Mercurial > repos > jjohnson > augustus_dep

comparison augustus.xml @ 0:807dc2efb781 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author jjohnson
date Mon, 22 Oct 2012 13:25:19 -0400
parents
children b7e800db2632
comparison
equal deleted inserted replaced
-1:000000000000 0:807dc2efb781
1 <tool id="augustus" name="Augustus" version="0.2">
2 <description>gene prediction for eukaryotic genomes</description>
3 <requirements>
4 <requirement type="package" version="2.2.5">augustus</requirement>
5 </requirements>
6 <command>augustus
7 --strand=$strand
8 $noInFrameStop
9 $gff
10 $protein
11 $introns
12 $start
13 $stop
14 $cds
15 $codingseq
16 $singlestrand
17 $input_genome
18 --genemodel=$genemodel
19 --species=$organism
20 --outfile=$output
21
22 #please set export AUGUSTUS_CONFIG_PATH=/path_to_augustus/augustus/config
23 #or use the --AUGUSTUS_CONFIG_PATH=path switch
24
25 </command>
26 <inputs>
27 <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/>
28 <param name="noInFrameStop" type="boolean" label="Don't report transcripts with in-frame stop codons. Otherwise, intron-spanning stop codons could occur" truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" />
29 <param name="gff" type="boolean" label="GFF formated output, standard is GTF" truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" />
30 <param name="protein" type="boolean" label="Output predicted protein sequences" truevalue="--protein=on" falsevalue="--protein=off" checked="false" />
31 <param name="introns" type="boolean" label="Output predicted intron sequences" truevalue="--introns=on" falsevalue="--introns=off" checked="false" />
32 <param name="start" type="boolean" label="Output predicted start codons" truevalue="--start=on" falsevalue="--start=off" checked="false" />
33 <param name="stop" type="boolean" label="Output predicted stop codons" truevalue="--stop=on" falsevalue="--stop=off" checked="false" />
34 <param name="cds" type="boolean" label="Output CDS region" truevalue="--cds=on" falsevalue="--cds=off" checked="true" />
35 <param name="codingseq" type="boolean" label="Output coding sequence as comment in the output file" truevalue="--codingseq=on" falsevalue="--codingseq=off" checked="false" />
36
37 <param name="singlestrand" type="boolean" label="Predict genes independently on each strand, allow overlapping genes on opposite strands" truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" />
38
39 <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset.">
40 <option value="human">Homo sapiens</option>
41 <option value="fly">Drosophila melanogaster</option>
42 <option value="arabidopsis">Arabidopsis thaliana</option>
43 <option value="brugia ">Brugia malayi</option>
44 <option value="aedes">Aedes aegypti</option>
45 <option value="tribolium">Tribolium castaneum</option>
46 <option value="schistosoma">Schistosoma mansoni</option>
47 <option value="tetrahymena">Tetrahymena thermophila</option>
48 <option value="galdieria">Galdieria sulphuraria</option>
49 <option value="maize">Zea mays</option>
50 <option value="toxoplasma ">Toxoplasma gondii</option>
51 <option value="caenorhabditis ">Caenorhabditis elegans</option>
52 <option value="aspergillus_fumigatus">Aspergillus fumigatus</option>
53 <option value="aspergillus_nidulans ">Aspergillus nidulans</option>
54 <option value="aspergillus_oryzae ">Aspergillus oryzae</option>
55 <option value="aspergillus_terreus">Aspergillus terreus</option>
56 <option value="botrytis_cinerea ">Botrytis cinerea</option>
57 <option value="candida_albicans ">Candida albicans</option>
58 <option value="candida_guilliermondii ">Candida guilliermondii</option>
59 <option value="candida_tropicalis ">Candida tropicalis</option>
60 <option value="chaetomium_globosum">Chaetomium globosum</option>
61 <option value="coccidioides_immitis ">Coccidioides immitis</option>
62 <option value="coprinus ">Coprinus cinereus</option>
63 <option value="coprinus_cinereus">Coprinus cinereus</option>
64 <option value="cryptococcus_neoformans_gattii ">Cryptococcus neoformans gattii</option>
65 <option value="cryptococcus_neoformans_neoformans_B ">Cryptococcus neoformans neoformans</option>
66 <option value="cryptococcus_neoformans_neoformans_JEC21 ">Cryptococcus neoformans neoformans</option>
67 <option value="debaryomyces_hansenii">Debaryomyces hansenii</option>
68 <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option>
69 <option value="eremothecium_gossypii">Eremothecium gossypii</option>
70 <option value="fusarium_graminearum ">Fusarium graminearum</option>
71 <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option>
72 <option value="(histoplasma)">Histoplasma capsulatum</option>
73 <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option>
74 <option value="laccaria_bicolor ">Laccaria bicolor</option>
75 <option value="lamprey">Petromyzon marinus</option>
76 <option value="leishmania_tarentolae">Leishmania tarentolae</option>
77 <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option>
78 <option value="magnaporthe_grisea ">Magnaporthe grisea</option>
79 <option value="neurospora_crassa">Neurospora crassa</option>
80 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option>
81 <option value="pichia_stipitis">Pichia stipitis</option>
82 <option value="rhizopus_oryzae">Rhizopus oryzae</option>
83 <option value="saccharomyces_cerevisiae_S288C ">Saccharomyces cerevisiae</option>
84 <option value="saccharomyces_cerevisiae_rm11-1a_1 ">Saccharomyces cerevisiae</option>
85 <option value="(saccharomyces)">Saccharomyces cerevisiae</option>
86 <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option>
87 <option value="trichinella">Trichinella spiralis</option>
88 <option value="ustilago_maydis">Ustilago maydis</option>
89 <option value="yarrowia_lipolytica">Yarrowia lipolytica</option>
90 <option value="nasonia">Nasonia vitripennis</option>
91 <option value="tomato ">Solanum lycopersicum</option>
92 <option value="chlamydomonas">Chlamydomonas reinhardtii</option>
93 <option value="amphimedon ">Amphimedon queenslandica</option>
94 <option value="pneumocystis ">Pneumocystis jirovecii</option>
95 </param>
96
97 <param name="strand" type="select" multiple="false" format="text" help="Report predicted genes on both strands, just the forward or just the backward strand.">
98 <option value="both">both</option>
99 <option value="forward">forward</option>
100 <option value="backward">backward</option>
101 </param>
102
103 <param name="genemodel" label="Gene Model" type="select" multiple="false" format="text" help="Gene Model to predict, for more information please refere to the help.">
104 <option value="complete">complete</option>
105 <option value="partial">partial</option>
106 <option value="intronless">intronless</option>
107 <option value="atleastone">atleastone</option>
108 <option value="exactlyone">exactlyone</option>
109 </param>
110
111 </inputs>
112 <outputs>
113 <data format="gtf" name="output">
114 <change_format>
115 <when input="gff" value="--gff3=on" format="gff" />
116 </change_format>
117 </data>
118 </outputs>
119 <help>
120
121 **What it does**
122
123 AUGUSTUS is a gene prediction program for eukaryotes written by Mario Stanke and Oliver Keller.
124 It can be used as an ab initio program, which means it bases its prediction purely on the
125 sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources
126 such as EST, MS/MS, protein alignments and synthenic genomic alignments.
127
128 -----
129
130 **Parameters**
131
132 Gene Model::
133
134 partial : allow prediction of incomplete genes at the sequence boundaries (default)
135 intronless : only predict single-exon genes like in prokaryotes and some eukaryotes
136 complete : only predict complete genes
137 atleastone : predict at least one complete gene
138 exactlyone : predict exactly one complete gene
139
140
141
142 **Example**
143
144 Suppose you have the following DNA formatted sequences::
145
146 >Seq1
147 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
148 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
149 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
150 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
151 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
152
153 Running this tool will produce this::
154
155 # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) -----
156 #
157 # Constraints/Hints:
158 # (none)
159 # Predicted genes for sequence number 1 on both strands
160 # start gene g1
161 scaffold1|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6
162 scaffold1|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1
163 scaffold1|size1992969 AUGUSTUS start_codon 17453 17455 . + 0 transcript_id "g6.t1"; gene_id "g6";
164 scaffold1|size1992969 AUGUSTUS intron 17615 17660 0.38 + . transcript_id "g6.t1"; gene_id "g6";
165 scaffold1|size1992969 AUGUSTUS intron 17708 17772 0.54 + . transcript_id "g6.t1"; gene_id "g6";
166 scaffold1|size1992969 AUGUSTUS intron 17902 18035 0.58 + . transcript_id "g6.t1"; gene_id "g6";
167 scaffold1|size1992969 AUGUSTUS intron 18313 18367 0.99 + . transcript_id "g6.t1"; gene_id "g6";
168 scaffold1|size1992969 AUGUSTUS intron 19014 19080 0.44 + . transcript_id "g6.t1"; gene_id "g6";
169 scaffold1|size1992969 AUGUSTUS CDS 17453 17614 0.55 + 0 transcript_id "g6.t1"; gene_id "g6";
170 scaffold1|size1992969 AUGUSTUS CDS 17661 17707 0.38 + 0 transcript_id "g6.t1"; gene_id "g6";
171 scaffold1|size1992969 AUGUSTUS CDS 17773 17901 0.54 + 1 transcript_id "g6.t1"; gene_id "g6";
172 scaffold1|size1992969 AUGUSTUS CDS 18036 18312 0.52 + 1 transcript_id "g6.t1"; gene_id "g6";
173 scaffold1|size1992969 AUGUSTUS CDS 18368 19013 0.99 + 0 transcript_id "g6.t1"; gene_id "g6";
174 scaffold1|size1992969 AUGUSTUS CDS 19081 19379 0.31 + 2 transcript_id "g6.t1"; gene_id "g6";
175 scaffold1|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6";
176
177
178 **References**
179
180 Mario Stanke and Stephan Waack (2003)
181 Gene Prediction with a Hidden-Markov Model and a new Intron Submodel.
182 Bioinformatics, Vol. 19, Suppl. 2, pages ii215-ii225
183
184
185 </help>
186 </tool>