Mercurial > repos > iuc > stacks_assembleperead
diff stacks_assembleperead.xml @ 0:a741c49dce73 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit e1c1550e0bd61c88ffead2b1c4f6ab7393052393
| author | iuc |
|---|---|
| date | Sat, 25 Jun 2016 17:24:55 -0400 |
| parents | |
| children | f084f60c8423 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/stacks_assembleperead.xml Sat Jun 25 17:24:55 2016 -0400 @@ -0,0 +1,169 @@ +<tool id="stacks_assembleperead" name="Stacks: assemble read pairs by locus" version="@WRAPPER_VERSION@.1"> + <description>run the STACKS sort_read_pairs.pl and exec_velvet.pl wrappers</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[ + + mkdir stacks_inputs reads stacks_outputs + + && + + #for $input_file in $stacks_col: + #set $ext = "" + #if not str($input_file.element_identifier).endswith('.tsv'): + #set $ext = ".tsv" + #end if + ln -s "${input_file}" "stacks_inputs/${input_file.element_identifier}${ext}" && + #end for + + #for $input_file in $reads: + #set $name = str($input_file.element_identifier) + ## sort_read_pairs is expecting strange fastq names: <sample_name>.fq_2 + #if $name.endswith('.1.fq'): + ## handle a common case + #set $name = $name[:-5]+".fq_1" + #else if $name.endswith('.2.fq'): + ## handle a common case + #set $name = $name[:-5]+".fq_2" + #else if not $name.endswith('.fq') and not $name.endswith('.fq_2'): + ## no extension, consider it's a fq_2 file + #set $name = $name + ".fq_2" + #end if + ln -s "${input_file}" "reads/${name}" && + #end for + + sort_read_pairs.pl + -p stacks_inputs + -s 'reads' + + #if $whitelist: + -w '$whitelist' + #end if + + #if $threshold: + -r $threshold + #end if + + -o stacks_outputs + + #if $velvet.use_velvet: + ## remove possible empty files + && find stacks_outputs -type f -size 0 -delete + + && + mkdir assembled + && + velvet_path=`which velveth` && velvet_path=`dirname "\$velvet_path"` + && + exec_velvet.pl -s stacks_outputs -o assembled -c -M ${velvet.contig_length} -e "\$velvet_path" + #end if + + ]]></command> + <inputs> + <param name="stacks_col" argument="-p" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" /> + <param name="reads" argument="-s" format="fastqsanger" type="data" multiple="true" label="Files containing reads to assemble" help="only R2 reads" /> + + <param name="whitelist" argument="-w" format="txt,tabular" type="data" optional="true" label="White list of catalog IDs to include" /> + <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/> + + <conditional name="velvet"> + <param name="use_velvet" type="boolean" checked="false" label="Perform assembly with Velvet" help="If not selected, the tool will only produce of collection of fasta files (one per locus) containing reads ready to assemble." /> + <when value="false"></when> + <when value="true"> + <param name="contig_length" type="integer" value="200" label="Minimum length for asssembled contigs"/> + </when> + </conditional> + </inputs> + <outputs> + <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}"> + <filter>not velvet['use_velvet']</filter> + <discover_datasets pattern="(?P<name>.+)\.fa(sta)?$" ext="fasta" directory="stacks_outputs" /> + </collection> + + <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa"> + <filter>velvet['use_velvet']</filter> + </data> + </outputs> + + <tests> + <test> + <param name="stacks_col"> + <collection type="list"> + <element name="batch_1.catalog.alleles.tsv" ftype="tabular" value="genotypes/batch_1.catalog.alleles.tsv" /> + <element name="batch_1.catalog.snps.tsv" ftype="tabular" value="genotypes/batch_1.catalog.snps.tsv" /> + <element name="batch_1.catalog.tags.tsv" ftype="tabular" value="genotypes/batch_1.catalog.tags.tsv" /> + <element name="PopA_01.alleles.tsv" ftype="tabular" value="genotypes/PopA_01.alleles.tsv" /> + <element name="PopA_01.matches.tsv" ftype="tabular" value="genotypes/PopA_01.matches.tsv" /> + <element name="PopA_01.snps.tsv" ftype="tabular" value="genotypes/PopA_01.snps.tsv" /> + <element name="PopA_01.tags.tsv" ftype="tabular" value="genotypes/PopA_01.tags.tsv" /> + <element name="PopA_02.alleles.tsv" ftype="tabular" value="genotypes/PopA_02.alleles.tsv" /> + <element name="PopA_02.matches.tsv" ftype="tabular" value="genotypes/PopA_02.matches.tsv" /> + <element name="PopA_02.snps.tsv" ftype="tabular" value="genotypes/PopA_02.snps.tsv" /> + <element name="PopA_02.tags.tsv" ftype="tabular" value="genotypes/PopA_02.tags.tsv" /> + </collection> + </param> + <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" /> + + <output_collection name="collated"> + <element name="1"> + <assert_contents> + <has_text text="CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG" /> + </assert_contents> + </element> + </output_collection> + </test> + <test> + <param name="stacks_col"> + <collection type="list"> + <element name="batch_1.catalog.alleles.tsv" ftype="tabular" value="genotypes/batch_1.catalog.alleles.tsv" /> + <element name="batch_1.catalog.snps.tsv" ftype="tabular" value="genotypes/batch_1.catalog.snps.tsv" /> + <element name="batch_1.catalog.tags.tsv" ftype="tabular" value="genotypes/batch_1.catalog.tags.tsv" /> + <element name="PopA_01.alleles.tsv" ftype="tabular" value="genotypes/PopA_01.alleles.tsv" /> + <element name="PopA_01.matches.tsv" ftype="tabular" value="genotypes/PopA_01.matches.tsv" /> + <element name="PopA_01.snps.tsv" ftype="tabular" value="genotypes/PopA_01.snps.tsv" /> + <element name="PopA_01.tags.tsv" ftype="tabular" value="genotypes/PopA_01.tags.tsv" /> + <element name="PopA_02.alleles.tsv" ftype="tabular" value="genotypes/PopA_02.alleles.tsv" /> + <element name="PopA_02.matches.tsv" ftype="tabular" value="genotypes/PopA_02.matches.tsv" /> + <element name="PopA_02.snps.tsv" ftype="tabular" value="genotypes/PopA_02.snps.tsv" /> + <element name="PopA_02.tags.tsv" ftype="tabular" value="genotypes/PopA_02.tags.tsv" /> + </collection> + </param> + <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" /> + <param name="velvet|use_velvet" value="true" /> + <param name="velvet|contig_length" value="20" /> + + <output name="contigs"> + <assert_contents> + <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" /> + </assert_contents> + </output> + </test> + </tests> + + <help> +<![CDATA[ +.. class:: infomark + +**What it does** + +This program will run each of the Stacks sort_read_pairs.pl and exec_velvet.pl utilities to assemble pair-end reads from STACKS pipeline results + +-------- + +**Input file** + +Output from denovo_map or ref_map + + +**Output file** + +A collated.fa file containing assembled contigs for each locus + +@STACKS_INFOS@ +]]> + </help> + <expand macro="citation" /> +</tool>