Mercurial > repos > iuc > variant_analyzer
diff read2mut.py @ 2:18fcf8017300 draft default tip
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/variant_analyzer commit f492e9717cb946f0eb5689cd7b6eb8067abf6468"
| author | iuc |
|---|---|
| date | Tue, 10 Nov 2020 12:54:49 +0000 |
| parents | 833d9e71b864 |
| children |
line wrap: on
line diff
--- a/read2mut.py Wed Dec 04 21:20:55 2019 +0000 +++ b/read2mut.py Tue Nov 10 12:54:49 2020 +0000 @@ -10,13 +10,13 @@ ======= ========== ================= ================================ Version Date Author Description -0.2.1 2019-10-27 Gundula Povysil - +2.0.0 2020-10-30 Gundula Povysil - ======= ========== ================= ================================ USAGE: python read2mut.py --mutFile DCS_Mutations.tabular --bamFile Interesting_Reads.trim.bam --inputJson tag_count_dict.json --sscsJson SSCS_counts.json - --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim 10 + --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim 10 --chimera_correction """ @@ -32,12 +32,13 @@ import numpy as np import pysam import xlsxwriter +from cyvcf2 import VCF def make_argparser(): - parser = argparse.ArgumentParser(description='Takes a tabular file with mutations, a BAM file and JSON files as input and prints stats about variants to a user specified output file.') + parser = argparse.ArgumentParser(description='Takes a VCF file with mutations, a BAM file and JSON files as input and prints stats about variants to a user specified output file.') parser.add_argument('--mutFile', - help='TABULAR file with DCS mutations.') + help='VCF file with DCS mutations.') parser.add_argument('--bamFile', help='BAM file with aligned raw reads of selected tags (FASTQ created by mut2read.py - trimming with Trimmomatic - alignment with bwa).') parser.add_argument('--inputJson', @@ -52,6 +53,8 @@ help='Integer threshold for Phred score. Only reads higher than this threshold are considered. Default 20.') parser.add_argument('--trim', type=int, default=10, help='Integer threshold for assigning mutations at start and end of reads to lower tier. Default 10.') + parser.add_argument('--chimera_correction', action="store_true", + help='Count chimeric variants and correct the variant frequencies') return parser @@ -72,6 +75,7 @@ thresh = args.thresh phred_score = args.phred trim = args.trim + chimera_correction = args.chimera_correction if os.path.isfile(file1) is False: sys.exit("Error: Could not find '{}'".format(file1)) @@ -86,95 +90,95 @@ if trim < 0: sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thresh)) - # 1. read mut file - with open(file1, 'r') as mut: - mut_array = np.genfromtxt(mut, skip_header=1, delimiter='\t', comments='#', dtype=str) - - # 2. load dicts + # load dicts with open(json_file, "r") as f: (tag_dict, cvrg_dict) = json.load(f) with open(sscs_json, "r") as f: (mut_pos_dict, ref_pos_dict) = json.load(f) - # 3. read bam file - # pysam.index(file2) + # read bam file bam = pysam.AlignmentFile(file2, "rb") - # 4. create mut_dict + # create mut_dict mut_dict = {} mut_read_pos_dict = {} mut_read_dict = {} reads_dict = {} - if mut_array.shape == (13, ): - mut_array = mut_array.reshape((1, len(mut_array))) + i = 0 + mut_array = [] - for m in range(0, len(mut_array[:, 0])): - print(str(m + 1) + " of " + str(len(mut_array[:, 0]))) - # for m in range(0, 5): - chrom = mut_array[m, 1] - stop_pos = mut_array[m, 2].astype(int) + for variant in VCF(file1): + chrom = variant.CHROM + stop_pos = variant.start chrom_stop_pos = str(chrom) + "#" + str(stop_pos) - ref = mut_array[m, 9] - alt = mut_array[m, 10] - mut_dict[chrom_stop_pos] = {} - mut_read_pos_dict[chrom_stop_pos] = {} - reads_dict[chrom_stop_pos] = {} + ref = variant.REF + alt = variant.ALT[0] + + if len(ref) == len(alt): + mut_array.append([chrom, stop_pos, ref, alt]) + i += 1 + mut_dict[chrom_stop_pos] = {} + mut_read_pos_dict[chrom_stop_pos] = {} + reads_dict[chrom_stop_pos] = {} - for pileupcolumn in bam.pileup(chrom, stop_pos - 2, stop_pos, max_depth=1000000000): - if pileupcolumn.reference_pos == stop_pos - 1: - count_alt = 0 - count_ref = 0 - count_indel = 0 - count_n = 0 - count_other = 0 - count_lowq = 0 - n = 0 - print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups), - "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n) - for pileupread in pileupcolumn.pileups: - n += 1 - if not pileupread.is_del and not pileupread.is_refskip: - tag = pileupread.alignment.query_name - nuc = pileupread.alignment.query_sequence[pileupread.query_position] - phred = ord(pileupread.alignment.qual[pileupread.query_position]) - 33 - if phred < phred_score: - nuc = "lowQ" - if tag not in mut_dict[chrom_stop_pos]: - mut_dict[chrom_stop_pos][tag] = {} - if nuc in mut_dict[chrom_stop_pos][tag]: - mut_dict[chrom_stop_pos][tag][nuc] += 1 + for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=100000000): + if pileupcolumn.reference_pos == stop_pos: + count_alt = 0 + count_ref = 0 + count_indel = 0 + count_n = 0 + count_other = 0 + count_lowq = 0 + n = 0 + print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups), + "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n) + for pileupread in pileupcolumn.pileups: + n += 1 + if not pileupread.is_del and not pileupread.is_refskip: + tag = pileupread.alignment.query_name + nuc = pileupread.alignment.query_sequence[pileupread.query_position] + phred = ord(pileupread.alignment.qual[pileupread.query_position]) - 33 + if phred < phred_score: + nuc = "lowQ" + if tag not in mut_dict[chrom_stop_pos]: + mut_dict[chrom_stop_pos][tag] = {} + if nuc in mut_dict[chrom_stop_pos][tag]: + mut_dict[chrom_stop_pos][tag][nuc] += 1 + else: + mut_dict[chrom_stop_pos][tag][nuc] = 1 + if tag not in mut_read_pos_dict[chrom_stop_pos]: + mut_read_pos_dict[chrom_stop_pos][tag] = np.array(pileupread.query_position) + 1 + reads_dict[chrom_stop_pos][tag] = len(pileupread.alignment.query_sequence) + else: + mut_read_pos_dict[chrom_stop_pos][tag] = np.append( + mut_read_pos_dict[chrom_stop_pos][tag], pileupread.query_position + 1) + reads_dict[chrom_stop_pos][tag] = np.append( + reads_dict[chrom_stop_pos][tag], len(pileupread.alignment.query_sequence)) + + if nuc == alt: + count_alt += 1 + if tag not in mut_read_dict: + mut_read_dict[tag] = {} + mut_read_dict[tag][chrom_stop_pos] = (alt, ref) + else: + mut_read_dict[tag][chrom_stop_pos] = (alt, ref) + elif nuc == ref: + count_ref += 1 + elif nuc == "N": + count_n += 1 + elif nuc == "lowQ": + count_lowq += 1 + else: + count_other += 1 else: - mut_dict[chrom_stop_pos][tag][nuc] = 1 - if tag not in mut_read_pos_dict[chrom_stop_pos]: - mut_read_pos_dict[chrom_stop_pos][tag] = np.array(pileupread.query_position) + 1 - reads_dict[chrom_stop_pos][tag] = len(pileupread.alignment.query_sequence) - else: - mut_read_pos_dict[chrom_stop_pos][tag] = np.append( - mut_read_pos_dict[chrom_stop_pos][tag], pileupread.query_position + 1) - reads_dict[chrom_stop_pos][tag] = np.append( - reads_dict[chrom_stop_pos][tag], len(pileupread.alignment.query_sequence)) + count_indel += 1 - if nuc == alt: - count_alt += 1 - if tag not in mut_read_dict: - mut_read_dict[tag] = {} - mut_read_dict[tag][chrom_stop_pos] = alt - else: - mut_read_dict[tag][chrom_stop_pos] = alt - elif nuc == ref: - count_ref += 1 - elif nuc == "N": - count_n += 1 - elif nuc == "lowQ": - count_lowq += 1 - else: - count_other += 1 - else: - count_indel += 1 + print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq)) + else: + print("indels are currently not evaluated") - print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq)) - + mut_array = np.array(mut_array) for read in bam.fetch(until_eof=True): if read.is_unmapped: pure_tag = read.query_name[:-5] @@ -190,13 +194,13 @@ mut_dict[key][read.query_name][nuc] = 1 bam.close() - # 5. create pure_tags_dict + # create pure_tags_dict pure_tags_dict = {} for key1, value1 in sorted(mut_dict.items()): i = np.where(np.array(['#'.join(str(i) for i in z) - for z in zip(mut_array[:, 1], mut_array[:, 2])]) == key1)[0][0] - ref = mut_array[i, 9] - alt = mut_array[i, 10] + for z in zip(mut_array[:, 0], mut_array[:, 1])]) == key1)[0][0] + ref = mut_array[i, 2] + alt = mut_array[i, 3] pure_tags_dict[key1] = {} for key2, value2 in sorted(value1.items()): for key3, value3 in value2.items(): @@ -207,7 +211,7 @@ else: pure_tags_dict[key1][pure_tag] = 1 - # 6. create pure_tags_dict_short with thresh + # create pure_tags_dict_short with thresh if thresh > 0: pure_tags_dict_short = {} for key, value in sorted(pure_tags_dict.items()): @@ -216,11 +220,7 @@ else: pure_tags_dict_short = pure_tags_dict - whole_array = [] - for k in pure_tags_dict.values(): - whole_array.extend(k.keys()) - - # 7. output summary with threshold + # output summary with threshold workbook = xlsxwriter.Workbook(outfile) ws1 = workbook.add_worksheet("Results") ws2 = workbook.add_worksheet("Allele frequencies") @@ -234,11 +234,10 @@ 'read median length.ba', 'DCS median length', 'FS.ab', 'FS.ba', 'FSqc.ab', 'FSqc.ba', 'ref.ab', 'ref.ba', 'alt.ab', 'alt.ba', 'rel. ref.ab', 'rel. ref.ba', 'rel. alt.ab', 'rel. alt.ba', - 'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', + 'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', 'trim.ab', 'trim.ba', 'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba', - 'other mut', 'chimeric tag') + 'in phase', 'chimeric tag') ws1.write_row(0, 0, header_line) - counter_tier11 = 0 counter_tier12 = 0 counter_tier21 = 0 @@ -249,20 +248,23 @@ counter_tier32 = 0 counter_tier41 = 0 counter_tier42 = 0 - + counter_tier5 = 0 row = 1 tier_dict = {} + chimera_dict = {} for key1, value1 in sorted(mut_dict.items()): counts_mut = 0 + chimeric_tag = {} if key1 in pure_tags_dict_short.keys(): i = np.where(np.array(['#'.join(str(i) for i in z) - for z in zip(mut_array[:, 1], mut_array[:, 2])]) == key1)[0][0] - ref = mut_array[i, 9] - alt = mut_array[i, 10] + for z in zip(mut_array[:, 0], mut_array[:, 1])]) == key1)[0][0] + ref = mut_array[i, 2] + alt = mut_array[i, 3] dcs_median = cvrg_dict[key1][2] + whole_array = list(pure_tags_dict_short[key1].keys()) tier_dict[key1] = {} - values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0)] + values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5", 0)] for k, v in values_tier_dict: tier_dict[key1][k] = v @@ -291,15 +293,11 @@ total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values()) if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na'] - # na1f = na1/total1 else: - # na1 = na1f = 0 na1 = 0 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): lowq1 = mut_dict[key1][key2[:-5] + '.ab.1']['lowQ'] - # lowq1f = lowq1 / total1 else: - # lowq1 = lowq1f = 0 lowq1 = 0 if ref in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): ref1 = mut_dict[key1][key2[:-5] + '.ab.1'][ref] @@ -318,29 +316,27 @@ if add_mut1 > 1: for k, v in mut_read_dict[(key2[:-5] + '.ab.1')].items(): if k != key1: + new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0] if len(add_mut14) == 0: - add_mut14 = str(k) + "_" + v + add_mut14 = new_mut else: - add_mut14 = add_mut14 + ", " + str(k) + "_" + v + add_mut14 = add_mut14 + ", " + new_mut else: k1 = [] else: total1 = total1new = na1 = lowq1 = 0 ref1 = alt1 = ref1f = alt1f = 0 + k1 = [] if key2[:-5] + '.ab.2' in mut_dict[key1].keys(): total2 = sum(mut_dict[key1][key2[:-5] + '.ab.2'].values()) if 'na' in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): na2 = mut_dict[key1][key2[:-5] + '.ab.2']['na'] - # na2f = na2 / total2 else: - # na2 = na2f = 0 na2 = 0 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): lowq2 = mut_dict[key1][key2[:-5] + '.ab.2']['lowQ'] - # lowq2f = lowq2 / total2 else: - # lowq2 = lowq2f = 0 lowq2 = 0 if ref in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): ref2 = mut_dict[key1][key2[:-5] + '.ab.2'][ref] @@ -359,29 +355,27 @@ if add_mut2 > 1: for k, v in mut_read_dict[(key2[:-5] + '.ab.2')].items(): if k != key1: + new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0] if len(add_mut23) == 0: - add_mut23 = str(k) + "_" + v + add_mut23 = new_mut else: - add_mut23 = add_mut23 + ", " + str(k) + "_" + v + add_mut23 = add_mut23 + ", " + new_mut else: k2 = [] else: total2 = total2new = na2 = lowq2 = 0 ref2 = alt2 = ref2f = alt2f = 0 + k2 = [] if key2[:-5] + '.ba.1' in mut_dict[key1].keys(): total3 = sum(mut_dict[key1][key2[:-5] + '.ba.1'].values()) if 'na' in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): na3 = mut_dict[key1][key2[:-5] + '.ba.1']['na'] - # na3f = na3 / total3 else: - # na3 = na3f = 0 na3 = 0 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): lowq3 = mut_dict[key1][key2[:-5] + '.ba.1']['lowQ'] - # lowq3f = lowq3 / total3 else: - # lowq3 = lowq3f = 0 lowq3 = 0 if ref in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): ref3 = mut_dict[key1][key2[:-5] + '.ba.1'][ref] @@ -399,10 +393,11 @@ if add_mut3 > 1: for k, v in mut_read_dict[(key2[:-5] + '.ba.1')].items(): if k != key1 and k not in k2: + new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0] if len(add_mut23) == 0: - add_mut23 = str(k) + "_" + v + add_mut23 = new_mut else: - add_mut23 = add_mut23 + ", " + str(k) + "_" + v + add_mut23 = add_mut23 + ", " + new_mut else: total3 = total3new = na3 = lowq3 = 0 ref3 = alt3 = ref3f = alt3f = 0 @@ -411,15 +406,11 @@ total4 = sum(mut_dict[key1][key2[:-5] + '.ba.2'].values()) if 'na' in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): na4 = mut_dict[key1][key2[:-5] + '.ba.2']['na'] - # na4f = na4 / total4 else: - # na4 = na4f = 0 na4 = 0 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): lowq4 = mut_dict[key1][key2[:-5] + '.ba.2']['lowQ'] - # lowq4f = lowq4 / total4 else: - # lowq4 = lowq4f = 0 lowq4 = 0 if ref in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): ref4 = mut_dict[key1][key2[:-5] + '.ba.2'][ref] @@ -437,10 +428,11 @@ if add_mut4 > 1: for k, v in mut_read_dict[(key2[:-5] + '.ba.2')].items(): if k != key1 and k not in k1: + new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0] if len(add_mut14) == 0: - add_mut14 = str(k) + "_" + v + add_mut14 = new_mut else: - add_mut14 = add_mut14 + ", " + str(k) + "_" + v + add_mut14 = add_mut14 + ", " + new_mut else: total4 = total4new = na4 = lowq4 = 0 ref4 = alt4 = ref4f = alt4f = 0 @@ -485,94 +477,94 @@ else: alt4ff = alt4f - details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4) - details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3) + beg1 = beg4 = beg2 = beg3 = 0 + + details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) + details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) + trimmed = False - if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))): - total1new = 0 + contradictory = False + + if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & all(float(ij) == 0. for ij in [alt2ff, alt3ff])) | (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) & all(float(ij) == 0. for ij in [alt1ff, alt4ff]))): alt1ff = 0 - trimmed = True - - if ((read_pos4 >= 0) and ((read_pos4 <= trim) | (abs(read_len_median4 - read_pos4) <= trim))): - total4new = 0 alt4ff = 0 - trimmed = True + alt2ff = 0 + alt3ff = 0 + trimmed = False + contradictory = True + else: + if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))): + beg1 = total1new + total1new = 0 + alt1ff = 0 + alt1f = 0 + trimmed = True - if ((read_pos2 >= 0) and ((read_pos2 <= trim) | (abs(read_len_median2 - read_pos2) <= trim))): - total2new = 0 - alt2ff = 0 - trimmed = True + if ((read_pos4 >= 0) and ((read_pos4 <= trim) | (abs(read_len_median4 - read_pos4) <= trim))): + beg4 = total4new + total4new = 0 + alt4ff = 0 + alt4f = 0 + trimmed = True - if ((read_pos3 >= 0) and ((read_pos3 <= trim) | (abs(read_len_median3 - read_pos3) <= trim))): - total3new = 0 - alt3ff = 0 - trimmed = True + if ((read_pos2 >= 0) and ((read_pos2 <= trim) | (abs(read_len_median2 - read_pos2) <= trim))): + beg2 = total2new + total2new = 0 + alt2ff = 0 + alt2f = 0 + trimmed = True - chrom, pos = re.split(r'\#', key1) + if ((read_pos3 >= 0) and ((read_pos3 <= trim) | (abs(read_len_median3 - read_pos3) <= trim))): + beg3 = total3new + total3new = 0 + alt3ff = 0 + alt3f = 0 + trimmed = True + details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) + details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) + # assign tiers - if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | - (all(int(ij) >= 3 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): + if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | (all(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): tier = "1.1" counter_tier11 += 1 tier_dict[key1]["tier 1.1"] += 1 - elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & - any(int(ij) >= 3 for ij in [total1new, total4new]) & - any(int(ij) >= 3 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): + elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) + & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): tier = "1.2" counter_tier12 += 1 tier_dict[key1]["tier 1.2"] += 1 - elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & - any(int(ij) >= 3 for ij in [total1new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | - (all(int(ij) >= 1 for ij in [total2new, total3new]) & - any(int(ij) >= 3 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) + | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): tier = "2.1" counter_tier21 += 1 tier_dict[key1]["tier 2.1"] += 1 - elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): + elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): tier = "2.2" counter_tier22 += 1 tier_dict[key1]["tier 2.2"] += 1 - elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & - any(int(ij) >= 3 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) & - any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff])) | - (all(int(ij) >= 1 for ij in [total2new, total3new]) & - any(int(ij) >= 3 for ij in [total1new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) & - any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))): + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) & any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff])) + | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) & any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))): tier = "2.3" counter_tier23 += 1 tier_dict[key1]["tier 2.3"] += 1 - elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | - (all(int(ij) >= 1 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) + | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): tier = "2.4" counter_tier24 += 1 tier_dict[key1]["tier 2.4"] += 1 - elif ((len(pure_tags_dict_short[key1]) > 1) & - (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) | - all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): + elif ((len(pure_tags_dict_short[key1]) > 1) & (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) | all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): tier = "3.1" counter_tier31 += 1 tier_dict[key1]["tier 3.1"] += 1 - elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & - all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff])) | - (all(int(ij) >= 1 for ij in [total2new, total3new]) & - all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff])) + | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): tier = "3.2" counter_tier32 += 1 tier_dict[key1]["tier 3.2"] += 1 @@ -582,12 +574,18 @@ counter_tier41 += 1 tier_dict[key1]["tier 4.1"] += 1 - else: + elif (contradictory): tier = "4.2" counter_tier42 += 1 tier_dict[key1]["tier 4.2"] += 1 - var_id = '-'.join([chrom, pos, ref, alt]) + else: + tier = "5" + counter_tier5 += 1 + tier_dict[key1]["tier 5"] += 1 + + chrom, pos = re.split(r'\#', key1) + var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt]) sample_tag = key2[:-5] array2 = np.unique(whole_array) # remove duplicate sequences to decrease running time # exclude identical tag from array2, to prevent comparison to itself @@ -634,14 +632,7 @@ if min_value == 0 or dist2 == 0: min_tags_list_zeros.append(tag) chimera_tags.append(max_tag) - # chimeric = True - # else: - # chimeric = False - # if mate_b is False: - # text = "pos {}: sample tag: {}; HD a = {}; HD b' = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, min_value, dist2, list(max_tag), chimeric) - # else: - # text = "pos {}: sample tag: {}; HD a' = {}; HD b = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, dist2, min_value, list(max_tag), chimeric) i += 1 chimera_tags = [x for x in chimera_tags if x != []] chimera_tags_new = [] @@ -651,11 +642,19 @@ chimera_tags_new.append(t) else: chimera_tags_new.extend(i) - chimera_tags_new = np.asarray(chimera_tags_new) chimera = ", ".join(chimera_tags_new) else: + chimera_tags_new = [] chimera = "" + if len(chimera_tags_new) > 0: + chimera_tags_new.append(sample_tag) + key_chimera = ",".join(sorted(chimera_tags_new)) + if key_chimera in chimeric_tag.keys(): + chimeric_tag[key_chimera].append(float(tier)) + else: + chimeric_tag[key_chimera] = [float(tier)] + if (read_pos1 == -1): read_pos1 = read_len_median1 = None if (read_pos4 == -1): @@ -673,25 +672,43 @@ {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1), 'format': format1, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)}) ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(row + 1, row + 1, row + 1, row + 1), 'format': format3, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)}) ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=$B${}>="3"'.format(row + 1), 'format': format2, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)}) + row += 3 - row += 3 + if chimera_correction: + chimeric_dcs_high_tiers = 0 + chimeric_dcs = 0 + for keys_chimera in chimeric_tag.keys(): + tiers = chimeric_tag[keys_chimera] + chimeric_dcs += len(tiers) - 1 + high_tiers = sum(1 for t in tiers if t < 3.) + if high_tiers == len(tiers): + chimeric_dcs_high_tiers += high_tiers - 1 + else: + chimeric_dcs_high_tiers += high_tiers + chimera_dict[key1] = (chimeric_dcs, chimeric_dcs_high_tiers) # sheet 2 - header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (Du Novo)', 'AF (Du Novo)', - 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', - 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', - 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2') + if chimera_correction: + header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'chimeras in AC alt (all tiers)', 'chimera-corrected cvrg', 'chimera-corrected AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'chimeras in AC alt (tiers 1.1-2.4)', 'chimera-corrected cvrg (tiers 1.1-2.4)', 'chimera-corrected AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', + 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', + 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', + 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5') + else: + header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', + 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', + 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', + 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5') ws2.write_row(0, 0, header_line2) row = 0 @@ -699,15 +716,15 @@ for key1, value1 in sorted(tier_dict.items()): if key1 in pure_tags_dict_short.keys(): i = np.where(np.array(['#'.join(str(i) for i in z) - for z in zip(mut_array[:, 1], mut_array[:, 2])]) == key1)[0][0] - ref = mut_array[i, 9] - alt = mut_array[i, 10] + for z in zip(mut_array[:, 0], mut_array[:, 1])]) == key1)[0][0] + ref = mut_array[i, 2] + alt = mut_array[i, 3] chrom, pos = re.split(r'\#', key1) ref_count = cvrg_dict[key1][0] alt_count = cvrg_dict[key1][1] cvrg = ref_count + alt_count - var_id = '-'.join([chrom, pos, ref, alt]) + var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt]) lst = [var_id, cvrg] used_tiers = [] cum_af = [] @@ -717,21 +734,44 @@ if len(used_tiers) > 1: cum = safe_div(sum(used_tiers), cvrg) cum_af.append(cum) - lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg), (cvrg - sum(used_tiers[-4:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-4:]))), alt_count, safe_div(alt_count, cvrg)]) + lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)]) + if chimera_correction: + chimeras_all = chimera_dict[key1][0] + new_alt = sum(used_tiers) - chimeras_all + fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers))) + if fraction_chimeras is None: + fraction_chimeras = 0. + new_cvrg = cvrg * (1. - fraction_chimeras) + lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) + lst.extend([(cvrg - sum(used_tiers[-5:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-5:])))]) + if chimera_correction: + chimeras_all = chimera_dict[key1][1] + new_alt = sum(used_tiers[0:6]) - chimeras_all + fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:6]))) + if fraction_chimeras is None: + fraction_chimeras = 0. + new_cvrg = (cvrg - sum(used_tiers[-5:])) * (1. - fraction_chimeras) + lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) + lst.extend([alt_count, safe_div(alt_count, cvrg)]) lst.extend(used_tiers) lst.extend(cum_af) lst = tuple(lst) ws2.write_row(row + 1, 0, lst) - ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)}) - ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)}) - ws2.conditional_format('P{}:S{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:S{} P1:S1'.format(row + 2, row + 2)}) + if chimera_correction: + ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)}) + ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)}) + ws2.conditional_format('V{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:Z{} V1:Z1'.format(row + 2, row + 2)}) + else: + ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)}) + ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)}) + ws2.conditional_format('P{}:T{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:T{} P1:T1'.format(row + 2, row + 2)}) row += 1 # sheet 3 sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21), ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), - ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), - ("tier 4.1", counter_tier41), ("tier 4.2", counter_tier42)] + ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4.1", counter_tier41), + ("tier 4.2", counter_tier42), ("tier 5", counter_tier5)] header = ("tier", "count") ws3.write_row(0, 0, header) @@ -748,95 +788,101 @@ 'format': format3}) ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), {'type': 'formula', - 'criteria': '=OR($A${}="tier 3.1", $A${}="tier 3.2", $A${}="tier 4.1", $A${}="tier 4.2")'.format(i + 2, i + 2, i + 2, i + 2), + 'criteria': '=$A${}>="3"'.format(i + 2), 'format': format2}) - description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "remaining variants")] + description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "mates with contradictory information"), ("Tier 5", "remaining variants")] examples_tiers = [[("Chr5:5-20000-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289", - "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", + "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None, - "289", "0", "0", "0", "0", "0", "0", "3", "6", None, None, None, None, - "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], + "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, + "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], [("Chr5:5-20000-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289", - "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", + "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), - ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "11068", "268", "268", "270", "288", "289", + ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289", "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1", - "7", "4081", "4098", "5", "10", "", "")], + "7", "0", "0", "4081", "4098", "5", "10", "", "")], [("Chr5:5-20000-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290", - "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", "1", - "6", "47170", "41149", "", ""), + "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", + "0", "0", "1", "6", "47170", "41149", "", ""), ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290", - "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", "1", - "6", "47170", "41149", "", "")], + "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", + "0", "0", "1", "6", "47170", "41149", "", "")], [("Chr5:5-20000-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289", - "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", + "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None, - "289", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", None, None, "0", "0", - "0", "0", "4081", "4098", "5", "10", "", "")], + "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0", + "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], [("Chr5:5-20000-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289", - "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", + "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289", - "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", + "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], [("Chr5:5-20000-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None, "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0", - "0", "0", "0", "4081", "4098", "5", "10", "", ""), + "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289", - "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "1", "7", - "4081", "4098", "5", "10", "", "")], + "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0", + "0", "0", "4081", "4098", "5", "10", "", "")], [("Chr5:5-20000-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289", - "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "4081", + "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289", - "1", "1", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "4081", + "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], [("Chr5:5-20000-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290", "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1", - "3", "3", "47170", "41149", "", ""), + "0", "0", "3", "3", "47170", "41149", "", ""), ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None, "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5", - "0", "0", "0", "1", "3", "3", "47170", "41149", "", "")], + "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")], [("Chr5:5-20000-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271", "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", - "0.666666666666667", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""), + "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""), ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271", "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", - "0.666666666666667", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")], - [("Chr5:5-20000-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "0", "0", "255", "276", "269", - "5", "6", "5", "6", "0", "0", "5", "6", "0", "0", "1", "1", "0", "0", "0", "0", "1", - "1", "5348", "5350", "", ""), + "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")], + [("Chr5:5-20000-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "0", "100", "255", "276", "269", + "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""), ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None, "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", - "0", "0", "0", "1", "1", "5348", "5350", "", "")], - [("Chr5:5-20000-13983-G-C", "4.2", "ATGTTGTGAATAACCCACAC", "ab1.ba2", "209", "186", "255", "276", "269", - "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "1", - "1", "5348", "5350", "", ""), + "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], + [("Chr5:5-20000-13963-T-C", "4.2", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263", + "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0", + "0", "0", "0", "1", "1", "5348", "5350", "", ""), + ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263", + "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0", + "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], + [("Chr5:5-20000-13983-G-C", "5", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269", + "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0", + "0", "1", "1", "5348", "5350", "", ""), ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None, "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", - "0", "0", "0", "1", "1", "5348", "5350", "", "")]] + "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]] - ws3.write(11, 0, "Description of tiers with examples") - ws3.write_row(12, 0, header_line) + start_row = 15 + ws3.write(start_row, 0, "Description of tiers with examples") + ws3.write_row(start_row + 1, 0, header_line) row = 0 for i in range(len(description_tiers)): - ws3.write_row(13 + row + i + 1, 0, description_tiers[i]) + ws3.write_row(start_row + 2 + row + i + 1, 0, description_tiers[i]) ex = examples_tiers[i] for k in range(len(ex)): - ws3.write_row(13 + row + i + k + 2, 0, ex[k]) - ws3.conditional_format('L{}:M{}'.format(13 + row + i + k + 2, 13 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(13 + row + i + k + 2, 13 + row + i + k + 2), 'format': format1, 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(13 + row + i + k + 2, 13 + row + i + k + 3, 13 + row + i + k + 2, 13 + row + i + k + 3, 13 + row + i + k + 2, 13 + row + i + k + 3)}) - ws3.conditional_format('L{}:M{}'.format(13 + row + i + k + 2, 13 + row + i + k + 3), - {'type': 'formula', 'criteria': '=OR($B${}="2.1",$B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(13 + row + i + k + 2, 13 + row + i + k + 2, 13 + row + i + k + 2, 13 + row + i + k + 2), + ws3.write_row(start_row + 2 + row + i + k + 2, 0, ex[k]) + ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 'format': format1, 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) + ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), + {'type': 'formula', 'criteria': '=OR($B${}="2.1",$B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 'format': format3, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(13 + row + i + k + 2, 13 + row + i + k + 3, 13 + row + i + k + 2, 13 + row + i + k + 3, 13 + row + i + k + 2, 13 + row + i + k + 3)}) - ws3.conditional_format('L{}:M{}'.format(13 + row + i + k + 2, 13 + row + i + k + 3), + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) + ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', - 'criteria': '=$B${}>="3"'.format(13 + row + i + k + 2), + 'criteria': '=$B${}>="3"'.format(start_row + 2 + row + i + k + 2), 'format': format2, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(13 + row + i + k + 2, 13 + row + i + k + 3, 13 + row + i + k + 2, 13 + row + i + k + 3, 13 + row + i + k + 2, 13 + row + i + k + 3)}) + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) row += 3 workbook.close()
