Mercurial > repos > iuc > unicycler
changeset 8:f9973e8f6f22 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/unicycler commit d7f4eb848136b02ae1cf121a5cfb2e6175d35406"
author | iuc |
---|---|
date | Wed, 18 Nov 2020 20:25:42 +0000 |
parents | e3f1860582ca |
children | def4cbdf745d |
files | unicycler.xml |
diffstat | 1 files changed, 9 insertions(+), 9 deletions(-) [+] |
line wrap: on
line diff
--- a/unicycler.xml Tue Oct 08 02:47:24 2019 -0400 +++ b/unicycler.xml Wed Nov 18 20:25:42 2020 +0000 @@ -1,4 +1,4 @@ -<tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0"> +<tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0" profile="20.09"> <macros> <token name="@VERSION@">0.4.8</token> </macros> @@ -204,7 +204,7 @@ </section> </inputs> <outputs> - <data name="assembly_graph" format="tabular" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" /> + <data name="assembly_graph" format="gfa1" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" /> <data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/> </outputs> <tests> @@ -240,9 +240,9 @@ <section name="lr_align"> <param name="scores" value="3,-6,-5,-2"/> </section> - <output name="assembly_graph" ftype="tabular"> + <output name="assembly_graph" ftype="gfa1"> <assert_contents> - <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/> + <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/> </assert_contents> </output> <output name="assembly" ftype="fasta"> @@ -295,9 +295,9 @@ <section name="lr_align"> <param name="scores" value="3,-6,-5,-2"/> </section> - <output name="assembly_graph" ftype="tabular"> + <output name="assembly_graph" ftype="gfa1"> <assert_contents> - <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> + <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/> </assert_contents> </output> <output name="assembly" ftype="fasta"> @@ -342,9 +342,9 @@ <section name="lr_align"> <param name="scores" value="3,-6,-5,-2"/> </section> - <output name="assembly_graph" ftype="tabular"> + <output name="assembly_graph" ftype="gfa1"> <assert_contents> - <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> + <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/> </assert_contents> </output> <output name="assembly" ftype="fasta"> @@ -362,7 +362,7 @@ <param name="kmers" value="21,23"/> </section> <param name="long" value="only_long.fasta" ftype="fasta" /> - <output name="assembly_graph" ftype="tabular"> + <output name="assembly_graph" ftype="gfa1"> <assert_contents> <has_text text="S" /> </assert_contents>