--- a/stacks_assembleperead.xml	Fri Apr 07 11:44:59 2017 -0400
+++ b/stacks_assembleperead.xml	Thu Apr 27 04:15:36 2017 -0400
@@ -11,45 +11,45 @@
 
         &&
 
-        #for $input_file in $stacks_col:
+        #for $input_file in $stacks_col
             #set $ext = ""
-            #if not str($input_file.element_identifier).endswith('.tsv'):
+            #if not str($input_file.element_identifier).endswith('.tsv')
                 #set $ext = ".tsv"
             #end if
-            ln -s "${input_file}" "stacks_inputs/${input_file.element_identifier}${ext}" &&
+            ln -s '${input_file}' 'stacks_inputs/${input_file.element_identifier}${ext}' &&
         #end for
 
-        #for $input_file in $reads:
+        #for $input_file in $reads
             #set $name = str($input_file.element_identifier)
             ## sort_read_pairs is expecting strange fastq names: <sample_name>.fq_2
-            #if $name.endswith('.1.fq'):
+            #if $name.endswith('.1.fq')
                 ## handle a common case
                 #set $name = $name[:-5]+".fq_1"
-            #else if $name.endswith('.2.fq'):
+            #else if $name.endswith('.2.fq')
                 ## handle a common case
                 #set $name = $name[:-5]+".fq_2"
-            #else if not $name.endswith('.fq') and not $name.endswith('.fq_2'):
+            #else if not $name.endswith('.fq') and not $name.endswith('.fq_2')
                 ## no extension, consider it's a fq_2 file
                 #set $name = $name + ".fq_2"
             #end if
-            ln -s "${input_file}" "reads/${name}" &&
+            ln -s '${input_file}' 'reads/${name}' &&
         #end for
 
         sort_read_pairs.pl
             -p stacks_inputs
             -s 'reads'
 
-            #if $whitelist:
+            #if $whitelist
                 -w '$whitelist'
             #end if
 
-            #if $threshold:
+            #if $threshold
                 -r $threshold
             #end if
 
             -o stacks_outputs
 
-        #if $velvet.use_velvet:
+        #if $velvet.use_velvet == "yes"
             ## remove possible empty files
             && find stacks_outputs -type f -size 0 -delete
 
@@ -70,21 +70,24 @@
         <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/>
 
        <conditional name="velvet">
-            <param name="use_velvet" type="boolean" checked="false" label="Perform assembly with Velvet" help="If not selected, the tool will only produce of collection of fasta files (one per locus) containing reads ready to assemble." />
-            <when value="false"></when>
-            <when value="true">
+            <param name="use_velvet" type="select" label="Perform assembly with Velvet" help="If not selected, the tool will only produce of collection of fasta files (one per locus) containing reads ready to assemble.">
+                <option value="no" selected="true">No</option>
+                <option value="yes">Yes</option>
+            </param>
+            <when value="no"/>
+            <when value="yes">
                 <param name="contig_length" type="integer" value="200" label="Minimum length for asssembled contigs"/>
             </when>
         </conditional>
     </inputs>
     <outputs>
         <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}">
-            <filter>not velvet['use_velvet']</filter>
+            <filter>velvet['use_velvet'] == "no"</filter>
             <discover_datasets pattern="(?P&lt;name&gt;.+)\.fa(sta)?$" ext="fasta" directory="stacks_outputs" />
         </collection>
 
         <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa">
-            <filter>velvet['use_velvet']</filter>
+            <filter>velvet['use_velvet'] == "yes"</filter>
         </data>
     </outputs>
 
@@ -132,12 +135,12 @@
                 </collection>
             </param>
             <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" />
-            <param name="velvet|use_velvet" value="true" />
+            <param name="velvet|use_velvet" value="yes" />
             <param name="velvet|contig_length" value="20" />
 
             <output name="contigs">
                 <assert_contents>
-                    <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" />
+                    <has_text text="|NODE_" />
                 </assert_contents>
             </output>
         </test>