Mercurial > repos > jjohnson > defuse
changeset 12:33e2235bf003
Add create_reference_dataset.xml
| author | Jim Johnson <jj@umn.edu> | 
|---|---|
| date | Sun, 09 Jun 2013 20:30:21 -0500 | 
| parents | 19c48803a377 | 
| children | 85693cb5339f | 
| files | create_reference_dataset.xml defuse.xml | 
| diffstat | 2 files changed, 317 insertions(+), 2 deletions(-) [+] | 
line wrap: on
 line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/create_reference_dataset.xml Sun Jun 09 20:30:21 2013 -0500 @@ -0,0 +1,313 @@ +<tool id="create_defusei_reference" name="Create DeFuse Reference" version="1.6.1"> + <description>create a defuse reference from Ensembl and UCSC sources</description> + <requirements> + <requirement type="package" version="0.6.1">defuse</requirement> + <requirement type="package" version="0.1.18">samtools</requirement> + <requirement type="package" version="1.0.0">bowtie</requirement> + <requirement type="package" version="2013-05-09">gmap</requirement> + <requirement type="package" version="latest">kent</requirement> + </requirements> + <command interpreter="command"> /bin/bash $shscript </command> + <inputs> + <param name="ensembl_genome_version" type="text" value="" label="Esembl Genome Version" help="Example: GRCh37"/> + <param name="ensembl_version" type="integer" value="" label="Esembl Release Version" help="Example: 71"/> + <param name="ucsc_genome_version" type="text" value="" label="UCSC Genome Version" help="Example: hg19"/> + <param name="chromosomes" type="text" value="" label="Chromosomes" help="Example: 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,X,Y,MT"/> + <param name="mt_chromosome" type="text" value="MT" label="Mitochonrial Chromosome" /> + <param name="gene_sources" type="text" value="IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding" label="Gene sources" /> + <param name="ig_gene_sources" type="text" value="IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene" label="IG Gene sources" /> + <param name="rrna_gene_sources" type="text" value="Mt_rRNA,rRNA,rRNA_pseudogene" label="Ribosomal Gene sources" /> + </inputs> + <outputs> + <data format="txt" name="config_txt" label="${tool.name} on ${on_string}: config.txt"/> + </outputs> + <configfiles> + <configfile name="defuse_config"> +#import ast +# +# Configuration file for defuse +# +# At a minimum, change all values enclused by [] +# + +# Directory where the defuse code was unpacked +## Default location in the tool/defuse directory +# source_directory = ${__root_dir__}/tools/defuse +source_directory = __DEFUSE_PATH__ + +ensembl_version = $ensembl_version +ensembl_genome_version = $ensembl_genome_version +ucsc_genome_version = $ucsc_genome_version + +# Directory where you want your dataset +dataset_directory = $config_txt.extra_files_path + +#raw +# Input genome and gene models +gene_models = $(dataset_directory)/Homo_sapiens.$(ensembl_genome_version).$(ensembl_version).gtf +genome_fasta = $(dataset_directory)/Homo_sapiens.$(ensembl_genome_version).$(ensembl_version).dna.chromosomes.fa + +# Repeat table from ucsc genome browser +repeats_filename = $(dataset_directory)/repeats.txt + +# EST info downloaded from ucsc genome browser +est_fasta = $(dataset_directory)/est.fa +est_alignments = $(dataset_directory)/intronEst.txt + +# Unigene clusters downloaded from ncbi +unigene_fasta = $(dataset_directory)/Hs.seq.uniq +#end raw + +# Paths to external tools +samtools_bin = __SAMTOOLS_BIN__ +bowtie_bin = __BOWTIE_BIN__ +bowtie_build_bin = __BOWTIE_BUILD_BIN__ +blat_bin = __BLAT_BIN__ +fatotwobit_bin = __FATOTWOBIT_BIN__ +gmap_bin = __GMAP_BIN__ +gmap_setup_bin = __GMAP_SETUP_BIN__ +r_bin = __R_BIN__ +rscript_bin = __RSCRIPT_BIN__ + +#raw +# Directory where you want your dataset +gmap_index_directory = $(dataset_directory)/gmap +#end raw + +#raw +# Dataset files +dataset_prefix = $(dataset_directory)/defuse +chromosome_prefix = $(dataset_prefix).dna.chromosomes +exons_fasta = $(dataset_prefix).exons.fa +cds_fasta = $(dataset_prefix).cds.fa +cdna_regions = $(dataset_prefix).cdna.regions +cdna_fasta = $(dataset_prefix).cdna.fa +reference_fasta = $(dataset_prefix).reference.fa +rrna_fasta = $(dataset_prefix).rrna.fa +ig_gene_list = $(dataset_prefix).ig.gene.list +repeats_regions = $(dataset_directory)/repeats.regions +est_split_fasta1 = $(dataset_directory)/est.1.fa +est_split_fasta2 = $(dataset_directory)/est.2.fa +est_split_fasta3 = $(dataset_directory)/est.3.fa +est_split_fasta4 = $(dataset_directory)/est.4.fa +est_split_fasta5 = $(dataset_directory)/est.5.fa +est_split_fasta6 = $(dataset_directory)/est.6.fa +est_split_fasta7 = $(dataset_directory)/est.7.fa +est_split_fasta8 = $(dataset_directory)/est.8.fa +est_split_fasta9 = $(dataset_directory)/est.9.fa + +# Fasta files with bowtie indices for prefiltering reads for concordantly mapping pairs +prefilter1 = $(unigene_fasta) + +# deFuse scripts and tools +scripts_directory = $(source_directory)/scripts +tools_directory = $(source_directory)/tools +data_directory = $(source_directory)/data +#end raw + +#raw +# Bowtie parameters +bowtie_threads = 1 +bowtie_quals = --phred33-quals +max_insert_size = 500 +#end raw + +# Parameters for building the dataset +chromosomes = $chromosomes +mt_chromosome = $mt_chromosome +gene_sources = $gene_sources +ig_gene_sources = $ig_gene_sources +rrna_gene_sources = $rrna_gene_sources + +#raw +# Blat sequences per job +num_blat_sequences = 10000 + +# Minimum gene fusion range +dna_concordant_length = 2000 + +# Trim length for discordant reads (split reads are not trimmed) +discord_read_trim = 50 + +# Calculate extra annotations, fusion splice index and interrupted index +calculate_extra_annotations = no + +# Filtering parameters +clustering_precision = 0.95 +span_count_threshold = 5 +percent_identity_threshold = 0.90 +split_min_anchor = 4 +splice_bias = 10 +positive_controls = $(data_directory)/controls.txt +probability_threshold = 0.50 + +# Position density when calculating covariance +covariance_sampling_density = 0.01 + +# Number of reads for each job in split +reads_per_job = 1000000 + +# If you have command line 'mail' and wish to be notified +mailto = andrew.mcpherson@gmail.com + +# Remove temp files +remove_job_files = yes +remove_job_temp_files = yes +#end raw + </configfile> + <configfile name="shscript"> +#!/bin/bash +## define some things for cheetah proccessing +#set $ds = chr(36) +#set $amp = chr(38) +#set $gt = chr(62) +#set $lt = chr(60) +#set $echo_cmd = 'echo' +## Find the defuse.pl in the galaxy tool path +#import Cheetah.FileUtils +## substitute pathnames into config file +if `grep __DEFUSE_PATH__ $defuse_config ${gt} /dev/null`;then sed -i'.tmp' "s#__DEFUSE_PATH__#\${DEFUSE_PATH}#" $defuse_config; fi +if `grep __SAMTOOLS_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} SAMTOOLS_BIN=`which samtools`;then sed -i'.tmp' "s#__SAMTOOLS_BIN__#\${SAMTOOLS_BIN}#" $defuse_config; fi +if `grep __BOWTIE_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BOWTIE_BIN=`which bowtie`;then sed -i'.tmp' "s#__BOWTIE_BIN__#\${BOWTIE_BIN}#" $defuse_config; fi +if `grep __BOWTIE_BUILD_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BOWTIE_BUILD_BIN=`which bowtie-build`;then sed -i'.tmp' "s#__BOWTIE_BUILD_BIN__#\${BOWTIE_BUILD_BIN}#" $defuse_config; fi +if `grep __BLAT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BLAT_BIN=`which blat`;then sed -i'.tmp' "s#__BLAT_BIN__#\${BLAT_BIN}#" $defuse_config; fi +if `grep __FATOTWOBIT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} FATOTWOBIT_BIN=`which faToTwoBit`;then sed -i'.tmp' "s#__FATOTWOBIT_BIN__#\${FATOTWOBIT_BIN}#" $defuse_config; fi +if `grep __GMAP_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} GMAP_BIN=`which gmap`;then sed -i'.tmp' "s#__GMAP_BIN__#\${GMAP_BIN}#" $defuse_config; fi +if `grep __GMAP_SETUP_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} GMAP_SETUP_BIN=`which gmap_setup`;then sed -i'.tmp' "s#__GMAP_SETUP_BIN__#\${GMAP_SETUP_BIN}#" $defuse_config; fi +if `grep __GMAP_INDEX_DIR__ $defuse_config ${gt} /dev/null` ${amp}${amp} GMAP_INDEX_DIR=`pwd`/gmap;then sed -i'.tmp' "s#__GMAP_INDEX_DIR__#\${GMAP_INDEX_DIR}#" $defuse_config; fi +if `grep __R_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} R_BIN=`which R`;then sed -i'.tmp' "s#__R_BIN__#\${R_BIN}#" $defuse_config; fi +if `grep __RSCRIPT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} RSCRIPT_BIN=`which Rscript`;then sed -i'.tmp' "s#__RSCRIPT_BIN__#\${RSCRIPT_BIN}#" $defuse_config; fi + +## copy config to output +cp $defuse_config $config_txt +## make a data_dir and ln -s the input fastq +mkdir -p $config_txt.extra_files_path +## run defuse.pl +perl \${DEFUSE_PATH}/scripts/create_reference_dataset.pl -c $defuse_config + </configfile> + </configfiles> + + <tests> + </tests> + <help> +**DeFuse** + +DeFuse_ is a software package for gene fusion discovery using RNA-Seq data. The software uses clusters of discordant paired end alignments to inform a split read alignment analysis for finding fusion boundaries. The software also employs a number of heuristic filters in an attempt to reduce the number of false positives and produces a fully annotated output for each predicted fusion. + +Journal reference: http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1001138 + +.. _DeFuse: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=Main_Page + +------ + +**Inputs** + +DeFuse requires 2 fastq files for paried reads, one with the left mate of the paired reads, and a second fastq with the the right mate of the paired reads (**with reads in the same order as in the first fastq dataset**). + +If your fastq files have reads in different orders or include unpaired reads, you can preprocess them with **FASTQ interlacer** to create a single interlaced fastq dataset with only the paired reads and input that to **FASTQ de-interlacer** to separate the reads into a left fastq and right fastq. + +DeFuse uses a Reference Dataset to search for gene fusions. The Reference Dataset is generated from the following sources in DeFuse_Version_0.4_: + - genome_fasta from Ensembl + - gene_models from Ensembl + - repeats_filename from UCSC RepeatMasker rmsk.txt + - est_fasta from UCSC + - est_alignments from UCSC intronEst.txt + - unigene_fasta from NCBI + +.. _DeFuse_Version_0.4: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2 + +------ + +**Outputs** + +The galaxy history will contain 5 outputs: the config.txt file that provides DeFuse with its parameters, the defuse.log which details what DeFuse has done and can be useful in determining any errors, and the 3 results files that defuse generates. + +DeFuse generates 3 results files: results.txt, results.filtered.txt, and results.classify.txt. All three files have the same format, though results.classify.txt has a probability column from the application of the classifier to results.txt, and results.filtered.txt has been filtered according to the threshold probability as set in config.txt. + +The file format is tab delimited with one prediction per line, and the following fields per prediction (not necessarily in this order): + + - **Identification** + - cluster_id : random identifier assigned to each prediction + - library_name : library name given on the command line of defuse + - gene1 : ensembl id of gene 1 + - gene2 : ensembl id of gene 2 + - gene_name1 : name of gene 1 + - gene_name2 : name of gene 2 + - **Evidence** + - break_predict : breakpoint prediction method, denovo or splitr, that is considered most reliable + - concordant_ratio : proportion of spanning reads considered concordant by blat + - denovo_min_count : minimum kmer count across denovo assembled sequence + - denovo_sequence : fusion sequence predicted by debruijn based denovo sequence assembly + - denovo_span_pvalue : p-value, lower values are evidence the prediction is a false positive + - gene_align_strand1 : alignment strand for spanning read alignments to gene 1 + - gene_align_strand2 : alignment strand for spanning read alignments to gene 2 + - min_map_count : minimum of the number of genomic mappings for each spanning read + - max_map_count : maximum of the number of genomic mappings for each spanning read + - mean_map_count : average of the number of genomic mappings for each spanning read + - num_multi_map : number of spanning reads that map to more than one genomic location + - span_count : number of spanning reads supporting the fusion + - span_coverage1 : coverage of spanning reads aligned to gene 1 as a proportion of expected coverage + - span_coverage2 : coverage of spanning reads aligned to gene 2 as a proportion of expected coverage + - span_coverage_min : minimum of span_coverage1 and span_coverage2 + - span_coverage_max : maximum of span_coverage1 and span_coverage2 + - splitr_count : number of split reads supporting the prediction + - splitr_min_pvalue : p-value, lower values are evidence the prediction is a false positive + - splitr_pos_pvalue : p-value, lower values are evidence the prediction is a false positive + - splitr_sequence : fusion sequence predicted by split reads + - splitr_span_pvalue : p-value, lower values are evidence the prediction is a false positive + - **Annotation** + - adjacent : fusion between adjacent genes + - altsplice : fusion likely the product of alternative splicing between adjacent genes + - break_adj_entropy1 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 1 + - break_adj_entropy2 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 2 + - break_adj_entropy_min : minimum of break_adj_entropy1 and break_adj_entropy2 + - breakpoint_homology : number of nucleotides at the fusion splice that align equally well to gene 1 or gene 2 + - breakseqs_estislands_percident : maximum percent identity of fusion sequence alignments to est islands + - cdna_breakseqs_percident : maximum percent identity of fusion sequence alignments to cdna + - deletion : fusion produced by a genomic deletion + - est_breakseqs_percident : maximum percent identity of fusion sequence alignments to est + - eversion : fusion produced by a genomic eversion + - exonboundaries : fusion splice at exon boundaries + - expression1 : expression of gene 1 as number of concordant pairs aligned to exons + - expression2 : expression of gene 2 as number of concordant pairs aligned to exons + - gene_chromosome1 : chromosome of gene 1 + - gene_chromosome2 : chromosome of gene 2 + - gene_end1 : end position for gene 1 + - gene_end2 : end position for gene 2 + - gene_location1 : location of breakpoint in gene 1 + - gene_location2 : location of breakpoint in gene 2 + - gene_start1 : start of gene 1 + - gene_start2 : start of gene 2 + - gene_strand1 : strand of gene 1 + - gene_strand2 : strand of gene 2 + - genome_breakseqs_percident : maximum percent identity of fusion sequence alignments to genome + - genomic_break_pos1 : genomic position in gene 1 of fusion splice / breakpoint + - genomic_break_pos2 : genomic position in gene 2 of fusion splice / breakpoint + - genomic_strand1 : genomic strand in gene 1 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream + - genomic_strand2 : genomic strand in gene 2 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream + - interchromosomal : fusion produced by an interchromosomal translocation + - interrupted_index1 : ratio of coverage before and after the fusion splice / breakpoint in gene 1 + - interrupted_index2 : ratio of coverage before and after the fusion splice / breakpoint in gene 2 + - inversion : fusion produced by genomic inversion + - orf : fusion combines genes in a way that preserves a reading frame + - probability : probability produced by classification using adaboost and example positives/negatives (only given in results.classified.txt) + - read_through : fusion involving adjacent potentially resulting from co-transcription rather than genome rearrangement + - repeat_proportion1 : proportion of the spanning reads in gene 1 that span a repeat region + - repeat_proportion2 : proportion of the spanning reads in gene 2 that span a repeat region + - max_repeat_proportion : max of repeat_proportion1 and repeat_proportion2 + - splice_score : number of nucleotides similar to GTAG at fusion splice + - num_splice_variants : number of potential splice variants for this gene pair + - splicing_index1 : number of concordant pairs in gene 1 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 2 + - splicing_index2 : number of concordant pairs in gene 2 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 1 + + +**Example** + +results.tsv:: + + cluster_id splitr_sequence splitr_count splitr_span_pvalue splitr_pos_pvalue splitr_min_pvalue adjacent altsplice break_adj_entropy1 break_adj_entropy2 break_adj_entropy_min break_predict breakpoint_homology breakseqs_estislands_percident cdna_breakseqs_percident concordant_ratio deletion est_breakseqs_percident eversion exonboundaries expression1 expression2 gene1 gene2 gene_align_strand1 gene_align_strand2 gene_chromosome1 gene_chromosome2 gene_end1 gene_end2 gene_location1 gene_location2 gene_name1 gene_name2 gene_start1 gene_start2 gene_strand1 gene_strand2 genome_breakseqs_percident genomic_break_pos1 genomic_break_pos2 genomic_strand1 genomic_strand2 interchromosomal interrupted_index1 interrupted_index2 inversion library_name max_map_count max_repeat_proportion mean_map_count min_map_count num_multi_map num_splice_variants orf read_through repeat_proportion1 repeat_proportion2 span_count span_coverage1 span_coverage2 span_coverage_max span_coverage_min splice_score splicing_index1 splicing_index2 + 1169 GCTTACTGTATGCCAGGCCCCAGAGGGGCAACCACCCTCTAAAGAGAGCGGCTCCTGCCTCCCAGAAAGCTCACAGACTGTGGGAGGGAAACAGGCAGCAGGTGAAGATGCCAAATGCCAGGATATCTGCCCTGTCCTTGCTTGATGCAGCTGCTGGCTCCCACGTTCTCCCCAGAATCCCCTCACACTCCTGCTGTTTTCTCTGCAGGTTGGCAGAGCCCCATGAGGGCAGGGCAGCCACTTTGTTCTTGGGCGGCAAACCTCCCTGGGCGGCACGGAAACCACGGTGAGAAGGGGGCAGGTCGGGCACGTGCAGGGACCACGCTGCAGG|TGTACCCAACAGCTCCGAAGAGACAGCGACCATCGAGAACGGGCCATGATGACGATGGCGGTTTTGTCGAAAAGAAAAGGGGGAAATGTGGGGAAAAGCAAGAGAGATCAGATTGTTACTGTGTCTGTGTAGAAAGAAGTAGACATGGGAGACTCCATTTTGTTCTGTACTAAGAAAAATTCTTCTGCCTTGAGATTCGGTGACCCCACCCCCAACCCCGTGCTCTCTGAAACATGTGCTGTGTCCACTCAGGGTTGAATGGATTAAGGGCGGTGCGAGACGTGCTTT 2 0.000436307890680442 0.110748295953850 0.0880671602973091 N Y 3.19872427442695 3.48337348351473 3.19872427442695 splitr 0 0 0 0 Y 0 N N 0 0 ENSG00000105549 ENSG00000213753 + - 19 19 376013 59111168 intron upstream THEG AC016629.2 361750 59084870 - + 0 375099 386594 + - N 8.34107429512245 - N output_dir 82 0.677852348993289 40.6666666666667 1 11 1 N N 0.361271676300578 0.677852348993289 12 0.758602776578432 0.569678713445872 0.758602776578432 0.569678713445872 2 0.416666666666667 - + 3596 TGGGGGTTGAGGCTTCTGTTCCCAGGTTCCATGACCTCAGAGGTGGCTGGTGAGGTTATGACCTTTGCCCTCCAGCCCTGGCTTAAAACCTCAGCCCTAGGACCTGGTTAAAGGAAGGGGAGATGGAGCTTTGCCCCGACCCCCCCCCGTTCCCCTCACCTGTCAGCCCGAGCTGGGCCAGGGCCCCTAGGTGGGGAACTGGGCCGGGGGGCGGGCACAAGCGGAGGTGGTGCCCCCAAAAGGGCTCCCGGTGGGGTCTTGCTGAGAAGGTGAGGGGTTCCCGGGGCCGCAGCAGGTGGTGGTGGAGGAGCCAAGCGGCTGTAGAGCAAGGGGTGAGCAGGTTCCAGACCGTAGAGGCGGGCAGCGGCCACGGCCCCGGGTCCAGTTAGCTCCTCACCCGCCTCATAGAAGCGGGGTGGCCTTGCCAGGCGTGGGGGTGCTGCC|TTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAGACGTTCGAATGGGTCGTCGCCGCCACGGGGGGCGTGCGATCAGCCCGAGGTTATCTAGAGTCACCAAAGCCGCCGGCGCCCGCCCCCCGGCCGGGGCCGGAGAGGGGCTGACCGGGTTGGTTTTGATCTGATAAATGCACGCATCCCCCCCGCGAAGGGGGTCAGCGCCCGTCGGCATGTATTAGCTCTAGAATTACCACAGTTATCCAAGTAGGAGAGGAGCGAGCGACCAAAGGAACCATAACTGATTTAATGAGCCATTCGCAGTTTCACTGTACCGGCCGTGCGTACTTAGACATGCATGGCTTAATCTTTGAGACAAGCATATGCTACTGGCAGG 250 7.00711162298275e-72 0.00912124762512338 0.00684237452309549 N N 3.31745197152461 3.47233119514066 3.31745197152461 splitr 7 0.0157657657657656 0 0 N 0.0135135135135136 N N 0 0 ENSG00000156860 ENSG00000212932 - + 16 21 30682131 48111157 coding upstream FBRS RPL23AP4 30670289 48110676 + + 0.0157657657657656 30680678 9827473 - + Y - - N output_dir 2 1 1.11111111111111 1 1 1 N N 0 1 9 0.325530693397641 0.296465452915709 0.325530693397641 0.296465452915709 2 - - + + </help> +</tool>
--- a/defuse.xml Fri Jun 07 20:52:19 2013 -0500 +++ b/defuse.xml Sun Jun 09 20:30:21 2013 -0500 @@ -226,7 +226,9 @@ #try $ref_dict['gmap_index_directory'] #except -\$(dataset_directory)/gmap +#raw +$(dataset_directory)/gmap +#end raw #end try #raw @@ -597,7 +599,7 @@ mkdir -p output_dir #end if ## run defuse.pl -perl \${DEFUSE_PATH}/scripts/defuse.pl -c $defuse_config -d data_dir -o output_dir -p 8 +perl \${DEFUSE_PATH}/scripts/defuse.pl -c $defuse_config -1 data_dir/reads_1.fastq -2 data_dir/reads_2.fastq -o output_dir -p 8 ## copy primary results to output datasets if [ -e output_dir/log/defuse.log ]; then cp output_dir/log/defuse.log $defuse_log; fi if [ -e output_dir/results.tsv ]; then cp output_dir/results.tsv $results_tsv; fi
