
+**What it does**
+GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc.
+Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10.
+.. _GSNAP: http://research-pub.gene.com/gmap/
+.. _Publication: http://bioinformatics.oupjournals.org/cgi/content/full/26/7/873
+http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2844994/?tool=pubmed
+------
+**Know what you are doing**
+.. class:: warningmark
+You will want to read the README_
+.. _README: http://research-pub.gene.com/gmap/src/README
+------
+**Input formats**
+Input to GSNAP should be either in FASTQ or FASTA format.
+The FASTQ input may include quality scores, which will then be included in SAM
+output, if that output format is selected.
+For FASTA format, you should include one line per read (or end of a
+paired-end read).  The same FASTA file can have a mixture of
+single-end and paired-end reads of varying lengths, if desired.
+Single-end reads:
+Each FASTA entry should contain one short read per line, like this
+>Header information
+AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
+Each short read can have a different length.  However, the entire read
+needs to be on a single line, and may not wrap around multiple lines.
+If it extends to a second line, GSNAP will think that the read is
+paired-end.
+Paired-end reads:
+Each FASTA entry should contain two short reads, one per line, like
+this
+>Header information
+AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
+GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG
+By default, the program assumes that the second end is in the reverse
+complement direction compared with the first end.  If they are in the
+same direction, you may need to use the --circular-input (or -c) flag.
+( The Galaxy tool: "FASTA Width formatter"  can be used to reformat fasta files to have single line sequences. )
+------
+**Output formats in GSNAP**
+SAM output format
+Default GSNAP format
+See the README_
+</help>
+</tool>

Mercurial > repos > jjohnson > gmap

comparison gsnap.xml @ 0:10e3476429b5 draft