Mercurial > repos > iuc > unicycler
comparison unicycler.xml @ 8:f9973e8f6f22 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/unicycler commit d7f4eb848136b02ae1cf121a5cfb2e6175d35406"
author | iuc |
---|---|
date | Wed, 18 Nov 2020 20:25:42 +0000 |
parents | e3f1860582ca |
children | def4cbdf745d |
comparison
equal
deleted
inserted
replaced
7:e3f1860582ca | 8:f9973e8f6f22 |
---|---|
1 <tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0"> | 1 <tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0" profile="20.09"> |
2 <macros> | 2 <macros> |
3 <token name="@VERSION@">0.4.8</token> | 3 <token name="@VERSION@">0.4.8</token> |
4 </macros> | 4 </macros> |
5 <edam_topics> | 5 <edam_topics> |
6 <edam_topic>topic_0196</edam_topic> | 6 <edam_topic>topic_0196</edam_topic> |
202 <param argument="--low_score" optional="true" type="integer" value="" | 202 <param argument="--low_score" optional="true" type="integer" value="" |
203 label="Score threshold - alignments below this are considered poor" help="default = set automatically"/> | 203 label="Score threshold - alignments below this are considered poor" help="default = set automatically"/> |
204 </section> | 204 </section> |
205 </inputs> | 205 </inputs> |
206 <outputs> | 206 <outputs> |
207 <data name="assembly_graph" format="tabular" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" /> | 207 <data name="assembly_graph" format="gfa1" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" /> |
208 <data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/> | 208 <data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/> |
209 </outputs> | 209 </outputs> |
210 <tests> | 210 <tests> |
211 <test> | 211 <test> |
212 <conditional name="paired_unpaired"> | 212 <conditional name="paired_unpaired"> |
238 <param name="min_dead_end_size" value="1000"/> | 238 <param name="min_dead_end_size" value="1000"/> |
239 </section> | 239 </section> |
240 <section name="lr_align"> | 240 <section name="lr_align"> |
241 <param name="scores" value="3,-6,-5,-2"/> | 241 <param name="scores" value="3,-6,-5,-2"/> |
242 </section> | 242 </section> |
243 <output name="assembly_graph" ftype="tabular"> | 243 <output name="assembly_graph" ftype="gfa1"> |
244 <assert_contents> | 244 <assert_contents> |
245 <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/> | 245 <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/> |
246 </assert_contents> | 246 </assert_contents> |
247 </output> | 247 </output> |
248 <output name="assembly" ftype="fasta"> | 248 <output name="assembly" ftype="fasta"> |
249 <assert_contents> | 249 <assert_contents> |
250 <has_text text="length=5386" /> | 250 <has_text text="length=5386" /> |
293 <param name="min_dead_end_size" value="1000"/> | 293 <param name="min_dead_end_size" value="1000"/> |
294 </section> | 294 </section> |
295 <section name="lr_align"> | 295 <section name="lr_align"> |
296 <param name="scores" value="3,-6,-5,-2"/> | 296 <param name="scores" value="3,-6,-5,-2"/> |
297 </section> | 297 </section> |
298 <output name="assembly_graph" ftype="tabular"> | 298 <output name="assembly_graph" ftype="gfa1"> |
299 <assert_contents> | 299 <assert_contents> |
300 <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> | 300 <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/> |
301 </assert_contents> | 301 </assert_contents> |
302 </output> | 302 </output> |
303 <output name="assembly" ftype="fasta"> | 303 <output name="assembly" ftype="fasta"> |
304 <assert_contents> | 304 <assert_contents> |
305 <has_text text="length=5386" /> | 305 <has_text text="length=5386" /> |
340 <param name="min_dead_end_size" value="1000"/> | 340 <param name="min_dead_end_size" value="1000"/> |
341 </section> | 341 </section> |
342 <section name="lr_align"> | 342 <section name="lr_align"> |
343 <param name="scores" value="3,-6,-5,-2"/> | 343 <param name="scores" value="3,-6,-5,-2"/> |
344 </section> | 344 </section> |
345 <output name="assembly_graph" ftype="tabular"> | 345 <output name="assembly_graph" ftype="gfa1"> |
346 <assert_contents> | 346 <assert_contents> |
347 <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> | 347 <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/> |
348 </assert_contents> | 348 </assert_contents> |
349 </output> | 349 </output> |
350 <output name="assembly" ftype="fasta"> | 350 <output name="assembly" ftype="fasta"> |
351 <assert_contents> | 351 <assert_contents> |
352 <has_text text="length=5386" /> | 352 <has_text text="length=5386" /> |
360 <param name="min_anchor_seg_len" value="10"/> | 360 <param name="min_anchor_seg_len" value="10"/> |
361 <section name="spades"> | 361 <section name="spades"> |
362 <param name="kmers" value="21,23"/> | 362 <param name="kmers" value="21,23"/> |
363 </section> | 363 </section> |
364 <param name="long" value="only_long.fasta" ftype="fasta" /> | 364 <param name="long" value="only_long.fasta" ftype="fasta" /> |
365 <output name="assembly_graph" ftype="tabular"> | 365 <output name="assembly_graph" ftype="gfa1"> |
366 <assert_contents> | 366 <assert_contents> |
367 <has_text text="S" /> | 367 <has_text text="S" /> |
368 </assert_contents> | 368 </assert_contents> |
369 </output> | 369 </output> |
370 <output name="assembly" ftype="fasta"> | 370 <output name="assembly" ftype="fasta"> |